KR890014732A - Synthesis of TPA (Tissue type plasminogen activator) and Vector development method for mass production of TPA - Google Patents

Synthesis of TPA (Tissue type plasminogen activator) and Vector development method for mass production of TPA Download PDF

Info

Publication number
KR890014732A
KR890014732A KR1019880002685A KR880002685A KR890014732A KR 890014732 A KR890014732 A KR 890014732A KR 1019880002685 A KR1019880002685 A KR 1019880002685A KR 880002685 A KR880002685 A KR 880002685A KR 890014732 A KR890014732 A KR 890014732A
Authority
KR
South Korea
Prior art keywords
vector
dna
htpa
animal cells
kfcc
Prior art date
Application number
KR1019880002685A
Other languages
Korean (ko)
Other versions
KR900003926B1 (en
Inventor
케이.사만타 히마드리
김영준
곽규범
Original Assignee
손영희
제일제당 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 손영희, 제일제당 주식회사 filed Critical 손영희
Priority to KR8802685A priority Critical patent/KR900003926B1/en
Publication of KR890014732A publication Critical patent/KR890014732A/en
Application granted granted Critical
Publication of KR900003926B1 publication Critical patent/KR900003926B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

내용 없음.No content.

Description

TPA(Tissue type plasminogen activator)의 합성방법과 TPA를 대량생산하기위한 Vector개발 방법Synthesis of TPA (Tissue type plasminogen activator) and Vector development method for mass production of TPA

본 내용은 요부공개 건이므로 전문내용을 수록하지 않았음Since this is an open matter, no full text was included.

제1도는 박테리아 벡터(Vertor)bGEM3으로부터 Polylinker부분의 제한 효소 인식부위를 변형시킨 PGRX의 제조과정,1 is a process for preparing PGRX modified by restriction enzyme recognition of the polylinker moiety from bacterial vector (Vertor) bGEM3,

제2도는 TPA Poly A mRNA로부터 특정한 Oligonucleotide를 이용하여 목적한 부분만에 해당하는 cDNA를 Clone하는 조작법,2 is a method of cloning a cDNA corresponding to the desired portion using a specific oligonucleotide from TPA Poly A mRNA,

제3도는 발현(expression)벡터 pTRB1의 제조과정.3 shows the preparation of the expression vector pTRB1.

Claims (18)

대량생산을 목적으로 인간의 조직형 혈전 용해제(human tissue type plasminogen activator ; 이하 hTPA)를 생산, 분비하는 보우스 멜라노마세포(Bowes melanoma cell)에서 mRNA를 효과적인 방법으로 분리하여 적합한 방법을 사용하므로써 유전자 조작이 용이한 안정화된 mRNA를 만든다음 형질발현이 극대화되도록 조절하여 벡터 pTRB1, pTRB2, pTRB4, pPTRB6와 pTRB7을 합성한 후 숙주세포에 형질전환시켜 hTPA를 생산하는 방법.By mass-producing human tissue-type plasminogen activator (hTPA) for the purpose of mass production, mRNA is isolated from Bowes melanoma cells, which are produced and secreted by an effective method. A method of producing hTPA by producing a stabilized mRNA that is easily manipulated and then modulated to maximize expression, thereby synthesizing vectors pTRB1, pTRB2, pTRB4, pPTRB6 and pTRB7, and transforming host cells. 제 1항에 있어서, 염기서열이 5′GAGGCGGGATCCCATTTGCTTTTGAGG 3′인 합성 oligonucleotide DNA를 이용하여 mRNA를 분리하는 것을 특징으로 하는 방법.The method of claim 1, wherein the base sequence is 5'GAGGCGGGATCCCATTTGCTTTTGAGG 3 'mRNA oligonucleotide characterized in that the separation using the oligonucleotide DNA. 제 1항에 있어서, 분리한 mRNA를 염기서열이 5′GAGGCGGGATCCCATTTGCTTTTGAGG 3′와 5′ CTG7AGAGAAAACCTCTGC7AGG3′인 합성 oligonucleotide DNA를 이용여 hTPA를 암호화하는 유전자 서열을 포함하며 유전자 조작이 용이한 이중 가닥의 DNA로 안정화시키는 것을 특징으로 하는 방법.The method of claim 1, wherein the isolated mRNA is stabilized with a double-stranded DNA that includes a gene sequence encoding hTPA using synthetic oligonucleotide DNA having a base sequence of 5′GAGGCGGGATCCCATTTGCTTTTGAGG 3 ′ and 5 ′ CTG7AGAGAAAACCTCTGC7AGG3 ′. Characterized in that the method. 안정화된 이중 가닥 DNA를 EcoRI과 BamHI으로 처리하여 양끝이 서로 다른 Sticky 말단을 갖는 직선형 DNA로 만들어, 염기배열이 5′GATCTCGAGAATTCGGATCCTCGAGCTCTTAA GCCTAGGAGCTCGA 3′인 합성 oligonuclectide DNA를 사용하여 공지의 벡터 pGEH3의 polykinker부분을 변형시켜 제조한 벡터 pGRX에 도입선별하여 pGRX3를 제조하는 방법.Stabilized double-stranded DNA was treated with EcoRI and BamHI to form straight DNA having different sticky ends at both ends, and the polykinker portion of the known vector pGEH3 was modified using synthetic oligonuclectide DNA having 5′GATCTCGAGAATTCGGATCCTCGAGCTCTTAA GCCTAGGAGCTCGA 3 ′. A method for producing pGRX3 by introduction screening into a vector pGRX produced by the reaction. 제 4항에 있어서, 합성 oligonucleotide DNA를 동위 원소로 표지하여 1차 선별하고 삽입된 유전자 서열을 조사하여 2차 선별하는 것을 특징으로 하는 방법.The method according to claim 4, wherein the synthetic oligonucleotide DNA is labeled first with isotope and then screened for the second time by examining the inserted gene sequence. 제 1항에 있어서, 벡터 pTRB1은 벡터 pGRX3를 XhoI으로 처리하여 hTPA DNA를 끊어내어 BVP DNA와 인간의 메탈로티오닌 DNA와 쥐 메탈로티오닌 DNA를 포함하고 있는 벡터 pBMT3X의 XhoI자리에 삽입시켜 제조한 것을 특징으로 하는 방법.The vector pTRB1 is a vector pGRX3 treated with XhoI to cleave the hTPA DNA and inserted into the XhoI site of the vector pBMT3X containing BVP DNA, human metallothionine DNA and murine metallothionine DNA. Method characterized in that the prepared. 제 1 항에 있어서, 벡터 pTRR2는 polyadenylation signal이 포함된 DNA를 벡터 pGRX3의 hTPA DNA의 3′ 말단쪽 BamHI위치에 삽입 시킨후 끊어내어 pBMT3X의 XhoI위치에 도입시케 제조한 것을 특징으로 하는 방법.The method according to claim 1, wherein the vector pTRR2 is prepared by inserting the DNA containing the polyadenylation signal into the BamHI position of the 3 'terminal of hTPA DNA of the vector pGRX3 and cutting it into the XhoI position of pBMT3X. 제 1항에 있어서, 벡터 pTRB4는 Rous Sarcoma Virus (RSV)의 Long Terminal Repeat (LTR)DNA를 벡터 pBMT3X의 EcoR V위치에 삽입 시킨후 Xho I으로 끊고 Pely A Signal과 hTPA DNA를 벡터 pGRX3 B로부터 Xho I으로 잘라내어 도입시켜 제조하는 것을 특징으로 하는 방법.The vector pTRB4 is inserted into the Long Terminal Repeat (LTR) DNA of Rous Sarcoma Virus (RSV) at the EcoR V position of the vector pBMT3X and then cleaved with Xho I and Pely A Signal and hTPA DNA from the vector pGRX3 B. It is cut and introduced into I and manufactured. 제 1 항에 있어서, 벡터 pTRB6는 hTPA DNA의 5′ 말단쪽 인접부위에 두 개의 염기를 변이시켜 pBMTR2에 삽입시켜 제조한 것을 특징으로 하는 방법.The method of claim 1, wherein the vector pTRB6 is prepared by mutating two bases at the 5 ′ terminal adjacent portion of the hTPA DNA and inserting the same into pBMTR2. 제 1항에 있어서, 벡터 pTRB7는 hTPA DNA 5′말단쪽 인접부위에 두개의 염기를 변이시켜 pBMTR3X에 삽입시켜 제조한 것을 특징으로 하는 방법.The method of claim 1, wherein the vector pTRB7 is prepared by mutating two bases adjacent to the 5 ′ terminal of hTPA DNA and inserting the same into pBMTR3X. 제8항 내지 제9항에 있어서, 두꺼운 염기 서열을 변이 시키는데 사용한 합성 oligonudeotide DNA가 5′GGGACGCTGTGAAGCCACCATGGATGCAATGAAGAG 3′의 서열을 갖는 것을 특징으로 하는 방법.The method of claim 8, wherein the synthetic oligonudeotide DNA used to mutate the thick nucleotide sequence has a sequence of 5′GGGACGCTGTGAAGCCACCATGGATGCAATGAAGAG 3 ′. 제 1항에 있어서, 숙주세포로서 쥐의 섬유아세포인 C127을 사용함을 특징으로 하는 방법.2. The method according to claim 1, wherein C127, a mouse fibroblast, is used as a host cell. 제 1항에 있어서, 유전자 조작된 동물세포를 배양하여 hTPA를 대량생산하는데 있어서 발현 유발물질로써 Cadmium ion을 서서히 첨가하여 사용하는 것을 특징으로 하는 방법.[Claim 2] The method according to claim 1, wherein Cadmium ion is gradually added as an expression causing material in culturing genetically engineered animal cells to mass-produce hTPA. 벡터 pTRB1을 함유하고 있는 동물세포(KFCC-100465)Animal cells containing the vector pTRB1 (KFCC-100465) 벡터 pTRB2을 함유하고 있는 동물세포(KFCC-100466)Animal cells containing the vector pTRB2 (KFCC-100466) 벡터 pTRB4을 함유하고 있는 동물세포(KFCC-100467)Animal cells containing the vector pTRB4 (KFCC-100467) 벡터 pTRB6을 함유하고 있는 동물세포(KFCC-100468)Animal cells containing the vector pTRB6 (KFCC-100468) 벡터 pTRB7을 함유하고 있는 동물세포(KFCC-100469)Animal cells containing the vector pTRB7 (KFCC-100469) ※ 참고사항 : 최초출원 내용에 의하여 공개하는 것임.※ Note: The disclosure is based on the initial application.
KR8802685A 1988-03-14 1988-03-14 Expression vector for tpa KR900003926B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR8802685A KR900003926B1 (en) 1988-03-14 1988-03-14 Expression vector for tpa

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR8802685A KR900003926B1 (en) 1988-03-14 1988-03-14 Expression vector for tpa

Publications (2)

Publication Number Publication Date
KR890014732A true KR890014732A (en) 1989-10-25
KR900003926B1 KR900003926B1 (en) 1990-06-04

Family

ID=19272828

Family Applications (1)

Application Number Title Priority Date Filing Date
KR8802685A KR900003926B1 (en) 1988-03-14 1988-03-14 Expression vector for tpa

Country Status (1)

Country Link
KR (1) KR900003926B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100899173B1 (en) * 2003-08-14 2009-05-26 (주)바이오버드 Recombinant gene for mass production of Human tissue type plasminogen activator and protein refolding method thereof

Also Published As

Publication number Publication date
KR900003926B1 (en) 1990-06-04

Similar Documents

Publication Publication Date Title
McDevitt et al. Sequences capable of restoring poly (A) site function define two distinct downstream elements.
US5817483A (en) Process for the production of stochastically-generated peptides,polypeptides or proteins having a predetermined property
EP1227147A3 (en) Recombinational cloning using engineered recombination sites
Sugino et al. Interaction of bacteriophage T4 RNA and DNA ligases in joining of duplex DNA at base-paired ends.
Hill et al. The limits of template-directed synthesis with nucleoside-5′-phosphoro (2-methyl) imidazolides
WO1987007646A3 (en) Detection of point mutations in neu genes
DE68925972D1 (en) HEALING PROCEDURE USING CATALYTIC ANTIBODIES
BR0010806A (en) Methods and materials for the synthesis of organic products
Kirkegaard et al. Escherichia coli DNA topoisomerase I catalyzed linking of single-stranded rings of complementary base sequences
Wengler et al. Replicative form of Semliki Forest virus RNA contains an unpaired guanosine
KR830003574A (en) Microbial Expression of Anomalous Synthesis Genes
CA2020668A1 (en) Fused or hybrid protein comprising viral antigen and lymphokine
ATE77104T1 (en) QUANTITY AND METHOD FOR MAKING HIGH YIELD RECOMBINATION PRODUCTS.
WO2000040715A3 (en) Improved nucleic acid cloning
EP0260148A3 (en) Improved recombinant expression method, vector and transformed cells
NO942456D0 (en) Process for preparing thrombin
WO1989006286A3 (en) Probes for and methods of diagnosis for muscular dystrophy
UA48936C2 (en) Method for production of chicken anemia virus (cav) in two chain form, recombinant nucleate acid (variants), diagnostic set (variants), vaccination preparation (variants), cell culture (variants), method for production of diagnostic set (variants)
WO2000000600A3 (en) Lentiviral vectors, comprising modified major donor splice sites and major packaging signals
Prochiantz et al. TYMV RNA as a substrate of the tRNA maturation endonuclease
RU98101194A (en) RECOMBINANT WHITE MELEPOINT LECTIN (RML)
WO1998024906A3 (en) Isolated mammalian monocyte cell genes; related reagents
KR890014732A (en) Synthesis of TPA (Tissue type plasminogen activator) and Vector development method for mass production of TPA
KR880000587A (en) Manufacturing method of lysozyme
WO1989009824A3 (en) Gene synthesis

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
G160 Decision to publish patent application
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20060502

Year of fee payment: 17

LAPS Lapse due to unpaid annual fee