KR970005583B1 - Novel osteoinductive compositions - Google Patents

Abstract

No content.

Description

[Name of invention]

Osteoinductive Composition

Detailed description of the invention

The present invention relates to novel proteins and methods for their preparation. These proteins can induce cartilage and bone formation.

Background Technology

Bone is a highly differentiated tissue characterized by a fibrous protein collagen and a broad matrix structure composed of proteoglycans, non-collagenic proteins, fats and acidic proteins. The methods of bone formation and reshaping / repair of bone tissue that occur continuously throughout life are performed by differentiated cells. Long bone development of normal bone should precede the formation of a cartilage model.

Bone growth is probably mediated by osteoblasts (bone forming cells), and bone remodeling is performed by the associated activity of osteoblasts and osteoblasts, apparently called osteoclasts. Various bone formation, cartilage-inducing and bone inducing factors have been described. See, for example, European patent applications 148,155 and 169,016.

Brief description of the invention

The present invention provides a novel protein in purified form. In particular it relates to four novel proteins defined as BMP-1, BMP-2 choles I (or BMP-2), BMP-3 and BMP-2 choles II (or BMP-4). Where BMP is a bone forming protein.

The protein contains a peptide sequence that is identical or actually homologous to the amino acid sequences set forth in Tables II-X below. They can induce bone formation at designated sites. These bone inducers also have biochemical and biological characteristics, including the activity of bone concentrations of 10-1000 ng / g in the in vivo rat bone formation assays described below. Proteins of the present invention may be encoded by, or hybridized to, the DNA sequences listed in the table and may be encoded by polypeptides having bone growth factor biological properties or by various other modified sequences having such properties. Can be coded.

One of the proteins of the present invention is defined as BMP-1. The portion of human BMP-1 or hBMP-1 is equal to or substantially equivalent to amino acids ＃ 1 to amino acids ＃ 37 in Table V representing genomic hBMP-1 fragments, or amino acids ＃ 1 to amino acids 730 in Table VI representing hBMP-1 cDNA It contains the same peptide sequence. hBMP-1 or related bone induction factors are characterized as containing at least one portion of these sequences. These peptide sequences are encoded by DNA sequences that are the same as or substantially identical to the DNA sequences shown in nucleotides # 3440 to nucleotides # 3550 and nucleotides # 36 to nucleotides # 2225 of Table V, respectively. These hBMP-1 polypeptides are another feature of their ability to induce bone formation. hBMP-1 has a bone concentration of 10-1000 ng / g in the rat bone formation assay in vivo.

The cognate growth factor of the invention, defined as bBMP-1, contains a peptide sequence that contains sequences identical or substantially identical to amino acids VII to amino acids VII of Table II, which represent genomic bBMP-1 fragments. The peptidic sequences are encoded by DNA sequences that are identical or substantially identical to those shown in nucleotides # 294 to nucleotides # 404 in Table II. The bovine peptide sequences identified in Table II below are also 37 amino acids long. bBMP-1 is also characterized by its ability to induce bone formation.

Another bone-induced protein composition of the present invention is defined as BMP-2 class I (or BMP-2). This protein contains at least a portion of a peptide sequence that is equal to or substantially the same as amino acids # 1 to amino acids # 396 in Table VII representing cDNA hBMP-2 class I. This peptide sequence is encoded by a DNA sequence that is the same as or substantially the same as shown in nucleotides # 356 to nucleotides # 1543 in Table VIII. The human peptide sequence identified in Table VII is 396 amino acids long. hBMP-2 or related bone-inducing proteins also contain at least a portion of this peptide sequence. hBMP-2 class I is also characterized by its ability to induce bone formation.

The cognate bovine skeletal proteins of the invention, defined as bBMP-2 class I (or bBMP-2), have the DNA sequences identified in Table III below, which represent genomic sequences. This small DNA sequence has about 129 amino acid coding sequences followed by about 205 nucleotides (estimated 3 ′ non-coding sequences). bBMP-2 class I is further characterized by its ability to induce bone formation. Another bone-induced protein composition of the present invention is defined as BMP-2 class II or BMP-4. Human protein hBMP-2 class II (or hBMP-4) contains at least a portion of a peptide sequence that is equal to or substantially the same as amino acids # 1 to amino acid # 408 of Table V, which represents the cDNA of hBMP-2 class II. This peptide sequence is encoded by at least a portion of the DNA sequence as shown in nucleotides # 403 to nucleotides # 1626 of Table VIII or substantially the same. This factor is another feature of bone induction ability.

Another bone derivative BMP-3 of the present invention is represented by the cognate bBMP-3 of cattle. DNA sequences and amino acid sequences of Tables IV A and B, which represent the bovine genomic sequence of bBMP-3. It contains at least a portion of a peptide sequence that is equal to or substantially the same as amino acids # 1 to amino acids # 175 of Table IV A and B. BMP-3 is another feature of its ability to induce bone formation. Bovine factor can be used as a tool to obtain cognate human BMP-3 protein or other mammalian bone-derived proteins. Proper characterization of this bovine bone induction factor provides an essential starting point for the use of this sequence. This method, using techniques known to those of ordinary skill in the art of genetic engineering, uses bovine DNA sequences as probes to screen the human genome or cDNA libraries, and includes identifying DNA sequences that hybridize to the probes. . Clones with hybridizable sequences are plaque purified, DNA is isolated therefrom, subcloned and DNA sequenced. Therefore, another aspect of the invention is the human protein hBMP-3 produced by this method.

Another aspect of the invention is to provide a pharmaceutical composition containing a therapeutically effective amount of at least one bone growth factor polypeptide according to the invention with a pharmaceutically acceptable excipient. These compositions may further contain pledges useful for other treatments. They may also include suitable matrices for contributing proteins to bone defective sites and providing bone growth structures. These compositions can be used in various methods of treating bone defects and periodontal disease. These methods according to the invention are to administer an effective amount of at least one of the aforementioned novel proteins BMP-1, BMP-2 Class I, BMP-2 Class II and BMP-3 to patients in need of bone formation.

Another aspect of the invention is a DNA sequence encoding a human or bovine polypeptide having the ability to induce bone formation upon expression. This sequence has the nucleotide sequences shown in Tables II to V in the 5 'to 3' direction. Or a DNA sequence that hybridizes with the DNA sequences of Tables II to VII under stringent conditions and a DNA sequence mentioned under stringent conditions to encode a protein having at least one type of bone growth factor biological property upon hemostasis. It is included in the present invention. Finally, the corresponding or other modified sequences of the sequences of Tables II-VII, including whether or not these nucleotide changes cause or change the peptide sequence, are also included in the present invention.

Another aspect of the invention is a vector containing the above-described DNA sequence that is functionally linked with the expression expression control sequence. This vector can be used in a method for producing a bone growth factor polypeptide for culturing a cell line transformed with a DNA sequence encoding the expression of a bone growth factor polypeptide functionally bound to the hematopoietic control regulatory sequence therefor. This method can utilize pore known cells as host cells for the expression of polypeptides. Currently preferred cell lines are mammalian cell lines and bacterial cells.

Further aspects and advantages of the invention will be apparent with reference to the following detailed description and preferred examples.

Detailed description of the invention

The protein of the present invention contains an amino acid sequence or a portion thereof which is identical or substantially homologous to the sequences shown in Tables II-X below. These proteins also have the ability to induce bone formation.

Bone growth factors provided herein are encoded by sequences that are naturally modified (e.g., allelic modifications of nucleotide sequences that may occur in amino acids change polypeptides) or that are similar to those of artificially engineered sequences in Table II-VII. Contains the arguments. For example, the synthetic polypeptide may be a full or partial replication sequence of amino acid residues in Table II-VII. These sequences may have bone growth factor biological properties common to them depending on their primary, secondary or tertiary structure and coordination characteristics with the bone growth factor polypeptides of Table II-VII. Therefore, it can be used as a biologically active substituent for natural bone growth factor polypeptides in therapeutic methods.

Another specific variation of the sequence of bone growth factors described herein is to modify one or both glycosylation sites. Subsidies of glycosylation or only some of the glycosylation are generated by deleting one or both of the asparagine-binding glycosylated recognition sites present in the sequence of bone growth factors shown in Table II-VII. Asparagine-binding glycosylation recognition sites contain tripeptide sequences that are specifically recognized by appropriate cellular glycosylase enzymes. These tripeptide sequences are asparagine-X-threonine or asparagine-X-serine. Where X is usually any amino acid. Various amino acid substitutions or deletions of one or both of the first or third amino acid positions of the glycosylation recognition site result in non-glycosylation of the modified tripeptide sequence.

The present invention also includes novel DNA sequences that encode bone growth factors upon expression that are not bound to DNA sequences that encode other proteinaceous material. These DNA sequences are those shown in Table II-VII in the 5 ′ to 3 ′ direction and stringent hybridization conditions [T. Maniatis et al. Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Lasboratory (1982), p. 387-389], includes sequences that hybridize to the DNA sequences of Table II-VII.

DNA sequences that hybridize to the sequences of Table II-VII under relaxed hybridization conditions to encode bone growth factors having bone growth factor biological properties upon expression, also encode bone growth factors of the present invention. For example, a DNA sequence encoding a bone growth factor having an important part, for example, a glycosylation site or disulfide bond, similar to the sequence shown in Table II-VII, and having at least one bone growth factor biological property, Although not strictly hybridized to the sequences of Table II-VII, it is evident that the growth factors of the novel species of the invention are encoded.

Similarly, the DNA sequences encoding the bone growth factor polypeptides are encoded by the sequences in Table II-III, with alterations or allelic modifications of genetic coding (natural base changes in species that may or may not cause amino acid changes). Sequences that differ because of the encoded sequence also encode new growth factors of the invention. Also included in the present invention are the modified sequences of the DNA sequences of Table II-VII caused by point mutations or induced modifications to enhance activity, half-life or production of polypeptides encoded thereby.

Another aspect of the present invention is to provide a method for producing a novel osteoinduction factor. The method of the present invention is to cultivate a suitable cell or cell line transformed with a DNA sequence encoding a novel bone growth factor polypeptide of the present invention under the control of known regulatory sequences upon expression. Suitable cells or cell lines can be mammalian cells such as Chinese hamster ovary cells (CHO). Methods of selecting and transforming, culturing, propagating, screening and producing suitable mammalian host cells and methods of purification are known in the art. [Gething and Sambrook, Nature, 293; 620-625 (1981) or Kaufman et all., Mol. Cell. Biol., 5 (7); 1750-1759 (1965) or Howley et all., US Pat. No. 4,419,446].

Another suitable mammalian cell line described in the Examples below is a monkey COS-1 cell line. Likewise useful mammalian cell lines are CV-1 cell lines.

Bacterial cells are suitable hosts. For example, various strains of E. coli (eg HB101, MC1061) are known as host cells in the field of biosciences. Various strains such as B. subrilis, Pseudomonas and other bacilli can be used in this method.

Various strains of yeast cells known to those of ordinary skill in the art can be used as host cells for the expression of the polypeptides of the invention. In addition, insect cells may also be used as host cells in the methods of the present invention if necessary (Miller et all, Genetic Engineering, 8 '277-298 (Pleunm Press 1986) and references cited therein).

Another aspect of the invention is to provide a vector for use in the method of expressing these novel osteoinduced polypeptides. Preferably this vector contains the entirety of the novel DNA sequences described above encoding the novel factor of the invention. The vector also contains an appropriate expression control sequence that expresses bone-induced protein sequences. Otherwise, the vector in which the above-described modified sequence is combined is an example of the present invention, and is useful for preparing bone-derived proteins. This vector can be used in a method of transforming a cell line and contains an optional regulatory sequence that is functionally bound to the DNA coding sequence of the invention capable of directing replication and expression in a selected host cell. Regulatory sequences useful for such vectors are known to those of ordinary skill in the art and may be selected depending on the host cell selected. Such choices are conventional and do not constitute a part of the present invention.

The protein of the present invention, which induces bone growth in an environment where bone is not normally formed, can be applied to the treatment of fractures. The bone formation method using at least one protein of the present invention has a prophylactic use in conquering closed fracture as well as open bone conquest and can improve fixation of artificial joints.

The new bone formation induced by osteogenic agents is used for the treatment of congenital, trauma-induced, or tumor-induced craniofacial malformations, and is also useful for costly surgery. The bone formation factors of the present invention are of value in the treatment of dental root disease and other dental treatments. Such bone forming agents can provide an environment that attracts bone-forming cells, stimulates the growth of bone forming cells, or induces the differentiation of parent cells of bone forming cells. Of course, the proteins of the invention may have other therapeutic uses.

Another aspect of the invention is a method of treating and treating compositions for fractures and bone defects or other conditions associated with diseases of the fascia. Such compositions contain at least one type of bone induction factor protein of the invention in a therapeutically effective amount. The bone induction factor according to the invention may be present in the therapeutic composition in admixture with a pharmaceutically acceptable excipient or matrix. Moreover, the therapeutic methods and compositions of the present invention contain a therapeutic amount of the bone induction factor of the present invention together with one or more other bone inducing factors of the present invention in the form of a therapeutic. In addition, proteins according to the invention and combinations of proteins of the invention may be co-administered with one or more different bone inducers that can interact. Moreover, bone inducing proteins can be combined with other medicines that are beneficial for the treatment of bone defects. Such agents are not limited to various growth factors. Methods of physiologically acceptable protein compositions having the desired pH, isotonicity, stability and the like are within the skill of the art.

In particular, BMP-1 may be used alone in the composition. BMP-1 can also be used in combination with one or more other proteins of the invention. BMP-1 and BMP-2 Class I can be used in combination. BMP-1 and BMP-2 Class II may also be used in combination. BMP-1 and BMP-3 may also be used in combination. Moreover, BMP-1 can be used in combination with two or three other proteins of the invention. For example, BMP-1, BMP-2, Class I and BMP-2 Class II can be blended. BMP-1 can also be combined with BMP-2 class I and BMP-3. Furthermore, BMP-1 can be combined with BMP-2 class II and BMP-3. BMP-1, BMP-2 class I, BMP-2 II and BMP-3 can be blended.

BMP-2 Class I can be used alone in pharmaceutical compositions. BMP-2 class I can also be used in combination with one or more other proteins of the invention. BMP-2 Class I can be combined with BMP-2 Class II. It can also be combined with BMP-3. Moreover, BMP-2 Class I can be combined with Class II and BMP-3.

BMP-2 class II may be used alone in pharmaceutical compositions. It can also be used in combination with other proteins as identified above. Furthermore, it may be used in combination with BMP-3.

BMP-3 can be used alone in the composition. Furthermore, it can be used in various combinations as identified above.

The method of treatment is topical administration of the composition, such as implantation or device. When administered, the therapeutic composition for use in the present invention is, of course, pyrogen free and in physiologically acceptable form. Moreover, the composition can be injected or capsulated viscously for insertion into the site of bone injury. Preferably, the bone growth inducer composition provides a structure for the development of bone and cartilage by imparting bone induction factors to the site of bone injury, and optionally includes a matrix that can be absorbed into the body. Such matrices may be formed from other materials for other transplant medicine.

The choice of material is based, for example, on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and contact properties. Likewise, application of bone induction factors is by appropriate reform. Preferred matrices for bone inducers include, but are not limited to, biodegradable and chemical substances such as calcium sulfate, tricalcium phosphate, hydroxyoxyatrate, polylactic acid, foryl anhydride; Biodegradable and biological materials such as bone or skin collagen, other pure protein or matrix components of cells; Non-biodegradable and chemical materials such as sintered hydroxyapatite, bioglass, aluminate or other ceramics; Or combinations of the foregoing materials such as polylactic acid and hydroxyapatite or collagen and tricalcium phosphate. The composition may include baoceramides, such as calcium-aluminate-phosphate, which, for example, change voids, particle size, position and biodegradability.

Dosage depends on various factors that change the action of growth factors, such as the weight of the formed bone, the site of bone damage, the condition of the damaged bone, the age, sex and diet of the patient, the severity of the infection, the time of administration and other clinical factors. The decision is made by the attending physician. Dosage may vary depending on the type of matrix used for reconstitution and the composition of BMP. Adding other known growth factors such as IGF1 (insulin-like growth factor 1) to the final composition may be effective for administration. In general, the dosage should range from about 10 to 10 ⁶ ng protein per gram of bone needed. Periodic observation of bone growth and / or treatment is by X-ray. Such therapeutic compositions are also valuable in a number of fields that are species specific and lack bone inducers. In particular, not only humans, but also domestic animals and promising bone inducers of the present invention can be treated.

The following example illustrates an embodiment of the present invention in which bovine proteins are recovered and characterized and recovered using human proteins to obtain human proteins, which form and express these proteins through recombinant techniques.

Example 1

Isolation of Bovine Bone Derivatives

As described in the grinding of bovine bone powder (20-120 mesh, Helitrex), MR Urist et all., Proc. Natl. Acad. Sci. USA 70; Prepared according to the method of 3511 (1973). 10 kg of crushed powder was stirred vigorously at 4 ° C. for 45 hours while continuing to exchange HCl in 0.6N HCl to lose minerals. The resulting suspension is extracted with 50 L of 2M CaCl ₂ and 10 mM ethylenediamine-tetraacetic acid [EDTA] at 4 ° C. for 16 h and with 4 L of 0.5 M EDTA for 4 h. The residue was washed three times with distilled water, and Clin. Orthop. Rel. Res., 171; 20 L 4M guanidine hydrochloride [GuC1], 20 mM tris, pH 7.4, 1 mM M-ethylmaleimide, 1 mM iodoacetamide, 1 mM phenylmethylsulfonylfluorine as described in 213 (1982). Let's do it. After 16-20 hours, the supernatant is removed and replaced with another 10 L GiC1 buffer. The residue is extracted again for 24 hours.

The crude GuC1 extracts are combined and concentrated about 20-fold in a pelicon apparatus with a 10,000 molecular weight cut membrane and then dialyzed into 50 mM Tris, 0.1 M NaCL, 6 M urea (pH 7.2), starting buffer for the first column. After dialysis, the protein is placed in a 4 L DEAE cellulose column and the unbound fractions are collected.

Unbound fractions are concentrated and dialyzed in 50 mM NaAc, 50 mM NaC1 (pH 4.6) dissolved in 6M urea. Unbound fractions are placed in a carboxymethylcellulose column. Proteins that do not bind to the column are removed by pH washing with starting buffer and the material containing bone inducing factor is extracted from the column with 50 mM NaAc, 0.25 mM NaC1, 6M urea (pH4.6). Proteins from this step of elution are concentrated 20--40 times and diluted 5-fold with 80 mM KPO4, 6M urea (pH 6.0). The pH of the solution is adjusted to 6.0 with 500 mM K ₂ HPO ₄ . The sample is placed in a hydroxylapatite column (LKB) equilibrated in 80 mM KPO ₄ , 6M urea (pH 6.0) and all unbound proteins are removed by washing the column with the same buffer. Bone inducer activator is eluted with 100mMKPO4 (pH7.4) and 6M urea.

The protein is concentrated about 10-fold and solid NaC1 is added to a final concentration of 0.15M. This material is placed in a Hepari-Sepharose column equilibrated with 50 mM KPO ₄ , 150 mM NaCl, 6 M urea (pH 7.4). After washing the column with starting buffer, proteins with bone inducer activity are eluted with 50 mM KPO ₄ , 700 mM NaCl, 6 M urea (pH 7.4). The fractions were concentrated to a minimum volume and 0.4m1 fractions were placed in the Seperozel 6 and Seperose 12 columns connected in series equilibrated with 4M GuU1, 20 mM Tris (pH 7.2) and the column developed at a flow rate of 0.25 m1 / min. Let's do it. Proteins with bone induction factor activity have a relative mobility corresponding to about 30,000 Dalton proteins.

The fractions are collected, dialyzed in 50 mM NaAc, 6 M urea (pH4.6) and placed in a Pharmacia MonoS HR column. The column is developed with a ramp of 1.0 M MaC1, 50 mM NaAc, 6 M urea, pH 4.6. The active fractions are collected and adjusted to pH 3.0 with 10% trifluoroacetic acid (TFA). Place this material in a 0.46 × 25 cm Bid c4 column paralleled with 0.1% TFA, and place the column in 90% acetonitrile, 0.1% TFA (31.4% acetonitrile, 0.1% TFA-49.5% acetonitrile, 0.1% TAF, 1 1 meter per minute, 60 minutes per minute. The active substance elutes in about 40-44% acetonitrile. Some of the appropriate fractions are iodized according to one of the following methods [P. J. McConahey et all, Int. Arch. Allergy, 29; 185-189 (1966); A, E. Bolton et al, Biochem J, 133; 529 (1973); And in D. F. Bowen-Pope, J. Biol, Chem., 237; 5161 (1962). Iodide proteins present in these fractions are analyzed by SDS gel electrophoresis and ureatriton X100 isoelectric focusing method.

At this stage, the bone induction factor is estimated to be about 10-50% pure.

Example 2

Characterization of Bovine Bone Inducers

A. Molecular Weight

About 20 μg of protein from Example 1 is lyophilized and redissolved in 1 × SDS sample buffer. After heating at 37 ° C. for 15 minutes, the sample is placed in a 15% SDS polyacrylamide gel and subjected to electrophoresis while cooling. Molecular weights are determined against prestained molecular weight standards (Bethesda Research Labs). Immediately after completion, the lane of the gel containing the bone inducer is thinly cut into 0.3 cm pieces. Each piece is crushed and 1.4m1 of 0.1% SDS is added. The sample is shaken halfway slowly at room temperature to elute the protein. Each gel slice is desalted to prevent interference in biological assays. The supernatant from each sample was acidified to pH3.0 with 10% TFA, filtered through a 0.45 liter membrane and then 0.46 cm x 5 cm C4 beads developed with 0.1% TFA to 0.1% TFA, 90% CH ₃ CN gradient. Load the column. Appropriate bone inducer-containing fractions are pooled and reconstituted into a 20 mg mouse matrix. Most bone inducer fractions in this gel system have the motility of proteins with molecular weights of about 26,000-30,000 Daltons.

B. Isoelectric Focusing

The isoelectric point of bone inducer activity is determined at the degenerate isoelectric focus. The Triton X100 Urea Gel System (Hoeffer Scientific) is modified as follows; 1) 40% of the ampholytic electrolyte used is Seralite 3/10; 60% is cervalite 7-9. 2) The catholyte deposit used was 40 mM NaOH. About 20 μg of protein from Example 1 is lyophilized, dissolved in sample buffer and placed in a coin focus gel. The gel is left at 20 Watts, 10 ° C. for about 3 hours. After completion, the lanes containing the bone guide factor are cut thinly into 0.5 cm slices. Cut each piece thinly into 1.0m1 6M urea, 5mM slices. Each piece is crushed in 1.0 ml 6 M urea, 5 mM Tris (pH 7.8) and the sample is stirred at room temperature. Samples are acidified, filtered, desalted and analyzed as described above. The major part of the active material determined in the assay described in Example 3 shifts to match pI8.8-9.2.

C. Subunit specification

The subunit composition of the bone inducer is also determined. Pure bone inducer is isolated from the 15% SDS gel prepared as described above. A portion of the sample is replaced with 5 mM DTT in sample buffer and reelectrophoresed on a 15% SDS gel. The about 30kd protein exhibits two main bands at about 20kd and 18kd as well as the bubend at 30kd. The width of the two bands mostly indicates heterogeneity by glycosylation, other post-translational modifications, proteolysis or cartbamylation.

Example 3

Biological Activity of Bone Inducers

General methods of Selfes and Ready [Proc. Natl. Acad. Sci. U. S. A, 80: 6591-6595 (1963)] is used to assess the bone formation activity of the bovine bone induction factor of the invention obtained in Example 1 using a rat bone formation assay. This assay can also be used to evaluate bone inducers of other species. The ethanol precipitation step is placed by dialysis of the fraction to be analyzed into water. The solution or suspension is redissolved in a volatile solvent, such as 0.1-0.2% TFA, and the resulting sludge solution is added to 20 mg of rat matrix. The material is lyophilized and lyophilized, and the resulting powder is subcutaneously implanted into the abdominal thorax of Vans rats in a 21-49 day male maleon. After 7-14 days, remove the implant. Half of each implant was analyzed for alkaline phosphatase [A. H. Reddi et al., Proc, Natl. Acad. Sci., 69: 1601 (1972), and the other half is fixed and tissue analyzed. Generally, the glycol methacrylate portion of the lumbar part is stained with the Kyosa and Sanfusky ability to detect minerals of new bone. The enzyme alkaline phosphatase produced by chondrocytes and osteoblasts during the matrix formation is also measured. New cartilage and bone formations often correlate with alkaline phosphatase concentrations. Table 1 below illustrates the reaction amount of the mouse matrix sample, and also shows a control group not treated with a bone induction factor.

At this stage, the bone inducer is about 10-15% pure.

The bone or cartilage formed is confined to the space occupied by the matrix. Samples are analyzed by SDS gel electrophoresis and isoelectric focusing methods as described above, and automated radiographs are taken. This assay correlates activity with protein bands and pI9.0 at 26-30 kd.

An extinction coefficient of 1 OD / mg-cm is used as an evaluation criterion for the protein and the purity of the bone inducer in the feature fraction is measured. In the bone formation assay of mice diluted in vivo as described above, the protein is in vivo active at 10-200 ng protein / g bone to 1 μg protein / g bone or more.

Example 4

Bovine Bone Inducer Protein Compositions

The protein composition of Example 2A with a molecular weight of 28-30 kd is exchanged as described in Example 2C and digested with trypsin. Eight trypsin digestion fragments having the following amino acid sequences are isolated by standard methods.

Fragment 1: A A F L G D I A L D E E D L G

Fragment 2: A F Q V Q Q A A D L

Fragment 3: N Y Q D M V V E G

Fragment 4: S T P A Q D V S R

Fragment 5: N Q E A L R

Fragment 6: L S E P D P S H T L E E

Fragment 7: F D A Y Y

Fragment 8: L K P S N? A T I Q S I V E

A less purified protein formulation is prepared from bovine bone according to a similar scheme as described in Example 1. The purification step is the same as the one described above except for the reverse order of the hydroxylapatite and heparinsepharose columns, omitting the DE-52 column, the CM cellulose column and the mono S column. Briefly, the concentrated crude 4M extract is brought to a final ethanol concentration of 85% at 4 ° C. The mixture is centrifuged and the precipitate is redissolved in 50 mM Tris, 0.15 M NaCl, 6.0 M urea. This material is fractionated into heparin sepharose as described. Heparin binding material is fractionated to hydroxy apatite as described. The active fractions are combined, concentrated and fractionated in high magnification gel filtration (TSK 30000, 6M guanidinium chloride, 50 mM Tris, pH7.2). The active fractions are pooled and dialyzed in 0.1% TFA and then fractionated in a C bottomed up column as described. The formulations are exchanged and electrophoresed on acrylamide gels. The protein corresponding to the 18K band is eluted and digested with trypsin. Trypsin digest fragments having the following amino acid sequences are isolated.

Fragment 9: S L K P S N H A T I Q S? V

Fragment 10: S F DA Y Y C S? A

Fragment 11: V Y P N M T V E S C A

Fragment 12: V D F A D I? W

Trypsin digests 7 and 8 are actually identical to fragments 10 and 9, respectively.

A. bBMP-1

Alette's Method [J. Mol. Biol., 183 (1); 1-12 (1985), probes containing pools of oligonucleotides (or specific oligonucleotides) are designed and synthesized in automated DNA synthesizers. The Hanting needle is a relatively long (32 nucleotide) gessmer of the following nucleotide sequence [J. J. Toole et al, Nature, 312: 342-347 (1984);

TCCTCATCCAGGGCATGTCGCCCAGGAAGGC

Because the genetic code has changed (one or more codons can encode the same amino acid), the number of oligonucleotides in the probe pool is dependent on the frequency of codon use in eukaryotic cells, the relative stability of the G: T base pair, and the eukaryotic It is reduced based on the relative rarity of dinucleotide CpG in the cell coding sequence (Toole et al., Supra.). The second set of probes consists of shorter oligonucleotides (17 nucleotides in length) containing all possible sequences capable of encoding amino acids. The second set of policies has the following sequence.

(a) A [A / G] [A / G] TC [T / C] TC [T / C] TC [T / C] TC [A / G] TC [T / C] AA

(b) A [A / G] [A / G] TC [T / C] TC [T / C] TC [A / G] TCNAG

Nucleotides in parentheses may be protonated. N means A, T, C or G.

In both cases, the part of the amino acid sequence used for the probe design is chosen to avoid codons that have changed as much as possible. Oligonucleotides are synthesized in an automated DNA synthesizer. The probe is then radiolabeled with polynucleotide kinase and 32P-ATP.

These two sets of probes are used to screen bovine genomic recombination libraries. The library is formed as follows: Bovine liver DNA is partially digested with the restriction endonuclease enzyme Sau 3A and settled through a sucrose gradient. DNA sized within the range of 15-30 kb is ligated to bacteriophage BamHI vector EMBL3 [Frischauf et al, J. Mol. Biol, 170: 827-847 (1983). Plate the library at 8000 combinations per plate. Method of honor [Proc. Natl. Acad. Sci. USA, 75: 3688-91 (1978)] to produce and propagate Polak's cloned nitrocellulose replicas.

The 32-mer probe was kinylated with 32p-gamma-ATP, hybridized to one set of filters in 5X SSC, 0.1% SDS, 5X Denhardt, 100 μg / ml salmon sperm DNA at 45 ° C., and 5X SSC at 45 ° C. Wash with 0.1% SDS. The 17-mer probe was kinase and subjected to another set of 48M 3M tetra methylammonium chloride (TMAC), 0.1M sodium phosphate pH6.5, 1 mM EDTA, 5X Denhardt, 0.6% SDS, 100 μg / ml salmon sperm DNA. Hybridize to filter and wash in 3M TMAC, 50 mM Tris pH8.0 at 50 ° C. This condition minimizes the detection of mismatches in the 17-mer probe pool [Wood et al, Proc. Natl. Acad. Sci, U. S. A. 82: 1585-1588 (1985). Understand this method for screening 400,000 formulations and plaque purification of one replication positive. DNA is isolated from plate digests of this recombinant bacteriophage defined as lambda bp-50. The bp-50 was deposited on December 16, 1986 under the accession number ATCC 40295 in the Rockville 12301-Pikron Drive American Type Culture Collection (ATCC). This deposit and all deposits described therein, the international approval of the microbial deposit for the patent procedure is in accordance with the Bufafest Convention and its provisions. This bp-50 clone encodes at least a portion of the bovine bone growth factor defined as bBMP-1.

The oligonucleotide hybridization portion of this bBMP-1 clone is subcloned to M13 and organized into an approximately 800 bp EcoRI fragment sequenced by standard techniques. Partial DNA sequences and derived amino acid sequences of lambda bp-50 are shown in Table 2 below. The amino acid sequence corresponding to the trypsin digestion fragment isolated from bovine bone 28-30 kd material is underlined in Table II. The first underlined portion of the sequence corresponds to the trypsin digested fragment 1 above, in which the oligonucleotide probe was designed, and the second underlined portion corresponds to the trypsin digested fragment 2 above. The predicted amino acid sequence indicates that trypsin digest fragment 2 is preceded by a salty residue (R) as expected in view of the specificity of trypsin. The nucleic acid sequence preceding the two-pair CT at nucleotide position # 292-293 in Table 2 is a basic residue at the appropriate position of the consensus acceptor sequence (ie pyrimidine rich track, TCTCTCTCC, then AG) and the derived amino acid sequence. Considering the lack of, it is assumed to be an intron (noncoding sequence). This bBMP-1 genomic sequence is shown in Table 2. The bBMP-1 peptide sequence expected from this genomic clone is 37 amino acid long and is encoded by the DNA sequences of nucleotides # 294 to # 404 in Table 2.

B. bBMP-2

Based on the amino acid sequence of fragment 3, two probes consisting of pools of oligonucleotides are designed and synthesized in an automated DNA synthesizer as described above.

These probes are radiolabeled and screened for a genomic library of cattle formed as described in Part A, except that the vector is lambda J1 Bam H1 arms (Mullins et al Nature 3C8: 856-858 (1984)). The radiolabeled 17-mer probe # 1 is hybridized to one set of filters according to the method for 17-mer probes described in Part A.

Screen the 400,000 recombinants by the method described in Part A. One replication positive is plaque purified and DNA is isolated from plate digests of recombinant bacteriophages defined as lambda bp-21. Bacteriophage bp-21 has been deposited with the ATCC on accession number ATCC 40310 on March 6, 1987. The bp-21 clone encodes a growth factor for cattle defined as bBMP-2.

The oligonucleotide hybridization portion of this bBMP-2 clone is ubiquitous in the approximately 1.2 kb Sac I restriction fragment subcloned to M13 and sequenced by standard techniques. The partial DNA sequences and derived amino acid sequences of this Sac I fragment and subsequent Hind III-Sac I restriction fragments of bp-21 are shown in Table 3. The bBMP-2 peptide sequence from this clone is 129 amino acids in length and is encoded by the DNA sequence of nucleotides # 1 to nucleotides # 387. The amino acid sequences corresponding to trypsin fragments isolated from bovine bone 28-30 kd material are underlined in Table 3. The sequence corresponds to the trypsin digest fragment 3 above, in which the underlined portion is designed with an oligonucleotide probe of bBMP-2. The predicted amino acid sequence indicates that trypsin digest 3 is preceded by a basic residue (K) as expected in view of the specificity of trypsin. Arginine residues encoded by CGT are assumed to be the carboxy terminus of the protein, taking into account the adjacent stopcodon (TAG).

C. bBMP-3

A probe consisting of a pool of oligonucleotides is designed and synthesized on an automated DNA synthesizer based on the amino acids Earl of trypsin fragment 9 (probe # 3), 10 (probe # 2) and 11 (probe # 1).

Probe ＃ 1: ACNGTCAT [A / G] TTNGG [A / G] TA

Probe ＃ 2: CA [A / G] TA [A / G] TANGC [A / G] TC [A / G] TT

Probe ＃ 3: TG [A / G / T] ATNGTNGC [A / G] TG [A / G] TT

The genomic library of recombinants formed in EMBL3 is screened by the TMAC hybridization method described in Part A. Screen 400,000 recombination screens in replicate with probe # 1 labeled 32p. All recombinants hybridized to this probe are replated for the second fly. Triple nitro cellulose replicas are prepared from the second plate and propagated as described above. Three sets of filters are hybridized to probes # 1, # 2 and # 3 again under TMAC conditions. Monoclonal lambda bp-819 is hybridized to these three probes and plaque purified to separate DNA from plate digests. Bacteriophagelambda bp-819 was deposited with the ATCC 40344 as accession number to the ATCC on June 16, 1987. This bp-819 clone encodes bovine bone growth factor defined as bBMP-3.

The portion of bp-819 that hybridizes to probe # 2 is localized and sequenced. Partial DAN and derived amino acid sequences of this part are shown in Table 4a. Corresponds to trypsin digest fragments 10 and 12, and the second underline sequence corresponds to fragment 10. Therefore, the portion of bp-819 that hybridizes to probe # 2 encodes at least 111 amino acids. This amino acid sequence is encoded by the DNA sequence of nucleotides # 414 to # 746.

The portion of bp-819 that hybridizes to probes # 1 and # 3 is localized and sequenced. The partial NDA and derived amino acid sequences of this portion are shown in Table 4b. The amino acid sequences corresponding to trypsin digest fragments 9 and 11 are underlined. The first underline sequence corresponds to fragment 9 and the second underline sequence corresponds to fragment 11. The peptide sequence of this portion of bp-819 that hybridizes to probes # 1 and # 3 is 64 amino acids long and is encoded by nucleotides # 305- # 493 in Table 4b. Arginine residues encoded by the three-pair AGA are assumed to be the carboxy terminus of the protein, given the presence of stop codons (TAA) in contact therewith. Nucleic acid sequences preceding pair TC (positions 305-306) take into account the presence of consensus acceptor sequences (ie, pyrimidine rich stretch TTCTCCCTTTTCGTTCCT, then AG) and the presence of stops rather than basic residues at appropriate positions of the derived amino acid sequences. It is assumed to be intron (non-coding sequence).

BBMP-3 is therefore characterized by the DNA and amino acid sequences of Tables 4a and 4b. The peptide sequence of this clone is 175 amino acids long and is encoded by the DNA sequences of nucleotides # 414 to nucleotide # 746 in Table 4a and nucleotides # 305 to nucleotide # 493 in Table 4b.

Example 5

Human bone inducer

A. hBMP-1

Since the bovine and human bone growth factor genes are presumed to be very similar, the bovine bBMP-1 DNA sequence (or a portion thereof) of Table II is used as a probe to screen the human genome library. An 800 bp EcoR I fragment of bovine genomic clone is labeled 32 p by nick translation. Human genome libraries (Toole et al., Supra) are plated at 20 plates with 40,000 recombinants per plate. Replicate nitrocellulose filler replicas were prepared from each plate and nick translation probes in 5 × SSC, 5 × Denhard, 100 μg / ml denatured salmon sperm DNA, 0.1% SDS (standard hybridization solution) at 50 ° C. for about 14 hours. Hybridize to. The filter is washed in 1 × SSC, 0.1% SDS at 50 ° C. and auto radiographed. 5 Replicate positives are isolated and plaque purified. DNA is obtained from plate digests of one of these recombinant bacteriophages defined as LP-HI. LP-HI has been deposited with the ATCC on March 6, 1987 as the acceptance number of ATCC 40311. This clone encodes at least a portion of a human genomic bone growth factor called hBMP-1. The hybridization portion of LP-HI is ubiquitous in the 2.5 kb Xba I / Hind III restriction fragment.

Partial DNA sequences and derived amino acid sequences of lambda LP-HI are shown in Table 5 below. The peptide sequence from this clone is 37 amino acids long and is encoded by the DNA sequences of nucleotides # 3440 to nucleotides # 3550. The coding sequence of Table 5 is adjacent to about 28 nucleotides (estimated 5 ′ noncoding sequence) and about 19 nucleotides (estimated 3 ′ noncoding sequence). Comparing the bBMP-1 sequences in Table 2 with the hBMP-1 genomic sequences in Table 5, the two sequences are quite similar.

Since the size of the coding portion and the position of the non-coding portion are generally conserved in homologous genes of other species, the coding and non-coding portions of the bone inducer gene can be identified. Similar parts between the two genes adjacent to each other by RNA processing signals at similar sites indicate the coding part.

Probes specific to the human coding sequences listed in Table 5 are used to identify human cell lines or tissues that synthesize bone inducers. Probes are prepared according to the following method. The sequence shown below in an automatic synthesizer

(a) GGGAATTCTGCCTTTTCTTGHGGGACATTGCCCTGGACGAAGA

GGACCTGAG

(b) CGGGATCCGTCTGAGATCCACAGCCTGCTGTACCTGGAAGGCCC

TCAGG

2 nucleotides are synthesized and annealed, expanded using cleavage fragments of E. coli DNA polymerase I, digested with restriction enzymes EcoR I and Bam HI, and inserted into M13 beta. From the template preparation of this subclone, single-dose 32p labeled probes are obtained by canning techniques. Polyadenylated RNA from various cells and tissue sources is electrophoresed to formaldehyde-agarose gel and transferred to nitrocellulose by a tool or the like. Probes were hybridized to nitrocellulose blot in 50% formamide, 5 × SSC, 0.1% SDS, 40 mM sodium phosphate pH6.5, 100 μg / ml denatured salmon sperm DNA and 5 mM vanadil ribonucleosides at 42 ° C. overnight. Wash in 0.2 × SSC, 01.% SDS at 65 ° C. After autoradiography, lanes containing RNA from human osteoblast cell line U-2 os contain hybridization bands corresponding to RNA species of about 4.3 and 3.0 kb. CDNA is synthesized from U-2 os polyadenylation RNA and cloned into lambda gt 10 by known techniques (Toole et al., Supra). 20,000 recombinants from this library are plated on each 50 plate. Replicate nitrocellulose replicas are prepared from this plate. The oligonucleotides described above are kinase with 32p-gamma-ATP and hybridized to two sets of replicas overnight in standard activation solution at 55 ° C. The filter is washed in 1 × SSC, 0.1% SDS at 55 ° C. and autoradiated pictures are taken. Plaque purification of monoclonal positives defined as lambda U2os-1. Lambda U2os-1 has been deposited with the ATCC under accession number ATCC 40343 on 16 June 1987.

The complete nucleotide sequence and the derived amino acid sequence of the insert of lambda U2os-1 are shown in Table 6. This cDNA clone encodes Met and is linked by a characteristic hydrophobic leader sequence of the secreted protein and contains a stop codon at nucleotide positions 2226-2228. This clone contains an open reading frame of 2190 bp that encodes a protein of 730 amino acid with a molecular weight of og 83 kd based on this amino acid sequence. This clone contains the same sequence as the coding portion of Table V. This protein is the first translation product, which is cleaved to produce hBMP-1 protein. Therefore, this clone is the cDNA for hBMP-1 corresponding to the human gene fragment contained in the genomic hBMP-1 sequence lambda LP-HI. Amino acids # 550 to # 590 of BMP-1 are surface growth factors and are part of the growth factors of proteins C, X and IX.

B. hBMP-2: Class I and II

The genomic bBMP-2 fragment of HindIII-SacI cattle described in Example 4b is subcloned into M13 vector. A 32p-labeled single stranded DNA probe is prepared from the femplate preparation of this subclone. This probe is used to screen polyadenylation RNA from various cells and tissue sources as described in Part A. Hybridization bands corresponding to about 3.8 kdV mRNA species are detected in lanes containing RNA from human cell U-2 os. Screen the nitrocellulose filter replica of the U-2 os cDNA library as described above by labeling the HindIII-SacI fragment with 32 p by nick translation and hybridizing it in a standard hybridization buffer at 65 ° C. overnight, 1 × SSC, 0.1 Wash at 65 ° C. in% SDS. 13 Replicate positive clones are collected and replated for the second plate. Replicate nitrocellulose replicas are prepared from the second plate and two sets are hybridized to bovine genomic probes on the primary screen. One set of filters is washed in 1 × SSC, 0.1% SDS and the other set is washed at 65 ° C. in 0.1 × SSC, 0.1% SDS.

Two types of hBMP-2 cDNA clones are evident in light of strong (quadruent) or weak (seven-recombinant) hybridization signals under more stringent washing conditions (0.1 x SSC, 0.1% SDS). All 11 recombinant bacteriophages are plaque purified, a small amount of DNA preparation is prepared from each plate digest, and the inserts are subcloned into psp65 and M13 by thermal analysis. Sequencing of strongly hybridized clones defined as hBMP-2 class I (or BMP-2) indicates that they have significantly sequence similarity to the sequences in Table 3. Therefore, these clones are cDNAs that encode human proteins whose subsequences are encoded by the bBMP-2 genes described in Table 3. Sequencing of the hybridization recombinants defined as hBMP-2 class II (or known as BMP-4) shows that they are very similar to the sequences in Table 3 at the 3 ′ end of their coding portion and slightly at the 5 ′ portion. Less similar. Therefore, they encode similar human proteins, although not identical to such structures.

Full length hBMP-2 class IcDNA clones are obtained by the following method. The 1.5 kb insert of one of the class II subclones (II-10-) is isolated and radiolabeled by nick translation. Nitrocellulose replicas (50 filters, 1,000,000, corresponding to recombinant bacteriophages) of one set of U-2 os cDNA libraries screened above` are rehybridized with this probe (hybridized to 65 ° C. in standard hybridization buffer); Wash in 0.2 × SSC, 0.1% SDS at 65 ° C.). All recombinants hybridizing to bovine genomic probes that do not hybridize to class II probes are harvested and plaque purified (10 recombinants). Plate stocks are prepared and small scale bacteriophage DNA preparations are prepared. After subcloning to M13, sequencing revealed that four of them represent clones that overlap the native class I clones. One of them, lambda U-2os-39, contains an approximate 1.5 kb input and has been deposited with the ATCC as the accession number of the ATCC on June 16, 1987. Partial DNA sequences (obtained from lambda U-2os-39 and several other hBMP-2 class I cDNA recombinants) and derived amino acid sequences are shown in Table 7 below. Lambda U-2os-39 will contain the entire nucleotide sequence necessary for encoding the entire human protein BMP-2 Class II whose partial sequence is encoded by the bovine gene fragments shown in Table 3. This human cDNA hBMP-2 class II contains a 1188 bp open reading frame encoding a protein of 396 amino acids. This 396 amino acid protein has a molecular weight of 45 kd based on this amino acid sequence. This sequence represents the first translation product. This protein is preceded by a 5 'untranslated portion of 342 bp with a stop codon in every frame. The 13 bp portion preceding this 5 ′ untranslated portion represents a linker commercially available for cDNA colonization methods.

Full-length hBMP-2 class II human cDNA clones are recorded in the following manner. From its plastid subclone labeled by Nick translation, a 200 bp EcoR I-Sac I fragment was isolated from the 5 ′ end of class II preparation II-10-1 and cloned nitrocellulose ripple of one set of U-2 os cDNA libraries. Hybridize to Lyca (25 filters / set; represents 500,000 recombinants). Hybridization and washing are performed under the strict conditions described above. 16 replication positives are collected and replated for the second plate. Nitrocellulose filter replica of the second plate was prepared and synthesized according to the sequence of II-10-1

CGGGCTCAGGATACTCAAGACCAGTCGCTG

Hybridizes to oligonucleotides. Hybridize to standard hybridization buffer at 50 ° C. and wash in 1 × SSC, 0.1% SDS at 50 ° C. Fourteen recombinant bacteriophages that hybridize to this oligonucleotide are plaque purified. Plate stocks are prepared and small scale bacteriophage DNA preparations are prepared. After subcloning three of them into M13, sequencing revealed that they represent clones that overlap the native class II clones. One of them, Lambda U2os-3, was deposited with the ATCC at accession number ATCC 40342 dated June 16, 1987. U2os-3 contains insertions of about 1.8 kb. The partial DNA sequence and derived amino acid sequence of U2os-3 are shown in Table VIII below. This clone contains all of the nucleotide sequences needed to encode the entire human BMP-2 class II protein. This cDNA sequence contains a 1224 bp open reading frame encoding a protein of 408 amino acid preceded by a 394 bp 5 ′ untranslated portion with stopcode in every frame, followed by a 3 ′ untranslated portion of 308 bp Contains in-frame stopcode. The 8bp portion preceding the 5 ′ untranslated portion is the linker used in the cDNA cloning process. This 408 amino acid has a molecular weight of 47 kd of the protein and shows the first translation product.

The sequences of BMP-2 classes I and II and BMP-3 shown in Tables 3, 4, 7 and 8 have significant similarities to the exclusive (B) and beta (A) subunits of inhibin. Inhibin is a type of hormone currently being studied for use in contraception [A. J. Mason et al, Nature, 318: 659-663 (1985).

The similarity is less than that of inhibins, but they are transformative growth factor-beta (TGF-b) and testicular glycoproteins that retreat during development of the male fetus that can inhibit or stimulate the growth of cells or cause differentiation. It is similar to the backing inhibitor (MIS). Moreover, the sequence of Table 7 encoding hBMP-2 class II is very similar to the drosophila decapentaflexic (DPP-C) locus transcript [J. Mass-ague, Cell, 49: 437-438 (1987); R. W. Padgettet al, Nature, 325: 81-84 (1987): R. L. Cate et al, Cell 45: 685-698 (1986)]. Therefore, BMP-2 class II is a protein of human similarity prepared from transcripts from this developmental mutation locus.

C. BMP-3

Since the bovine and human bone growth factor genes are quite similar, the human genome library is screened using oligonucleotide probes that hybridize to the bovine DNA sequences of Tables 4a and 4b. These probes are used to screen the human genome library (Toole et al., Supra) and isolate the putative positives to obtain DNA sequences as described above. Evidence that this recombinant encodes part of the human bone inducer molecule is based on bovine / human protein and gene structure similarity.

A synthetic cell bacteriophage containing NDA encoding a portion of the human BMP-3 molecule is obtained and the human coding sequence is used as a probe as described in Example 5 (a) to synthesize the BMP-3 human cell line or Check the organization. MRNA is selected by oligo (dT) cellulose chromatography, and cDNAs are synthesized and cloned into lambda gt 10 by known techniques (Tll. E et al., Supra).

Otherwise, the complete gene encoding this human bone inducer can be identified and obtained in additional recombinant clones if necessary. Additional recombinants further containing the 3 ′ or `portion of this human bone inducer can be obtained by identifying DNA sequences specific to the ends of the original clone and using them as probes to rescreen the human genome library. Genes are resynthesized in a single plast by standard molecular biology techniques and propagated in bacteria. The complete BMP-3 factor gene can be transferred to an appropriate expression vector. Transfection vectors containing this gene are infected with mammalian cells, such as monkey COS cells, after transcribing human genes, followed by splices of RNA exactly. Analysis of bone inducer activity of the medium from infected cells indicates that the gene is complete. MRNA is obtained from these cells, and cDNA is synthesized and cloned from this mRNA source. The process described above can be similarly used to separate bone inducers of other species of interest using bovine bone inducers and / or human bone inducers as probe sources. Such other bone inducers may have similar utility in treating fractures.

Example 6

Expression of Bone Inducers

To prepare bovine, human or other mammalian bone inducers, the DNA encoding them is transferred to appropriate expression vectors and introduced into mammalian cells by known quantitative engineering techniques.

One of ordinary skill in the art would be those of Tables II-III or other modified sequences and pCD [Okayama et al., Mol, Cell Biol., 2: 161-170 (1982)] and pJL3, pJL4 [ Mammalian plasma vectors can be formed by using known vectors such as Gough et al., EMBO J., 4: 645-653 (1985). These vectors can be transformed into appropriate host cells to express bone inducers.

One of ordinary skill in the art can manipulate the sequences of Tables 2-8 by removing the mammalian regulatory sequences of both coding sequences or by aligning them with bacterial sequences to allow intracellular or cellular expression of cells by bacterial cells. Bacterial vectors can be prepared. For example, coding sequences can be further manipulated (eg, ligated to other known linkers, or noncoding sequences therefrom modified by deletion or exchange of nucleotides by other known techniques). Modified bone inducer coding sequences are described in T. Taniguchi et al., Proc. Natl Acald. Sci. USA, 77: 5230-5233 (1980)] can be used to insert into known bacterial vectors. This bacterial vector can be transformed into a bacterial host cell to express a bone inducer. See, for example, European Patent Application EPA 177,343 for the expression of cells of bone inducers in bacterial cells.

Similar manipulations can be carried out for the formation of insect beta for the transfection of insect cells (eg the method of published European patent application 155,476). Yeast vectors can be formed using yeast regulatory sequences to express intracellular or intracellularly by factors of the present invention (see methods of published PCT Application WO86 / 00639 and European Patent Application EPA 123,289). A method for producing the osteoinducer of the invention in high yield from mammalian cells is to form cells containing multiple copies of the heterologous bone inducer gene. Heterologous genes are ligated to proliferable markers, such as the dihydrofolate reductase (DHFR) gene, increasing concentrations according to Kaufman and sharp, J. Mol, Biol, 159: 601-629 (1982). Cells containing increased gene copies can be selected for propagation in methotrexate (MTX). This approach can also be used for many other cell types.

For example, a plasmid and DHER expression plasmid pADA26SV (A) 3 containing a DNA sequence of a bone inducer of the present invention functionally linked with other plasmid sequences for its expression, pADA26SV (A) 3 [Kaufman and sharp, Mol, Cell , Biol, 2: 1304 (1982) can be introduced into DHFR-binding CHO cells, DUKX-BII, by co-precipitation and infection with calcium phosphate. Selecting DHFR transgenic transformants for growth in alpha medium containing dialyzed fetal calf serum and as described in Kaufman et al., Mol, Cell, Biol., 5: 1750 (1983) DHFR transgenic transformants are selected for proliferation by growing in increasing concentrations of MTX (sequential steps of 0.02, 0.2, 1.0 and 5 μm MTX). The transformants are cloned and the biologically active bone inducer expression is regulated by bone activity analysis in mice. Bone inducer expression should increase with increasing MTX resistance. Similar methods can be followed to prepare other bone inducers.

Alternatively, human genes are directly expressed as described above. Active bone-derived phosphates can be produced in bacteria or yeast cells. However, a preferred transgene for current biologically active recombinant human bone inducers is stably transformed CHO cells.

As a specific example for preparing the human bone inducer of Example 5 (hBMP-1), the vector arms are digested with SalI to obtain an insert of U2os-1 and subcloned into mammalian transgenic vector pMT2CX digested with xhoI. . Plasmid DNA from this subclone was subjected to DEAE-textlan method [Sompayrac and Danna PNAS 78: 7575-7578 (1981): Luthman and Magnusson, Nucl. ACIDS Res. 11: Infect COS cells by 1295-1308 (1983). Choose a 24 hour control medium without serum from cells that begin infection after 40 to 70 hours.

Mammalian expression vector pMT2 Cla-Xho (pMT2 CX) contains the alpicillin resistance gene in tetracycline resistance gene acid and further contains the XhoI site for insertion of cDNA clones p91023 (b) (Wong et al. , Science 228: 810-815, 1985) is a derivative of p91023 (b). The functionality of pMT2 Cla-Xho is described in Kaufman, RJ, 1985, Proc. Natl. Acad. Sci. ISA 82: 689-693, and has been described as the Atenovirus VA gene, the SV40 clone including the 72 bp enhancer, 5 Adenovirus jurate promoters, including the splice site and the major adenovirus tripartite sequences present in adenovirus date mRNA, 3` splice acceptor sites, DHFR inserts, SV40 early polyadenylation sites (SV40) and Contains the pBR322 sequence necessary for propagation in coli.

Plasmids were recorded by EcoRl digestion of pMT2 Cla-Xho by pMT2-VWF and deposited in the ATCC under accession number ATCC 67122. EooRl digestion of cDNA inserts present in pMT-2VWF yields a linear pMT2 that can be ligated and used for ampicillin resistant transformation of E. coli HB101 or DH-5. Plasmid pMT2 DNA can be prepared by a known method. It is formed by digesting pMT2 CX2 with Eco RV and XbaI, treating the digested DNA with a cleno fragment of DNA polyterase I, and then ligation with Clalinker (NEBiolabs, CATCGATG). This removes bases 2266-2421 starting from the enhancer sequence of pMT2 and the HindIII site near the SV40 replicator. The plasmid DNA was digested with EcoR I to make a dudine terminal as described above, and then the Eco R I adapter

5`PO <sub>4</sub> -AATTCCTCGAGAGCT 3`

3` GGAFGCTCTCGA5`

Ligation, digestion with XhoI and ligation yield pMT2 Cla-Xho. And E. coli can be used to transform ampicillin resistance. Plasmid pMT2 Cla-Xho DNA can be prepared by a known method.

Example 7

Biological Activity of Transduced Bone Inducers

A. BMP-1

Factors are partially purified on a heparin Sepharose column to measure the biological activity of the transgenic bone inducer (hBMP-1) obtained in Example 6 above. 4 ml of infectious supernatant from one 100 mm dish is concentrated about 10-fold by ultrafiltration onto a YM10 membrane and dialyzed against 20 mM Tris, 0.15 M NaCl, pH7.4 (starting buffer). This material is placed in a 1.1 ml heparin cellulosic column in starting buffer. Unbound protein was removed by washing with 8 ml of starting buffer, and the bound protein containing BMP-1 was desorbed by washing with 20 mM Tris, 2.0 M NaCl, pH 7.43-4 ml.

Salts are reduced by concentrating the protein bound by the heparin column about 10-fold in Centricon 10 and diafiltering with 0.1% trifluoro acetic acid. Appropriate amount of this solution is mixed with 20 mg of rat matrix and assayed for bone and soft tissue formation in vivo as described in Example 3. The mock infection upper fraction is used as a control.

Implants containing a mouse matrix to which a certain amount of human BMP-1 was added are removed from the rats after 7 days and histological evaluation is performed. Representative portions of each implant are stained with Boncosa and Sanpuskin to confirm the presence of new bone material and stained with toluid blue to confirm the presence of cartilage-specific matrix formation. The type of cells present in that portion and the phenotype of these cells are evaluated.

At 7 days after implantation, human BMP-1 was added to the matrix material to form cartilage nodes. Chondrocyte-cell-like cells can be identified by the shape and expression of the metachromatic matrix. The amount of activity observed for human BMP-1 depends on the amount of human BMP-1 protein added to the matrix. Table 9 illustrates the dose-response relationship of human BMP-1 protein to the amount of bone inducer derived.

Cartilage (c) activity is assessed on a scale of 0 (-) to 5.

Similar levels of activity were observed in heparin Sepharose fractionated COS cell extracts. Partial purification is carried out in a similar manner to the above except that 6M urea is included in all buffers. Moreover, in the rat bone formation assay as described above, BMP-2 also has chondrogenic activity.

By the method described above, bovine bone inducers and / or human bone inducers can be used as probes to isolate other desired bone inducers. These other bone inducers also have similar utility in treating fractures.

The above description details the preferred examples of the present invention. Considering this description, those skilled in the art can make modifications and variations in practicing the present invention. Such modifications and variations are intended to be included in the scope of the appended claims.

Claims (19)

A process for preparing a pharmaceutical composition characterized by mixing together an effective amount of purified protein selected from the group consisting of (a), (b), (c) and (d) together with a pharmaceutically acceptable excipient, (a) BMP-1 prepared in step (i) actually hybridizes to cDNA having the following sequence and (1) this sequence under stringent hybridization conditions, and (2) upon expression, to induce bone, cartilage, or bone and cartilage. Culturing the transformed cells with a sequence encoding a protein which is capable of

(ii) recovering from this culture medium a protein which actually contains 37 amino acid sequences of amino acids ＃ 51 to ＃ 87 shown in (i), and (b) BMP-2 class I prepared by the following steps (i) a cDNA that actually has the following sequence and (1) a hybridization to this sequence under stringent hybridization conditions, and (2) a protein capable of inducing bone, cartilage, or bone and cartilage upon expression Culturing the transformed cells with the sequence encoding

(ii) recovering from this culture medium a protein which actually contains 97 amino acid sequences of amino acids # 229 to -396 shown in (i) above, and (c) BMP-2 class II prepared by the following steps. (i) a cDNA that actually has the following sequence and (1) a hybridization to this sequence under stringent hybridization conditions, and (2) a protein capable of inducing bone, cartilage, or bone and cartilage upon expression Culturing the transformed cells with the sequence encoding

(ii) recovering from this culture medium a protein which actually contains 97 amino acid sequences of amino acids # 311 to # 408 shown in (i), (d) BMP-3 prepared by the following steps, ( i) a protein characterized in that the cDNA actually has the following sequence and (1) hybridizes to this sequence under stringent hybridization conditions, and (2) can induce bone, cartilage, or bone and cartilage upon expression Culturing the transformed cells with the loading sequence and

(ii) recovering from this culture medium a protein containing 96 amino acid sequences of amino acids # 79 to # 175 shown in (d) (i) above. The method of claim 1, wherein the protein is BMP-1. The method of claim 1, wherein the protein is BMP-2 class I. The method of claim 1, wherein the protein is BMP-2 class II. The method of claim 1, wherein the protein is BMP-3. The pharmaceutical composition of claim 1, further comprising admixing a matrix to the pharmaceutical composition of claim 1, wherein the composition can be imparted to a bone or cartilage binding site and can provide a structure for inducing bone or cartilage formation. Manufacturing method. 7. The method of claim 6, wherein the matrix contains a substance selected from the group consisting of hydroxyapatite, collagen, collic acid, and tricalcium phosphate. An effective amount of at least one pharmaceutical composition selected from the group consisting of the pharmaceutical composition of claim 1 to a mammal, except for humans in need of bone or cartilage, characterized in that the administration to a mammal other than humans in need of bone or cartilage formation Method for inducing bone or cartilage formation in Characterized by culturing a cell line transformed with a DNA sequence containing the following nucleotide sequence encoding BMP- 'associated with the expression control sequence therefor in culture medium, and separating BMP-1 from the culture medium. BMP-1 production method.

A cell line transformed with a DNA sequence containing the following nucleotide sequence encoding the BMP-2 class I associated with the expression control sequence therefor was cultured in a culture medium, and the BMP-2 class I was cultured from the culture medium. A process for the preparation of BMP-2 class I characterized by dissociation.

A cell line transformed with a DNA sequence containing the following nucleotide sequence encoding the BMP-2 class II associated with the expression control sequence therefor was cultured in a culture medium, and the BMP-2 class II was recovered from the culture medium. Process for producing BMP-2 class II, characterized in that the separation.

A cell line transformed with a DNA sequence containing the following nucleotide sequence encoding the BMP-3 associated with the expression control sequence therefor is cultured in a culture medium, and the BMP-3 is separated from the culture medium. Preparation of BMP-3.

BMP-1 Ko, characterized by obtaining a cDNA which actually contains a nucleotide sequence according to claim 9 or a sequence which hybridizes to this sequence under stringent conditions, and which encodes a protein which, when expressed, actually characterizes BMP-1. Method for preparing ding cDNA. BMP- characterized in that a cDNA is obtained which actually contains a nucleotide sequence according to claim 10 or a sequence which hybridizes to this sequence under stringent conditions and which encodes a protein exhibiting the actual properties of BMP-2 Class I upon expression. 2 Manufacturing method of Class I coding cDAN. BMP- characterized in that a cDNA is obtained which actually contains a nucleotide sequence according to claim 11 or a sequence which hybridizes to this sequence under stringent conditions and which encodes a protein exhibiting the actual properties of BMP-2 class II upon expression. 2 Preparation of Class II Coding cDNA. BMP-3Co characterized by obtaining a cDNA which actually contains a nucleotide sequence according to claim 12 or a sequence which hybridizes to this sequence under stringent conditions and which encodes a protein exhibiting the actual properties of BMP-3 upon expression. Method for preparing ding cDNA. a. A BMP-1 coding DNA sequence which actually contains a nucleotide sequence according to claim 9 or a sequence which hybridizes to this sequence under stringent conditions and which encodes a protein exhibiting the actual properties of BMP-1 upon expression; b. A BMP-2 class I coding DNA sequence which actually contains a nucleotide sequence according to claim 10 or a sequence which hybridizes to this sequence under stringent conditions and which encodes a protein exhibiting the actual properties of BMP-2 class I upon expression; c. A BMP-2 class II coding DNA sequence which actually contains a nucleotide sequence as set forth in claim 11 or a sequence which hybridizes to this sequence under stringent conditions and which encodes a protein exhibiting the actual properties of BMP-2 class II upon expression; And d. Bone selected from the group of BMP-3 encoding DNA sequences that actually contain the nucleotide sequence described in claim 12 or a sequence that hybridizes to this sequence under stringent conditions and that exhibit the actual properties of BMP-3 upon expression and encode a protein A method of producing a vector for polypeptide expression, comprising inserting a DNA sequence encoding an inducer protein into a vector at a position at which the DNA sequence is to be expressed. A method for producing a recombinant microorganism, comprising inserting a vector according to claim 17 into a host cell capable of expressing a DNA sequence encoding a bone-derived protein. 19. The method of claim 18, wherein the host cell is selected from the group consisting of mammalian cells, bacterial cells, insect cells and yeast cells.