KR20240112124A - Corn-derived arabinoxylan, pharmaceutical composition for treating or preventing inflammatory bowel disease or irritable bowel syndrome containing the same, and method for preparing the same - Google Patents

Abstract

The present invention relates to high-purity arabinoxylan isolated from corn and having excellent biological activity, a composition for preventing, treating or improving inflammatory bowel disease and/or irritable bowel syndrome containing the same as an active ingredient, and a method for producing the same. will be.

Description

Corn-derived arabinoxylan, pharmaceutical composition for treating or preventing inflammatory bowel disease or irritable bowel syndrome containing the same, and method for producing the same {Corn-derived arabinoxylan, pharmaceutical composition for treating or preventing inflammatory bowel disease or irritable bowel syndrome containing the same, and method for preparing the same}

The present invention relates to a pharmaceutical composition for the treatment or prevention of inflammatory bowel disease and/or irritable bowel syndrome. That is, the present invention relates to the use of a specific substance as a medicine or health functional food for the treatment or prevention of inflammatory bowel disease and/or irritable bowel syndrome. The present invention also relates to methods of preparing substances useful for the treatment or prevention of inflammatory bowel disease and/or irritable bowel syndrome. The present invention also relates to arabinoxylan of a specific structure derived from corn and a method for producing the same.

Inflammatory bowel disease (IBD) is represented by ulcerative colitis (UC) and Crohn's disease (CD). However, the pathological mechanism of inflammatory bowel disease has not yet been clearly identified, and as the disease progresses, worsening and improving states occur repeatedly, and serious complications such as stenosis and perforation occur later, so it is classified as a rare and incurable disease. The prevalence of inflammatory bowel disease is increasing worldwide, and the rate of increase is higher in Asian countries than in the West.

Mucosal biopsies from patients with inflammatory bowel disease show increased expression of pro-inflammatory cytokines, chemokines, and intercellular adhesion molecules (ICAM-1 (Intercellular Adhesion Molecule 1)) and loss of mucus. It shows damage or disruption of tight junctions between epithelial cells.

Mucosal healing is an emerging treatment goal for inflammatory bowel disease. The biggest characteristic of patients with inflammatory bowel disease is that mucin production in the large intestine is reduced. The absence of the mucosal layer allows bacteria to reach the intestinal epithelial cells directly, where they cause a severe inflammatory response. To fundamentally improve intestinal function, mucous membrane production must be restored, and the tight junction between intestinal epithelial cells is also very important. Therefore, research on mucosal production has been actively conducted recently. Therefore, in order to treat IBD and maintain healthy intestinal function, it is necessary to properly suppress inflammation, restore normal mucus layer, and restore the tight junction tightness of intestinal epithelial cells.

Meanwhile, irritable bowel syndrome (IBS) is a functional bowel disease that is accompanied by chronic abdominal pain, abdominal discomfort, and defecation problems without any organic abnormalities in the intestinal tract. Irritable Bowel Syndrome is a common disease in which 28% of patients who visit with digestive symptoms are diagnosed with irritable bowel syndrome. Symptoms mainly include bowel problems, abdominal pain, bloating, and mucus in the stool. In addition to digestive symptoms, it also includes headaches, menstrual irregularities, and urination. It is often accompanied by disability, anxiety, nervousness, and depression. These symptoms tend to get worse when eating certain foods or under stress. The exact cause of irritable bowel syndrome has not yet been identified, and it includes colonic motor abnormalities, sensory abnormalities, brain-intestinal interactions, low-grade inflammation that persists after infection, immune system abnormalities, changes in the intestinal microbial population, genetic predisposition, and psychosocial factors. etc. are presented.

Representative drugs currently used to treat inflammatory bowel disease and/or irritable bowel syndrome include 5-aminosalicyic acid, corticosteroid, immunomodulator, and anti-tumor necrosis factor-α agent. , anti TNF-α), etc. Because they are effective through different mechanisms of action, they are being used step by step according to clinical guidelines, but the fundamental treatment method has not been established due to unclear pathological mechanisms. In addition, these drugs for symptomatic treatment have limited effectiveness or have been reported to have various side effects.

For example, sulfasalazine, a 5-aminosalicylic acid (5-ASA) drug that blocks the production of prostaglandins, causes abdominal fullness, headache, rash, liver disease, leukopenia, agranulocytosis, and male It is easy to cause side effects such as infertility. In the case of corticosteroids, their short-term effectiveness is recognized, but they cannot improve long-term prognosis. In addition, corticosteroids have limitations in that they should only be used in acute cases in terms of side effects such as induced infectious diseases, secondary adrenocortical insufficiency, peptic ulcers, diabetes, mental disorders, and steroid nephropathy. Anti-TNF-α agents, which are tumor necrosis factor inhibitors, are known to be effective in treating or relieving symptoms of previously untreated Crohn's disease by effectively inhibiting TNF-α, which is known to play an important role in the pathogenesis of ulcerative colitis. However, these treatments are expensive and cause side effects such as fluid reactions or infectious complications in some patients. Therefore, to treat inflammatory bowel disease and/or irritable bowel syndrome, other treatments without side effects are needed.

Meanwhile, arabinoxylan is a type of polysaccharide derived from plants and is a biologically active polysaccharide extracted from hemicellulose, one of the main substances in plant cell walls. Arabinoxylan is found primarily in the outer layer (bran) and starchy endosperm (flour) of many grains, including corn, rye, barley, oats, sorghum, wheat, and rice. The occurrence and structure of arabinoxylan vary among grains, and structural heterogeneity characteristics vary depending on the location of arabinoxylan tissue. Grain processing by-products are a cheap and abundant source of arabinoxylan, and there are various extraction methods such as hydrothermal, chemical and enzymatic treatments.

Arabinoxylan, a macromolecule, can have specific properties such as various molecular weights and sugar composition ratios depending on various (extraction) conditions (temperature, solvent used, enzymes) and various materials (corn, wheat, barley, etc.). In other words, the activity of these arabinoxylans may vary depending on molecular weight, sugar composition, etc.

Republic of Korea Patent Publication No. 10-2007-0076231

Therefore, the problem to be solved by the present invention is to provide a pharmaceutical or functional food composition that is useful for treating or preventing inflammatory bowel disease and/or irritable bowel syndrome and has few side effects.

That is, the problem to be solved by the present invention is to provide a new medicinal ingredient that is useful for the treatment or prevention of inflammatory bowel disease and/or irritable bowel syndrome and has few side effects.

The problem to be solved by the present invention is also to provide a new medicinal ingredient, corn-derived arabinoxylan, which is useful for the treatment or prevention of inflammatory bowel disease and/or irritable bowel syndrome and has few side effects, and a method for producing the same.

In order to solve the above problem, one aspect of the present invention is that the molecular weight is 70-90 kDa when measured by gel permeation chromatography, the content of arabinose and xylose is 35% by weight or more, and xylan is added to the main chain. It is a polysaccharide containing arabinose in the side chain, and arabinose is linked to 4-O-Methyl-D-glucuronic Acid, Acetyl ferulic acid, or hexose at the end. Provides corn-derived arabinoxylan, characterized in that:

Another aspect of the present invention is to treat inflammatory bowel disease (IBD) and/or irritable bowel syndrome (IBS), preferably inflammation, comprising corn-derived arabinoxylan as an active ingredient. A pharmaceutical or functional food composition for the treatment or prevention of growth diseases is provided.

The present inventors have found that high-purity arabinoxylan isolated from corn, or isolates or extracts containing a high content of arabinoxylan, exhibits a colitis treatment or prevention effect in DSS (dextran sodium sulfate)-induced colitis, and inflammatory cytokines. The present invention was completed by confirming that it has multifunctional effects such as suppressing the production of pro-inflammatory cytokines, promoting mucin secretion, and strengthening the tight junction of intestinal epithelial cells.

The arabinoxylan of the present invention has no cytotoxicity, improves proliferation of intestinal cells, and inhibits NO production, inhibits iNOS expression, promotes Mucin production, and improves proliferation of intestinal cells, thereby preventing inflammatory bowel diseases such as colitis. It is thought to have the property of suppressing, but the present invention is not limited to this theoretical mechanism.

The arabinoxylan of the present invention is derived from corn polysaccharide, and in a preferred embodiment of the present invention, the arabinoxylan has an arabinose and xylose content of 15% by weight or more, and more preferably Preferably, the arabinose and xylose content is 35% by weight or more, and most preferably, the arabinose and xylose content is 65% by weight or more.

Arabinoxylan of the present invention is a polysaccharide containing xylan in the main chain and arabinose in the side chain, and preferably contains xylan linked to xylose in a 1→4 bond as the main chain, and the xylose It contains one side chain connected at the C3 position or two side chains connected at the C2 and C3 positions, and the side chain includes arabinose. At this time, the arabinose preferably has 4-O-Methyl-D-glucuronic Acid, Acetyl ferulic acid, or hexose attached to the terminal.

In the present invention, "high content" means 20% by weight or more of corn-derived arabinoxylan, preferably 30% by weight or more, more preferably 40% by weight or more, and even more preferably 50% by weight, relative to the total weight of the composition. % or more, most preferably 60% by weight or more.

The composition according to the present invention may be a pharmaceutical composition, health functional food composition, feed composition, etc.

In one aspect of the present invention, the inflammatory bowel disease is ulcerative colitis (UC) or Crohn's disease (CD).

In one aspect of the present invention, arabinoxylan included in the composition for treating or preventing inflammatory bowel disease (IBD) and/or irritable bowel syndrome (IBS) of the present invention is

(S1) immersing corn in a weak acid aqueous solution;

(S2) Concentrating the corn steeping liquid and adding ethanol thereto;

(S3) recovering the precipitate by centrifuging the mixed solution of step S2;

(S4) adding an aqueous ethanol solution to the precipitate from step S3 and centrifuging to recover the supernatant; and

(S5) It is prepared by a production method including the step of fractionating the supernatant of step S4 or its concentrate according to molecular weight or size.

Preferably, in the above production method, any one or more selected from the group consisting of formic acid, acetic acid, benzoic acid, oxalic acid, hydrofluoric acid, nitrous acid, sulfurous acid, and phosphoric acid can be used as the weak acid.

In the above production method, (S1) the step of immersing corn in a weak acid aqueous solution, preferably an aqueous sulfurous acid solution, preferably uses an aqueous solution in which 0.1-0.5% by weight, preferably 0.1-0.3% by weight, of sulfur dioxide is dissolved in water. do.

In a preferred embodiment of the present invention, the fractionation in step (S5) is to recover a polysaccharide fraction with a molecular weight of 60-100 kDa, more preferably 70-90 kDa, by gel permeation chromatography (GPC).

In a preferred embodiment of the present invention, the arabinoxylan included in the composition according to the present invention is an arabinoxylan with a molecular weight of 60-100 kDa, preferably 70-90 kDa.

One aspect of the present invention also includes,

(S1) immersing corn in a weak acid aqueous solution;

(S2) Concentrating the corn steeping liquid and adding ethanol thereto;

(S3) recovering the precipitate by centrifuging the mixed solution of step S2;

(S4) adding an aqueous ethanol solution to the precipitate from step S3 and centrifuging to recover the supernatant; and

(S5) comprising the step of fractionating the supernatant of step S4 or its concentrate according to molecular weight or size,

A method for producing a composition for the treatment or prevention of inflammatory bowel disease (IBD) or irritable bowel syndrome (IBS) containing corn-derived arabinoxylan as an active ingredient is provided.

Preferably, the production method optionally includes the step of mixing corn-derived arabinoxylan obtained in fraction (S6) with a pharmaceutically acceptable additive.

One aspect of the present invention also provides, to individuals in need of treatment, improvement or prevention of inflammatory bowel disease and/or irritable bowel syndrome, corn-derived arabinoxylan according to the present invention or an isolate containing such arabinoxylan in a high content. Alternatively, a method for treating or preventing inflammatory bowel disease and/or irritable bowel syndrome is provided, comprising administering a therapeutically or prophylactically effective dose of the extract.

food composition

The food of the present invention refers to health supplements, health functional foods, functional foods, exercise supplements, etc., but is not limited thereto, and includes natural foods, processed foods, general food ingredients, etc. using corn-derived arabinoxylan or a high-grade product thereof. This includes addition of content extract.

The food composition containing corn-derived arabinoxylan of the present invention can be added as is or used together with other foods or food compositions, and can be used appropriately according to conventional methods. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention or health maintenance purpose). In general, the corn-derived arabinoxylan of the present invention can be added in an amount of 0.1 to 90% by weight, preferably 0.1 to 50% by weight, based on the raw materials when producing food or beverages, and more preferably. Can be added in an amount of 0.01 to 30% by weight.

There are no special restrictions on the types of foods above. The food composition containing corn-derived arabinoxylan or a high-content extract thereof as an active ingredient can be used in the form of preparations for oral administration such as tablets, hard or soft capsules, solutions, suspensions, etc. These preparations can be prepared using acceptable conventional carriers, for example, in the case of preparations for oral administration, excipients, binders, disintegrants, lubricants, solubilizers, suspending agents, preservatives or extenders.

Feed and animal functional feed compositions

The feed composition containing corn-derived arabinoxylan or a high-content extract thereof of the present invention as an active ingredient can be fed together with conventional feed, and a functional feed composition is prepared by adding the feed composition of the present invention to a conventional feed composition. You can also use it.

In addition, the feed composition of the present invention may further include functional ingredients other than the corn-derived arabinoxylan of the present invention. When preparing a functional feed composition in which the conventional feed composition and the corn-derived arabinoxylan of the present invention are mixed, the corn-derived arabinoxylan of the present invention is used in an amount of 0.1 to 90% by weight, preferably 0.1 to 50%, based on the total feed composition. It can be added in an amount of weight percent. The effective dose of corn-derived arabinoxylan in the feed composition can be used in accordance with the effective dose of the food composition, but in the case of long-term intake for the purpose of continuous intestinal health prevention and treatment, it may be below the above range, and the active ingredient Since there is no problem in terms of safety, it can be used in amounts above the above range.

The feed composition of the present invention is intended for livestock or poultry. Any mammal or bird other than a human that can be raised at home can be said to be the subject of the feed composition of the present invention.

pharmaceutical composition

The pharmaceutical composition containing corn-derived arabinoxylan or a high-content extract thereof of the present invention has the prevention and treatment properties mentioned above. The pharmaceutical composition containing corn-derived arabinoxylan or a high-content extract thereof of the present invention may be a pharmaceutical composition for the prevention and treatment of diseases caused by intestinal inflammation, exposure to endotoxin, damage to intestinal tissue due to harmful bacteria, etc. there is. The pharmaceutical composition of the present invention may contain 0.01 to 90% by weight, preferably 0.1 to 80% by weight, of the corn-derived polysaccharide of the present invention. However, this can be increased or decreased depending on the needs of the administering agent, and can be appropriately increased or decreased depending on circumstances such as diet, nutritional status, disease progression, and degree of obesity.

The pharmaceutical composition of the present invention can be administered orally or parenterally and can be used in the form of a general pharmaceutical preparation. Preferred pharmaceutical preparations include preparations for oral administration such as tablets, hard or soft capsules, solutions, suspensions, etc. These pharmaceutical preparations contain conventional pharmaceutically acceptable carriers, for example, in the case of preparations for oral administration, excipients, It can be prepared using binders, disintegrants, lubricants, solubilizers, suspending agents, preservatives, or extenders.

The administration dose of the pharmaceutical composition containing corn-derived arabinoxylan or a high-content extract thereof of the present invention may be determined by an expert depending on various factors such as the patient's condition, age, gender, and complications. For example, it can generally be administered in a dose of 0.1 mg to 10 g, preferably 10 mg to 5 g, based on the arabinoxylan content per 1 kg of an adult. In addition, each unit dosage form contains the daily dose of the pharmaceutical composition or 1/2, 1/3 or 1/4 thereof, and can be administered 1 to 6 times a day. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range, and the active ingredient may be used in amounts above the above range because there is no problem in terms of safety.

One aspect of the present invention is also,

(S1) immersing corn in a weak acid aqueous solution;

(S2) Concentrating the corn steeping liquid and adding ethanol thereto;

(S3) recovering the precipitate by centrifuging the mixed solution of step S2;

(S4) adding an aqueous ethanol solution to the precipitate from step S3 and centrifuging to recover the supernatant; and

(S5) comprising the step of fractionating the supernatant of step S4 or its concentrate according to molecular weight or size,

A method for producing arabinoxylan useful for the treatment or prevention of inflammatory bowel disease or irritable bowel syndrome is provided.

Preferably, in the above method, any one or more selected from the group consisting of formic acid, acetic acid, benzoic acid, oxalic acid, hydrofluoric acid, nitrous acid, sulfurous acid, and phosphoric acid can be used as the weak acid.

In a preferred embodiment, the step (S1) of immersing the corn in a weak acid aqueous solution, preferably an aqueous sulfurous acid solution, involves using an aqueous sulfurous acid solution in which 0.1-0.5% by weight, preferably 0.1-0.3% by weight, of sulfur dioxide is dissolved in water. Use it.

Preferably, the seed part of the corn is used.

In a preferred embodiment, the soaking of (S1) is carried out for 12-72 hours, preferably 24-60 hours.

In one aspect of the present invention, 2-6 times the amount of ethanol in step (S2) is added compared to the volume of the concentrate.

In one aspect of the present invention, the ethanol aqueous solution in step (S4) may be an ethanol aqueous solution having an ethanol:water volume ratio of 1:1 (ethanol:water) to 3:1.

In one aspect of the present invention, the fraction in step (S5) is a fraction obtained by recovering a polysaccharide fraction with a molecular weight of 60-100 kDa, preferably 70-90 kDa, using gel permeation chromatography (GPC).

Corn-derived arabinoxylan or extracts or isolates containing high content thereof according to the present invention reduces the activity and expression of inflammatory activity indicator factors and prevents inflammatory bowel disease (IBD) and irritable bowel syndrome (Irritable Bowel Disease). It has the effect of improving the disease activity of bowel syndrome (IBS) and can be usefully used as an active ingredient in compositions for the prevention and treatment of inflammatory bowel disease and/or irritable bowel syndrome.

The following drawings attached to this specification illustrate a preferred aspect(s) of the present invention, and serve to further understand the technical idea of the present invention along with the contents of the above-described invention, so the present invention is shown in such drawings. The interpretation should not be limited to only the stated matters.
Figure 1 schematically shows a process for separating and purifying arabinoxylan-containing fractions or high-purity arabinoxylan from corn.
Figure 2 shows the results of measuring the molecular weight distribution of MCP-AX1 and MCP-AX2, which are embodiments of the present invention.
Figure 3 is the DSS-induced colitis model experiment schedule of Example 9.
Figure 4 is a graph showing the change in body weight and disease activity index (DAI) for each group after administration of corn polysaccharide fraction.
Figure 5 shows the results of evaluation of colon length in a DSS-induced colitis model after administration of corn polysaccharide fraction.
Figure 6 is a photographic result comparing the differences in histological changes in the large intestine of each experimental group.
Figure 7 is a schematic diagram showing the structure of corn-derived arabinoxylan according to the present invention.

Hereinafter, to aid understanding of the present invention, it will be described in detail through examples. However, the embodiments according to the present invention may be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the present invention are provided to more completely explain the present invention to those with average knowledge in the field to which the present invention pertains.

Example 1: Isolation of corn-derived polysaccharide

Corn seeds were soaked in an aqueous sulfurous acid solution (containing 0.3% sulfur dioxide) for 60 hours. Sulfurous acid separates starch and insoluble proteins from the endosperm of corn and precipitates them, and converts dissolved sugars into lactic acid, lowering the pH to below 4. The steeping liquid generated at this time was named corn steep liquor (CSL).

Corn steep liquor (CSL) was concentrated to a final concentration of 20 Brix, 4 times the final volume of ethanol was added, and left overnight. Afterwards, the precipitate was recovered using a centrifuge (6000 rpm, 30 min, 4°C). The precipitate was named MCP.

Afterwards, the MCP was again precipitated using a solution of distilled water (DIW) and ethanol mixed at a volume ratio of 1:2, and then the precipitate and supernatant were recovered twice using a centrifuge (6000 rpm, 30 min, 4°C). I repeated. Afterwards, the recovered supernatant was again concentrated to 20 Brix using a rotary vacuum concentrator and then recovered. The recovered concentrate was hereinafter named MCP-AX. And the remaining precipitate was named MCP-G.

In order to extract high molecular weight polysaccharides from the polysaccharides present in MCP-G, water and ethanol were prepared at a ratio of 1:2 and fractionated into MCP-GS and MCP-GP.

Example 2: Per-member analysis of MCP, MCP-G, MCP-GS, MCP-AX, MCP-AX1, and MCP-AX2

Constituent sugar analysis was performed by applying the method of Albersheim et al. (Jones TM, Albersheim P. A gas chromatographic method for the determination of aldose and uronic acid constituents of plant cell wall Polysaccharides. Plant Physiol. 49: 926-936 (1972)) did. After hydrolyzing each polysaccharide sample, that is, the fractions, each constituent sugar was derivatized with alditol acetate and analyzed using GC (Gas Chromatography).

Specifically, first, the polysaccharide sample, which is the MCP, MCP-G, MCP-GS, MCP-AX, MCP-AX1, MCP-AX2 polysaccharide fraction obtained in Example 1 and Example 3 described later, was treated with 2 M TFA (trifluoroacetic acid). It was hydrolyzed by reacting at 121°C for 1.5 hours. Afterwards, the hydrolyzate was dissolved in 1 mL of 1 M NH ₄ OH (Ammonia solution) and reduced with 10 mg of NaBH ₄ for 4 hours. Then, an appropriate amount of acetic acid was added to remove the remaining NaBH ₄ , and then methanol was added and repeated drying was performed to remove the excess acetic acid and convert it into alditol corresponding to each constituent sugar. Afterwards, 1 mL of acetic anhydride was added to each alditol and reacted at 121°C for 30 minutes to convert it into alditol acetate. This was separated and extracted using a chloroform/H ₂ O two-phase solvent system, and the extract was dried and dissolved in a small amount of acetone. It was used as a sample for GC analysis. The GC analysis conditions for alditol acetate derivatives are shown in Table 1, and the mole% for each component was calculated by calculating the peak area, molecular weight, and molecular response factor for FID (Flame ionization detector) of each derivative.

The chemical composition and sugar analysis results of the crude polysaccharide fraction isolated from corn are shown in Table 2 below.

First, as a result of analyzing the chemical composition of MCP, a crude polysaccharide isolated from corn steep liquor (CSL), 70.7% of neutral sugar, 0.9% of acidic sugar, and 28.4% of protein were detected. In addition, MCP was hydrolyzed and converted to an alditol acetate derivative, and the sugars were analyzed. As a result, MCP was glucose (46.8%), arabinose (11.7%), and xylose (7.0%). It contained a high proportion, and trace amounts of mannose and galactose were detected. It was confirmed that MCP is a crude polysaccharide in which highly branched phytoglycogen (alpha-glucan, arabinoxylan) and trace amounts of pectin are mixed.

As a result of examining the chemical properties of MCP-AX, a supernatant fraction obtained from 50% ethanol treatment, MCP-AX was mainly composed of 81.0% neutral sugar, 9.5% acidic sugar, and 9.5% protein. Meanwhile, it did not contain the KDO substance that is detected when rhamnogalacturonan II derived from Pectin is present in plants. In addition, analysis of the constituent sugars of MCP-AX showed that it was composed of glucose (33.5%), arabinose (22.3%), and xylose (14.3%), and trace amounts of galactose and mannose were detected.

To determine the general chemical properties of MCP-AX1, its constituent sugars were analyzed. As a result, MCP-AX1 was mainly composed of 88.9% neutral sugars and 9% acidic sugars, and contained small amounts of proteins and KDO substances detected in plant extracts. Meanwhile, MCP-AX1 and MCP-AX2 were hydrolyzed and converted into alditol acetate derivatives and their constituent sugars were analyzed. As a result, MCP-AX1 contained arabinose and xylose in high proportions of 37.9% and 29.8%, respectively, and other glucose It contained small amounts of uronic acid and other constituent sugars.

These results mean that MCP-AX1 contains a high proportion of arabinoxylan, a type of hemicellulose, among the cell wall polysaccharides present in corn. MCP-GS was also analyzed for its constituent sugars using the same method as above.

Example 3: Purification of corn arabinoxylan MCP-AX

In order to identify the active structure of MCP-AX, the corn-derived arabinoxylan obtained in Example 1, corn arabinoxylan was purified according to the following process. First, the MCP-AX fraction, which is a freeze-dried product of the supernatant separated using a solution of distilled water (DIW) and ethanol in a 1:2 volume ratio, was dissolved in a small amount of water and equilibrated with 50 mM ammonium formate buffer (pH 5.5). It was purified by gel permeation chromatography (GPC) using a Sephadex G-100 column (4 × 120 cm). The eluate obtained as a result of GPC was fractionated into 120 fractions of 5 mL each. Each fraction was recovered through analysis of neutral sugar and protein content, and polysaccharide fraction MCP-AX1 with a molecular weight of 80 kDa and MCP-AX2 with a molecular weight of 4 kDa were obtained. The recovered fraction was then dialyzed to remove substances that did not meet the molecular weight standards, and then concentrated again using a rotary vacuum concentrator, and then lyophilized to recover the freeze-dried product. The recovered freeze-dried material was used for testing.

Example 4-1: Measurement of molecular weight distribution of MCP-AX1 and MCP-AX2

High performance liquid chromatography (HPLC) was performed using a superdex 200 GL column to measure the molecular weight distribution of MCP-AX purified from corn steep liquor (CSL). As a result of checking the molecular weight distribution of MCP-AX, it was found that MCP-AX mostly contained a high proportion of arabinoxylan compared to MCP. The molecular weight of MCP-AX1 was approximately 80 kda, and that of MCP-AX2 was 4 kda (Figure 2).

Example 4-2: Determination of structure and binding position of MCP-AX1 by methylation analysis

In order to analyze the structure of MCP-AX1, which showed the highest activity, methylation analysis was performed to determine the binding site of the polysaccharide sample by partially modifying the Hakomori method (Hakomori, 1964). 1 mL of anhydrous DMSO (dimethylsulfoxide) was added to 1 mg of the freeze-dried polysaccharide sample and dissolved. Afterwards, 500 μL of methylsulfinyl carbanion (MSCA), synthesized in the laboratory using NaOH and DMSO, was added and reacted for 4 hours. If necessary, MSCA was added repeatedly several times to ensure that the polysaccharide was completely converted to polyalkoxide, and the remaining amount was checked with triphenylmethane. Methylated polysaccharide was recovered through several steps using a Sep-Pak C18 cartridge (Waters Associates, Milford, MA, USA). The methylated sample was hydrolyzed by adding 1 mL of 2 M TFA and reacting at 121°C for 90 minutes, followed by drying. Afterwards, it was converted to partially methylated alditol acetate through a reduction process and acetylation process. This was separated and extracted using a two-phase solvent system (chloroform, H ₂ O), dissolved in acetone, and analyzed by GC and GC-MS. GC analysis used gas chromatography (ACME6100, Young-Lin Co., Ltd., Anyang, Korea) equipped with a capillary column (SP-2380, 0.25 mm × 30 m, 0.2 μm film thickness; Supelco, Bellefonte, USA). It was carried out. Splitless injection mode (1/) under optimal temperature conditions for GC analysis [60 ℃ (1 min), 60 ℃ → 180 ℃ (30/min), 180 ℃ → 250 ℃ (1.5/min), 250 ℃ (5 min)] 20), and the flow rate of carrier gas (N ₂ ) was adjusted to 1.5 mL/min. Meanwhile, GC-MS was performed in splitless injection mode (He flow rate) under the same optimal temperature conditions as GC analysis using an Agilent 6890N GC system equipped with a SP-2380 capillary column and a 5973N mass spectrophotometer (Agilent Technologies, Palo Alto, CA, USA). : 1.5 mL/min). Derivatives of methylated samples were identified by combining fragment ion analysis by GC-MS and relative retention time of GC, and the mole% of each peak was converted from the peak area and molecular response coefficient (Sweet et al., 1975).

Through this, it was confirmed that MCP-AX1 is an arabinoxylan with a specific structure. Specifically, in MCP-AX1, a total of 8 types of sugar chains participated in the binding, and arabinose binding and xylose binding were confirmed at a high rate. In particular, in the case of arabinose residues, terminal-Araf was detected at a high rate (12.2%). This fact indicates that there is a lot of arabinose present at the non-reducing terminal, and therefore arabinose is present in the side chain. It could be assumed that it was highly branched. From the fact that 2-linked-Araf and 5-linked-Araf exist in high proportions, it was assumed that the side chain made of arabinose constitutes the non-reducing end in the form of 1 → 2 bond and 1 → 5 bond. In the case of xylose residues, 4-linked Xylp, 3,4-branched Xylp, and 2,3,4-branched Xylp were detected at high rates. From these results, it can be seen that the main chain of MCP-AX1 exists in the form of xylan with a (1→4) bond, and a single side chain extends from the C3 position of xylose or C2 and C3. It is expected to extend into two side chains at the same location. Therefore, the immune activity of MCP-AX1 was determined to be due to highly branched arabinoxylan.

Example 5: Analysis of anti-inflammatory effect of corn arabinoxylan fraction

The anti-inflammatory effect of the polysaccharide fraction obtained in Example 1 was evaluated. Nitric oxide (NO) production inhibitory activity was measured using RAW 264.7 murine macrophage cells. Additionally, MTT (Dimethylthiazaolyl diphenyltetrazolium salt) assay was performed to evaluate the cytotoxicity of the test substance.

Example 5-1: Cell culture

RAW 264.7 murine macrophage cells were cultured in DMEM medium (dulbecco's modified eagle's medium, GIBCO, GIBCO) containing 1% penicillin-streptomycin and 10% fetal bovine serum (FBS). Grand Island, YY, USA) was used and cultured at 37°C and 5% CO ₂ incubator conditions.

Example 5-2: Measurement of NO production inhibitory activity and cytotoxicity evaluation of corn polysaccharide fraction

The RAW 264.7 cells cultured in Example 5-1 were dispensed into a 96-well plate to have a cell number of (1*10 ⁵ cells/well, 100 μl per well), and incubated for 24 hours under 37°C and 5% CO ₂ incubator conditions. Cultured. After incubation, the medium was removed, washed with Phosphate Buffered Saline (PBS), and then replaced with medium containing 1 μg/mL LPS (lipopolysaccharides). After replacing the medium containing LPS, the polysaccharide fraction samples were treated at concentrations of 100 μg/mL and 200 μg/mL, respectively, and cultured for 24 hours. After culturing for 24 hours, the amount of NO produced was measured in the form of NO ₂ present in the cell culture medium using Greiss reagent (1% sulfanilamide, 0.1% naphthylethylenediamine in 2.5% phosphoric acid). In a 96-well plate, 100 μl of the cell culture medium cultured for 24 hours and 100 μl of Griess reagent were mixed and reacted for 10 minutes, and then the absorbance was measured at 540 nm using a microplate reader. The amount of NO produced was compared after creating a calibration curve using sodium nitrite (NaNO ₂ ).

Meanwhile, for the MTT assay, the remaining cell culture fluid used in the NO production inhibition activity experiment was diluted with the polysaccharide fraction in the medium at a double concentration of 100 μg/mL and 200 μg/mL, respectively, and treated with 100 μl each ( The final concentration was 1X) and cultured for 24 hours. After 24 hours, 100 μl of the supernatant was transferred and discarded, treated with 10 μl of MTT solution, and cultured for 3 hours. Afterwards, cells were thawed by culturing with 100 μl of MTT stopping solution containing SDS (sodium dodecyl sulfate), formazan was dissolved in DMSO, and cytotoxicity was measured by measuring the absorbance using a microplate reader at 570 nm. evaluated. Cytotoxicity was calculated by the following equation.

Cell viability (%)=(A _sample /A _control )×100

Absorbance of formazan formed after treatment with A _sample solvent (no sample added)

Absorbance of formazan formed after processing A _control sample

The NO production inhibitory activity measurement and cytotoxicity evaluation results of the corn polysaccharide fraction are summarized in Table 3 below.

As a result of measuring the inhibition activity of NO production, an inflammatory factor, MCP-AX1 and MCP-AX, whose main ingredient is arabinoxylan, showed an excellent NO production inhibition effect, unlike other polysaccharide fractions, even when administered simultaneously with LPS, a strong inflammatory factor. . In particular, in the case of MCP-AX1, not only was there no cytotoxicity, but the NO production inhibition rate also increased by 33% and 44%, respectively, in a concentration-dependent manner, confirming that it has a strong NO production inhibition effect.

Example 6: Measurement of TNF-α and iNOS production inhibitory activity according to the concentration of polysaccharide fraction

The RAW 264.7 cells cultured in Example 5-1 were distributed in a 12-well plate at a cell count of 1*10 ⁶ cells/well, 1 ml per well, and cultured for 18 hours under 37°C and 5% CO ₂ incubator conditions. After incubation, the medium was removed, washed with Phosphate Buffered Saline (PBS), and then replaced with medium containing 1 μg/mL LPS (lipopolysaccharides). After replacing the medium containing LPS, the polysaccharide fraction sample was treated at a concentration of 200 μg/mL and cultured for 24 hours. Cells were lysed using TRIzol, and RNA was isolated by adding BCP to separate RNA into the supernatant. Afterwards, cDNA was synthesized at a concentration of 1000 ng/μl. After mixing RT-PCR premix, DEPC, Primer (Forward, Reverse), and cDNA, PCR was performed using a thermocycler.

GAPDH F 5' TCTCTGCTCCTCCCTGTTCC 3'

GAPDH R 5' TACGGCCAAATCCGTTCACA 3'

iNOS F 5' CGAAACGCTTCACTTCCAA 3'

iNOS R 5' TGAGCCTATATGCTGTGGCT 3'

TNF-α F 5' TGCCTATGTCTCAGCCTCTT 3'

TNF-α R 5' GAGGCCATTTGGGAACTTCT 3'

The results of measuring the TNF-α and iNOS production inhibitory activities of the polysaccharide fraction are summarized in Table 4 below.

The degree of inhibitory activity on gene expression of inflammatory factors TNF-α and iNOS was analyzed by comparing it with the LPS-treated group, which is the control group. As a result of measuring the inhibitory activity of TNF-α and iNOS gene expression according to the concentration of the polysaccharide fraction, it was confirmed that the expression of TNF-α and iNOS genes was significantly reduced in a concentration-dependent manner within the non-cytotoxic concentration range. In particular, in the case of MCP-AX1, multifunctional efficacy was confirmed by inhibiting the production of TNF-α, a powerful inflammatory factor, by more than 20% and reducing iNOS gene expression by 13% even when treated simultaneously with LPS. It was confirmed that this was a very superior effect compared to other polysaccharide components derived from corn.

Example 7: Evaluation of the effect of corn polysaccharide fraction on intestinal mucus secreting cells (LS 174T, a human intestinal goblet cell line)

Example 7-1: Mucus secreting cell (goblet cell) culture

LS174T cells, a human colon epithelial cell line, were used to confirm mucin expression levels. LS 174T cells were used by culturing in RPMI-1640 containing 10% FBS, 100 unit/mL penicillin, and 100μg/mL streptomycin in a 5% CO ₂ -95% air incubator condition.

Example 7-2: Cytotoxicity evaluation (MTT assay)

The cultured LS174T cells were distributed to a 96-well plate to reach a cell number of (3*10 ⁵ cells/well, 100 μl per well) and cultured for 24 hours at 37°C and 5% CO ₂ incubator conditions. After incubation, the medium was removed, washed with Phosphate Buffered Saline (PBS), and the medium was exchanged. Afterwards, the fraction samples were each treated at a concentration of 100 μg/mL and incubated for 24 hours. After culturing for 24 hours, 100 μl of the cell culture supernatant was transferred and discarded, then treated with 10 μl of MTT solution and cultured for 3 hours. Afterwards, cells were lysed by culturing with 100 μl of MTT stopping solution containing SDS (sodium dodecyl sulfate), formazan was dissolved in DMSO, and cytotoxicity was evaluated by measuring the absorbance using a microplate reader at 570 nm. did. Cytotoxicity was calculated by the following equation.

Cell viability (%)=(A _sample / A _control )X100

Absorbance of formazan formed after treatment with A _sample solvent (no sample added)

Absorbance of formazan formed after processing A _control sample

Example 7-3: Evaluation of MUC2 expression level in intestinal mucus secreting cells (LS174T cell line)

LS174T cells, a human colon epithelial cell line, were used to confirm mucin expression levels. Propionate, a SCFA, was used as a positive control for comparison. LS174T cells ^{( 3} Cells were lysed using TRIzol, and RNA was isolated by adding BCP to separate RNA into the supernatant. Afterwards, cDNA was synthesized at a concentration of 1000ng/μl. After mixing RT-PCR premix, DEPC, Primer (Forward, Reverse), and cDNA, PCR was performed using a thermocycler.

GAPDH F: 5'-GACAGTCAGCCGCATCTTCT 3'

GAPDH R: 5'-GCGCCCAATACGACCAAATC 3'

MUC2 F: 5`- ACCCGCACTATGTCACCTTTC-3`

MUC2 R: 5`- GGACAGGACACCTTGTCGTT-3`

The results of MUC2 expression level in intestinal mucus secreting cells (LS174T cell line) are summarized in Table 5 below.

As a result, it was confirmed that in the case of MCP-AX and MCP-AX1, which are arabinoxylan fractions among corn polysaccharide fractions, the expression of genes related to mucin production increased by 210% and 150%, respectively, compared to propionate, a positive control.

Example 8: Effect on intestinal epithelial cells (Caco2, epithelial cells) tight junction

Example 8-1: Intestinal epithelial cells (Caco2, epithelial cells) culture

Caco2 cells, a human small intestine enterocyte cell line, were used to determine tight junction protein levels. Caco2 cells were cultured at 37°C for 5 days using DMEM (Dulbecco Modified Eagle Medium, Cytiva, UT, USA) containing 1% penicillin-streptomycin and 10% fetal bovine serum (FBS). It was used by culturing under % CO ₂ incubator conditions.

Example 8-2: Cytotoxicity evaluation (MTT assay)

The Caco2 cells cultured in Example 8-1 were plated on a 96-well plate (3*10 ⁴ cells/cm ² , 100 μl per well) and incubated for 24 hours under 37°C and 5% CO ₂ incubator conditions. cultured for a while. After incubation, the medium was removed, washed with Phosphate Buffered Saline (PBS), and the medium was exchanged. Afterwards, the polysaccharide fraction samples prepared by target concentration were each treated at a concentration of 100 ㎍/mL and cultured for 24 hours. After culturing for 24 hours, 100 μl of the cell culture supernatant was transferred and discarded, treated with 10 μl of MTT solution, and cultured for 3 hours. Afterwards, cells were thawed by culturing with 100 μl of MTT stopping solution containing SDS (sodium dodecyl sulfate), formazan was dissolved in DMSO, and the absorbance was measured using a microplate reader at 570 nm to determine cytotoxicity. was evaluated. Cytotoxicity was calculated by the following equation:

Cell viability (%)=(A _sample / A _control )X100

Absorbance of formazan formed after treatment with A _sample solvent (no sample added)

Absorbance of formazan formed after processing A _control sample

Example 8-3: Evaluation of tight junction protein (occludin) expression level

Caco2, a human small intestine enterocyte cell line The cells were used to determine mucin expression levels and tight junction protein levels. Propionate, a SCFA, was used as a positive control for comparison. Caco2 cells cultured in Example 8-1 were plated in a 12 well plate (3*10 ⁴ cells/cm ² , 100 μl per well). Afterwards, overnight incubation (37°C, 5% CO ₂ ) was performed. After incubation, 500 μl of the supernatant was removed, and then 500 μl of the polysaccharide fraction dilution was treated and cultured for 24 hours. Cells were lysed using TRIzol, RNA was isolated by adding BCP to the supernatant, and then cDNA was synthesized at a concentration of 1000 ng/μl. After mixing RT-PCR premix, DEPC, Primer (Forward, Reverse), and cDNA, PCR was performed using a thermocycler.

GAPDH F 5' GACAGTCAGCCGCATCTTCT 3'

GAPDH R 5' GCGCCCAATACGACCAAATC 3'

Occludin F 5' TCCTATAAATCCACGCCGGTTTC 3'

Occludin R 5' CTCAAAGTTACCACCGCTGCTGCTG 3'

Afterwards, electrophoresis was performed on a 1% agarose gel containing EtBR (Ethidium bromide) at 100 V for 1 hour, and band intensities were compared under UV. The results of evaluating the expression level of tight junction protein (occludin) are summarized in Table 6 below.

As a result, it was confirmed that among the corn polysaccharide fractions, only MCP-AX1 increased occludin gene expression, a protein important for strengthening the intestinal wall, by 200% compared to propionate, a positive control.

Example 9: Confirmation of the effect of corn-derived polysaccharide fraction in DSS-induced colitis animal model

Example 9-1: Inflammation inhibition effect in intestinal inflammation model

A study was conducted on the inhibition and treatment effects of intestinal inflammation by active fractions containing corn-derived arabinoxylan or high-purity arabinoxylan. An experiment was conducted to induce inflammatory bowel disease (IBD) in a BALB/c mouse model using dextran sodium sulfate (DSS). For the experiment, 8-week-old male BALB/c mice were purchased and randomly divided into six groups (8 mice per group, n=8). To induce acute colitis in mice, DSS was dissolved at 5% in drinking water and fed freely to BALB/c mice for 7 days, and the normal control group (not treated; NT) was fed drinking water ad libitum. One day after receiving DSS, the normal control group and the negative control group that consumed 5% DSS alone were administered distilled water, and the sample group was administered orally once a day for 9 days by dissolving each sample in distilled water at the dosage shown in Table 1. , Changes in DAI indicators such as body weight, loose stool, presence of bloody stool, and perianal bleeding were observed at two-day intervals, and 10 days after the start of the experiment, mice were sacrificed and spleen weight, small and large intestine length were measured. The DSS-induced colitis model experiment schedule is summarized in Figure 3 and Table 7 (list of groups for evaluating efficacy in DSS-induced colitis animal model).

group Diet method Not treated (NT) group A group in which neither dextran sulfate sodium (DSS) nor samples were administered Negative control (NC) group Inflammatory growths treated with dextran sulfate sodium (DSS)
Hwan Judo Army Positive control Sulfasalazine Sulfasalazine 2.0 mg/mouse (100 mg/kg) + dextran sulfate sodium (DSS) treatment Experimental group MCP-GS MCP-GS (100mg/kg) + dextran sodium sulfate (DSS) treatment Experimental group MCP-AX MCP-AX (100mg/kg) + Dextran Sulfate Sodium (DSS) treatment Experimental group MCP-AX-I MCP-AXI (100mg/kg) + dextran sodium sulfate (DSS) treatment

The severity of colitis (disease activity index, DAI) is determined by visually checking weight loss, looseness of stool, degree of hematochezia, and presence of blood in the anus every two days, and the score written in Table 8 (Disease activity index (DAI) scoring system). It was calculated based on The measurement results are summarized and shown in Figure 4.

Since DAI is measured using weight, stool condition, and blood stain level as factors, DAI may be a more important evaluation factor. As a result of measuring the change in DAI in each administration group, the DAI score increased from the 2nd day in all groups except the normal control group, but in MCP-AX1, the DAI index did not increase but tended to be maintained after the 6th day of DSS intake, and on the 8th day. The DAI score was significantly lower than that of the negative control (NC), confirming that it had an inhibitory effect on colitis. On the other hand, other polysaccharide fractions and positive controls had little effect.

As a result of observing the body weight of the colitis-induced group due to 5% DSS intake, the negative control group (NC) showed an average weight loss of 23.4% on the 10th day of DSS intake compared to before the experiment, and the colitis treatment sulfasalazine (positive control group) used as the positive control group. (positive control, PC)) showed a weight loss of 26.4%. However, the MCP-AX1 polysaccharide fraction showed only a 17.12% weight loss. In particular, in the negative control group (NC), watery stools and bloody stools were observed in all mice, while the polysaccharide fraction had less watery stools than NC, and only occult blood was observed in three mice.

Additionally, on the 10th day of the experiment, mice were sacrificed and the length of the large intestine was measured and evaluated. On the last day of the experiment, mice were sacrificed and the length of the large intestine was measured, and the results are shown in Figure 5.

As a result of the measurement, the length of the colon of the negative control group NC, which consumed 5% DSS alone, was reduced by about 17% compared to the normal group NT, which did not consume DSS, but the MCP-AX1 polysaccharide fraction decreased by about 3% compared to the normal group NT. It was confirmed that the patient recovered to a level similar to that of the normal NT group. In particular, the MCP-AX1 polysaccharide fraction administration group had very similar colon lengths among mice within the group, confirming that the reliability of the experiment was high.

Considering the above results, the DAI score of MCP-AX1 polysaccharide fraction was reduced compared to the negative control (NC), and the length of the large intestine was relatively longer, which confirmed that it had colitis-inhibiting activity.

Example 10: Observation of histological changes in the large intestine

To perform a tissue examination after autopsy, the extracted colon was fixed in a 10% formaldehyde solution and then embedded in paraffin through a standard tissue processing process. Each embedded tissue was sectioned at 5.0 μm with a microtome (Leica, Wetzlar, Germany), alcian blue staining was performed, and each slice was treated with Canadian balsam and observed with an optical microscope (Olympus BX53 microscope (Olympus Corp., Tokyo, Japan). The results are shown in Figure 6.

As a result, in the group treated with DSS (dextran sodium sulfate), tissue damage due to inflammation was severe, the inflammation extended to the mucous membrane, and the entire intestinal gland and epithelial cells were severely damaged. However, this damage was significantly reduced in the MCP-AX and MCP-AX1 groups, which are the colitis treatment sulfasalazine (PC) and arabinoxylan fraction used as a positive control group, and in particular, the experimental group MCP-AX1 showed markedly recovered tissue. was able to discover.

Claims (14)

When measured by gel permeation chromatography, the molecular weight is 70-90 kDa, the content of arabinose and xylose is more than 35% by weight, and it is a polysaccharide containing xylan in the main chain and arabinose in the side chain, Arabinose is an arabinoxylan derived from corn, characterized by 4-O-Methyl-D-glucuronic Acid, Acetyl ferulic acid, or hexose sugar connected to the terminal. . A composition for the treatment or prevention of inflammatory bowel disease (IBD) or irritable bowel syndrome (IBS), comprising the corn-derived arabinoxylan of claim 1 as an active ingredient. The composition of claim 2, wherein the composition is for treating or preventing inflammatory bowel disease. The composition of claim 3, wherein the inflammatory bowel disease is ulcerative colitis (UC) or Crohn's disease (CD). (S1) immersing corn in a weak acid aqueous solution;
(S2) Concentrating the corn steeping liquid and adding ethanol thereto;
(S3) recovering the precipitate by centrifuging the mixed solution of step S2;
(S4) adding an aqueous ethanol solution to the precipitate from step S3 and centrifuging to recover the supernatant; and
(S5) comprising the step of fractionating the supernatant of step S4 or its concentrate according to molecular weight or size,
A method for producing a composition for the treatment or prevention of inflammatory bowel disease (IBD) or irritable bowel syndrome (IBS), comprising corn-derived arabinoxylan as an active ingredient. The method of claim 5, wherein the weak acid is at least one selected from the group consisting of formic acid, acetic acid, benzoic acid, oxalic acid, hydrofluoric acid, nitrous acid, sulfurous acid, and phosphoric acid. The production method according to claim 5, wherein the step (S1) of immersing corn in a weak acid aqueous solution uses an aqueous solution in which 0.1-0.5% by weight, preferably 0.1-0.3% by weight, of sulfur dioxide is dissolved in water. The production method according to claim 5, wherein the fractionation in step (S5) is a polysaccharide fraction having a molecular weight of 70-90 kDa recovered by gel permeation chromatography. The method of any one of claims 5 to 8, wherein the arabinoxylan obtained by the above production method has a molecular weight of 70-90 kDa when measured by gel permeation chromatography, and the arabinose and xylose contents are It is more than 35% by weight and is a polysaccharide containing xylan in the main chain and arabinose in the side chain, and arabinose is 4-O-Methyl-D-glucuronic Acid and acetyl ferulic acid at the ends. (Acetyl ferulic acid) or hexose sugar linked, manufacturing method. (S1) immersing corn in a weak acid aqueous solution;
(S2) Concentrating the corn steeping liquid and adding ethanol thereto;
(S3) recovering the precipitate by centrifuging the mixed solution of step S2;
(S4) adding an aqueous ethanol solution to the precipitate from step S3 and centrifuging to recover the supernatant; and
(S5) comprising the step of fractionating the supernatant of step S4 or its concentrate according to molecular weight or size,
Method for producing arabinoxylan useful for treating or preventing inflammatory bowel disease or irritable bowel syndrome. The method of claim 10, wherein the weak acid is at least one selected from the group consisting of formic acid, acetic acid, benzoic acid, oxalic acid, hydrofluoric acid, nitrous acid, sulfurous acid, and phosphoric acid. The method of claim 10, wherein the step (S1) of immersing the corn in a weak acid aqueous solution involves dissolving 0.1-0.5% by weight, preferably 0.1-0.3% by weight, of sulfur dioxide in water. The production method according to claim 10, wherein the fractionation in step (S5) is a polysaccharide fraction having a molecular weight of 70-90 kDa recovered by gel permeation chromatography. The method of any one of claims 10 to 13, wherein the arabinoxylan obtained by the above production method has a molecular weight of 70-90 kDa when measured by gel permeation chromatography, and the arabinose and xylose contents are It is more than 35% by weight and is a polysaccharide containing xylan in the main chain and arabinose in the side chain, and arabinose is 4-O-Methyl-D-glucuronic Acid and acetyl ferulic acid at the ends. (Acetyl ferulic acid) or hexose sugar linked, manufacturing method.