KR20240055235A - PCR primer set and probe for species identification of Gobiobotia macrocephala and real-time PCR method using the same - Google Patents

Abstract

The present invention relates to a method for identifying codfish from other freshwater fish by amplifying a target sequence specific to coccurignia using a primer set containing the oligonucleotide of SEQ ID NO: 10 and the oligonucleotide of SEQ ID NO: 13, which are PCR primers.
In addition, the present invention uses a composition comprising an oligonucleotide of SEQ ID NO: 10, an oligonucleotide of SEQ ID NO: 13, a probe containing the oligonucleotide of SEQ ID NO: 15, and a probe containing the oligonucleotide of SEQ ID NO: 16, to perform real-time PCR. It is about a method to quickly identify codfish from fish or environmental water with excellent specificity and sensitivity.

Description

PCR primer set and probe for species identification of Gobiobotia macrocephala and real-time PCR method using the same {PCR primer set and probe for species identification of Gobiobotia macrocephala and real-time PCR method using the same}

The present invention relates to a method for identifying codfish from other freshwater fish by amplifying a target sequence specific to coccurignia using a primer set containing the oligonucleotide of SEQ ID NO: 10 and the oligonucleotide of SEQ ID NO: 13, which are PCR primers.

In addition, the present invention uses a composition comprising an oligonucleotide of SEQ ID NO: 10, an oligonucleotide of SEQ ID NO: 13, a probe containing the oligonucleotide of SEQ ID NO: 15, and a probe containing the oligonucleotide of SEQ ID NO: 16, to perform real-time PCR. It is about a method to quickly identify codfish from fish or environmental water with excellent specificity and sensitivity.

Gobiobotia macrocephala is a Korean endemic species distributed in the Han River, Imjin River, and Geum River. It was designated as a Class 2 endangered wild species in 2012 and is protected by the Ministry of Environment.

Recently, a technology that can predict what species live by analyzing environmental DNA (eDNA) in water has been developed and is being used by many researchers.

Environmental DNA is not DNA extracted from living organisms, but organic matter collected from the surrounding environment in which they live. In the case of fish, it refers to a method of securing genomes from mucus, secretions, scales, etc. and identifying them through base sequence analysis. For example, this is a method of finding out what kind of organisms live in a river by amplifying and analyzing specific genes from DNA fragments found by sampling only environmental water. Therefore, it is possible to find out whether the target organism is inhabited without collecting it directly, so it does not depend on the collector's skills. It is a very effective method for identifying breeding sites or habitats of rare species in terms of cost and reliability compared to labor-intensive methods.

The present invention developed a specific primer set and probe for the identification of Koguri in order to improve the specificity and sensitivity of the identification of Koguri in fish or environmental water, and established a real-time PCR method (real-time PCR, qPCR, etc.) using this.

Korean Patent No. 10-2018798 Korean Patent No. 10-1955124

The present invention was developed to solve the problems of the above technology, and its purpose is to provide a primer set and probe that can quickly identify codfish from fish or environmental water with excellent specificity and sensitivity.

In addition, the present invention provides real-time PCR by using a composition comprising an oligonucleotide of SEQ ID NO: 10, an oligonucleotide of SEQ ID NO: 13, a probe containing the oligonucleotide of SEQ ID NO: 15, and a probe containing the oligonucleotide of SEQ ID NO: 16. The purpose is to provide a method to quickly identify codfish from fish or environmental water with excellent specificity and sensitivity.

In order to achieve the above object, the present invention provides a primer set for coguri identification comprising the oligonucleotide of SEQ ID NO: 10 and the oligonucleotide of SEQ ID NO: 13.

In addition, the present invention provides a probe for coguri identification comprising the oligonucleotide of SEQ ID NO: 15 and the oligonucleotide of SEQ ID NO: 16.

In addition, the present invention provides a composition for identifying codfish including the oligonucleotide of SEQ ID NO: 10, the oligonucleotide of SEQ ID NO: 13, and the probe.

Additionally, the present invention includes the steps of isolating DNA from fish or environmental water;

The isolated DNA; and mixing the primer set or the composition and amplifying it by PCR. and

It provides a method for identifying kuguri including the step of checking the C _T (threshold cycle) value of the amplified product.

In one embodiment of the present invention, the step of checking the C _T value of the amplified product provides a method of identifying a kkuguri, characterized in that it is determined to be a kkuguri when C _T appears below the maximum cycle number.

The present invention can provide a primer set and probe that can quickly identify codfish from fish or environmental water with excellent specificity and sensitivity.

In addition, the present invention provides real-time PCR ( Real-time PCR, qPCR, etc.) can provide a method to quickly identify codfish from fish or environmental water with excellent specificity and sensitivity.

In addition, by using a specific primer set and probe, the present invention can reduce the inconvenience and process of determining the base sequence or electrophoresis, reduce the possibility of contamination, and provide a method for identification of Cuguri that enables quantitative analysis.

Figure 1 shows the results of qPCR amplification reaction using a total of 10 PCR primer combinations targeting the Cuguri genomic DNA sample of the present invention.
Figure 2 shows the results of a qPCR amplification reaction using a Taqman probe using a total of two PCR primer combinations and four temperature steps for the Cuguri genomic DNA sample of the present invention.
Figure 3 shows the results of a species-specific real-time PCR amplification reaction of 25 specimens of the Sand Turtle family fish of the present invention.
Figure 4 shows Multiplex qPCR amplification according to the concentration of Cuguri genomic DNA (20ng/rxn, 2ng/rxn, 200pg/rxn, 20pg/rxn, 2pg/rxn, 0.2pg/rxn) of the Cuguri species-specific real-time PCR marker of the present invention. Shows an amplification curve representing the Ct value of the reaction.
Figure 5 is Multiplex qPCR amplification according to the concentration of the Cuguri genomic DNA (20ng/rxn, 2ng/rxn, 200pg/rxn, 20pg/rxn, 2pg/rxn, 0.2pg/rxn) of the species-specific real-time PCR marker of the present invention. Shows the calibration curve of the amplification reaction, which represents the Ct value of the reaction (r ²=0.999).

The present invention will be described in detail below based on examples and drawings. The terms, examples, drawings, etc. used in the present invention are merely illustrative to explain the present invention in more detail and aid the understanding of those skilled in the art, and should not be construed as limiting the scope of the present invention. .

Technical terms and scientific terms used in the present invention, unless otherwise defined, represent meanings commonly understood by those skilled in the art in the technical field to which this invention pertains.

The present invention relates to a primer set for identification of codfish including the oligonucleotide of SEQ ID NO: 10 and the oligonucleotide of SEQ ID NO: 13.

In addition, the present invention relates to a probe for codfish identification comprising the oligonucleotide of SEQ ID NO: 15 and the oligonucleotide of SEQ ID NO: 16.

In addition, the present invention relates to a composition for identifying codfish including the oligonucleotide of SEQ ID NO: 10, the oligonucleotide of SEQ ID NO: 13, and the above probe.

Additionally, the present invention includes the steps of isolating DNA from fish or environmental water;

The isolated DNA; and mixing the primer set or the composition and amplifying it by PCR. and

It relates to a method of identifying kuguri comprising the step of checking the C _T (threshold cycle) value of the amplified product.

In addition, the step of checking the C _T value of the amplified product is characterized in that it is judged as correct when C _T appears below the maximum number of cycles.

(Example 1) Securing freshwater fish genetic samples

We obtained 25 samples of sandy snails, including the courier.

600 μl of DNA extraction solution (10 mM Tris-HCl pH 8.0; 125 mM NaCl; 10 mM EDTA pH 8.0; 1% SDS; 8 M Urea) (Asahida et al. 1996) and Proteinase K solution (20 mg/ml) 6 μl was added and a genetic sample was obtained through the same process as in the literature (Table 1).

No. Specimen no. Species name Common name One AGTC-FF-0075 Pseudopungtungia tenuicorpa Thin stone fish 2 AGTC-FF-0107 Pseudopungtungia nigra persimmon fish 3 AGTC-FF-0095 Hemibarbus labeo nucci 4 AGTC-FF-0109 Pungtungia herzi stone fish 5 AGTC-FF-0080 Microphysogobio yaluensis let's go 6 AGTC-FF-0076 Gobiobotia brevibarba stone shark 7 AGTC-FF-0077 Microphysogobio jeoni ?瘟歷早? 8 AGTC-FF-0086 Saurogobio dabryi Doo-woo-jung 9 AGTC-FF-0106 Pseudogobio esocinus Plain of sand 10 AGTC-FF-0141 Microphysogobio koreensis sand injection 11 AGTC-FF-0079 Squalidus japonicus Koreanus I don't know 12 AGTC-FF-0122 Microphysogobio longidorsalis Bae Sari 13 AGTC-FF-0085 Ladislavia taczanowskii Sammy 14 AGTC-FF-0110 Coreoleuciscus splendidus Shiri 15 AGTC-FF-0162 Hemibarbus mylodon Eoreumchi 16 AGTC-FF-0040 Microphysogobio rapidus Immediately after the rapids 17 AGTC-FF-0146 Squalidus multimaculatus doommolgae 18 AGTC-FF-0131 Sarcocheilichthys nigripinnis used machine 19 AGTC-FF-0129 Hemibarbus longirostris yam 20 AGTC-FF-0140 Squalidus chankaensis tsuchigae Chammolgae 21 AGTC-FF-0130 Pseudorasbora parva True carp 22 AGTC-FF-0081 Coreoleuciscus aeruginos Chamsiri 23 AGTC-FF-0111 Sarcocheilichthys wakiyae Chamjung meat 24 AGTC-FF-0027 Gobiobotia naktongensis White Stallion 25 AGTC-FF-0082 Gobiobotia macrocephala Kuguri

(Example 2) PCR amplification and primer design

The mitochondrial COB gene region of 25 fish species was PCR amplified using the designed PCR primer combinations.

The DNA sequence information of the PCR amplification product was decoded to create a mitochondrial COB region DNA sequence information matrix.

By comparative analysis of the COB base sequence matrix, primers (SEQ ID NOs: 1 to 4, 6 to 8, 10 to 14) and probes (SEQ ID NOs: 5, 9, 15, and 16) for identification of Coguri, which can only be amplified from Coguri, were prepared as follows. (Table 2).

At this time, using Sequence Manipulation Suite: PCR Primer Stats (http://www.bioinfor-matics.org/sms2), the length, GC content, and T _m of PCR primer combinations and fluorescent probes were determined. The optimal combination was designed by calculating and predicting values, secondary structures, etc.

Specifically, the PCR primers were designed to be 18-20 mer, GC content 40-55%, and T _m value at 50-60°C.

In addition, the fluorescent probe was designed to be 16-25 mer and GC content 55-70%, and the T _m value was designed to be 2-5°C higher than the T _m value of the primer combinations.

order
number name Base sequence (5'→3') note One Gma-0083f CAGTGTGATGGAATTTTGGG 2 Gma-0089f GATGGAATTTTGGGTCCTTAC 3 Gma-0315r TCTCCTTGTAAAGGTAGGAC 4 Gma-0327r CCAATATTTCAGGGTCTCCTTG 5 Gma-0128p ATTGTACAGATCTTAACGGGACTCTT TaqMan probe 6 Gma-0314f GGTCCTACCTTTACAAGGAG 7 Gma-0498r CGTTATCTACTGAGAACCCA 8 Gma-0522r GCGAAGAATCGTGTGAGG 9 Gma-0374p TAACGGCCTTCGTCGGGTA TaqMan probe 10 Gma-0725f TAGCTTTATTCTCCCCCAAC 11 Gma-0915r GCTTTGAGGTGTGTAAGATG 12 Gma-0948r TTGGGTGAGTGGACGAAAG 13 Gma-1057r AAGTACAGAACTGATGCGAC 14 Gma-1104r ATTTTCCAGTAACCCTGCC 15 Gma-0798p ACACATCAAGCCCGAGTGGTA TaqMan probe 16 Gma-0870p CGTTCTCGCACTACTGTTTCC TaqMan probe

The probe may be bound to both ends of a reporter and a quencher fluorescent substance capable of quenching the reporter fluorescence.

The reporters include FAM (6-carboxyfluorescein), Texas red, HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), NED, JOE, Cy3 and Cy5 It may be one or more selected from the group consisting of, and the quencher may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), MGB Eclipse, BHQ1, BHQ2, BHQ3, NFQ and Dabcyl, but is limited thereto. It doesn't work.

For example, the probe (Gma-0798p) can be defined as FAM-ACACATCAAGCCCGAGTGGTA-BHQ1, and the probe (Gma-0870p) can be defined as HEX-CGTTCTCGCACTACTGTTCTCC-BHQ1, etc.

The probe is a TaqMan probe, the 5' end of which is a reporter fluorescent labeling factor (FAM, HEX, etc.), and the 3' end of which is a quencher substance (MGB Eclipse, BHQ1, etc.), SEQ ID NO: 1 It is preferable to use with oligonucleotides of 4 to 8, 6 to 8, and 10 to 14 oligonucleotides.

The probe specifically hybridizes to the template DNA in the annealing step of the PCR process, and only the probe hybridized to the template is degraded by the 5'->3' exonuclease activity of the polymerase in the extension step. As the fluorescent labeling factor is released from the probe, the inhibition by the inhibitor is lifted and fluorescence is emitted.

(Example 3) Real-time PCR verification

To perform a real-time PCR amplification reaction, a PCR reaction solution was prepared using GoTaq ^® Probe qPCR MasterMix (Promega, USA) as follows (Table 3). At this time, genomic DNA (20 ng/㎕) was used as template DNA.

Reagent Cocktail (×30) GoTaq® Probe qPCR MasterMix 10㎕ 300 ㎕ CXR (20x) 1㎕ 30㎕ Genomic DNA (20 ng/㎕) 2㎕ 60㎕ Forward primer (5 pmol) 1㎕ 30㎕ Reverse primer (5 pmol) 1㎕ 30㎕ Probe 1 (5 pmol) 0.5 μl 15㎕ Probe 2 (5 pmol) 0.5 μl 15㎕ Nuclease-free water 4㎕ 120㎕ Total 20 μl 600 ㎕

The real-time PCR amplification reaction was performed using QuantStudio5 (Thermo Fisher Scientific, USA) under the following conditions (Table 4).

Temperature Time No. cycles Initial denaturation 95℃ 2min One Denaturation 95℃ 15 seconds 50 Annealing/elongation 63℃ 1 min

A total of 10 primer combinations were created using the primers designed in Table 2 above (Table 5), and real-time PCR (hereinafter referred to as ‘qPCR’) amplification reaction was performed on these for the Cuguri genomic DNA.

No. Primer set qPCR
(amplification reaction) qPCR
(Ct value) Remark One Gma-0083f/0315r O 15 Check for non-specific reactions 2 Gma-0083f/0327r O 15 3 Gma-0089f/0315r O 15 Check for non-specific reactions 4 Gma-0089f/0327r O 15 5 Gma-0314f/0498r O 15 Check for non-specific reactions 6 Gma-0314f/0522r O 15 Check for non-specific reactions 7 Gma-0725f/0915r O 15 Check for non-specific reactions 8 Gma-0725f/0948r O 15 9 Gma-0725f/1057r O 15 10 Gma-0725f/1104r O 15 Check for non-specific reactions

As a result of performing a qPCR amplification reaction using SYBR Green, four primer combinations (No 2, No 4, No 8, No 9) were judged to be suitable as primer combinations for Cuguri species-specific PCR (Figure 1), but the fluorescent probe Combinations of two primers, Gma-0725f/0948r (No 8) and Gma-0725f/1057r (No 9), which are expected to be able to use two primers at the same time, were first selected and used for optimizing the newly designed Taqman probe and qPCR amplification reaction. Among the reaction steps, the temperature of the 'binding/elongation' step was varied by 2°C, and the amplification reaction of each primer combination was confirmed at a total of 4 temperature steps from 60 to 66°C (Table 6 and Figure 2).

No. Primer set qPCR
(amplification reaction) amplification reaction
Limit temperature (℃) Remark One Gma-0725f/0948r O 66 Amplification efficiency decreases from 64℃ 2 Gma-0725f/1057r O 66 Amplification efficiency decreases from 64℃

As a result of the qPCR amplification reaction of primer and probe combinations performed on the Cuguri genomic DNA sample, the optimal primer combination was Gma-0725f/1057r (No 9), and both probes Gma-0798p and Gma-0870p were used simultaneously. It was judged to be possible, and the optimal bonding temperature was confirmed to be 62~64℃. Additionally, as a result of checking the optimal bonding temperature by varying it from 62 to 65℃ in 1℃ increments, it was confirmed that the optimal bonding temperature was 63℃.

In addition, the real-time PCR amplification reaction of genomic DNA (20ng/rxn) of 25 species of Sandridae family, including Courier, was confirmed using the designed primer set, and the specificity of the real-time PCR marker was verified. The results are as follows ( Table 7 and Figure 3)

No. Specimen no. Species name Common name Amp.* One AGTC-FF-0075 Pseudopungtungia tenuicorpa Thin stone fish UD** 2 AGTC-FF-0107 Pseudopungtungia nigra persimmon fish UD 3 AGTC-FF-0095 Hemibarbus labeo nucci UD 4 AGTC-FF-0109 Pungtungia herzi stone fish UD 5 AGTC-FF-0080 Microphysogobio yaluensis let's go UD 6 AGTC-FF-0076 Gobiobotia brevibarba stone shark UD 7 AGTC-FF-0077 Microphysogobio jeoni ?瘟歷早? UD 8 AGTC-FF-0086 Saurogobio dabryi Doo-woo-jung UD 9 AGTC-FF-0106 Pseudogobio esocinus Plain of sand UD 10 AGTC-FF-0141 Microphysogobio koreensis sand injection UD 11 AGTC-FF-0079 Squalidus japonicus Koreanus I don't know UD 12 AGTC-FF-0122 Microphysogobio longidorsalis Bae Sari UD 13 AGTC-FF-0085 Ladislavia taczanowskii Sammy UD 14 AGTC-FF-0110 Coreoleuciscus splendidus Shiri UD 15 AGTC-FF-0162 Hemibarbus mylodon Eoreumchi UD 16 AGTC-FF-0040 Microphysogobio rapidus Immediately after the rapids UD 17 AGTC-FF-0146 Squalidus multimaculatus doommolgae UD 18 AGTC-FF-0131 Sarcocheilichthys nigripinnis used machine UD 19 AGTC-FF-0129 Hemibarbus longirostris yam UD 20 AGTC-FF-0140 Squalidus chankaensis tsuchigae Chammolgae UD 21 AGTC-FF-0130 Pseudorasbora parva True carp UD 22 AGTC-FF-0081 Coreoleuciscus aeruginos Chamsiri UD 23 AGTC-FF-0111 Sarcocheilichthys wakiyae Chamjung meat UD 24 AGTC-FF-0027 Gobiobotia naktongensis White Stallion UD

Since there was no real-time PCR amplification reaction of the genomic DNA of 24 specimens of the Sand Radish family except for the Cuguri, it was confirmed that the primer set of the present invention can be used as a species-specific real-time PCR marker for the Cuguri.

In order to create a species-specific real-time PCR calibration curve for Kuguri, a calibration curve was created using Kuguri gDNA at a concentration of 20ng/rxn to 0.2pg/rxn (Figures 4 and 5). The R ² value, which determines the reliability of the calibration curve, was 0.999, which was judged to be sufficiently usable as a cuguri-specific qPCR molecular marker. Since no non-specific signal was observed in the negative control, the maximum detection limit could not be calculated.

Claims (5)

A primer set for coguri identification comprising the oligonucleotide of SEQ ID NO: 10 and the oligonucleotide of SEQ ID NO: 13.
A probe for codfish identification comprising the oligonucleotide of SEQ ID NO: 15 and the oligonucleotide of SEQ ID NO: 16.
A composition for identifying codfish comprising the oligonucleotide of SEQ ID NO: 10, the oligonucleotide of SEQ ID NO: 13, and the probe of claim 2.
Isolating DNA from fish or environmental water;
The isolated DNA; And mixing the primer set of claim 1 or the composition of claim 3 and amplifying it by PCR; and
A method of identifying a codfish comprising the step of checking the C _T (threshold cycle) value of the amplified product.
According to clause 4,
The step of checking the C _T value of the amplified product is a method of identifying a kkuguri, characterized in that it is determined as a kkuguri when C _T appears below the maximum number of cycles.