KR20240046147A - Composition for preventing and treating disc disease containing ABT263 as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing and treating disc disease containing ABT263 as an active ingredient, wherein ABT263 or navitoclax reduces the expression of Mmp13, Adamts4, Cox2, iNos and Ngf, and inhibits senescent cells in the disc. It can be removed. Accordingly, it can be used for the prevention, improvement or treatment of disc-related diseases, which is a new medicinal use.

Description

Composition for preventing and treating disc disease containing ABT263 as an active ingredient}

It relates to a composition for preventing and treating disc disease containing ABT263 as an active ingredient.

A disc, intervertebral disc, or intervertebral disc is an elastic support that connects two bones with a fibrocartilage joint. There are 23 intervertebral discs in the human lower back. Mechanically, the disc stabilizes the connection between the two vertebral bodies while allowing movement between them.

Such disc damage is an inevitable disease that humans acquire while walking on two legs, and conservative treatments such as drugs and physical therapy are used to treat it. If conservative treatment is ineffective, surgical treatment such as disc removal, spinal fusion, or artificial disc insertion may be considered. Surgical treatment has the effect of reducing pain in the short term, but in the long term, it can worsen degenerative changes and cause spinal instability, which can result in worsening back pain.

Under this background, the use of ABT 263 as an anticancer agent was confirmed (EP 3066101 B1), but there is insufficient research on its use for preventing and treating disc-related diseases.

One aspect provides a pharmaceutical composition for preventing and treating disc disease containing ABT263 as an active ingredient.

Another aspect provides a health functional food composition for preventing and improving disc disease containing ABT263 as an active ingredient.

Other objects and advantages of the present application will become clearer from the following detailed description together with the appended claims and drawings. Contents not described in this specification can be fully recognized and inferred by a person skilled in the technical field of this application or a similar technical field, so description thereof is omitted.

Each description and embodiment disclosed in this application may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Additionally, the scope of the present application cannot be considered limited by the specific description described below.

One aspect is to provide a pharmaceutical composition for preventing and treating disc disease containing ABT263 as an active ingredient.

The term “ABT263” or Navitoclax (CAS 923564-51-6) is a compound with a molecular formula of C ₄₇ H ₅₅ C _l F ₃ N ₅ O ₆ S ₃ and a molecular weight of 974.61. The compound may be represented by the following formula (1). ABT263 was previously only known to be used as an anti-cancer agent through its inhibitory effect on the anti-apoptotic BCL-2 protein, but in the present invention, its use in preventing and treating disc disease was newly discovered. The compounds may be derived from nature or may be synthesized using known organic synthesis methods. Alternatively, it may be a non-protein compound, a peptide, an extract of plant-derived tissues or cells, or a product obtained by culturing microorganisms (e.g., bacteria or fungi, and especially yeast).

[Formula 1]

ABT263 may cause systemic toxic side effects. In order to prevent such side effects in the present invention, ABT263 was encapsulated in a drug release system and then injected into the area of the disc disease to locally release the drug only into the disc, which is the area of the disease.

In order to obtain the appropriate therapeutic efficacy of ABT263, ABT263 must be repeatedly injected into the patient over time. Repeated injections into the disc can cause inflammation and worsen disc disease. In order to prevent this problem in the present invention, ABT263 was encapsulated in a drug release system and then injected into the area of disc disease to release the drug in sustained release.

The term “disc” may refer to tissue such as cartilage that exists between bones. There are types of discs, such as lumbar discs, cervical discs, and chin discs, which are joint parts in the body, but are not limited to these.

In one embodiment, the composition may include a biocompatible polymer as an additional active ingredient.

The term “biocompatible polymer” refers to a polymer that is safe in vivo and does not cause high cytotoxicity and inflammatory reactions when administered in vivo, and is also referred to simply as polymer in this specification. Examples of the biocompatible polymer include polyethylene glycol, fatty acids, cholesterol, albumin and fragments thereof, albumin binding substances, polymers of repeating units of specific amino acid sequences, antibodies, antibody fragments, FcRn binding substances, in vivo connective tissue or derivatives thereof, nucleotides, Examples include, but are not limited to, fibronectin, transferrin, saccharide, or high molecular weight polymers.

In order to develop a formulation that combines such a biocompatible polymer with a drug showing medicinal properties, the physical properties of the drug, the dosage of the drug, the physicochemical compatibility of the drug and the polymer, and the solubility of the drug in organic solvents must be considered, and all of the above factors must be considered. Even so, the drug release pattern of the manufactured dosage form is different depending on the manufacturing method and process variables according to each manufacturing method. The present invention has invented a composition that has a significant effect on disc disease by limiting factors that can specify the unique release pattern and capture efficiency of these biocompatible polymers and drugs.

In one embodiment, the biocompatible polymer is polyethylene glycol, polypropylene glycol, ethylene glycol-propylene glycol copolymer, polyoxyethylated polyol, polysaccharide, dextran, polyvinyl ethyl ether, PLA (polylactic acid), polyvinyl Alcohol (PVA), poly(p-xylylene) polymer, poly(ε-caprolactone) (PCL), poly(valerolactone) (PVL), poly(ε-decalactone) (PDL), poly(1) ,4-dioxane-2,3-dione), poly(1,3-dioxan-2-one), poly(para-dioxanone)(PDS), poly(hydroxybutyric acid)(PHB), poly It may be one or more selected from the group consisting of (hydroxyvaleic acid) (PHV), ethylene vinyl acetate, poly(β-malic acid) (PMLA), and polylactic-glycolic acid (PLGA).

In one embodiment, the conjugate of ABT263 and a biocompatible polymer is prepared by a solvent evaporation method, a spray drying method, a solvent extraction method, or a microfluidic method. It may be. More specifically, it may be manufactured by solvent evaporation, but is not limited thereto.

In one embodiment, the diameter of the conjugate may be 200 nm to 2 μm. More specifically, it may be 200 to 1500 nm, 200 to 1000 nm, 200 to 800 nm, and 200 to 500 nm, but is not limited thereto. Particles with a diameter of 2 μm or less do not easily contact macrophages, so phagocytosis is not active. Therefore, the diameter of the conjugate has the technical effect of lowering the possibility of phagocytosis by macrophages after being injected into the disc tissue.

In one embodiment, the drug capture efficiency of the conjugate may be 40 to 70%. More specifically, it may be 40 to 60%, 50 to 70%, or 55 to 70%, but is not limited thereto.

In one embodiment, the mixing weight ratio of the biocompatible polymer and ABT263 is 7 to 1: 5 to 1, 7 to 2: 5 to 1, 6 to 2: 5 to 2, 6 to 2: 4 to 2, 5 to 2. 2: 4 to 2, 5 to 3: 4 to 2.

In one embodiment, the disc disease may be herniated disc, back pain, infection, or chordoma. More specifically, it may be a degenerative disc herniation.

In one embodiment, the composition may reduce the expression of Mmp13, Adamts4, Cox2, iNos, and Ngf. The gene or protein whose expression is reduced may be a Senescence Associated Secretary Phenotype (SASP), which includes interleukin-6 (IL-6), interleukin-8 (IL-8), and interleukin-1α / β ( IL-1α/β), ECM catabolic enzymes, and pro-inflammatory cytokines such as nitric oxide. In the case of discs with degenerative disc disease, inflammation and degeneration occur in the disc, leading to the expression of age-related secretory phenotypes such as inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX2), and nerve growth factor (NGF). You can see that this is increasing.

In one embodiment, the pharmaceutical composition may be effective in removing senescent cells within the disc.

The term “prevention” refers to any action that inhibits or delays the onset of a disease by administering the composition.

The term “treatment” refers to the treatment, for an individual suffering from a disease or at risk of developing a disease, of improving the condition of the individual (e.g., one or more symptoms), delaying the progression of the disease, delaying the onset of symptoms, or preventing the progression of symptoms. refers to any form of treatment that provides effects including slowing. Accordingly, the terms “treatment” and “prevention” are not intended to imply cure or complete elimination of symptoms.

The pharmaceutical composition may contain the active ingredient alone, or may be provided as a pharmaceutical composition including one or more pharmaceutically acceptable carriers, excipients, or diluents.

Specifically, the carrier may be, for example, a colloidal suspension, powder, saline solution, lipid, liposome, microsphere, or nano-spherical particle. They may form complexes or associate with delivery vehicles and may be used in the art as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation agents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancers or fatty acids. It can be transported in vivo using known delivery systems.

When the pharmaceutical composition is formulated, it may be prepared using commonly used diluents or excipients such as lubricants, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, fillers, extenders, binders, wetting agents, disintegrants, and surfactants. You can. Solid preparations for oral administration may include tablets, pills, powders, granules, capsules, etc., and these solid preparations may contain at least one excipient, such as starch, calcium carbonate, or sucrose. ) or it can be prepared by mixing lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. . Preparations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used, and when manufacturing in the form of eye drops, known diluents or excipients can be used. there is.

In addition, the pharmaceutical composition may be administered in combination with an existing treatment for disc disease, that is, it may be provided by mixing with a composition for preventing or treating disc disease known in the art.

The pharmaceutical composition can be administered in parallel with a known composition that has a disc disease prevention or treatment effect, and can be administered simultaneously, separately, or sequentially, and can be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.

The term "administration" means introducing a predetermined substance into an individual by an appropriate method, and "individual" refers to all living organisms such as rats, mice, and livestock, including humans, that may have infertility or infertility. As a specific example, it may be a mammal, including humans.

In one aspect, the route of administration of the pharmaceutical composition is, but is not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, This includes topical, sublingual, or rectal administration.

The composition can be administered orally or parenterally, and when administered parenterally, the injection method can be selected for external application through the skin, intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. Specifically, it can be administered for external use in the form of an application applied to the skin outside the body organ where the disc is present, or it can be injected directly into the disc itself in the form of an injection. More specifically, the pharmaceutical composition may be injected directly into the disc in the form of an injection.

The pharmaceutical composition is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type of patient's disease, the severity, the activity of the drug, the drug It can be determined based on factors including sensitivity, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The administration may be administered once a day, or may be administered several times.

Specifically, the effective amount of the pharmaceutical composition may vary depending on the patient's age, condition, weight, absorption of the active ingredient in the body, inactivation rate, excretion rate, type of disease, concomitant drug, route of administration, and severity of obesity. , may increase or decrease depending on gender, weight, age, etc.

Another aspect is to provide a method for preventing or treating disc disease, comprising administering the pharmaceutical composition to an individual having a disc-related disease.

The meaning of terms such as “pharmaceutical composition,” “disc disease,” “individual,” “administration,” “prevention,” or “treatment” may be within the above-mentioned range.

Another aspect is to provide a health functional food composition for preventing and improving disc disease containing ABT263 as an active ingredient.

Among the terms or elements mentioned in the description of the health functional food composition, those that are the same as those already mentioned are as described above.

The term “improvement” may refer to any action that results in at least a reduction in the severity of a parameter associated with the condition being treated, such as symptoms. At this time, the health functional food can be used simultaneously or separately with a drug for treatment before or after the onset of the disease in order to prevent or improve disc disease.

In the health functional food, the active ingredient can be added directly to the food or used together with other foods or food ingredients, and can be used appropriately according to conventional methods. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention or improvement). In general, when manufacturing a food or beverage, the health functional food may be added in an amount of about 15% by weight or less, more specifically about 10% by weight or less, based on the raw materials. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range.

The health functional food may be formulated with one selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquid formulations, further including one or more of carriers, diluents, excipients, and additives. Foods to which compounds according to one aspect can be added include various foods, powders, granules, tablets, capsules, syrups, beverages, gum, tea, vitamin complexes, health functional foods, etc.

Specific examples of the carriers, excipients, diluents and additives include lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose. , a group consisting of polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil. It may be at least one selected from.

In addition to containing the effective ingredients, the health functional food may contain other ingredients as essential ingredients without any particular restrictions. For example, like regular beverages, it may contain various flavoring agents or natural carbohydrates as additional ingredients. Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those mentioned above, natural flavoring agents (thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. You can. The ratio of the natural carbohydrates can be appropriately determined by the selection of a person skilled in the art.

In addition to the above, health functional foods according to one aspect include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavors, colorants and thickening agents (cheese, chocolate, etc.), pectic acid and salts thereof. , alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. These components can be used independently or in combination, and the proportions of these additives can also be appropriately selected by those skilled in the art.

Figure 1 shows the results of confirming the shape and size of PLGA-ABT.
Figure 2 shows the results comparing senescent cells in the degenerative disc and control group and the results after ABT263 treatment.
Figure 3 shows the results of confirming the effective concentration of ABT263 for AF cells and NP cells.
Figure 4 shows the results of confirming the drug release and drug efficacy of PGLA-ABT.
Figure 5 shows the results confirming the persistence and toxicity of PLGA-ABT in the IVDD mouse model.
Figure 6 shows the results confirming the effect of PLGA-ABT in eliminating senescent cells in the IVDD mouse model.
Figure 7 shows the results confirming the effect of PLGA-ABT on reducing SASP expression in the IVDD mouse model.
Figure 8 shows the results of confirming whether PLGA-ABT induces apoptosis in normal disc cells.
Figure 9 shows the results confirming the disc recovery effect of PGLA-ABT in degenerative disc.

[Manufacturing example]

Preparation Example 1: Separation of senescent annulus fibrosus cells and nucleus pulposus cells

Degenerated intervertebral disc (IVD) tissue was obtained from four male and two female patients who underwent lumbar discectomy and posterior interbody fusion for lumbar disc herniation and lumbar spinal stenosis. The mean age of patients was 48.0 ± 23.4 years (range, 21–86 years). The degree of disc degeneration at the index level was determined using Pfirrmann's grading system. Three patients had grade 3 and three patients had grade 4. Senescent annulus fibrosus (AF) and nucleus pulposus (NP) cells were isolated from the patient's lumbar disc. The institutional ethics review committee of Bundang Cha Hospital approved this study (approval number 2019-04-049-002), and written consent was obtained from all patients. Rat IVD tissue was obtained from the tail disc of healthy 6-week-old female Sprague-Dawley rats (Orient Bio Inc, Korea).

Human or rat IVD tissues were washed three times with HBSS solution (Sigma-Aldrich, USA) supplemented with 100 U ^ml penicillin and 100 ug ml ^-1 streptomycin (P/S; Gibco, USA). According to the different anatomical features of the two regions, the tissue was separated into NP and AF, cut into small pieces, and filtered through a 40 μm strainer (SPL, Korea) to remove impurities. Tissue remaining on the top of the strainer was collected and digested with 1.5% (w/v) protease from F12 supplemented with 5% fetal bovine serum and P/S on a shaker for 1 h at 37 °C. After digestion, the specimens were collected and washed three times with HBSS solution supplemented with P/S. After washing, samples were digested again with 0.012% (w/v) collagenase II from F12 supplemented with 5% FBS and 1% P/S on a shaker for 16 h at 37°C. After digestion, samples were passed through a 70 μm strainer and cells were collected by centrifugation at 2,000 rpm for 5 min. The cell pellet was resuspended in RBC lysis buffer (Biolegend, USA), left for 10 min, and then centrifuged at 2,000 rpm for 5 min to collect the cells. The collected cell pellets were washed and incubated with F12 supplemented with 10% FBS and P/S. Senescent annulus fibrosus and nucleus pulposus cells isolated from each human and rat were used separately for experiments.

Preparation Example 2: Preparation of IVDD mouse model

The IVDD mouse model was prepared as follows. Six-week-old female Sprague-Dawley rats (220-240 g, Orient Bio Inc., Korea) were anesthetized by intraperitoneal injection of Zoletil® (50 mg kg-1) and Rompun® (10 mg kg-1). The tail skin was sterilized with 70% alcohol and povidone iodine, and a dorsal midline skin incision was made to reveal the IVD. The caudal discs (Co6/7 and Co7/8) were punctured with a 20-gauge sterile needle from the dorsal to the ventral side of the tail. The needle was placed perpendicular to the skin to ensure insertion in the center of the disc level through the AF and into the NP. The needle was limited to a depth of 5 mm and rotated 360 degrees twice and held for 30 seconds. The temperature of the rectal area was maintained at 37°C by a thermostatically controlled heating pad. The skin was sutured and disinfected. To prevent hypothermia, all animals were kept on a heating pad and injected subcutaneously with 0.9% saline (5 ml). Patients were prophylactically administered antibiotics (Cefazolin, CKD Pharmaceuticals, South Korea) and analgesics (Ketoprofen, SCD Pharm. Co. Ltd, South Korea) for 3 days after surgery. All animals were housed in an environment with a temperature of 22 ± 1°C, relative humidity of 50% ± 1%, and a life/dark cycle of 12/12 h. Animal study procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of CHA Bundang Medical Center (IACUC180167).

Preparation Example 3: Preparation of PLGA-ABT (PLGA-ABT263)

PLGA nanoparticles (PLGA-NP; PLGA-nanoparticles) were synthesized and prepared as follows to be used as a carrier for ABT263 delivery, and the results were confirmed.

Nanoparticles were prepared using PLGA (LA: GA = 85:15, Sigma-Aldrich, USA) by emulsion solvent evaporation method. PLGA (1% w/v) and ABT263 were dissolved in methylene chloride (polymer:drug = 4:3). The polymer-drug solution was added dropwise to an aqueous poly(vinyl alcohol) solution (0.5%, w/v) and sonicated three times every 10 s to form an oil-in-water emulsion. The solution with the emulsion was stirred for 3 hours and left overnight. It was centrifuged at 17,000 g for 15 minutes, washed three times with distilled water, and then lyophilized to remove residual solvent. To make control PLGA-NPs without ABT263, the same procedure was used without adding drugs. Nanoparticles for testing in vivo retention were prepared using Cy5.5-NHS (polymer: Cy5.5-NHS = 120:1, Thermo Fisher Scientific, USA) instead of drug. The morphologies of PLGA-ABT and PLGA-NP were observed by scanning electron microscopy (JSM-7800F Prime, JEOL Ltd, Japan). The size and size distribution of PLGA-ABT and PLGA-NP were measured by dynamic light scattering (Zeta-sizer Nano ZS, Malvern Instruments, UK). PLGA-ABT and PLGA-NP were dispersed in aqueous poly(vinyl alcohol) solution (0.1%, w/v).

As a result, as shown in Figure 1, the shape of PLGA-ABT was confirmed to be a sphere by scanning electron microscopy (Figure 1A). Dynamic light scattering analysis showed that the average diameter of PLGA-ABT was 494 nm (Figure 1B).

[Experimental example]

Experimental Example 1: Identification of senescent cells in degenerative disc

The following in vitro experiment was performed to determine whether senescent cells exist in the annulus fibrosus (AF) and nucleus pulposus (NP) cell tissues of human IVDD patients.

Human AF and NP cells were seeded at a density of 2 x 10 ⁴ cells cm ^-2 and cultured at 37°C with 5% CO ₂ . To stain senescent cells, the SA-β-gal staining kit (#9860, Cell Signaling Technology, USA) was used according to the manufacturer's instructions. Cells were fixed in fixation solution for 15 min and incubated with β-galactosidase staining solution adjusted to pH 6 overnight in a dry incubator. Stained cells were imaged under a light microscope (IX71, Olympus, Japan).

As a result, as shown in Figure 2, most of the AF and NP cells isolated from healthy IVD tissues of mice were stained with HMGB1, a non-senescent cell marker, but only 0 to 34% of AF and NP cells isolated from IVDD patients were stained with HMGB1. Staining was confirmed (Figure 2A).

This means that many senescent cells exist in the AF and NP tissues of IVDD patients.

Experimental Example 2: Confirmation of effective concentration of ABT263 for AF and NP cells

To confirm the effective concentration of ABT263 for AF and NP cells, the following experiment was performed.

To determine the effective concentration of ABT263, AF and NP cells isolated from IVDD patients were treated with various concentrations of ABT263 for 24 h.

As a result, as shown in Figure 3, AF cells showed the effect of eliminating senescent cells when the ABT263 concentration was 0.3125 μM or higher, and it was confirmed that 0.3125 μM was the effective concentration (Figure 3A). Additionally, as shown in Figure 3, in the case of NP cells, an apoptosis inducing effect was observed when the ABT263 concentration was 15 μM or higher, and 15 μM was confirmed to be an effective concentration (Figures 3B, 3C).

Experimental Example 3: Confirmation of the effect of ABT263 on removing aged annulus fibrosus (AF) and nucleus pulposus (NP) cells

To confirm the effect of ABT263 on removing aged annulus fibrosus and nucleus pulposus cells, the following experiment was performed.

Human or rat AF and NP cells of Preparation Example 1 were inoculated at a density of 2 x 10 ⁴ cells cm ^-2 and cultured at 37°C with 5% CO ₂ . Human AF cells were treated with 0.625 (immunocytochemical analysis and SA-β-gal staining) or 1.25 μM (flow cytometry) ABT263 (MedChemExpress, USA), and human NP cells were treated with 15 μM ABT263. Rat AF and NP cells were treated with 0.625 μM ABT263. Additionally, for quantification of cleaved caspase 3 protein in human NP cells, they were treated with 500 μM H ₂ O ₂ for 6 hours and then exposed to ABT263 for 3 hours. Cell lysis buffer was prepared by adding 10x cell lysis buffer (Cell Signaling Technology, USA) and 100x PMSF (Thermo Scientific, USA) in RNAse-free water (Thermofisher, USA). Proteins were extracted from cultured cells by washing them with PBS and then treating them with lysis buffer. The buffer was collected in a tube and placed on ice for 15 min. After centrifugation at 2,000 rpm for 5 minutes, the supernatant was transferred to a new tube. The cleaved caspase 3 ELISA kit was used according to the manufacturer's instructions to measure the amount of cleaved caspase 3 in samples.

As a result, as shown in Figure 2, it was confirmed that treatment with ABT263 significantly increased the proportion of HMGB1 positive cells (Figure 2A).

Additionally, as shown in Figure 2, ABT263 treatment of AF and NP cells isolated from healthy IVD tissues of mice did not affect the proportion of HMGB1-positive cells, and SA-β-gal staining showed that ABT263 treatment did not affect senescence. Removal of cells was confirmed (Figure 2B).

Additionally, as shown in Figure 2, Propidium iodide (PI)-Annexin V staining revealed decreased PI+annexin V− cells in parallel with increased annexin V+ cells after ABT263 treatment for 24 h. (Figure 2C)

Additionally, as shown in Figure 2, it was confirmed that the expression level of cleaved caspase 3 increased. (Figure 2D)

This means that ABT263 selectively eliminates senescent cells by activating the intrinsic cell death pathway and has no significant effect on normal cells.

Experimental Example 4: Confirmation of the effect of removing aged annulus fibrosus (AF) and nucleus pulposus (NP) cells by repeated treatment of ABT263

The following experiment was conducted to confirm the effect of repeated treatment of ABT263 on removing aged annulus fibrosus (AF) and nucleus pulposus (NP) cells.

The human or rat AF and NP cells of Example 1 were inoculated at a density of 2 x 10 ⁴ cells cm ^-2 and cultured at 37°C with 5% CO ₂ . To test the effect of repeated exposure to ABT263 on human AF cells, cells were treated with 1.25 μM ABT263 on days 0 and 2.

As shown in Figure 2, when AF cells isolated from IVDD patients were treated with ABT263 once, the proportion of healthy (HMGB1-positive) cells increased after 1 day of treatment but decreased significantly after 3 days of treatment. was confirmed (Figure 2E).

In contrast, multiple treatment with ABT263 confirmed maintaining an increased proportion of healthy (HMGB1-positive) cells at day 3.

This means that repeated treatment with ABT263 is required to effectively remove senescent cells from degenerated IVD tissue.

Experimental Example 5: Confirmation of drug capture efficiency and drug release amount of PLGA-ABT

The following experiment was conducted to confirm the drug capture efficiency and drug release amount of PLGA-ABT.

To measure the amount of ABT263 loaded on PLGA-ABT, 1 mg of PLGA-ABT loaded with ABT263 was dissolved in 1 ml of dimethyl sulfoxide (Sigma, USA). The solution was filtered through a 0.45 μm syringe filter (Millipore, USA) and the concentration of ABT263 was determined by HPLC. Drug entrapment efficiency was calculated as drug entrapment (%) = (weight of ABT263 captured in PLGA-NPs/weight of PLGA-ABT) x 100. ABT263 capture efficiency was 57% as measured by high-performance liquid chromatography (HPLC).

To determine the amount of ABT263 released from PLGA-ABT in vitro, 0.1 M citric acid solution (pH 5.5) was used as a buffer to simulate the acidic environment of the degenerated IVD. Three individual PLGA-ABT samples were used for drug release testing. Each sample was resuspended in buffer and stirred on a shaker (Labogene, USA) in an incubator at 37°C. At various time points, 1 ml of sample was taken and subjected to three centrifugations at 17,000 g for 15 min, one wash in distilled water, one wash in 5% Tween 20 (v/v), and finally three washes in distilled water. Washed PLGA-ABT was freeze-dried for 2 days, samples were dissolved in DMSO (Sigma, USA) and the amount of ABT263 in PLGA-ABT was determined by HPLC. The sequences of primers used in HPLC are shown in Table 1 below.

Gene (Rat) Forward primer (5'-3') Reverse primer (5'-3') Adamts4 CGTGGTGTGTGTGTGTGT AGAGGAAAGTAGGCAGGT Cox2 TGTATGCTACCATCTGGCTTCGG GTTTGGAACAGTCGCTCGTCATC Mmp13 TGGTCCCTGCCCCTTCCCTA CCGCAAGAGTCACAGGATGGTAGTA iNos CTGCAGGTTCTTTGACGCTCGGAG GTGGAACACAGGGGGTGATGCTCC Ngf CATCGCTCTCTCTCACAGAGTT ACACTGAGGTGAGGCTTGGGT Gapdh AGACAGCCGCATCTTCTTGT TGATGGCAACAATGTCCACT

The HPLC system (HPLC 9100 series, 270 nm, Young In Chromass, Korea) was as follows. Water containing acetonitrile and 1% trifluoroacetic acid was used as the mobile phase after being filtered through a 0.45 μm filter, and gradient elution was used. A C18 column (Sunfire® C18 5.0 um, 4.6 mm x 150 mm, Waters, USA) was used at a flow rate of 1 ml min ^-1 and 50 μl of sample was used each time. Chromatographs were analyzed with the Autochro 3000 program.

As a result, as shown in Figure 4, PLGA-ABT was slowly degraded in buffer solution at 37 °C in vitro (Figure 4A). It could be confirmed that ~80% of ABT263 encapsulated in PLGA-ABT was released in vitro during the first 2 days and ~15% of the encapsulated drug was released over the next 19 days (Fig. 4B).

This means that the ABT263 delivery system of PLGA-ABT has a strong effect on senescent cells in the early stages, and has a relatively weak but steady effect on senescent cells over the following weeks.

Experimental Example 6: Confirmation of the in vitro senescent cell removal effect of PLGA-ABT

The following experiment was performed to confirm whether the PLGA-ABT delivery system can effectively remove senescent cells in vitro.

PLGA-ABT was cultured in medium for 24 h at 37 °C with 5% CO ₂ . Media conditioned with PLGA-ABT was collected after removal of PLGA-ABT via centrifugation at 17,000 g for 15 min. The conditioned medium was filtered through a 0.22 μM filter (Millipore, USA) and then used for human AF cell culture. The conditioned medium contained ABT263 as much as the daily release amount of PGLA-ABT, and was replaced every day to maintain only the daily release amount of ABT without accumulation.

As a result, as shown in Figure 4, the proportion of HMGB1-positive cells in human AF cells isolated from IVDD patients significantly increased when treated in vitro for 1 day in medium conditioned with PLGA-ABT and treated for 7 days. increased additionally (Figure 4C). This means that PLGA-ABT can be an appropriate alternative to treatment by repeated drug injections.

Experimental Example 6: Confirmation of persistence of PLGA-ABT in IVDD mouse model

To confirm the sustainability of the senescent cell removal effect of PLGA-ABT in the IVDD mouse model, the following experiment was conducted.

In the IVDD mouse model of Preparation Example 2, 4 μl of PLGA-ABT labeled with Cy5.5-NHS was injected into the tail IVD. Fluorescence was examined 30 minutes, 7 days, and 14 days after injection. Fluorescence was measured with an IVIS SpectrumCT in vivo imaging system (Xenogen, USA). Fluorescence was compared between the non-injected group and the PLGA-ABT injected group.

As a result, as shown in Figure 5, a noticeable fluorescent signal was observed in the entire caudal disc immediately after injection (Figure 5A). One week after injection, the fluorescence intensity of PLGA-ABT was maintained in the caudal disc. At 2 weeks after injection, the fluorescent signal remained in the caudal disc but was slightly reduced.

Experimental Example 7: Confirmation of toxicity of PLGA-ABT in IVDD mouse model

To evaluate the in vivo toxicity of PLGA-ABT, the following experiment was performed.

PLGA-ABT was injected into the damaged disc of the mouse model in Preparation Example 2 (13 μg ABT263 per damaged disc). As a control group, five rats received intradiscal injections of PBS. To assess in vivo toxicity, blood samples were collected from mice at 1 and 3 weeks after injection. Blood samples were centrifuged at 3,500 rpm for 15 min at 4 °C to obtain serum. Serum concentrations of platelets, ALT, AST, BUN and creatinine were analyzed using an automated biochemical analyzer (AU680, Beckman coulter, US).

As a result, as shown in Figure 5, the levels were within the normal range (685-1436 x 103 cells/μL for platelets, 54-298 U/L for AST, 35-80 U/L for ALT, 10 for BUN). -21 mg/dl), and there was no significant difference between the PLGA-ABT group and the PBS group (Figure 5B).

This means that PLGA-ABT is not toxic in vivo.

Experimental Example 8: Confirmation of the effect of PLGA-ABT in eliminating senescent cells in the IVDD mouse model

To confirm the effect of PLGA-ABT in eliminating senescent cells in the IVDD mouse model, the following experiment was conducted.

Caudal IVD degeneration was induced in rats using needle puncture (Co 6-7 and Co 7-8). Two weeks later, PBS (Veh), PLGA nanoparticles (PLGA-NP), or PLGA-ABT were injected into the degenerated IVD (Co 6-7 and Co 7-8) (Figure 6A). Additionally, Veh and PLGA-ABT were injected into the intact normal IVD (Co 5-6).

To determine whether PLGA-ABT injection eliminates senescent cells in NP and AF tissues of damaged IVD, β-galactosidase (SA-β-gal) staining was performed as follows.

Rat coccyxes were dissected and fixed in 0.2% glutaraldehyde at 4 °C for 1 day and decalcified in 10% EDTA for 3 to 4 days. After extensive washing, samples were infiltrated overnight with 30% sucrose solution, embedded in Tissue Tek OCT (Sakura Finetek USA, Torrance, CA), and cut into 3-μm-thick sections. Sections were rinsed in PBS and incubated overnight at 37 °C in SA-β-gal staining solution (1 mg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, 40 mM citric acid/sodium phosphate). (pH 6.0), 150mM NaCl, 2mM MgCl2, 5mM potassium ferrocyanide, 5mM potassium ferricyanide). After three washes with PBS, sections were briefly washed in distilled water and counterstained with Nuclear Fast Red (NFR, Biomeda Foster City, CA) for 5 min. The percentage of SA-β-gal-positive cells was determined using ImageJ (National Institutes of Health, Bethesda, MD, USA).

As a result, as shown in Figure 6, 2 weeks after injury, SA-β-gal positive cells increased in NP and AF tissues compared to the case without injury (normal undamaged IVD, Nor), and PLGA-ABT was used in the disc. It was confirmed that direct intraocular injection significantly reduced SA-β-gal-positive cells in the NP and AF tissues of the damaged IVD at 1 week after injection compared to injecting Veh or PLGA-NP (Figure 6B). . Additionally, PLGA-ABT injection did not affect the number of SA-β-gal-positive cells in the intact normal IVD group.

This means that PLGA-ABT injection selectively eliminates senescent cells in both AF and NP tissues and does not affect normal cells.

To determine whether PLGA-ABT injection eliminates senescent cells in damaged IVD tissue, immunostaining for p16INK4a and HMGB1 was performed as follows.

IVD tissue was collected and stored in 4% PFA solution. A 5–10 μm thick lesional portion of the IVD was dewaxed, rehydrated, and labeled with Type 2 collagen (1:1,000, Abcam, UK), p16INK4a (1:400, Abcam, UK), and MMP13 (1:1600, Abcam, UK). ), PCNA (1: 10000, Abcam, UK) and HMGB1 (1: 1,600, Abcam, UK). After 24 h, sections were washed with PBS and incubated with DISCOVERY UltraMap anti-Ms HRP, DISCOVERY UltraMap anti-Rb HRP (Roche Diagnostics Ltd, Switzerland) and Alexa 488-conjugated secondary antibodies (Invitrogen, USA). After washing, specimens were stained with DAPI (1:500, Abcam, UK) for 10 min. Sections were mounted and examined using a fluorescence microscope (Zeiss 880, Germany and Leica SP5, Germany).

As shown in Figure 6, immunostaining for p16INK4a and HMGB1 after 6 weeks of treatment showed that PLGA-ABT injection decreased the expression of p16INK4a and increased the expression of HMGB1 in NP and AF cells compared to Veh or PLGA-NP injection. It was shown that (Figure 6C, 6D).

This means that direct intradisc injection of PLGA-ABT can effectively remove senescent cells from the damaged IVD.

Experimental Example 8: Confirmation of the effect of PLGA-ABT on reducing SASP expression in the IVDD mouse model

An experiment was conducted to confirm the effect of PLGA-ABT in reducing the expression of SASP (senescence-associated secretory phenotype) in the IVDD mouse model.

Caudal IVD degeneration was induced in rats using needle puncture (Co 6-7 and Co 7-8). Two weeks later, PBS (Veh), PLGA nanoparticles (PLGA-NP), or PLGA-ABT were injected into the degenerated IVD (Co 6-7 and Co 7-8) (Figure 6A). Additionally, Veh and PLGA-ABT were injected into the intact normal IVD (Co 5-6).

Expression of SASP-related factors was measured as follows. To extract RNA from IVD tissue, the tissue was first homogenized. Total RNA was extracted from samples using QIAzol (Qiagen, Germany). Extracted RNA was reverse transcribed into cDNA using RT premix (Bioneer, South Korea) using the manufacturer's protocol. qRT-PCR was performed using the StepOnePlus Real-Time PCR System with TOPreal™ qPCR 2X PreMIX using the manufacturer's protocol for Adamts4, Cox2, Mmp13, Ngf and Nos. Relative gene expression was calculated with the 2-ㅿㅿCt method, which normalizes the expression level of target genes to the GAPDH expression level.

As a result, as shown in Figure 7, MMP13 expression increased in the degenerative disc of the mouse model in both protein (Figure 7A) and mRNA (Figure 7B). Single intradiscal injection of PLGA-ABT significantly reduced Mmp13 expression compared to Veh or PLGA-NP injection. Additionally, PLGA-ABT injection significantly reduced the mRNA expression of Adamts4, Cox2, iNos, and Ngf (Figure 7B and Table 1).

This means that PLGA-ABT injection can reduce SASP expression in damaged IVD through removal of senescent cells.

Experimental Example 9: Confirmation of the effect of PLGA-ABT on IVDD inhibition and IVD structure restoration in the IVDD mouse model

To confirm the effect of PLGA-ABT on IVDD inhibition and IVD structure restoration in the IVDD mouse model, expression level analysis of apoptotic factors, MRI, and safranin-O staining were performed.

TUNEL analysis was performed as follows. IVD tissues were collected and stored in 4% paraformaldehyde (PFA) for 24 h, then supplied with TUNEL assay kit (TACS®2 TdT-DAB in Situ Apoptosis Detection kit, R&D Systems, USA). protocol was used. Histological sections (10 μm) were deparaffinized, dehydrated, and incubated in Protinase K solution for 1 h. Incubate sections in quenching solution for 10 min and then soak in 1X TdT labeling buffer for 5 min. TUNEL Reaction Mix (Labeling Reaction Mix) was added to the sections and the sections were incubated at 37°C for 1 hour. The sections were then incubated with Streptavidin-HRP solution at 37°C in a humidity chamber. Next, the sections were soaked in 3,3-Diaminobenzidine (DAB) solution for 7 min, and then the sections were counterstained with 1% methyl green. Sections were mounted and scanned using an OLYMPUS C-mount camera adapter (U-TVO.63XC, Japan).

MRI analysis and imaging were performed as follows. The rat caudal IVD was scanned using a 9.4 T MRI spectrometer (Bruker BioSpec, USA) and a custom MR coil for sagittal and axial T2-weighted MRI scans using the following settings: The conditions for the sagittal and coronal planes are as follows.

(1) Sagittal plane; Repetition time (TR) of 5,000 milliseconds (ms), echo time (TE) of 50 ms, 200 horizontal Х 600 vertical matrix; Viewing angle 20 horizontal Х 60 vertical, 0.8 mm slices with a gap of 0 mm between each slice

(2) coronal plane; TR 5,000 ms, TE 30 ms, 150 horizontal Х 150 vertical matrix; Viewing angle 15 horizontal Х 15 vertical, 0.5 mm slices with a gap of 0 mm between each slice.

An area of high signal intensity in the mid-sagittal plane of the T2 image was defined as the outline of the NP, and the region of interest (ROI) was measured using Image J software (National Institutes of Health, Bethesda, MD, USA). Signal intensity areas and ROI ratios of damaged discs were compared with values of Co8/9 (intact) discs. This was measured by two random, independent observers.

Safranin-O staining was performed as follows. The IVD tissue was fixed in 10% neutral buffered formalin, then dehydrated and embedded in paraffin. Sections of 6 mm thickness were obtained, dewaxed, rehydrated, and stained with Safranin-O (Sigma, USA) to determine the distribution and amount of proteoglycan. All samples were subjectively assessed for tissue morphology and structure by a pathologist blinded to sample information.

As a result, as shown in Figure 8, it was shown that apoptosis of NP cells, which is an indicator of IVDD damage, was significantly increased, and it was confirmed through TUNEL analysis that IVD damage induced IVDD. One week after injection of PLGA-ABT into the normal IVD, TUNEL-positive cells were no different from the normal group at day 7, indicating that PLGA-ABT did not induce apoptosis in normal disc cells.

As shown in Figure 9, in the magnetic resonance imaging (MRI) scan of the rat tail spine, the bright signal intensity of the disc was observed in a normal healthy disc (Co8/9, blue arrow). Significant loss in both signal intensity area and signal intensity ratio was identified in damaged IVDs administered Veh or PLGA-NPs (Co6/7 and Co7/8, red arrows). In contrast, the signal intensity area and ratio of the PLGA-ABT treatment group significantly increased.

This means that intradisc injection of PLGA-ABT can restore the moisture content of the degenerative disc due to damage.

Additionally, as shown in Figure 9, it was confirmed that healthy IVD has a high ratio of proliferating cells and progenitor cells, and that IVDD is associated with reduced cell proliferation ability. A single injection of PLGA-ABT in NP tissue significantly increased the number of PCNA-positive cells, which was similar to that of normal IVD.

This means that PLGA-ABT treatment can activate quiescent progenitor-like populations for IVD regeneration.

Additionally, as shown in Figure 9, the results for type II collagen (Figure 6C) and safranin O staining (Figure 6D) of the IVD (Nor group vs. Inj group) showed that damage-induced disc degeneration was associated with IVD ECM (Figure 6C and D). We confirmed that it resulted in a significant decline at day 0 (=2 weeks post-injury): a single intradiscal injection of PLGA-ABT significantly reduced type II collagen-positive areas and Safra compared to the Veh or PLGA group at week 6 and the Inj group at day 0. The Nin-O positive area was significantly increased.

A histological scoring system was used for Safranin-O staining to evaluate the extent of IVDD according to structure, cellularity and morphology, NP and AF, as shown in Figure 9, after 6 weeks of treatment, PLGA-ABT treated IVD tissue showed better histological scores compared to IVD tissue treated with Inj, Veh, or PLGA.

This means that PLGA-ABT treatment can inhibit IVDD progression and restore IVD structure after injury-induced disc degeneration by removing senescent cells and SASP from damaged IVD.

Claims (12)

A pharmaceutical composition for preventing and treating disc disease containing ABT263 as an active ingredient,
The ABT263 forms a complex with a biocompatible polymer,
The ABT263 is 15 to 20 μM,
The mixing weight ratio of the biocompatible polymer and ABT263 is 7 to 1: 5 to 1,
A pharmaceutical composition for preventing and treating disc disease, wherein the disc disease is intervertebral disc herniation. The method of claim 1, wherein the biocompatible polymer is polyethylene glycol, polypropylene glycol, ethylene glycol-propylene glycol copolymer, polyoxyethylated polyol, polysaccharide, dextran, polyvinyl ethyl ether, PLA (polylactic acid), polyvinyl alcohol. (PVA), poly(p-xylylene) polymer, poly(ε-caprolactone) (PCL), poly(valerolactone) (PVL), poly(ε-decalactone) (PDL), poly(1, 4-dioxane-2,3-dione), poly(1,3-dioxan-2-one), poly(para-dioxanone) (PDS), poly(hydroxybutyric acid) (PHB), poly( For the prevention and treatment of disc disease, which is at least one selected from the group consisting of hydroxyvaleic acid (PHV), ethylene vinyl acetate and poly (cetemal acid) (PMLA), glycolic acid (PGA), and polylactic-glycolic acid (PLGA). Pharmaceutical composition. The method of claim 1, wherein the conjugate of ABT263 and a biocompatible polymer is prepared by a solvent evaporation method, a spray drying method, a solvent extraction method, or a microfluidic method. Pharmaceutical composition for preventing and treating in-disc disease. The pharmaceutical composition for preventing and treating disc disease according to claim 3, wherein the diameter of the complex is 200 nm to 2 μm. The pharmaceutical composition for preventing and treating disc disease according to claim 3, wherein the drug capture efficiency of the conjugate is 40 to 70%. The pharmaceutical composition for preventing and treating disc disease according to claim 1, wherein the composition reduces the expression of Mmp13, Adamts4, Cox2, iNos, and Ngf. The pharmaceutical composition for preventing and treating disc disease according to claim 1, wherein the pharmaceutical composition is effective in removing senescent cells in the disc. The pharmaceutical composition for preventing and treating disc disease according to claim 3, wherein the conjugate of ABT263 and a biocompatible polymer is used to release ABT263 in sustained release. The pharmaceutical composition for preventing and treating disc disease according to claim 3, wherein the conjugate of ABT263 and a biocompatible polymer releases ABT263 directly into the disc. A health functional food composition for preventing and improving disc disease containing ABT263 as an active ingredient,
The ABT263 forms a complex with a biocompatible polymer,
The ABT263 is 15 to 20 μM,
The mixing weight ratio of the biocompatible polymer and ABT263 is 7 to 1: 5 to 1,
A health functional food composition, wherein the disc disease is intervertebral disc herniation. A method for preventing or treating disc disease comprising administering the pharmaceutical composition of claim 1 to an individual having disc disease. The method of claim 11, wherein the administration is repeated administration.