KR890005070B1 - Shuttle promoter dna sequence in e.coli and yeast - Google Patents

Abstract

The new DNA(YEP1) having promotor activity in E.coli and yeast and its purification method are presented. Thus, DNA extracted from yeast is treated with restriction enzyme AluI and HaeIII, and DNA with 500-2500 base pairs is obtained by electrophoresis in 1% agarose gel. The obtained DNA is treated with restriction enzyme BamHI and ligated into pk15 vector using T4 DNA ligase. E.coli LE392 transformed with above vector is cultured and plasmid DNA is extracted from E.coliLE392. Yeast transformed with extracted plasmid DNA is treated with restriction enzyme BamHI.

Description

Novel DNA (YEP1) with Two Promoter Activity of Yeast and Escherichia Coli and Isolation Method

1 is an assembly process of pK15 and pKW4, which is a vector for promoter development.

Figure 2 is a schematic diagram of the separation method of the yeast and Escherichia coli promoter dual activity (YEP1).

Figures 3a-c show restriction maps of YEP1 and various analysis diagrams. A is a restriction map and partial deletion experiment. B is a probe used for primer extension experiment and Southern assay. C is a sequencing diagram.

4 is a nucleotide sequence diagram of YEP1.

The present invention relates to a novel DNA (YEP1) having dual promoter activity of yeast and E. coli and a method for separating it from yeast.

In general, the prokaryote Escherichia coli and the eukaryote yeast are most widely used as host cells as a place for obtaining a cloned gene product, and the DNA base structure constituting the promoter is characterized. (Hawley, D. K and McClure, WR Nucleic Acids Research 11, 2237-2255 (1983); Sentenac, A. and Hall, B. The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression (Strathern, JN) , Jones, EW, Broach, JR) PP.561-606 (Cold Spring Harbor, New York, 1982).

Therefore, in order to properly express genes in the above two individuals, it has been common practice to connect the gene DNA after the appropriate promoter of each individual.

Unlike the conventional concept of the present invention, two promoters of E. coli and yeast exist together in one DNA, so that the dual promoter of so-called yeast and E. coli can be commonly used for expression of genes in E. coli and yeast. Its purpose is to. The dual promoter DNAs of yeast and Escherichia coli can be used in common in both host cells as one transcription unit, enabling the generation of genes more rapidly in the two host cells without additional genetic manipulation. Comparing the quantity and potency has the advantage that it is easy to determine which of the two host cells is more suitable for the production of the gene.

In the present invention, such a double promoter was isolated from natural yeast, Saccharomyces cerevisiae gene DNA. First, a shuttle plasmid between Escherichia coli and yeast, pK15 and pKW4, which is a vector for promoter development, was It was assembled from the known plasmids pBR325 (Bolivar, Gene, 4, 121-136 (1978) and pMA56 (Valenzuela et al., Nature 298, 347-350 (1982)). E. coli empicillin resistance gene (Ap ^R ) and Col El plasmid replication point (pBR ori), yeast TRP1 gene (TRP1) and 2μ replication point (2μ ori), in addition to the label for detecting the promoter to be used in the present invention As a marker, it has a coding gene portion excluding the promoter portion of Cm ^R , which is a resistance gene to the antibiotic chloramphenicol.

Therefore, Escherichia coli or yeast cells containing only pK15 plasmid are not resistant to the antibiotic chloramphenicol in the assay medium, but when the appropriate promoter is introduced before (Cm ^R ) of pK15, the Cm ^R gene is introduced by the introduced promoter. The E. coli or yeast cells are expressed in the presence of the antibiotic chloramphenicol, which is used to detect and isolate the promoter DNA. It has been reported that the prokaryotic Cm ^R gene is functionally expressed not only in E. coli but also in yeast. (Cohen, JD Bard, Proc. Natl. Acad. Sci. USA 77, 1078-1082 (1980))

Referring to Figure 2, a method for separating the yeast and E. coli double promoter (YEP1) from the yeast Saccharomyces cerevisiae by the present invention, first, the yeast Saccharomyces cerevisiae cells Was grown in YPD medium (1% yeast extract, 2% peptone, 2% glucose) at an optical density of (A600) at about 30 ° C. up to about 1.5 and then centrifuged and recovered to 60.000 yeast zymolase (Zymolyase). After rupturing the cell wall at 30 ° C. for 1 hour, high molecular weight DNA was isolated by Rodriguez and Tait (Rodriguez, RL and Tait, RC, Recombinant DNA Techique: an Introduction, PP 167-169 (Addison-). Wesley, Reading, MA, 1983). The isolated yeast gene DNA was cut by weakly double-treatment with restriction enzymes AluI and HaeIII, and electrophoresed on a 1% agarose gel to separate the base pair length of 500-2500bp from the gel by an electro-recovery method using an osmotic membrane. do. Next, the vector pK15 (KCTC 8284P; pK15 / LE392) was treated with the restriction enzyme BamHI, and both ends thereof were cleaved with Klenow fractionase of DNA polymerase I of Escherichia coli, and then DNA fragments of the yeast isolated before Are inserted using a T4 DNA ligase enzyme.

In this way, as shown in the bottom of FIG. 2, the recognition sites of the restriction enzyme BamHI are formed at both end portions of the inserted yeast DNA fragments, and thus the target of the present invention obtained as a result of the following screening operation by the treatment of BamHI enzyme. New DNA with dual promoter activity of yeast and E. coli can be isolated. Among the many DNA fragments inserted into the vector pK15, the following series of screening operations are performed to select the double promoter DNA insertion fragments of E. coli and yeast. A ligation sample into which the yeast DNA fragments were inserted at the BamHI site of the vector pK15 was injected into the E. coli by transformation, and the E. coli cells contained 50 µg / ml each of empicillin and chlorapenicol. Only Escherichia coli obtained with resistance to chloramphenicol by culturing overnight in LB medium (1% tryptone, 0.5% yeast extract, 1% salt) is selected.

Next, the total plasmid DNA was extracted from the cultured E. coli cells, and the yeast Saccharomyces cerevisiae D13-1A (a, his 3-532, trpl, gal2) (Struhl et al., Proc. Natl. Acad, Sci. USA 76, 1035-1089 (1979)) SD-trp solid medium (amino acid-depleted yeast) after transformation with a cation treatment method using LiOAc in cells (Ito et al., J. Bacteriol. 153, 163-168 (1983) Incubate for 5 days at 28 ° C. for 5 days at 0.67% nitrogen base, 2% glucose, traces of essential trace elements adenine, uracil, histidine, methionine and leucine respectively, 2% agar. YEPGE selection batch containing chloramphenicol (1% yeast extract, 2% peptone, glycerol 3%, alcohol 2%, agar 2%, chloramphenicol 1mg / ml) and incubated for 5-7 days at 28 ℃, the resulting cells They have a yeast and E. coli double promoter inserted into the chloramphenicol in both E. coli and yeast It was those for showing the tolerance. Accordingly, the promoter is functional in the dual-promoter in yeast and E. coli.

Detailed embodiments of the present invention are as follows.

Example 1

Several strains of yeast Saccharomyces cerevisiae, ie ATSS 42677 (α.ade 1, trp1, ura 1) (Petes, TD, Proc. Natl. Acad. Sci. USA 76, 410-414 (1979) ). D13-1A (a, his 3-532, trp 1, gal 2) (Struhl, K. et al., Proc. Natl. Acad. Sci. USA 76, 1035-1039 (1979)) and YNN 27 (α, trp 1 -289, ura 3-52, gal 2) (Proc. Natl. Acad. Sci. USA 77, 4599-4563 (1980)) about 20 μg of total gene DNA was treated with restriction enzymes AluI and HaeIII to treat 1% agar. Ross gel electrophoresis was performed, and the DNA base pair having a length of 500-2500 parts was recovered by electroelution using a dialysis membrane. Next, 2.5 μg of the pK15 (KCTC 8284P; pK15 / LE392) vector DNA was treated with restriction enzyme BamHI, followed by 50 minutes at 25 ° C. with a DNA polymerase I Klenow fraction of E. coli, 20 mM Tris (pH 7.5), 100 mM NaCl. . Reaction was carried out in the presence of 10 mM MgCl ₂ , 1 mM DTT and 4dNTPs to bind both ends, whereby the previously recovered yeast DNA fragments were conjugated in a 12 hour reaction at 18 ° C. using T4 DNA ligase (2.5u) enzyme. ) The conjugated E. coli cells LE 392 (F, hsd R514 (r _k , m _k ), sup E 44, sup F 58, lac Y1, gal K2, gal T22, met Bl, trp R55, λ-) (Murray, NE et al Mol Gen. Genet. 150, 53-. (1977) strains were transformed by the method using CaCl ₂ , and the transformed E. coli mixture (about 1 ml) was immediately converted into antibiotics of 50 µg of empicillin and chloramphenicol. Inoculated in 100ml LB medium containing / ml each and grown by shaking culture at 37 ℃ overnight. As a result, the grown E. coli cells were collected by centrifugation, and the plasmid DNA was extracted there by alkali treatment (Birnboim, HC and Doly, H., Nucleic Acidc Res. 7, 1513-, (1979)). Next, the extracted plasmid DNA was transformed into a method of treating LiOAc in yeast Saccharomyces cerevisiae D13-1A cells (Ito et al., J. Bacteriol. 153, 163-168 (1983), and SD-trp. 50 colonies were grown in solid medium, and the colonies were transferred to YEPGE + Cm solid medium and incubated at 28 ° C. for 7 days to obtain 10 colonies resistant to chloramphenicol.

Plasmids were extracted from these 10 colonies and treated with the restriction enzyme BamHI to isolate the yeast and E. coli double promoter (YEP1) (KCTC 8285 P) of the present invention.

The promoter YEP1 isolated by the above method was about 2200 base pairs, and FIG. 3a shows the pK15 plasmid containing YEP1 (YEP1-pK15) in a long box, and the black portion of the YEP1 DNA was enlarged to show the restriction map. At this time, the name of each restriction enzyme used is as follows. A, Alu I; B, Bam HI; C, ClaI; E, EcoRI; H, HaeIII; K, KpnI; P, PvuII, R, RsaI; S, SalI; T, TaqI.

Example 2

In order to investigate the dual promoter action in yeast and Escherichia coli of the promoter YEP1 isolated in Example 1, the 2,200 base pairs are shown in Fig. 3a, as shown in Fig. 3a, various parts of YEP1 (560), YEP1 (840), and YEP1 (2,200). The division experiment was performed to investigate the promoter activity of each part.

The method linked each YEP1 moiety to (Cm ^R ) of the plasmid pK15 to measure and compare the chloramphenicolacetyl transferase (CAT) enzyme activity expressed and transcribed by each moiety. The results were as shown in Table 1 below.

TABLE 1

In Table 1, YEP1 (840) (KCTC 8285P: YEP1 (840) -pK15 / LE392), which consists of the right end of the YEP1 DNA from the upper left to about 840 base pairs, has its promoter activity in yeast, Escherichia coli, or the original YEP1 gene. It can be seen that the length is 2,200 base pairs and the defects, and therefore, the 840 base pairs are sufficient as a double promoter of E. coli and yeast.

Example 3

In order to determine the nucleotide sequence of the YEP1 DNA, the YEP1 840 is divided into several fragments as shown in Fig. 3c, and Sanger's method (Sanger, F. et al., Proc. Natl. Acad. Sci. USA 74, 5643-5467 (1977)). The nucleotide sequence of the analyzed YEP1 DNA was as shown in Fig. 4. At this time, the A base of the translation start codon ATG of the Cm ^R gene linked to YEP1 was set as the base number +1 for convenience. The sequence was analyzed by comparing the BIONET computer system (Smith, DH et al., Nucl. Acids Res. 14, 17-20 (1986)) with the sequences of the yeast gene bank and confirmed that YEP1 is a new DNA that has not been identified before.

The sequences indicated by dotted lines in FIG. 4 are the TATA box sequences of the yeast promoter found in YEP1, and the sequences included in the two boxes are the Pribnow box and -35 region sequence, which are the E. coli promoter components found in YEP1. In addition, the sequences indicated by the solid line are the Shine-Dalgarno sequence of the Cm ^R gene itself, and the portion between i and t is an open reading frame (ORF) portion of which the protein product is still unknown.

Example 4

The 5'-end starting point of the Cm ^R information RNA transcribed by the dual promoter YEP1 was determined by primer extension method. The primer used here was labeled 'primer' in FIG. 3b, and the 3'-end point of this primer was indicated by an arrow in FIG. This primer was labeled with ³² P, hybridized with RNA isolated from E. coli and yeast containing plasmid YEP1-pK15, and the primer was extended to the 5'-end position of the Cm ^R information RNA as a reverse transcriptase.

As a result, the determined information RNA start point was found in E. coli and more than 20 points in yeast, and these points were rounded in Fig. 4 (starting point in E. coli) and three points of visual point (yeast). Starting point at).

Example 5

Southern blot analysis was performed to determine if YEP1 DNA was present in yeast Saccharomyces cerevisiae. Twenty micrograms of total gene DNA isolated from yeast Saccharomyces cerevisiae were treated with the restriction enzymes EcoRI, ClaI or EcoRI + ClaI, respectively, followed by electrophoresis on agarose gels, and then fixed on nitrocellulose membranes. Analysis was performed by hybridizing with a probe marked 'Southern' in FIG. 3b.

As a result, all positive bands were observed in the EcoRI, EcoRI + ClaI and ClaI treatments. Especially, in the EcoRI + ClaI treatment, the bands of 612 base pairs expected in the YEP1 base sequence of FIG. 4 were observed. Was found in the real yeast gene.

Claims (3)

The DNA DNA extracted from the yeast was treated with restriction enzymes AluI and HaeIII, and then recovered by DNA electrophoresis from 1% agarose gel to a DNA length of 500-2500 base pairs, which were treated with restriction enzyme BamHI and subjected to E. coli polymerase klenow fraction. Conjugated by using a T4 DNA ligase enzyme to pK15 vector, a processed promoter development vector, which was transformed into E. coli LE392, cultured, and subjected to alkali treatment to plasmid DNA. Extracting and transforming the extracted plasmid DNA with yeast, and then culturing with BamHI restriction enzyme to separate new DNA (YEP1) having two promoter activities of yeast and E. coli from yeast. The transformed E. coli LE392 (E. coli LE392) is cultured in a medium containing empicillin and chloramphenicol, and further, the transformed yeast cells are cultured in a chloramphenicol-containing medium, and both yeast and E. coli are cultured from yeast. To isolate novel DNA (YEP1) with eggplant promoter activity. New DNA (YEP1) with two promoter activities of yeast and Escherichia coli with the following nucleotide sequences. GTCGACACACTGGACACCTTGAATTCTTCCACTTATTTAAGCATT GGCAATGAAAAGTGTGCTGGCACGGGATCGTTACTAATCCAGTAG TTTCTGAATCCATTCTTTCAAGGCAAACGGGACATGTGGGGAGTT CGACTTTTACCAGTTCCTTTTTTTTCTTAACAGTGAATGGATCAG TAAGCAGATAGGGGAAGTCCTCGTTAGCGGCTGGTCTTTGGAAGA GCTTTTTTTGAAAAACTATTTCTTTTACAGAGATCACATGGCATG TTTCGGGATCCCGATATTCTATTTGGGGGTACGCTGTCTTAAGT TTGCCTGTAAGTATTATTGTTGTCTCAGGTGCAATTTACGTTTTA CAGTGGGCTAACCCAACTTAATACAACTTTTCATTCCTTTGTATA GAGTCTTCATGAATGAAAGTCTTATTCATTTTTTTTTTTTTTTAG CATAGTTTTATATTCCTTTTTTATTCCAAGACTTATATTCTCATT ATATTCTATTTAGTTTCGCATGGAATTTCAAGTACACATATAACT ACAGCCTTACTTGAAAATTGCCTGTCTGGGTCTTATACTTTGCAC CCTTGTACAGCTTTGTATTTTTGCCAATTGTTAATCCAGATACAA TATCGATGGCTTCTACATAGATTCCACTGGCCGATTGTCCTATGT AAGAATATTCTAAGGAGACTGTTTGTAAATCAACTTTTTTTGTAA AATTTGGCCCAGTATTTTCATACTCAATACAGCCACGTAGTACAG GTACCGTTCCAGTGGCAGTTGATTTATCAAAAATCCATTGTCCTT GACCCATGATAATGCTATTTTCAAAACGG.

Images