KR20240108819A - Pharmaceutical composition for preventing or treating degenerative brain diseases comprising salicylic acid derivative as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating degenerative brain diseases containing a salicylic acid derivative as an active ingredient, and one of the derivatives, 2-hydroxy-5-[[2-(2-naphtha Renyloxy)ethyl]amino]benzoic acid (2-Hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino]benzoic acid) compound promotes acetylcholine production and inhibits acetylcholinesterase activity. , it can be usefully used as a composition for preventing, treating, or improving degenerative brain diseases by confirming that it has the activity of suppressing the expression of genes related to Alzheimer's dementia and suppressing amyloid-beta deposition.

Description

Pharmaceutical composition for preventing or treating degenerative brain diseases comprising salicylic acid derivative as an active ingredient}

The present invention relates to a pharmaceutical composition for preventing or treating degenerative brain diseases containing a salicylic acid derivative as an active ingredient.

Degenerative brain disease refers to a disease that occurs in the brain among the degenerative diseases that occur with age. It can be distinguished by considering the main symptoms and brain area affected. Representative examples include Alzheimer's disease and frontotemporal dementia. ), Lewy body dementia, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, etc. Degenerative brain diseases are known to be caused by the death of nerve cells due to the aggregation of specific proteins for each disease due to neurodegeneration due to aging and genetic and environmental factors. Basic research is actively underway.

Alzheimer's disease develops slowly due to memory loss and progresses to a gradual and extensive loss of cognitive functions, such as loss of visuospatial ability, language impairment, and executive ability impairment, resulting in dementia symptoms that make it impossible to independently perform daily activities. Although the pathological mechanism has not yet been accurately identified, it is reported to be due to the interaction between aging, genetic risk factors, and environmental factors.

According to the results of analysis by dementia-related organizations such as the Ministry of Health and Welfare, National Health Insurance Corporation, Health Insurance Review and Assessment Service, Social Security Information Service, and Statistics Korea, the number of dementia patients is estimated to be more than 700,000 at the end of 2017, and annual management per dementia patient is estimated to be over 700,000. The cost is approximately 20.74 million won, and the national dementia management cost is approximately 14.6 trillion won. Currently, the prevention, diagnosis, and management of dementia uses surveys such as clinical questionnaires or expensive examinations such as PET-CT, and biological samples such as cerebrospinal fluid are required for diagnosis and management after the onset of dementia. Therefore, the pain suffered by patients is adding to the burden of management costs. Moreover, the number of patients and costs are expected to continue to increase as the society ages, and considering the additional social costs resulting from this, it is a huge burden for the country.

1. Republic of Korea Patent No. 10-1934527 (published on December 27, 2018)

The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating degenerative brain diseases containing a salicylic acid derivative as an active ingredient.

Another object of the present invention is to provide a health functional food composition for preventing or improving degenerative brain diseases containing the above derivative as an active ingredient.

Another object of the present invention is to provide a health functional food composition for improving cognitive function or memory containing the above derivative as an active ingredient.

In order to achieve the above object, the present invention is 2-hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino]benzoic acid (2-Hydroxy-5-[[2) represented by the following formula (1) Provided is a pharmaceutical composition for preventing or treating degenerative brain disease, comprising -(2-naphthalenyloxy)ethyl]amino]benzoic acid) compound or a pharmaceutically acceptable salt thereof as an active ingredient.

[Formula 1]

In addition, the present invention provides a health functional food composition for preventing or improving degenerative brain disease, comprising the compound represented by Formula 1 or a foodologically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a health functional food composition for improving cognitive function or memory, comprising the compound represented by Formula 1 or a foodologically acceptable salt thereof as an active ingredient.

According to the present invention, 2-Hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino]benzoic acid (2-Hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino]benzoic acid prevention of degenerative brain disease, by confirming that the compound promotes acetylcholine production, inhibits acetylcholinesterase activity, inhibits the expression of genes related to Alzheimer's dementia, and inhibits amyloid-beta deposition. It can be usefully used as a composition for treatment or improvement.

Figure 1 shows 2-Hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino]benzoic acid; This is a graph showing the results of cytotoxicity analysis after treating the compound (hereinafter referred to as KBN-2202) to Neuro2a cells (*: cases where there is a significant difference in survival rate compared to the control group) (p<0.05).
Figure 2 is a graph showing the results of analyzing changes in acetylcholine (acetylcholine; hereinafter referred to as Ach) and acetylcholinesterase (hereinafter referred to as AchE) activities after treating Neuro2a cells with compound KBN-2202 (* : Case showing a significant difference compared to the control group) (*, p<0.05; ***, p<0.001).
Figure 3 is a graph showing the results of analyzing changes in nitric oxide (nitrite; hereinafter referred to as NO) production after treating Neuro2a cells with compound KBN-2202 (*: cases where NO production shows a significant difference compared to the control group) (p<0.05).
Figure 4 is a graph showing the results of analyzing changes in expression of Alzheimer's dementia-related genes (App, Tau, Psen1, and Psen2) after treating Neuro2a cells with compound KBN-2202 (*: significant difference in gene expression compared to the control group) (p<0.05).
Figure 5 is a graph showing the results of analyzing changes in behavioral ability through a Y-maze experiment after administering compound KBN-2202 to a dementia-induced mouse model (*: When the effect of improving cognitive function shows a significant difference compared to the control group )(p<0.05).
Figure 6 is a graph showing the results of analyzing changes in amyloid-beta deposition after administering compound KBN-2202 to a dementia-induced mouse model.

Hereinafter, the present invention will be described in more detail.

The present invention relates to 2-hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino]benzoic acid (2-Hydroxy-5-[[2-(2-naphthalenyloxy)ethyl) represented by the following formula 1: Provided is a pharmaceutical composition for preventing or treating degenerative brain diseases, comprising a ]amino]benzoic acid) compound or a pharmaceutically acceptable salt thereof as an active ingredient.

[Formula 1]

The compound or its pharmaceutically acceptable salt can promote the production of acetylcholine and inhibit acetylcholinesterase activity.

Additionally, the compound or its pharmaceutically acceptable salt can inhibit the production of nitrite.

In addition, the compound or a pharmaceutically acceptable salt thereof can inhibit the expression of an Alzheimer's dementia-related gene, and the gene may be one or more selected from the group consisting of App, Tau, Psen1, and Psen2, but is not limited thereto.

Additionally, the compound or a pharmaceutically acceptable salt thereof can inhibit amyloid-beta deposition.

The degenerative brain diseases include Alzheimer's disease, frontotemporal dementia, Parkinson's disease, amyotrophic lateral sclerosis, progressive supranuclear palsy, and corticobasal degeneration ( It may be one or more selected from the group consisting of (corticobasal degeneration), Pick's disease, mild cognitive impairment (MCI), and dementia, but is not limited thereto.

The pharmaceutical composition of the present invention is prepared in unit dose form or in a multi-dose container by formulating it using a pharmaceutically acceptable carrier according to a method that can be easily performed by those skilled in the art. It can be manufactured by internalizing it.

The pharmaceutically acceptable carriers are those commonly used in preparation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Includes, but is not limited to, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. In addition to the above ingredients, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.

In the present invention, the content of additives included in the pharmaceutical composition is not particularly limited and can be appropriately adjusted within the content range used in conventional formulations.

The pharmaceutical compositions include injectable formulations such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, tablets, creams, gels, patches, sprays, ointments, warning agents, lotions, liniment agents, paste agents, and cataplasmase agents. It may be formulated in the form of one or more external skin preparations selected from the group consisting of, but is not limited to this.

The pharmaceutical composition of the present invention may additionally contain pharmaceutically acceptable carriers and diluents for formulation. The pharmaceutically acceptable carriers and diluents include excipients such as starch, sugar and mannitol, fillers and extenders such as calcium phosphate, cellulose derivatives such as carboxymethylcellulose, hydroxypropylcellulose, gelatin, alginate, polyvinyl pyrrolidone. It includes, but is not limited to, binders such as talc, calcium stearate, lubricants such as hydrogenated castor oil and polyethylene glycol, disintegrants such as povidone and crospovidone, and surfactants such as polysorbate, cetyl alcohol, glycerol, etc. The pharmaceutically acceptable carrier and diluent may be biologically and physiologically friendly to the subject. Examples of diluents include, but are not limited to, saline, aqueous buffers, solvents, and/or dispersion media.

The pharmaceutical composition of the present invention can be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally, or topically) depending on the desired method. For oral administration, it can be formulated as tablets, troches, lozenges, aqueous suspensions, oily suspensions, powders, granules, emulsions, hard capsules, soft capsules, syrups, elixirs, etc. In the case of parenteral administration, it can be formulated as an injection, suppository, powder for respiratory inhalation, aerosol for spray, ointment, powder for application, oil, cream, etc.

The dosage of the pharmaceutical composition of the present invention is determined by the patient's condition, weight, age, gender, health, dietary constitution specificity, nature of the preparation, degree of disease, administration time of the composition, administration method, administration period or interval, excretion rate, and The range may vary depending on the drug form and can be appropriately selected by a person skilled in the art. For example, it may range from about 0.1 to 10,000 mg/kg, but is not limited and may be administered once or in divided doses several times a day.

The pharmaceutical composition may be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally, or topically applied) depending on the desired method. The pharmaceutically effective amount and effective dosage of the pharmaceutical composition of the present invention may vary depending on the formulation method, administration method, administration time, administration route, etc. of the pharmaceutical composition, and those skilled in the art will know that it is effective for the desired treatment. Dosage can be easily determined and prescribed. The pharmaceutical composition of the present invention may be administered once a day, or may be administered in several divided doses.

In addition, the present invention relates to 2-hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino]benzoic acid (2-Hydroxy-5-[[2-(2-naphthalenyloxy) represented by the following formula 1: )ethyl]amino]benzoic acid) compound or a foodologically acceptable salt thereof as an active ingredient, and provides a health functional food composition for preventing or improving degenerative brain disease.

In addition, the present invention relates to 2-hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino]benzoic acid (2-Hydroxy-5-[[2-(2-naphthalenyloxy) represented by the following formula 1: )ethyl]amino]benzoic acid) compound or a foodologically acceptable salt thereof as an active ingredient, and provides a health functional food composition for improving cognitive function or memory.

[Formula 1]

The present invention can be generally used with commonly used foods.

The food composition of the present invention can be used as a health functional food. The term “health functional food” refers to food manufactured and processed using raw materials or ingredients with functionality useful to the human body in accordance with the Health Functional Food Act, and “functional” refers to food that is related to the structure and function of the human body. It means ingestion for the purpose of controlling nutrients or obtaining useful health effects such as physiological effects.

The health functional food composition may contain common food additives, and its suitability as a “food additive” is determined in accordance with the general provisions and general test methods of the food additive code approved by the Ministry of Food and Drug Safety, unless otherwise specified. The decision is made based on the specifications and standards for the item.

Items listed in the “Food Additives Code” include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid; natural additives such as subchromic pigment, licorice extract, crystalline cellulose, high-liquid pigment, and guar gum; Examples include mixed preparations such as sodium L-glutamate preparations, noodle additive alkaline preparations, preservative preparations, and tar coloring preparations.

The food composition of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. For example, among health functional foods in the form of capsules, hard capsules can be manufactured by mixing and filling the composition according to the present invention with additives such as excipients in a regular hard capsule, and soft capsules can be manufactured by mixing and filling the composition according to the present invention. It can be manufactured by mixing with additives such as excipients and filling it with a capsule base such as gelatin. The soft capsule may contain plasticizers such as glycerin or sorbitol, colorants, preservatives, etc., if necessary.

Definitions of terms such as excipients, binders, disintegrants, lubricants, coagulants, flavoring agents, etc. are described in literature known in the art and include those with the same or similar functions. There is no particular limitation on the type of food, and it includes all health functional foods in the conventional sense.

In the present invention, the term “prevention” refers to all actions that suppress or delay the degenerative brain disease by administering the composition according to the present invention.

In the present invention, the term “treatment” refers to all actions that improve or beneficially change the degenerative brain disease by administering the composition according to the present invention.

In the present invention, the term “improvement” refers to any action that improves the bad condition of the degenerative brain disease by administering the composition according to the present invention.

Hereinafter, the present invention will be described in detail through examples to aid understanding. However, the following examples only illustrate the content of the present invention and the scope of the present invention is not limited to the following examples. Examples of the present invention are provided to more completely explain the present invention to those skilled in the art.

[ Experiment example 1] Experiments related to cognitive function ( in vitro )

1-1. cell culture

Neuro2a cells derived from mouse neuroblastoma were purchased from ATCC (American Type Culture Collection), and MEM (minimum essential medium) containing 10% fetal bovine serum (FBS) was added and incubated at 37°C. Cultured under 5% CO ₂ conditions. When the cell density reached 70-80% confluence, the cells were subcultured using 0.25% trypsin/EDTA.

1-2. Measurement of cell viability

To confirm the cytotoxicity of compound KBN-2202, cell viability was measured using Cell Counting Kit-8 (CCK-8; Dojindo). Neuro2a cells were distributed in a 96-well plate at a concentration of 5,000 cells per well and cultured for 24 hours. Afterwards, the cells were washed with 1 ) and cultured for 24 hours. Afterwards, 10 μl of CCK-8 solution was added to each well, reacted at 37°C for 2 hours, and cell viability was analyzed by measuring absorbance at 450 nm.

1-3. Ah generative analysis

To confirm changes in Ach production through KBN-2202 treatment, Neuro2a cells were suspended at 1.5 × 10 ⁵ /ml in MEM medium containing 10% FBS, 10 ml was dispensed into a 100 mm dish, and cultured for 24 hours. Afterwards, the cells were washed with 1×PBS, treated with 10 μM KBN-2202, and cultured for 24 hours. Afterwards, the cell pellet harvested with 0.25% trypsin/EDTA was repeatedly frozen and thawed in liquid nitrogen to lyse the cells. The cell suspension was pipetted by adding 1×PBS, left on ice for 5 minutes, and then centrifuged at 12,000×g and 4°C for 30 minutes. The supernatant was obtained and protein was quantified using the Bradford method. Mix 50 μl of each total protein (1 μg/μl) extracted from the control group (untreated group) and KBN-2202 treated group and 50 μl of 1% hydroxylamine, and adjust to pH 1.2 ± 0.2 using hydrochloric acid (HCl). Adjusted. Afterwards, 50 μl of 10% iron(III) chloride (FeCl ₃ ) dissolved in 0.1 N hydrochloric acid was added, shaken sufficiently, and absorbance was measured at 490 nm.

1-4. AchE Degradative enzyme activity analysis

To confirm changes in AchE activity through KBN-2202 treatment, approximately 1 × 10 ⁷ cultured Neuro2a cells were harvested, and the cell pellet was added with 1 ml of homogenization buffer [1M sodium chloride (NaCl), 50mM magnesium chloride (MgCl ₂ )]. and 1% Triton X-100 (pH 7.2)] was added. The cells were sufficiently released, left on ice for 5 minutes, and then centrifuged for 30 minutes at 12,000 × g and 4°C. The supernatant was obtained and protein was quantified using the Bradford method. 10 μl of protein solution was mixed with 10 μl of 0.02% DMSO (solvent of KBN-2202) or KBN-2202, and reacted at 37°C for 15 minutes. Afterwards, 70 μl of 0.5mM Ellman's reaction solution (0.5mM Ach iodide and 1mM DTNB (5,5′-dithiobis-(2-nitrobenzoic acid)) was added and reacted for 10 minutes at 37°C. The reaction solution was examined at 405nm. Absorbance was measured.

1-5. NO production assay

To confirm the change in NO production through KBN-2202 treatment, Neuro2a cells were suspended at 2×10 ⁵ /ml in MEM medium (containing 10% FBS) without phenol red, and cultured in a 6-well plate. After dispensing 2ml each, the cells were cultured for 24 hours. After washing the cells with PBS, phenol red-free MEM medium containing KBN-2202 diluted to a concentration of 10 μM was added to the cells. Cells were cultured at 37°C and 5% CO ₂ for 4 hours, 1 μg/ml LPS was added, and then cultured at 37°C and 5% CO ₂ for an additional 20 hours. The culture supernatant was recovered and the amount of NO was measured using the Griess reagent system (Promega) according to the manufacturer's manual.

1-6. Real-time RT- PCR Dementia-related gene expression analysis through

To confirm changes in dementia-related gene expression through KBN-2202 treatment, Neuro2a cells were treated with KBN-2202 at a concentration of 10 μM, cultured for 24 hours, and the cells were harvested to detect Alzheimer's dementia-related genes (App, Tau, Psen1 and Psen2) expression changes were analyzed. Total RNA was extracted from cells using Trizol ^TM reagent (Thermo Fisher Scientific) according to the manufacturer's manual. The concentration and purity of the extracted RNA were measured using NanoDrop (Thermo Fisher Scientific), and then cDNA was synthesized using Enzynomics' TOPscript ^TM . After mixing the synthesized cDNA, primers for each gene, and TB Green Premix Ex Taq ii (Tli RNaseH Plus) (TaKaRa), quantitative PCR (hereinafter referred to as qPCR) was performed using QuantStudio ^ⓡ 3 Real-Time PCR (Thermo Fisher Scientific). ) was performed. Specifically describing the qPCR process, the sample was denatured at 95°C for 10 minutes (1 cycle) in the QuantStudio ^ⓡ 3 Real-Time PCR system, and annealed at 95°C for 15 seconds and 60°C for 1 minute for amplification. After (40 cycles), the final melting curve was denatured at 95°C for 15 seconds, dissociated at 60°C for 1 minute, and again at 95°C for 15 seconds. Data were analyzed using the 2 ^{- ΔΔCT} method. The primers used in the experiment are listed in Table 1 below.

gene Forward(5′-3′) Reverse(5′-3′) Amplicon size (bp) Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA 123 App TCCGAGAGGTGTGCTCTGAA CCACATCCGCCGTAAAAGAATG 115 Psen1 GGTGGCTGTTTTATGTCCCAA CAACCACACCATTGTTGAGGA 112 Psen2 GAAGACTCCTACGACAGTTTTGG CACCAGGACGCTGTAGAAGAT 150 Tau CGCCCCTAGTGGATGAGAGA GCTTCTCGGTGTAATTCCTT 88

[ Experiment example 2] Experiments related to cognitive function ( in vivo )

2-1. laboratory animals

The experimental animals were 12 male 5xFAD mice, randomly divided into 2 groups (control group and KBN-2202 administration group) (n=6), and used after acclimatization for 7 days in the animal room of Gyeongsang National University. Experimental animals were raised in a breeding room where temperature (22 ± 2°C) and light/dark cycle (12-hour cycle) conditions were maintained constant, and feed and water were supplied without restrictions during the adaptation period. All animal experiments were performed with approval from the Institutional Animal Care and Use Committee (IACUC) of Gyeongsang National University (IACUC approval number: GNU-221012-M0133).

2-2. test solution administration

A test solution was prepared by dissolving KBN-2202 at a concentration of 2 μg/μl in 10% DMSO. Mice in the KBN-2202 administration group were orally administered 200 μl of the test solution (containing 600 μg of KBN-2202) per mouse using an oral needle, and mice in the control group were orally administered 200 μl of 10% DMSO per mouse. The drug was administered at regular times every two days for eight weeks.

2-3. Y-maze test

To confirm the change in behavioral ability of the dementia-induced mouse model through KBN-2202 administration, a non-reflective white plastic with a 120° angle of 8cm was carried out. The camera and red light were turned on, and the animals were moved to the experimental location 10 minutes before the experiment. The experimental subject was placed in the start arm of the Y-maze, all lights except the red light were turned off, and the experimenter left the experimental site. The test subject was filmed exploring the Y-maze for 8 minutes. The test subject was moved to the cage, the Y-maze was cleaned, and then the experiment was conducted on the next test subject. Spontaneous alternation performance and alternate arm return were measured while watching the recorded video.

2-4. Immunohistochemical staining ( Immunohistochemistry )through amyloid beta deposition analysis

To confirm changes in amyloid-beta (Aβ) deposition in a dementia-induced mouse model through KBN-2202 administration, mouse brain tissue was fixed in 10% neutral buffered formalin (NBF), and the fixed tissue was washed and washed with water. After going through the dehydration process, paraffin embedding was performed to create a block, and the block tissue was cut into pieces with a thickness of 4 μm and attached to a probe-on plus slide (Thermo Fisher Scientific), followed by deparaffinization and hydration, and then washed with distilled water. Using a microwave oven, 10mM citric acid buffer (pH 6.0) was first heated for 5 minutes, then the slide was placed, heated twice for 5 minutes, antigen expression was performed, and the temperature was gradually lowered by leaving the slide at room temperature for 20 minutes. Afterwards, it was washed with Tris buffer, treated with 0.3% hydrogen peroxide solution, and washed three times with Tris buffer. To block non-specific antigens in the tissue, the cells were reacted with normal sheep serum for 30 minutes. Anti-beta amyloid (Abcam, 1:1,000), a monoclonal primary antibody, was reacted overnight at 4°C, washed three times with Tris buffer, and secondary antibody (ImmPRESS ^ⓡ HRP Horse Anti- Rabbit IgG Polymer Detection kit, Vector Laboratories) was reacted at 37°C for 30 minutes and washed with PBS. It was reacted at room temperature for 3 minutes using DAB reagent and washed with PBS. The slides were completed by counterstaining with Mayer's hematoxylin for 3 minutes and encapsulating.

[ Example 1] Cytotoxicity analysis

As a result of analyzing the cytotoxicity of KBN-2202 according to Experimental Example 1-2, it was confirmed that the cytotoxicity of KBN-2202 did not appear up to a concentration of 100 μM, as shown in Figure 1.

[ Example 2] Ah and AchE active analysis

According to Experimental Examples 1-3 and 1-4, as a result of analyzing changes in Ach and AchE activities through KBN-2202 treatment, as shown in Figure 2, Ach production was significantly (p< 0.05), and the AchE inhibitory activity was confirmed to have increased by 3.5 times compared to the untreated group at a concentration of 10 μM.

[ Example 3] NO production analysis

According to Experimental Example 1-5, as a result of analyzing the change in NO production through KBN-2202 treatment, as shown in Figure 3, NO production significantly increased in the LPS-only treatment group, while the LPS and KBN-2202 treatment group It was confirmed that NO production was reduced compared to the LPS-only treatment group and that NO production was lower than the control group.

[ Example 4] Analysis of gene expression related to Alzheimer's dementia

According to Experimental Examples 1-6, as a result of analyzing changes in gene expression related to Alzheimer's disease through KBN-2202 treatment, as shown in Figure 4, App, Tau, Psen1, and Psen2 in the KBN-2202 treatment group compared to the control group. It was confirmed that gene expression was significantly reduced.

[ Example 5] Behavioral ability analysis of dementia-induced mouse model

According to Experimental Example 2-3 above, as a result of analyzing the change in behavioral ability of the dementia-induced mouse model through KBN-2202 administration, as shown in Figure 5, spontaneous alteration was observed in the control group at 4 and 8 weeks after KBN-2202 administration. There was a significant increase compared to , and it was confirmed that spontaneous alteration increased more at the 8th week compared to the 4th week after administration. From the above results, it was confirmed that KBN-2202 is effective in improving cognitive function by increasing spontaneous alteration.

[ Example 6] amyloid beta deposition analysis

According to Experimental Example 2-4, as a result of analyzing changes in amyloid beta deposition in a mouse model inducing dementia through KBN-2202 administration, as shown in Figure 6, amyloid beta deposition was reduced in the KBN-2202 administration group compared to the control group. It was confirmed that From the above results, it was confirmed that KBN-2202 can inhibit amyloid beta deposition in the brain.

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. do. That is, the actual scope of the present invention is defined by the appended claims and their equivalents.

Sequence list electronic file attached

Claims (9)

2-Hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino]benzoic acid (2-Hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino] represented by the following formula 1: A pharmaceutical composition for preventing or treating degenerative brain diseases, comprising a benzoic acid compound or a pharmaceutically acceptable salt thereof as an active ingredient.
[Formula 1]
The pharmaceutical composition according to claim 1, wherein the compound or a pharmaceutically acceptable salt thereof promotes the production of acetylcholine and inhibits acetylcholinesterase activity. The pharmaceutical composition according to claim 1, wherein the compound or a pharmaceutically acceptable salt thereof inhibits the production of nitrite. The pharmaceutical composition according to claim 1, wherein the compound or a pharmaceutically acceptable salt thereof inhibits expression of genes related to Alzheimer's disease. The pharmaceutical composition according to claim 4, wherein the gene is one or more selected from the group consisting of App, Tau, Psen1, and Psen2. The pharmaceutical composition according to claim 1, wherein the compound or a pharmaceutically acceptable salt thereof inhibits amyloid-beta deposition. The method of claim 1, wherein the degenerative brain disease includes Alzheimer's disease, frontotemporal dementia, Parkinson's disease, amyotrophic lateral sclerosis, and progressive supranuclear palsy. , Corticobasal degeneration, Pick's disease, mild cognitive impairment (MCI), and dementia. 2-Hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino]benzoic acid (2-Hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino] represented by the following formula 1: A health functional food composition for preventing or improving degenerative brain disease, comprising a benzoic acid compound or a foodologically acceptable salt thereof as an active ingredient.
[Formula 1]
2-Hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino]benzoic acid (2-Hydroxy-5-[[2-(2-naphthalenyloxy)ethyl]amino] represented by the following formula 1: A health functional food composition for improving cognitive function or memory, containing a benzoic acid compound or a foodologically acceptable salt thereof as an active ingredient.
[Formula 1]