KR20240103154A - Method for preparing cells producing afucosylated protein and cells prepared by the method - Google Patents

Abstract

The present invention relates to a method for producing a non-fucosylated protein producing cell line and a cell line produced according to the method, and more specifically, to the step of inducing a mutation in exon 9 of the FUT8 (Fucosyltransferase 8) gene using the CRISPR/Cas system. It relates to a method for producing a non-fucosylated protein producing cell line comprising and a non-fucosylated protein producing cell line produced according to the method.
Using the method provided by the present invention and the cell line produced according to the method, non-fucosylated proteins can be produced very efficiently.

Description

Method for preparing cell lines producing non-fucosylated proteins and cell lines prepared according to the method {Method for preparing cells producing afucosylated protein and cells prepared by the method}

The present invention relates to a method for producing a non-fucosylated protein producing cell line and a cell line produced according to the method, and more specifically, to the step of inducing a mutation in exon 9 of the FUT8 (Fucosyltransferase 8) gene using the CRISPR/Cas system. It relates to a method for producing a non-fucosylated protein producing cell line comprising and a non-fucosylated protein producing cell line produced according to the method.

Eukaryotic glycosylation is the most common covalent post-translational protein modification mechanism and has been intensively studied for decades. Approximately 1-2% of the human transcriptome (approximately 250-500 glycogen) is predicted to translate proteins responsible for glycosylation. Glycosylation of cellular proteins performs many key biological functions, such as protein folding, stability, intra- and intercellular trafficking, cell-cell interactions, and cell-matrix interactions.

There are four groups of glycoproteins (N-linked, O-linked, glycosaminoglycans, and glycosylphosphatidylinositol-anchored proteins). N-linked glycosylation occurs through the side chain amide nitrogen of the asparagine residue and occurs in the amino acid sequence Asn-X-Ser/Thr. Here, X may be any amino acid except proline and aspartic acid. O-linked glycosylation uses an oxygen atom on the side chain of a serine or threonine residue.

Fucose (6-deoxy-L-galactose) is a monosaccharide present in many glycoproteins and glycolipids in vertebrates, invertebrates, plants, and bacteria. Fucosylation is the process of transferring fucose residues to various proteins and oligosaccharides. Fucosylation is regulated by several molecules, including fucosyltransferases, guanosine diphosphate (GDP)-fucose synthase, and GDP-fucose transporters. Many of the fucosylated glycoproteins are secreted or membrane proteins on the cell surface.

Meanwhile, the most striking change in oncology drug development over the past two decades has been the shift from classical cytotoxics to drugs that affect signaling pathways implicated in cancer, known as “monoclonal antibodies,” or mAbs. Human IgG1 antibodies are highly fucosylated glycoproteins. Two N-linked biantennary oligosaccharides consisting of a core heptasaccharide with various additions of fucose, galactose, bipartite N-acetylglucosamine and sialic acid are present at Asn-297 of IgG1. Antibody glycosylation leads to unique biological functions known as “effector functions”: antibody-dependent cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC).

The effector function of an IgG molecule is defined by the interaction of the antibody Fc region with leukocyte receptors known as FcγRs or with complement components. The composition of the oligosaccharide structure is very important for effector function through FcγR binding. Analysis of the crystal structure of human IgG1 revealed complex interactions between oligosaccharide chains and the CH2 domain.

The efficiency of the ADCC mechanism is highly dependent on the level of antibody fucosylation. The lower the fucosylation, the higher the ADCC ratio. Therefore, loss of fucosylation has significant biological consequences. The loss may be due to non-functional fucosyltransferase enzymes, which results in non-fucosylation of cellular proteins. The absence of fucose in the primary N-acetylglucosamine results in the generation of IgG1 antibodies with increased binding affinity for the FcγRIIIα receptor, resulting in a 50- to 100-fold higher efficacy of ADCC. The improvement in ADCC using non-fucosylated IgG is directly proportional to the increased affinity for FcγRIIIα, which allows non-fucosylated IgG Fc to overcome competition with high concentrations of fucosylated IgG in normal serum.

In mammalian expression systems, GDP-fucose, an essential substrate for fucosylation, is synthesized in the cytoplasm via de novo and salvage pathways. In the de novo pathway of fucosylation, GDP-fucose is converted to GDP-4-keto-6-deoxy-mannose, catalyzed by the enzyme GDP-mannose 4,6-dehydrogenase (GMD). It is synthesized. This GDP-fucose is transported inside the Golgi apparatus and used as a substrate for protein fucosylation by the enzyme α1-6 fucosyltransferase (encoded by the FUT8 gene).

Non-fucosylated forms of therapeutic antibodies developed in mammalian platforms with impaired fucose biosynthesis may have clinical advantages over the fucosylated forms due to the improved efficiency of ADCC against target tumor cells.

Accordingly, while researching a method for producing a cell line capable of efficiently producing non-fucosylated proteins, the present inventor found that this goal could be achieved by causing a mutation in exon 9 of the FUT8 gene using the CRISPR/Cas system. After discovering that this was possible, the present invention was completed.

Therefore, an object of the present invention is to provide a method for producing a non-fucosylated protein producing cell line, comprising the steps of introducing the following (a) to (c) into the cell:

(a) Guide RNA (gRNA) containing a base sequence that can bind complementary to exon 9 of the FUT8 (Fucosyltransferase 8) gene;

(b) a nucleic acid encoding a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease; and

(c) Gene encoding the target protein.

Another object of the present invention is to provide a cell line prepared according to the above method.

Another object of the present invention is to provide a method for producing a non-fucosylated protein, comprising culturing the cell line in a medium and obtaining a target protein from the medium.

In order to achieve the above-described object of the present invention, the present invention provides a method for producing a non-fucosylated protein producing cell line, comprising the steps of introducing the following (a) to (c):

(a) Guide RNA (gRNA) containing a base sequence that can bind complementary to exon 9 of the FUT8 (Fucosyltransferase 8) gene;

(b) a nucleic acid encoding a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease; and

(c) Gene encoding the target protein.

In order to achieve another object of the present invention, the present invention provides a cell line prepared according to the above method.

In order to achieve another object of the present invention, the present invention provides a method for producing a non-fucosylated protein, comprising culturing the cell line in a medium and obtaining a target protein from the medium.

Hereinafter, the present invention will be described in detail.

The present invention provides a method for producing a non-fucosylated protein producing cell line, comprising the steps of introducing the following (a) to (c):

(a) Guide RNA (gRNA) containing a base sequence that can bind complementary to exon 9 of the FUT8 (Fucosyltransferase 8) gene;

(b) a nucleic acid encoding a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease; and

(c) Gene encoding the target protein.

In the present invention, the “guide RNA” or “CRISPR-Cas system guide RNA” may include a transcription terminator domain. The term “transcription terminator domain” refers to a secondary structure that prevents bacterial transcription in an effective amount and/or stabilizes the association of a nucleic acid sequence to one or more Cas proteins (or functional fragments thereof) when the CRISPR complex is present in a bacterial species. Refers to a nucleic acid element or domain within a nucleic acid sequence (or polynucleotide sequence) that forms, in the presence of one or more proteins (or functional fragments thereof), one or more Cas proteins and the nucleic acid elements to form a biologically active CRISPR complex. and/or may be active on the target sequence in the presence of the target sequence and the DNA-binding domain. In some embodiments, the transcription terminator domain has at least or about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43. , 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68 , 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93 , 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190 , a nucleic acid sequence for a biologically active CRISPR complex ( and at least one sequence capable of forming a hairpin or duplex that partially induces the association of sgRNA, crRNA and tracrRNA, or other nucleic acid sequences.

In the present invention, the “DNA-binding domain” refers to a nucleic acid element or domain within a nucleic acid sequence (eg, guide RNA) that is complementary to a target sequence (eg, FUT8 gene). In some embodiments, the DNA-binding domain will bind to or have affinity for the FUT8 gene such that one or more Cas proteins can be enzymatically active on the target sequence in the presence of a biologically active CRISPR complex. In some embodiments, the DNA binding domain comprises at least one sequence capable of forming a Watson Crick base pair with a target sequence as part of a biologically active CRISPR system at a concentration and microenvironment suitable for forming a CRISPR system.

In the present invention, a "CRISPR-associated endonuclease protein-binding domain or a "Cas binding domain" is one or a plurality of CRISPR-associated endonucleases (or functional fragments thereof) that bind to or have an affinity for an effective amount. In some embodiments, a nucleic acid element or domain within a nucleic acid sequence or polynucleotide sequence, in the presence of one or more proteins (or functional fragments thereof) and a target sequence, the one or more proteins and nucleic acid elements are biologically active CRISPR. In some embodiments, the CRISPR-associated endonuclease may form a complex and/or be enzymatically active on the target sequence, and in some embodiments, may be Cas9 or The Cas12a endonuclease may have a nucleotide sequence identical to the wild-type Streptococcus pyogenes sequence, in some embodiments the CRISPR-linked endonuclease may be from a different species, e.g. For example, from other Streptococcus species, such as Pseudomona aeruginosa, Escherichia coli, or other sequenced bacterial genomes and archaea, or other prokaryotic microorganisms. These species may be Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus. suis), Actinomyces sp., Cycliphilusdenitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii , Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhizobium sp., Brevibacillus laterosporus ), Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus Puniceispirillum, Clostridium cellulolyticum cellulolyticum), Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseo Dinoroseobacter shibae, Eubacterium dolichum, Gammaproteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum (Haemophilus sputorum), Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., methyl Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria Neisseria lactamica, Neisseria meningitidis, Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvivaculum labamentiboran Parvibaculum lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutells, Ralstonia syzygii, Rhodopseudomonas palustris , Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus aureus ), Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tistrella mobilis, Treponema sp. ) and Verminephrobacter eiseniae (or any of the Cas9 endonucleases described above and at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%) , 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98% or 99% sequence identity). In some embodiments, the CRISPR-associated endonuclease may be a Cas12a nuclease. The Cas12a nuclease has a nucleotide sequence identical to the wild-type Prevotella or Francisella sequence (or at least 70%, 71%, 72%, 73%, 74% of any of the Cas12 endonucleases described above). %, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, functional fragments or variants of any of the foregoing sequences having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity).

“CRISPR system” refers to the sequence encoding the Cas gene, the tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or active portion tracrRNA), the tracr-mate sequence (“direct repeat” and tracrRNA in the context of the endogenous CRISPR system). -CRISPR-associated (“Cas”) genes, including processed partial direct repeats), guide sequences (also referred to as “spacers” in the context of the endogenous CRISPR system) or other sequences and transcripts from the CRISPR locus. It refers collectively to transcripts or synthetically produced transcripts and other elements involved in expression or directing its activity. In some embodiments, one or more elements of the CRISPR system are derived from a Type I, Type II, or Type III CRISPR system. In some embodiments, one or more elements of the CRISPR system are derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. Typically, CRISPR systems feature elements (also referred to as protospacers in the context of endogenous CRISPR systems) that promote the formation of a CRISPR complex at the site of the target sequence. In the context of the formation of a CRISPR complex, “target sequence” refers to a sequence designed to be complementary to a guide sequence, where hybridization between the target sequence and the guide sequence promotes the formation of the CRISPR complex. Complete complementarity is not necessarily necessary, as long as sufficient complementarity exists to cause hybridization and promote formation of the CRISPR complex. The target sequence may comprise any polynucleotide, such as a DNA or RNA polynucleotide. In some embodiments, the target sequence is a DNA polynucleotide and is referred to as a DNA target sequence. In some embodiments, the target sequence is a Cas-CRISPR complex or system comprising a Cas protein and at least one sgRNA or one tracrRNA/crRNA duplex when associated within a microenvironment and at a concentration suitable for association of such system. Contains at least three nucleic acid sequences recognized by proteins. In some embodiments, the target DNA comprises at least one or more proto-spacer adjacent motifs, the sequence of which is known in the art and is dependent on the Cas protein system to be used with the sgRNA or crRNA/tracrRNA used by this task.

Typically, in the context of an endogenous CRISPR system, the formation of a CRISPR complex (comprising a guide sequence hybridized to the target sequence and complexed with one or more Cas proteins) occurs within or near the target sequence (e.g., 1 step from the target sequence). , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or results in cleavage of one or both strands (within a base pair or more). Without being bound by theory, it comprises all or a portion of the wild-type tracr sequence (e.g., about 20, 26, 32, 45, 48, 54, 63, 67, 85 or more nucleotides of the wild-type tracr sequence); The tracr sequence may also form part of a CRISPR complex, such as by hybridization of at least a portion of the tracr sequence to all or a portion of a tracr mate sequence operably linked to a guide sequence. In some embodiments, the tracr sequence has sufficient complementarity to hybridize to the tracr mate sequence and participate in formation of the CRISPR complex. As with the target sequence, full complementarity is not believed to be necessary as long as it is sufficient to be functional (bind to the Cas protein or functional fragment thereof). In some embodiments, the tracr sequence, when optimally aligned, is at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59% along the length of the tracr mate sequence. , 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76 %, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, Has a sequence complementarity of 93%, 94%, 95%, 96%, 97%, 98% or 99%. In some embodiments, one or more vectors driving expression of one or more elements of the CRISPR system are introduced into a host cell such that the presence and/or expression of the elements of the CRISPR system directs the formation of a CRISPR complex at one or more target sites. For example, the Cas enzyme, the guide sequence linked to the tracr-mate sequence, and the tracr sequence can each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements can be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. In addition to at least some of the modifications contemplated by this disclosure, in some embodiments, the guide sequence or RNA or DNA sequence that forms the CRISPR complex is at least partially synthetic. The CRISPR system elements assembled in a single vector may be arranged in any suitable orientation, for example, one element 5' ("upstream") of a second element or 3' ("downstream") of a second element. "). In some embodiments, the present disclosure relates to compositions comprising chemically synthesized guide sequences. In some embodiments, a chemically synthesized guide sequence is used with a vector containing a coding sequence encoding a CRISPR enzyme, such as a class 2 Cas9 or Cas12a protein. In some embodiments, a chemically synthesized guide sequence is used in conjunction with one or more vectors, where each vector comprises a coding sequence encoding a CRISPR enzyme, such as a class 2 Cas9 or Cas12a protein. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element and may be oriented in the same or opposite direction. In some embodiments, a single promoter comprises a CRISPR enzyme and one or more additional (second, third, fourth, etc.) guide sequences, a tracr mate sequence (optionally operably linked to the guide sequence), and one or more intron sequences. Induce expression of a transcript encoding a tracr sequence (e.g., each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, the CRISPR enzyme, one or more additional guide sequences, tracr mate sequence, and tracr sequence are each components of a different nucleic acid sequence. For example, in the case of tracr and tracr mate sequences, and in some embodiments, the present disclosure relates to compositions comprising at least a first and a second nucleic acid sequence, wherein the first nucleic acid sequence comprises a tracr sequence and the second The nucleic acid sequence comprises a tracr mate sequence, the first nucleic acid sequence is complementary to the second nucleic acid sequence, so that the first nucleic acid and the second nucleic acid form a duplex and the first nucleic acid and the second nucleic acid individually or collectively It contains a DNA-targeting domain, a Cas protein binding domain, and a transcription terminator domain. In some embodiments, the CRISPR enzyme, one or more additional guide sequences, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter.

In some embodiments, the guide RNA may be a short synthetic chimeric tracrRNA/crRNA (“single guide RNA” or “sgRNA”). The guide RNA may also include two short synthetic tracrRNA/crRNA ("dual guide RNA" or 'dgRNA"). In a preferred embodiment of the present invention, the guide RNA is sgRNA and consists of the base sequence of SEQ ID NO: 1. May contain crRNA.

[SEQ ID NO: 1]

GUAUUCCUCAAUGGGAUGGA

In the present invention, “FUT8” exists as a type II integral membrane protein in the Golgi apparatus, in which the catalytic domain at the C-terminus is located in the lumen of the Golgi, and at the N-terminus This form has a cytoplasmic tail (CT). At this time, the cytoplasmic tail, transmembrane domain (TM), and stem region (stem) are important in the movement and maintenance of the protein to the Golgi, and although it was predicted that they would form a dimer, the exact principle of action is not yet known. There is nothing. The FUT8 enzyme functions downstream of the GDP-Fucose biosynthesis step and is the final enzymatic step for fucosylation of cellular proteins in the Golgi apparatus. Fucosylation precursors in the de novo and salvage pathways use the FUT8 enzyme for transfer of the final fucose moiety. Therefore, knocking down the FUT8 gene essentially stops both de novo and rescue pathways of cellular protein fucosylation. This approach results in 100% non-fucosylation of proteins, including monoclonal antibodies produced in FUT8 knockout cell lines. The base sequence of the FUT8 gene is known through GeneBank ID: 100751648, etc., and in the present invention, part or all of the base sequence of exon 9 of the FUT8 gene is mutated, substituted, deleted, or one or more bases are changed using the CRISPR/Cas system. The purpose is to reduce the expression of the FUT8 gene or protein by inserting.

In one aspect of the present invention, the guide RNA may target the GTATTCCCTCAATGGGATGGAAGG sequence of exon 9 of the FUT8 gene.

CRISPR/endonuclease (e.g., CRISPR/Cas9) systems are known in the art and are described, for example, in U.S. Pat. No. 9,925,248, which is incorporated herein by reference in its entirety.

In the present invention, the CRISPR-linked endonuclease may be, for example, a Class 1 CRISPR-linked endonuclease or a Class 2 CRISPR-linked endonuclease. Class 1 CRISPR-associated endonucleases include type I, type III, and type IV CRISPR-Cas systems, which have effector molecules containing multiple subunits. For Class 1 CRISPR-associated endonucleases, the effector molecules in some embodiments include SS (Cas11) and Cas8a1; Cas8b1; Cas8c; Cas8u2 and Cas6; Cas3" and Cas10d; Cas SS (Cas11), Cas8e, and Cas6; Cas8f and Cas6f; Cas6f; Cas8-like (Csf1); SS (Cas11) and Cas8-like (Csf1); or with SS (Cas11) and Cas10 In some embodiments the Class 1 CRISPR-associated endonuclease may also include a target cleavage molecule, which in some embodiments may be Cas3 (type I) or Cas10 (type III), e.g. may be associated with spacer acquisition molecules such as Cas1, Cas2, and/or Cas4.

Class 2 CRISPR-associated endonucleases include type I, type V, and type VI CRISPR-Cas systems with a single effector molecule. For Class 2 CRISPR-associated endonucleases, in some embodiments the effector molecule is Cas9, Cas12a (cpf1), Cas12b1 (c2c1), Cas12b2, Cas12c (c2c3), Cas12d (CasY), Cas12e (CasX), Cas12f1 ( Cas14a), Cas12f2 (Cas14b), Cas12f3 (Cas14c), Cas12g, Cas12h, Cas12i, Cas12k (c2c5), Cas13a (c2c2), Cas13b1 (c2c6), Cas13b2 (c2c6), Cas13c (c2c7), Cas13d, c2c4, c2c8, may include c2c9, and/or c2c10.

In some embodiments, the CRISPR-associated endonuclease can be a Cas9 nuclease. The Cas9 nuclease may have a nucleotide sequence identical to the wild-type Streptococcus pyogenes sequence. In some embodiments, the CRISPR-associated endonuclease is from another species, e.g., another Streptococcus species, e.g., thermophilus; Sequences may be from Pseudomona aeruginosa, Escherichia coli or other sequenced bacterial genomes and archaea, or other prokaryotic microorganisms. These species include: Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis ( Actinobacillus suis, Actinomyces sp., Cycliphilusdenitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii ), Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhizobium sp., Brevibacillus laterosporus ( Brevibacillus laterosporus), Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus puniceispirillum, Clostridium cellulolyticum (Clostridium cellulolyticum), Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dino Roseobacter shibae, Eubacterium dolichum, Gammaproteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus Lactobacilluscrispatus, Listeria Ivanovii, Listeriamonocytogenes, Listeriaceaebacterium, Methylocystis sp., Methylosinus Trichosporium (Methylosinustrichosporium), Mobiluncusmulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria menin Neisseriameningitidis, Neisseria sp., Neisseriawadsworthii, Nitrosomonas sp., Parvibaculumlavamentivorans, Pasteurella water Pasteurellamultocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella radish Simonsiellamuelleri, Sphingomonas sp., Sporolactobacillusvineae, Staphylococcus aureus, Staphylococcuslugdunensis, Streptococcus spp. Streptococcus sp.), Subdoligranulum sp., Tistrellamobilis, Treponema sp., and Vermineprobacter aiseniae).

The wild-type Streptococcus pyogenes Cas9 sequence may be modified. Nucleic acid sequences can be codon optimized for efficient expression in mammalian cells, such as human cells. Cas9 nuclease sequences codon-optimized for expression in human cell sequences include, for example, Genbank accession number KM099231.1 GI:669193757; KM099232.1 GI:669193761; or the Cas9 nuclease sequence encoded by any of the expression vectors listed in KM099233.1 GI:669193765. Alternatively, the Cas9 nuclease sequence may be a sequence contained, for example, in a commercially available vector, e.g., pX458, pX330 or pX260 from Addgene (Cambodge, Mass.). In some embodiments, the Cas9 endonuclease is pX458, pX330, or pX260 (Addgene, Cambridge, Mass.), GenBank accession number KM099231.1 GI:669193757; KM099232.1 GI:669193761; or KM099233.1 GI:669193765 or any Cas9 endonuclease sequence of the Cas9 amino acid sequence. The Cas9 nucleotide sequence can be modified to encode biologically active variants of Cas9, which can be differentiated from wild-type Cas9, for example, by one or more mutations (e.g., addition, deletion, or substitution mutations or combinations of the foregoing mutations). may have or comprise different amino acid sequences.

In one aspect of the present invention, the CRISPR-related endonuclease may be Cas12a nuclease. The Cas12a nuclease may have a nucleotide sequence identical to the wild-type Prevotella or Francisella sequence. Alternatively, wild type Prevotella or Francisella Cas12a sequences can be modified. Nucleic acid sequences can be codon optimized for efficient expression in mammalian cells, such as human cells. Cas12a nuclease sequences codon-optimized for expression in human cell sequences are, for example, Genbank accession numbers MF193599.1 GI: 1214941796, KY985374.1 GI: 1242863785, KY985375.1 GI: 1242863787, or KY985376.1 GI: It may be the Cas9 nuclease sequence encoded by any of the expression vectors listed in 1242863789. Alternatively, the Cas12a nuclease sequence may be a sequence contained, for example, in a commercially available vector, e.g., pAs-Cpf1 or pLb-Cpf1 from Addgene (Cambodge, Mass.). In some embodiments, the Cas12a endonuclease is pAs-Cpf1 or pLb-Cpf1 (Addgene, Cambridge, Mass.) under Genbank accession number MF193599.1 GI: 1214941796, KY985374.1 GI: 1242863785, KY985375.1 GI. : 1242863787, or KY985376.1 GI: 1242863789 or any Cas12a endonuclease sequence of the Cas12a amino acid sequence. The Cas12a nucleotide sequence can be modified to encode biologically active variants of Cas12a, which variants may differ from wild-type Cas12a, for example, by one or more mutations (e.g., addition, deletion, or substitution mutations or combinations of the foregoing mutations). may have or comprise different amino acid sequences.

In one aspect of the present invention, when the (a) guide RNA and (b) CRISPR-associated endonuclease are administered as nucleic acids or contained in an expression vector, the CRISPR-associated endonuclease is a nucleic acid identical to the guide RNA sequence. Or it can be encrypted by a vector. In some embodiments, the CRISPR-associated endonuclease may be encoded on a nucleic acid physically separate from the guide RNA sequence or on a separate vector. The nucleic acid sequence encoding the guide RNA may include a DNA binding domain, a Cas protein binding domain, and a transcription terminator domain.

The nucleic acid encoding the guide RNA and/or CRISPR-associated endonuclease may be an isolated nucleic acid. An “isolated” nucleic acid may be, for example, a naturally occurring DNA molecule or fragment thereof, provided that at least one of the nucleic acid sequences is flanking a naturally occurring genomic DNA molecule removed or absent. It is found immediately adjacent to Isolated nucleic acid molecules can be produced by standard techniques. For example, polymerase chain reaction (PCR) techniques can be used to obtain isolated nucleic acids containing nucleotide sequences described herein, including nucleotide sequences encoding polypeptides described herein. PCR can be used to amplify specific sequences of RNA as well as DNA origin, including sequences from total genomic DNA or total cellular RNA. Various PCR methods are described, for example, in PCR Primer: A Laboratory Manual, Dieffenbach and Dveksler, eds., Cold Spring Harbor Laboratory Press, 1995. Generally, sequence information from the end of the region or more regions of interest is used to design oligonucleotide primers that are identical or similar in sequence to the opposite strand of the template to be amplified. A variety of PCR strategies are also available by which site-specific nucleotide sequence modifications can be introduced into the template nucleic acid.

Recombinant constructs are also provided herein and can be used to transform cells to express CRISPR-associated endonuclease and/or guide RNA complementary to the FUT8 gene. The recombinant nucleic acid construct may comprise a nucleic acid encoding a CRISPR-associated endonuclease and/or a guide RNA complementary to the FUT8 gene, which may include a guide RNA complementary to the CRISPR-associated endonuclease and/or the FUT8 gene. is operably linked to a suitable promoter for expression in the cell. In some embodiments, the nucleic acid encoding the CRISPR-associated endonuclease is operably linked to the same promoter as the nucleic acid encoding the guide RNA. In another embodiment, the nucleic acid encoding the CRISPR-associated endonuclease and the nucleic acid encoding the guide RNA are operably linked to different promoters.

In the present invention, the vectors include, for example, viral vectors (e.g., adenovirus (“Ad”), adeno-associated virus (AAV), vesicular stomatitis virus (VSV) and retrovirus), liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating the delivery of polynucleotides comprising (a) to (c) above into cells. Vectors may also contain other components or features that further modulate gene transfer and/or gene expression or otherwise provide beneficial properties to the targeted cells. As described and illustrated in more detail below, such other components include, for example, components that affect binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); Components that affect the uptake of vector nucleic acids by cells; Ingredients that affect the localization of polynucleotides within cells after uptake (e.g., agents that mediate nuclear localization); and components that affect the expression of polynucleotides. These components may also include markers, such as detectable and/or selectable markers, that can be used to detect or select cells that take up and express the nucleic acid delivered by the vector. Suitable nucleic acid delivery systems include recombinant viral vectors, typically sequences from at least one of an adenovirus, an adenovirus-associated virus (AAV), a helper-dependent adenovirus, a retrovirus, or a hemagglutinating virus in a Japanese-liposome (HVJ) complex. Includes. In this case, the viral vector contains a strong eukaryotic promoter, such as a cytomegalovirus (CMV) promoter, operably linked to a polynucleotide. A recombinant viral vector may contain within it one or more polynucleotides, and in some embodiments may contain about one polynucleotide.

In one aspect of the invention, one or more CRISPR-associated endonucleases and one or more guide RNAs may be provided in combination with a ribonucleoprotein (RNP) form. RNP complexes can be introduced into cells, for example, by injection, electroporation, nanoparticles, vesicles and/or with the aid of cell-penetrating peptides.

In one aspect of the present invention, the method involves introducing (a) and (b) into cells to produce a cell line deficient in expression of the FUT8 gene or protein, and then constructing the cell line with a polynucleotide containing (c). It can be performed by dividing into transfection steps.

According to the method of the present invention, FUT8 expression or activity is reduced in a cell, and (a) one or more DNA sequences encoding a guide RNA (gRNA) complementary to a target sequence (specifically, exon 9) within the FUT8 gene ( s) and (b) introducing a nucleic acid sequence encoding a CRISPR-associated endonuclease into a cell, whereby the gRNA hybridizes to exon 9 of the FUT8 gene, and the CRISPR-associated endonuclease cleaves the FUT8 gene. , wherein FUT8 expression or activity in said cells is reduced compared to cells in which one or more DNA sequences encoding a gRNA and a nucleic acid sequence encoding a CRISPR-associated nuclease have not been introduced. Reducing FUT8 expression in a cell may include reducing expression of FUT8 mRNA in the cell, reducing expression of FUT8 protein in the cell, or both. In some embodiments, expression of one or more allele(s) of the FUT8 gene is reduced. In some embodiments, introducing one or more DNA sequence(s) encoding a gRNA and a nucleic acid sequence encoding a CRISPR-associated endonuclease into a cell reduces, but does not completely eliminate, FUT8 expression and/or activity in the cell. No. Preferably, in an embodiment, FUT8 expression and/or activity in the cell is completely eliminated.

By transforming a cell line in which the expression and/or activity of FUT8 has been partially or completely removed with a polynucleotide containing the gene encoding the target protein (c), recombinant cells in which fucosylation has been partially or completely removed from the cell line Proteins can be produced. The term “partially” means at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% of the content. It can be done, but is not limited to this.

In the present invention, the term “introduction” can be used interchangeably with transduction, transfection, and transformation, and refers to modification of the genotype of a host cell by introducing an exogenous polynucleotide, and regardless of the method used, the exogenous polynucleotide It means that nucleotides are introduced into the host cell. An exogenous polynucleotide introduced into a host cell may remain integrated into the host cell's genome or may remain unintegrated, including both. In the present invention, a vector containing a polynucleotide encoding any one selected from the group consisting of (a) to (c) may be used by methods known in the art, such as, but not limited to, transient transfection. ), microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran-mediated transfection, polybrene- Cells can be transformed by being introduced into cells by polybrene-mediated transfection, electroporation, gene gun, and other known methods for introducing nucleic acids into cells.

In the present invention, the “cell” includes COS, CHO-S, CHO-K1, CHO-K1 GS (-/-), CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV, VERO, MDCK, W138, V79, B14AF28-G3, BHK, HaK, NS0, SP2/0-Ag14, HeLa, HEK293-F, HEK293-H, HEK293-T, YB23HL.P2.G11.16Ag.20 and perC6 cells. , but is not limited to this.

In the present invention, the “target protein” is not particularly limited in kind, and may include antibodies, recombinant proteins or peptides, glycosylated proteins or peptides, preferably antibodies, and most preferably antibodies. Preferably, it may be a monoclonal or polyclonal antibody showing ADCC. In one aspect of the invention, the antibody is an inhibitory antibody. Inhibitory antibodies can inhibit one or more biological activities of the antigen to which the antibody binds. For example, an inhibitory antibody may downregulate signaling of the corresponding antigen by inhibiting the activity of the antigen or may inhibit the expression of the antigen. In another aspect of the invention, the antibody is a neutralizing antibody. Neutralizing antibodies reduce or abolish some biological activity of soluble antigens or living organisms, such as infectious agents. Neutralizing antibodies can compete with neutral ligands or receptors for their antigens. In one aspect of the invention, the antibody is a stimulatory or activating antibody. Stimulatory or activating antibodies are agonist antibodies that, upon binding of an antigen, activate signaling of the corresponding antigen, thereby activating or upregulating the activity of the antigen, or upregulating the expression of the antigen to which the antibody binds. It can be. As used herein, the term "antibody" includes complete molecules and functional fragments thereof, such as Fc fusion proteins, as defined herein: a constant heavy chain linked to another polypeptide or protein, either directly or through a suitable polypeptide linker. A genetically engineered molecule containing wealth. Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules, immunoglobulin chains, or fragments of immunoglobulins that contain minimal sequence derived from non-human immunoglobulins. Humanized antibodies include human immunoglobulins (recipient antibodies), wherein the residues forming the complementarity determining regions (CDRs) of the recipient are transferred to a non-human species (donor antibody), such as mouse, with desirable specificity, affinity and capacity. Replaced with residues from rat or rabbit CDRs. In some cases, Fv framework residues of human immunoglobulins are replaced with corresponding non-human residues. Humanized antibodies may also contain residues that are not found in the recipient antibody or in the introduced CDR or framework sequences.　Generally, a humanized antibody will comprise at least one, and typically substantially both, of two variable domains, wherein all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions. is from the human immunoglobulin consensus sequence. The humanized antibody will optimally also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. In one aspect of the invention, the light and heavy chains of an antibody can be transformed into separate transformed host cell cultures of either the same or different species. In an alternative embodiment, separate plasmids for the light and heavy chains can be used to co-transform single transformed host cell cultures. In another embodiment, a single expression plasmid that contains both genes and is capable of expressing genes for both light and heavy chains can be transformed into a single strain host cell culture.

Exemplary antibodies produced in the cells of the invention include adalimumab (HumiraRTM), alemtuzumab (CampathRTM), basiliximab (SimulectRTM), and bevacizumab (AvastinRTM). ), cetuximab (ErbituxRTM), daclizumab (ZenapaxRTM), dacetuzumab, efalizumab (RaptivaRTM), epratuzumab, ibritumomab (ibritumomab) (ZevalinRTM), tiuxetan, infliximab (RemicadeRTM), muromonab-CD3 (OKT3), omalizumab (XolairRTM), palivizumab ) (SynagisRTMoregovomab (OvaRexRTM), rituximab (RituxanRTM), trastuzumab (HerceptinRTM), ocrelizumab, pertuzumab, hu M195Mab, anti-Abeta, anti -CD4, anti-oxLDL, trastuzumab-DM1, apomab, rhuMAb GA101, anti-OX40L, ipilimumab, ustekinumab, golimumab, Specific for ofatumumab, zalutumumab, motavizumab, ecromeximab, MDX010, 4B5, TNX-901, IDEC-114, anti-CLDN03, and antigen and any Fc antibody fragment capable of introducing ADCC.

The present invention also provides a cell line prepared according to the above method.

The present invention also provides a method for producing a non-fucosylated protein, comprising culturing the cell line in a medium and obtaining a target protein from the medium.

Commercially available media such as Ham's F1O (Sigma-Aldrich Co., St. Louis, MO), minimal essential medium (MEM, Sigma-Aldrich Co.), RPMI-1640 (Sigma-Aldrich Co.), and Dulbecco's modified Eagle's medium (DMEM, Sigma-Aldrich Co.) are suitable for culturing cells. The medium may be supplemented with hormones and/or other growth factors, salts, buffers, nucleotides, antibiotics, trace elements and glucose or equivalent energy sources if necessary. The culture medium composition and culture conditions may vary depending on the type of cell, which can be appropriately selected and adjusted by a person skilled in the art.

The protein may accumulate in the cytoplasm of the cell, be secreted from the cell, or be targeted to the periplasm or extracellular medium (supernatant) by an appropriate signal sequence. Targeting to the periplasm or extracellular medium is desirable. In addition, it is desirable to refold the produced protein using a method well known to those skilled in the art and give it a functional conformation. Obtainment of the protein may vary depending on the characteristics of the produced protein and the characteristics of the cell, which can be appropriately selected and controlled by those skilled in the art. If the protein is produced within a cell, the cell can be destroyed to release the protein as a first step. Particulate debris, host cells or dissolved fragments are removed, for example by centrifugation or ultrafiltration. When proteins are secreted into the medium, supernatants from such expression systems are typically first concentrated using commercially available protein concentration filters, such as Amicon or Millipore Pellicon ultrafiltration units. Protease inhibitors, such as PMSF, may be included in any preceding step to inhibit proteolysis, and antibiotics may be included to prevent the growth of accidental contaminants. Proteins prepared from cells can be purified using, for example, hydroxyapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, and the antibodies of the invention are preferably purified through affinity chromatography. You can.

Using the method provided by the present invention and the cell line produced according to the method, non-fucosylated proteins can be produced very efficiently.

Figure 1 shows the results of analyzing the amino acid sequence of FUT8 in a FUT8-deficient CHO-K1 cell line (5H4) and a wild-type CHO-K1 cell line using sgRNA containing the crRNA of SEQ ID NO: 1 and the CRISPR/Cas9 system.
Figure 2 shows CHO-K1 treated with 0.5 μg/mL LCA-FITC, 1 hr RT incubation, and washed three times, followed by FUT8-deficient CHO-K1 cell lines (5H4 and 7F8) and wild-type CHO- This is the result of confirming whether core fuose was removed from the membrane protein glycan structure in the K1 cell line.
Figure 3 shows the results of confirming indel mutation in FUT8 Exon9, the target region of intracellular gDNA.
Figures 4 to 7 show purification of claudin antibodies expressed in WT CHO-K1, FUT8 KO CHO-K1 (5H4) & FUT8 KO CHO-K1 (7F8) to confirm how much fucose was removed through sugar structure analysis. This is the result of extracting only the glycan from the antibody, labeling the glycan with rapiflour, and performing UPLC (quantitative) and LC-MS/MS (glycan ID analysis).
Figures 8 and 9 summarize the results according to Figures 4 to 7.
Figures 10 to 12 show purification of claudin antibodies expressed in WT CHO-K1, FUT8 KO CHO-K1 (5H4) & FUT8 KO CHO-K1 (7F8) to determine how much fucose was removed through sugar structure analysis. This is the result of extracting only the glycan, labeling the glycan with rapiflour, and performing UPLC (quantitative) and LC-MS/MS (glycan ID analysis).
Figure 13 shows that when the core fucose of the sugar structure present at N297 of the antibody is removed, the ADCC efficacy increases because the interaction with the sugar structure present at N162 of CD16a (FcγIIIa) expressed in NK increases, FUT8 KO CHO -K1 (5H4) & FUT8 KO This is the result of evaluating whether the efficacy of ADCC mediated by claudin antibodies expressed in CHO-K1 (7F8) is improved compared to WT.
Figure 14 shows the results of evaluating cell survival rate during repeated subculture of FUT8 KO CHO-K1 (5H4) & FUT8 KO CHO-K1 (7F8).

Hereinafter, the present invention will be explained in detail by the following examples. However, the following examples are only for illustrating the present invention, and the present invention is not limited thereto.

Genome editing technique using CRISPR uses single guide RNA and Cas9 nuclease to cause random insertion/deletion in the desired region (on genomic DNA), thereby creating a frameshift that breaks the sequence of amino acids that will be synthesized into proteins in the future. It is a technology that induces the production of abnormal proteins with poor functionality.

We attempted to create a cell line with KO FUT8 using CRISRP Cas9 technology. sgRNA is composed of crRNA and tracRNA, crRNA binds complementary to the target sequence, and tracRNA binds to Cas9 protein. At this time, the PAM sequence (NGG) must be included on the 3' side of the target sequence for the Cas9 protein to operate, creating a double-strand break 3-4 nucleotides 5' upstream of the PAM sequence, and random breaks are generated by the NHEJ repair system. Insertion/deletion is triggered.

In this experiment, the sgRNA-Cas9 complex, which is a conjugate of sgRNA and Cas9 containing the crRNA of SEQ ID NO: 1 (GUAUUCCUCAAUGGGAUGGA), was prepared and lipofection was performed on CHO-K1 to induce the series of processes described above to occur.

Single cell dilution was performed to obtain a single clone with properly functioning CRISRP Cas9 from the entire pool of cells treated with CRISRP Cas9, and to verify several candidates, target sequence amplification and analysis through LCA binding assay and gDNA extraction were performed in the corresponding cell line. Sugar structure analysis of the expressed antibody was performed.

As a result of sequence analysis of the selected clones (5H4 and 7F8), it was confirmed that a 4bp deletion occurred in the FUT8 target sequence and that a stop codon was generated earlier due to frameshift (Figure 1, short protein production).

Since glycan structures also exist in the CHO-K1 membrane protein, and KOing FUT8 removes the core fucose from the corresponding structures, an experiment was performed to confirm whether the core fucose was also removed from the glycan structures of the membrane protein (LCA is performed on the core Therefore, if FUT8 KO is performed properly, a value close to the mock can be obtained). CHO-K1 was treated with 0.5 μg/mL LCA-FITC, incubated at RT for 1 hour, washed three times, and the results were obtained by FACS.

As shown in Figure 2, since both single cell dilution clones 5H4 & 7F8 were confirmed to have no LCA binding, it was confirmed that the core fucose was removed from the glycan structure of the CHO-K1 membrane protein.

An experiment was conducted to confirm indel mutation in FUT8 Exon9, the target region of intracellular gDNA. After breaking the cells and obtaining gDNA, only the exon part of the target gene (The exon 9 of FUT8 (GeneBank ID: 100751648); catalytic site of FUT8) was amplified by PCR and sequenced. The ab1 file and sgRNA sequence obtained through sequencing were also You can find out whether CRISPR worked well by putting it in the analysis tool (https://ice.synthego.com/#/).

Through the results in Figure 3, the genotype and sequence were identified, and the correct indel and sequence were identified.

Claudin antibodies expressed in WT CHO-K1, FUT8 KO CHO-K1 (5H4) & FUT8 KO CHO-K1 (7F8) were purified to determine how much fucose was removed through sugar structure analysis. Only the glycan was extracted from the antibody, the glycan was labeled with rapiflour, and UPLC (quantitative) and LC-MS/MS (glycan ID analysis) were performed.

As shown in Figures 4 to 7, unlike WT, core fucose was not found in glycans extracted from antibodies derived from 5H4 and 7F8.

In addition, as shown in FIG. 8, WT_CHO-K1_ABN501 sample: G0F 81.95%, G1F 11.1%, and Fucosylated Glycan was identified, 5H4_4B10_ABN501 sample: G0 90%, G1 6% 3H4_ABN501501 sample: G0 Fucosylated glycan was not identified in 81% and G1 in 10%.

Additionally, as shown in Figure 9, it was confirmed that core fucose was not found in glycans extracted from 5H4 and 7F8-derived antibodies (green cells: indicate glycan ID with fucose).

Claudin antibodies expressed in WT CHO-K1, FUT8 KO CHO-K1 (5H4) & FUT8 KO CHO-K1 (7F8) were purified to determine how much fucose was removed through sugar structure analysis. Only the glycan was extracted from the antibody, the glycan was labeled with rapiflour, and UPLC (quantitative) and LC-MS/MS (glycan ID analysis) were performed.

As shown in Figures 10 to 12, unlike WT, core fucose was not found in glycans extracted from antibodies derived from 5H4 and 7F8.

ADCC (Antibody-dependent-cell-cytoxicity) occurs when an antibody attaches to a target protein, the Fc gamma receptor (Fc gamma receptor) of a natural killer cell (NK cell) recognizes the Fc portion of the antibody, and a series of downstream events occur in the corresponding immune cell. This refers to a mechanism whereby signaling occurs and Perforin and Granzyme are secreted to kill bacteria and cancer cells that express the target protein.

When the core fucose of the sugar structure present at N297 of the antibody is removed, the interaction with the sugar structure present at N162 of CD16a (FcγIIIa) expressed in NK cells increases, so ADCC efficacy increases. An experiment was conducted to confirm this. proceeded.

(1) Seed MDA-MB-453 cell line _, a TNBC cell line, in 96 wells at ^2.5

(2) Treat with an appropriate amount of antibody, seed NK92mi-CD16 so that the E:T ratio is 4:1 based on the number of cells seeded the previous day, and incubate for 4 hours at 37oC.

(3) Graph analysis by measuring the amount of Lactate dehydrogenase (LDH) released from dead or damaged cells (EZ-LDH Cell Cytotoxicity Assay Kit)

As a result, as shown in Figure 13, it was confirmed that the efficacy of ADCC mediated by claudin antibodies expressed in FUT8 KO CHO-K1 (5H4) & FUT8 KO CHO-K1 (7F8) was significantly increased compared to WT.

We wanted to test the VCD stability of FUT8 KO CHO-K1 (5H4) & FUT8 KO CHO-K1 (7F8). Viable cell viability of cells immediately before and immediately after passage was measured through periodic subculture.

As shown in Figure 14, it was confirmed that 5H4 and 7F8 cells were stably maintained even after multiple passages.

By using the method provided by the present invention and the cell line produced according to this method, non-fucosylated proteins can be produced very efficiently, so their industrial applicability is very high.

Sequence list electronic file attached

Claims (14)

Method for producing a non-fucosylated protein producing cell line, comprising introducing the following (a) to (c) into the cell:
(a) Guide RNA (gRNA) containing a base sequence that can bind complementary to exon 9 of the FUT8 (Fucosyltransferase 8) gene;
(b) a nucleic acid encoding a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease; and
(c) Gene encoding the target protein.
The method of claim 1, wherein the guide RNA includes tracrRNA and crRNA.
The production method according to claim 1, wherein the guide RNA includes crRNA consisting of the base sequence of SEQ ID NO: 1.
The method of claim 1, wherein the CRISPR-related endonuclease Cas protein is used.
The method of claim 3, wherein the Cas protein is selected from the group consisting of Cas3, Cas5, Cas6, Cas7, Cas9, Cas12a, Cas12b, Cas12c, Cas12d, Cas13a, Cas13b, Cas13c, c2c4, c2c5, c2c8, c2c9 and c2c10 proteins. A manufacturing method characterized by:
The method of claim 4, wherein the Cas protein is Streptococcus pyogenes, thermophilus , Pseudomona aeruginosa , Escherichia coli , acidoborax Avene ( Acidovorax avenae ), Actinobacillus pleuropneumoniae , Actinobacillus succinogenes , Actinobacillus suis , Actinomyces sp. ), Cycliphilus denitrificans, Aminomonas paucivorans , Bacillus cereus , Bacillus smithii, Bacillus thuringiensis, Pak . Bacteroides sp. , Blastopirellula marina, Bradyrhizobium sp. , Brevibacillus laterosporus , Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus Puniceispirillum, Clostridium cellulolyticum , Clostridium perfringens perfringens ), Corynebacterium accolens , Corynebacterium diphtheria, Corynebacterium matruchotii , Dinoroseobacter shibae , Eubacterium dolly Eubacterium dolichum , Gammaproteobacterium , Gluconacetobacter diazotrophicus , Haemophilus parainfluenzae , Haemophilus sputorum , Helicobacter canadensis ), Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae , Lactobacillus crispatus , Listeria Listeria ivanovii, Listeria monocytogenes , Listeriaceae bacterium , Methylocystis sp. ), Methylosinus trichosporium , Mobiluncus mulieris, Neisseria bacilliformis , Neisseria cinerea , Neisseria flavescens ), Neisseria lactamica, Neisseria meningitidis, Neisseria sp . , Neisseria wadsworthii, Nitrosomonas sp. , Parviva Parvibaculum lavamentivorans , Pasteurella multocida , Phascolarctobacterium succinatutells , Ralstonia syzygii , Rhodoshomonas palustris ( Rhodopseudomonas palustris ), Rhodovulum sp. , Simonsiella muelleri , Sphingomonas sp. , Sporolactobacillus vineae , Staphylococcus aureus Staphylococcusaureus , Staphylococcus lugdunensis , Streptococcus sp. , Subdoligranulum sp. , Tistrella mobilis, Treponema spp. ( Treponema sp. ) and Verminephrobacter eiseniae .
The method of claim 1, wherein the guide RNA and CRISPR-related endonuclease are in the form of a ribonucleoprotein (RNP), or a recombinant vector containing a nucleic acid encoding the CRISPR-related endonuclease and a guide RNA. Manufacturing method using.
The manufacturing method according to claim 1, wherein the introduction is performed using one or more methods selected from the group consisting of electroporation, liposomes, plasmids, viral vectors, nanoparticles, and PTD (protein translocation domain) fusion proteins. .
The method of claim 1, wherein the cells are COS, CHO-S, CHO-K1, CHO-K1 GS (-/-), CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV, VERO, MDCK, W138, V79 , B14AF28-G3, BHK, HaK, NS0, SP2/0-Ag14, HeLa, HEK293-F, HEK293-H, HEK293-T, YB23HL.P2.G11.16Ag.20 and perC6 cells. Characterized manufacturing method.
The method of claim 1, wherein the target protein is an antibody; Recombinant protein or peptide; Or a manufacturing method characterized in that it is a glycosylated protein or peptide.
A cell line prepared according to the method of claims 1 to 10.
A method for producing a non-fucosylated protein, comprising culturing the cell line according to claim 11 in a medium and obtaining a target protein from the medium.
The method of claim 12, wherein the target protein is an antibody; Recombinant protein or peptide; Or a manufacturing method characterized in that it is a glycosylated protein or peptide.
The method of claim 13, wherein the antibody exhibits improved antibody dependent cellular cytotoxicity (ADCC) compared to the antibody produced by the parent cell.