KR20240043174A - microRNA from serum for diagnosis or prediction of oral cancer and uses thereof - Google Patents

Abstract

The present invention relates to serum-derived microRNA for diagnosing or predicting oral cancer and its use, by analyzing the expression level of serum-derived miR-92b-3p, miR-629-5p, miR-92a-3p or miR-320c of the present invention. It may be useful for diagnosing or predicting oral cancer, or for screening oral cancer treatments.

Description

Serum-derived microRNA for diagnosis or prediction of oral cancer and uses thereof {microRNA from serum for diagnosis or prediction of oral cancer and uses thereof}

The present invention relates to serum-derived microRNA for diagnosing or predicting oral cancer and its use.

Head and neck cancer refers to all types of malignant tumors that occur in the nose, paranasal sinuses, oral cavity, face, larynx, pharynx, salivary glands, and thyroid gland. Depending on the location of occurrence, oral cancer, laryngeal cancer, pharynx cancer, salivary gland cancer, thyroid cancer, etc. It can be divided into sinonasal cancer, etc. Among head and neck cancers, oral cancer occurs in the tongue, base of the tongue, buccal mucosa, gums, palate, retromolar triangle, lips, and jawbone, and more than 90% of oral cancer occurs in the squamous epithelial cells that make up the mucosa in the mouth. It is a type of squamous cell carcinoma that occurs in the early stages, showing redness or changes in the mucous membrane and developing infiltrative or extrinsic lesions as it progresses. In addition, adenoid cystic carcinoma, mucoepidermoid carcinoma, and adenocarcinoma occurring in the minor salivary glands may occur.

To prevent common oral cancers that occur in the oral cavity, quitting smoking and drinking alcohol is necessary, and to prevent lip cancer, it is recommended to wear a hat or use sunscreen cream to block exposure to ultraviolet rays. Through many studies, it is known that consumption of fruits, green and yellow vegetables, vitamin A, vitamin C, and vitamin E can play a role in preventing the occurrence of oral cancer.

Most cancer diagnosis methods use invasive methods such as biopsies, but they are not easily accessible because they cause severe pain for the examiner, cause side effects due to infection, and require hospitalization and a recovery period after the test. does not exist. Since tests are generally not performed before symptoms appear, most patients are diagnosed with cancer when the cancer is already at an advanced stage. Therefore, in recent years, methods for analyzing proteins, DNA, etc. from blood, urine, feces, etc. have been actively studied to diagnose cancer through non-invasive methods.

Meanwhile, Korean Patent Publication No. 2018-0081937 discloses a 'pharmaceutical composition for the treatment of oral precancer and a method for predicting or diagnosing oral precancer or oral cancer' containing a compound that inhibits the expression of the Axin2 gene or Snail gene. Publication Patent No. 2021-0029823 discloses 'diagnosis method, information provision method, composition, and kit for oral cancer using MMP-9 in saliva', but the serum-derived microRNA panel for diagnosing or predicting oral cancer of the present invention and its use There is nothing written about it.

The present invention was developed in response to the above-mentioned needs, and the present inventors performed next-generation small RNA sequencing on serum samples from oral cancer patients and serum samples from healthy people (normal controls) to determine normal After selecting miRNAs that showed a large expression difference in oral cancer patient samples compared to the control group, a re-validation experiment was performed on oral cancer patients, and four miRNAs (miR-92a-3p, miR-92b-3p) were selected as biomarkers for oral cancer diagnosis. ,miR-320c,miR-629-5p) were finally selected. In addition, it was confirmed that the expression levels of miR-92a-3p, miR-92b-3p, miR-320c or miR-629-5p of the present invention were significantly increased in oral cancer patient samples compared to normal controls, and all four miRNAs were found to be significantly increased. The present invention was completed by confirming that when used in combination, the AUC (Area under the ROC curve), specificity, and sensitivity for oral cancer increased compared to individual miRNAs, thereby demonstrating superior oral cancer diagnosis.

In order to solve the above problems, the present invention provides a biomarker composition for diagnosing or predicting oral cancer comprising at least one microRNA selected from the group consisting of miR-92b-3p and miR-629-5p as an active ingredient.

Additionally, the present invention provides a composition for diagnosing or predicting oral cancer, including an agent for measuring the expression level of one or more microRNAs selected from the group consisting of miR-92b-3p and miR-629-5p.

Additionally, the present invention provides a kit for diagnosing or predicting oral cancer comprising the composition.

In addition, the present invention provides the following steps: (1) measuring the expression level of one or more microRNAs selected from the group consisting of miR-92b-3p and miR-629-5p from an isolated biological sample from a patient suspected of oral cancer; (2) comparing the expression level with a normal control sample; and (3) determining oral cancer when the expression level is higher than that of a normal control sample.

In addition, the present invention provides the following steps: (1) measuring the expression levels of miR-92b-3p, miR-629-5p, miR-92a-3p, and miR-320c from an isolated biological sample from a patient suspected of oral cancer; (2) comparing the expression level with a normal control sample; and (3) determining oral cancer when the expression level is higher than that of a normal control sample.

In addition, the present invention provides a therapeutic agent for oral cancer, comprising measuring the expression level of one or more microRNAs selected from the group consisting of miR-92b-3p and miR-629-5p after administration of a candidate substance expected to be able to treat oral cancer. A screening method is provided.

In addition, the present invention provides a treatment for oral cancer, comprising measuring the expression levels of miR-92b-3p, miR-629-5p, miR-92a-3p, and miR-320c after administration of a candidate substance expected to treat oral cancer. Provides a screening method.

The present invention can be useful in the diagnosis or prediction of oral cancer or in the screening of oral cancer treatments by analyzing the expression level of serum-derived miR-92b-3p, miR-629-5p, miR-92a-3p, or miR-320c. It is expected that there will be.

Figure 1 shows small RNA sequencing results for patients with oral squamous cell carcinoma (OSCC). (A) is a heat map showing 42 differentially expressed mature miRNAs (DEmiRNAs) that are differentially expressed between oral cancer patients and healthy people, and (B) is a heat map showing significant differences between oral cancer patients and healthy people. It is a volcano plot showing DEmiRNAs in response to fold change (yellow: 26 up-regulated DEmiRNAs with a fold change value of 3 or more, blue: 16 down-regulated DEmiRNAs with a fold change value of -3 or less), ( C) is a Venn diagram showing that 9 candidate DEmiRNAs were selected by analyzing small RNA sequencing results for OSCC at Chungnam National University Hospital (CNUH) and OSCC genome information from TCGA, and (D) is a Venn diagram showing the selected candidates This is a heatmap showing the expression levels of 9 DEmiRNAs.
Figure 2 shows the results of qRT-PCR on serum samples from OSCC patients and healthy people at Chungnam National University Hospital. (A) shows the results of confirming the expression levels of miR-92a-3p, miR-92b-3p, miR-320c, and miR-629-5p in serum samples from OSCC patients and healthy people, and (B) shows the results of confirming the expression levels of (C) is the result of confirming the expression levels of miR-92a-3p, miR-92b-3p, miR-320c, and miR-629-5p in human serum samples, and (C) shows the expression levels of miR-92a-3p in tissue samples from OSCC patients and healthy people. This is the result of confirming the expression levels of -3p, miR-92b-3p, miR-320c, and miR-629-5p, and (D) analyzes Pearson correlation coefficients (PCC) for the qRT-PCR results. This is a scatter plot shown as follows.
Figure 3 shows ROC (receiver-operating characteristic) curve analysis performed by applying miR-92a-3p, miR-92b-3p, miR-320c, and miR-629-5p to OSCC patients at Chungnam National University Hospital (CNUH). It is a result.
Figure 4 shows the results of oral cancer treatment monitoring using miR-92a-3p, miR-92b-3p, miR-320c, and miR-629-5p of the present invention. (A) is the qRT-PCR result confirming the expression level of miRNA in the serum of OSCC patients before and after surgery (pre-ope) and after surgery (post-ope), and (B) is the results of qRT-PCR before surgery (pre-ope) of OSCC patients. , This is the qRT-PCR result confirming the level of miRNA expression in serum after surgery (post-ope), recurrence (recurrence), and reoperation (post-ope).

In order to achieve the object of the present invention, the present invention provides a biomarker composition for diagnosing or predicting oral cancer containing as an active ingredient one or more microRNAs selected from the group consisting of miR-92b-3p and miR-629-5p.

In the biomarker composition for diagnosing or predicting oral cancer of the present invention, the active ingredients may include, but are not limited to, miR-92b-3p, miR-629-5p, miR-92a-3p, and miR-320c.

In the present invention, micorRNA (miRNA) refers to 21 to 23 non-coding RNAs that regulate gene expression post-transcriptionally by promoting degradation of target RNA or inhibiting their translation. Not only miRNAs represented by specific base sequences, but also precursors (pre-miRNAs, pri-miRNAs) of the above-mentioned miRNAs, miRNAs with equivalent biological functions, such as homologs (i.e. homologs or orthologs), variants such as genetic polymorphisms, and derivatives.

The microRNA is preferably derived from human serum, but is not limited thereto.

Additionally, the present invention provides a composition for diagnosing or predicting oral cancer, including an agent for measuring the expression level of one or more microRNAs selected from the group consisting of miR-92b-3p and miR-629-5p.

The composition for diagnosing or predicting oral cancer according to the present invention preferably includes an agent for measuring the expression level of one or more microRNAs (miRNAs) selected from the group consisting of the above-mentioned miR-92b-3p and miR-629-5p, 4 It may include all agents that measure the expression levels of canine miRNAs, namely, miR-92b-3p, miR-629-5p, miR-92a-3p, and miR-320c. Oral cancer can be diagnosed or predicted more efficiently by simultaneously using agents that measure the expression levels of the four miRNAs.

In the composition for diagnosing or predicting oral cancer of the present invention, the miR-92b-3p may be composed of the nucleotide sequence of SEQ ID NO: 1, and the miR-629-5p may be composed of the nucleotide sequence of SEQ ID NO: 2, The miR-92a-3p may be composed of the nucleotide sequence of SEQ ID NO: 3, and the miR-320c may be composed of the nucleotide sequence of SEQ ID NO: 4, but are not limited thereto. Additionally, homologs of the above base sequence are included within the scope of the present invention.

In the present invention, the term 'diagnosis' means confirming the presence or characteristics of a pathological condition. For the purposes of the present invention, diagnosis is to determine whether oral cancer has developed.

In the present invention, the agent for measuring the expression level of the miRNA is not limited thereto, but is preferably an antisense oligonucleotide, primer, or probe complementary to the miRNA, and the primer or probe is used by referring to the base sequence of the miRNA. , a person skilled in the art can design it using known methods, programs or tools.

In the present invention, the term 'primer' refers to a nucleic acid sequence with a short free 3' hydroxyl group that can form a base pair with a complementary template and serves as a starting point for copying the template strand. refers to a short nucleic acid sequence that functions as a Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature. In the present invention, oral cancer can be diagnosed or predicted by performing PCR amplification using sense and antisense primers that can bind to the base sequence of miRNA (Table 3) and determining whether the desired product is produced. PCR conditions and lengths of sense and antisense primers can be modified based on those known in the art.

In the present invention, the term 'probe' refers to a nucleic acid fragment such as RNA or DNA that is as short as a few bases or as long as several hundred bases, capable of forming a specific binding to mRNA, and is labeled to confirm the presence or absence of a specific mRNA. You can. Probes may be manufactured in the form of oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes, etc. In the present invention, hybridization is performed using a probe complementary to a miRNA polynucleotide (Table 3), and oral cancer can be diagnosed or predicted based on hybridization. Selection of appropriate probes and hybridization conditions can be modified based on those known in the art.

The present invention also provides a kit for diagnosing or predicting oral cancer comprising the composition.

The kit of the present invention is Oral cancer can be diagnosed or predicted by checking whether or not miRNA (Table 3) is detected. The kit for diagnosing or predicting oral cancer of the present invention includes not only an agent (e.g., a primer or probe) for detecting the expression level of the miRNA according to the present invention, but also one or more other component compositions, solutions, or components suitable for the analysis method. Devices may be included.

The present invention also,

(1) measuring the expression level of one or more microRNAs selected from the group consisting of miR-92b-3p and miR-629-5p from an isolated biological sample from a patient suspected of oral cancer;

(2) comparing the expression level with a normal control sample; and

(3) Provides a method of providing information for diagnosing oral cancer, including the step of determining oral cancer when the expression level is higher than that of a normal control sample.

The present invention also,

(1) Measuring the expression levels of MiR-92b-3p, MiR-629-5p, MiR-92a-3p, and MiR-320c from isolated biological samples from patients suspected of oral cancer;

(2) comparing the expression level with a normal control sample; and

(3) Provides a method of providing information for diagnosing oral cancer, including the step of determining oral cancer when the expression level is higher than that of a normal control sample.

In the method according to one embodiment of the present invention, the miRNA is the same as described above.

In the present invention, the term 'biological sample' includes samples such as tissue, cells, whole blood, serum, plasma, tissue autopsy samples (brain, skin, lymph nodes, spinal cord, etc.), paraffin tissue, saliva, sputum, or urine. Without being limited thereto, the biological sample may be used in a manipulated or unmanipulated state.

In the method according to one embodiment of the present invention, the expression level of the miRNA is determined by conventional methods known in the art, such as next generation sequencing (NGS), polymerase chain reaction (PCR), and reverse transcription polymerase chain reaction. One or more methods selected from the group consisting of RT-PCR, Realtime PCR, RNase protection assay (RPA), microarray, and northern blotting. It can be measured through, but is not limited to.

In the method according to one embodiment of the present invention, the comparison of the expression level of miRNA in oral cancer patients (Table 3) with that in normal controls is absolute (e.g., μg/ml) or relative (e.g., signal of relative intensity) can be expressed as a difference.

The present invention also provides a therapeutic agent for oral cancer, comprising measuring the expression level of one or more microRNAs selected from the group consisting of miR-92b-3p and miR-629-5p after administration of a candidate substance expected to treat oral cancer. A screening method is provided.

The present invention also provides a therapeutic agent for oral cancer, comprising measuring the expression levels of MiR-92b-3p, MiR-629-5p, MiR-92a-3p, and MiR-320c after administration of a candidate substance expected to be able to treat oral cancer. Provides a screening method.

Specifically, in the presence and absence of oral cancer treatment candidates. Oral cancer treatments can be screened by comparing the change (increase or decrease) in the expression level of miR-92b-3p, miR-629-5p, miR-92a-3p or miR-320c, and preferably the Substances that indirectly or directly reduce the expression level may be selected as a treatment for oral cancer. That is, the expression level of the miRNA of the present invention is measured in a biological sample of an oral cancer patient in the absence of an oral cancer treatment candidate, and the expression level of the miRNA of the present invention is measured in the presence of an oral cancer treatment candidate, and the two are compared. A substance that reduces the expression level of the miRNA of the present invention in the presence of an oral cancer treatment candidate compared to the expression level in the absence of an oral cancer treatment candidate can be predicted as a treatment for oral cancer.

The substance that indirectly or directly reduces the expression level of the miRNA is a substance that binds complementary to the miRNA and is selected from the group consisting of PNA (Peptide Nucleic Acid), siRNA (small interfering RNA), aptamer, and antisense RNA. However, it is not particularly limited thereto, and any substance that inhibits the expression of miRNA can be used.

In the screening method for oral cancer treatment according to one embodiment of the present invention, the miRNA is the same as described above.

Hereinafter, the present invention will be described in detail by examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Collection of human-derived samples

From January 2017 to December 2019, serum samples were collected from 27 patients with oral squamous cell carcinoma (OSCC) and 21 healthy subjects (normal controls) at Chungnam National University Hospital (Korea). Additionally, tumor tissue and adjacent non-tumor tissue were collected from 7 patients with OSCC. All OSCC patients were initially diagnosed and subsequently confirmed through pathological diagnosis. The present invention was tested with approval from Chungnam National University Hospital, and the human samples used in the present invention were used after obtaining prior consent from all patients in accordance with the guidelines of Chungnam National University Hospital.

2. NGS analysis

Whole-transcriptome next generation sequencing (NGS) was performed by requesting Macrogen (Korea). Sequencing libraries were prepared using the TruSeq Rapid SBS kit or TruSeq SBS Kit v4, and sequenced using the HiSeq 2500 sequencer (Illumina, USA) according to the instructions in the HiSeq 2500 System User Guide Document #15035786 v02 HCS 2.2.70. Sequencing reads were aligned to the Homo sapiens reference genome (UCSC Genome Browser Gateway, GRCh37/hg19) sequence, and miRNAs that showed different expression patterns between experimental groups were estimated using DESeq2 and edgeR. The q -value of FDR (false discovery rate) is 0.05 or less.

3. Bioinformatics

Four serum samples from OSCC patients and six serum samples from normal controls matched for clinical characteristics such as age, gender, and past medical history were prepared for next-generation small RNA sequencing analysis. Sequencing was performed using the Illumina Hiseq2000/2500 system (LC Sciences, USA) according to the manufacturer's instructions. Differentially expressed miRNAs identified based on normalized deep-sequencing counts were analyzed using student's t -test, and screening criteria were fold change (FC) >3 and p <0.05.

All OSCC genome data from The Cancer Genome Atlas (TCGA) were obtained from the specific portal (https://tcga-data.nci.nih.gov) and cancer browser (https://genome-cancer.ucsc.edu). Volcano maps, heat maps and cluster analysis were performed using the Online Analysis Tool (https://www.chiplot.online/), a free online platform for data analysis and visualization. And the target genes of miRNA were predicted using the TargetScan 8.0 database (www.targetscan.org). Functional annotation analysis was performed using DAVID (Database for Annotation, Visualization anc Integrated Discovery; https://david.ncifcrf.gov/), GO (Gene Ontology), and KEGG (Kyoto Encyclopedia of Genes and Genomes). Network analysis of miRNA-mRNA interactions was performed using Cytoscape (version 3.7.1), an open bioinformatics software.

4. RNA extraction and qRT-PCR (Quantitative reverse transcriptase polymerase chain reaction)

Circulating miRNA (circulating miRNA) was isolated from 200 ㎕ of serum using miRNeasy serum/plasma kits (Qiagen, Germany) according to the manufacturer's instructions, and total RNA was extracted from tissue samples using TRIzol reagent (Invitrogen, USA). did. MiRNAs were quantified through SYBR Green qRT-PCR analysis, and total miRNAs were used as a template for cDNA synthesis using the miScript II RT Kit (Qiagen) according to the manufacturer's instructions. In addition, qRT-PCR for miRNA analysis was performed using the miScript SYBR Green PCR kit (Qiagen) along with the miScript analysis provided by the manufacturer using universal primers and miRNA-specific forward primers. The miRNA-specific primers were obtained from miScript primer assay, miRCURY LNA miRNA PCR Assay (Qiagen, Germany), and Bioneer (Korea). Primer information used in qRT-PCR is shown in Table 1 below.

In addition, miR-16 and miR-423-5p were used as references when performing qRT-PCR on serum samples, and RNU6 (U6 small nuclear) was used as a reference when performing qRT-PCR on tissue samples. It has been done. At the end of the PCR cycle, the melting curve was analyzed, and each sample was repeated in triplicate. Then, the expression level of miRNA was analyzed using the ^2ΔΔCT method.

5. Statistical analysis

All statistical analyzes were performed using SPSS and GraphPad Prism 8 (GraphPad Software, USA). In addition, the significance of the miRNA expression level was confirmed using the non-parametric test (Mann-Whitney U test), Independent Samples t-test, and Paired sample t-test.

The diagnostic value of differentially expressed miRNAs was analyzed using ROC (Receiver operating characteristic) curves, and a logistic regression model was used to determine the predicted probability of the combination of four miRNAs. It was composed. In addition, the levels of miRNA expression in serum and tissues were compared using Pearson correlation coefficients, and the correlation between the concentration of miRNAs and the clinicopathological characteristics of OSCC patients was confirmed using an independent samples t-test. The miRNA expression level of each experimental group was expressed as mean ± standard deviation. All p -values were two-sided, and p -values less than 0.05 were considered statistically significant.

Example 1. Profiling of miRNA expression in serum to confirm differential expression between OSCC patients and normal controls

To identify potential circulating miRNA biomarkers of oral squamous cell carcinoma (OSCC), next-generation small RNA sequencing was performed on 4 OSCC patients and 6 healthy subjects (normal controls) at Chungnam National University Hospital (CNUH) to identify the presence of circulating miRNA biomarkers in serum. The level of miRNA expression was measured.

In the initial screening, 272 differentially expressed mature miRNAs (DEmiRNAs) were identified between OSCC patients and healthy people using DESeq2 and edgeR programs, and 26 up-regulated DEmiRNAs and down-regulated DEmiRNAs were identified according to two criteria. A total of 42 DEmiRNAs, including 16 DEmiRNAs, were selected (Figure 1A). The above two criteria are as follows: 1) When DEmiRNAs in the OSCC group show at least a 3-fold difference in expression compared to the normal control group, (2) the p -value corrected through the BH (Benjamini & Hochberg) method is statistically statistically significant. If there is significance ( p ≤ 0.05). And, among the 26 upregulated DEmiRNAs, miR-92a-3p was confirmed to be upregulated the most, with a log ₂ fold change of 2.46 (Figure 1B).

In addition, in order to select specific candidate miRNAs, 9 candidate DEmiRNAs were selected by analyzing the next-generation small RNA sequencing results for OSCC patients at Chungnam National University Hospital and the OSCC genome information of TCGA (Figure 1C), and the selected candidates It was confirmed that 9 DEmiRNAs were classified into 5 up-regulated DEmiRNAs and 4 down-regulated DEmiRNAs (Figure 1D; Table 2).

Example 2. Validation of candidate DEmiRNA using qRT-PCR

qRT-PCR using the nine candidate DEmiRNAs selected above was performed on OSCC patients to verify their effectiveness as biomarkers for diagnosing oral cancer. Specifically, 23 OSCC patients at Chungnam National University Hospital [tongue, n=18; buccal mucosa, n=2; retromolar trigone, n=2; and floor of mouth mucosa, n=1] and serum samples from 15 healthy people (normal controls) were collected and qRT-PCR was performed. Among the 9 candidate DEmiRNAs, 4 miR- The expression levels of 92a-3p,miR-92b-3p,miR-320c andmiR-629-5p (Table 3) were significantly higher than those in the normal control group (Figure 2A), and the remaining five DEmiRNAs were significant between the two experimental groups. It was confirmed that there was no difference (Figure 2B).

Sequence information of four miRNAs of the present invention miRNA Sequence information (5'-3') (SEQ ID NO) miR-92b-3p UAUUGCACUCGUCCCGGGCCUCC (1) miR-629-5p UGGGUUUACGUUGGGAGAACU (2) miR-92a-3p UAUUGCACUUGUCCCGGCCUGU (3) miR-320c AAAAGCUGGGUUGAGAGGGU (4)

In addition, in order to determine whether the level of DEmiRNA expression in the serum is correlated with the level of DEmiRNA in the tissue, OSCC tissues were collected at the Chungnam National University Medical Center and qRT-PCR was performed on the four DEmiRNAs. As a result, the results for the serum samples and Likewise, the expression levels of MiR-92a-3p, MiR-92b-3p, MiR-320c, and MiR-629-5p were significantly higher at 2.79-fold, 3.79-fold, 2.23-fold, and 3.97-fold levels, respectively, compared to the normal control group. Expression was confirmed (Figure 2C).

In addition, as a result of analyzing Pearson correlation coefficients (PCC) using the qRT-PCR results for the serum and tissue samples of the OSCC patients, a significant positive correlation was found between the DEmiRNA expression level in serum and the DEmiRNA expression level in tissue. The relationship was confirmed (Figure 2D). Through these results, it was found that the four final selected genes, miR-92a-3p, miR-92b-3p, miR-320c, and miR-629-5p, were reliable biomarkers for detecting OSCC.

Example 3. Prediction of OSCC patient diagnosis using miR-92a-3p, miR-92b-3p, miR-320c, and miR-629-5p

To estimate the potential diagnostic thresholds of miR-92a-3p, miR-92b-3p, miR-320c, and miR-629-5p for serum samples from OSCC patients, the ROC for discriminating between OSCC patients and healthy subjects -operating characteristic) curve analysis was performed. The ROC curve is the most widely used to evaluate the diagnostic ability of a biomarker and provides information about the relationship between the specificity and sensitivity of the biomarker.

First, as a result of analyzing the ROC curve for OSCC patients at Chungnam National University Hospital (CNUH), when using only miR-92a-3p, the area under the curve (AUC) was 0.7108 (95% confidence interval: 0.6174- 0.8042), the sensitivity is 0.4348; When using miR-92b-3p alone, the AUC was 0.7269 (95% confidence interval: 0.6333-0.8204) and the sensitivity was 0.913; When using miR-320c alone, the AUC was 0.8206 (95% confidence interval: 0.7432-0.898) and the sensitivity was 0.6957; When using only miR-629-5p, the AUC was confirmed to be 0.7011 (95% confidence interval: 0.6045-0.7977) and the sensitivity was 0.7391. In addition, when all four miRNAs were used in combination, it was confirmed that the AUC was 0.855 and the sensitivity was 0.9855 (Figure 3 and Table 4).

In addition, the x-axis in the ROC curve represents the false positive rate (1-specificity; False Positive Rate, FPR), and the false positive rate was lowest when miR-92b-3p was used alone, and even when all four miRNAs were used in combination, the false positive rate was the lowest. This was confirmed to be low.

Through the above results, the present invention's miR-92a-3p, miR-92b-3p, miR-320c, and miR-629-5p have excellent oral cancer diagnosis effects even when used alone, but a combination of all four miRNAs can be used. In this case, it was found that the oral cancer diagnosis or prediction effect was better.

ROC curve analysis results for CNUH OSCC patients miRNA AUC False positive rate responsiveness miR-92a-3p 0.7108 0.9333 0.4348 miR-92b-3p 0.7269 0.4667 0.9130 miR-320c 0.8206 0.9556 0.6957 miR-629-5p 0.7011 0.6222 0.7391 4-miRNA panel (combine) 0.8550 0.5299 0.9855

Then, using clinical information from the TCGA database, we investigated whether the increased expression levels of miR-92a-3p, miR-92b-3p, miR-320c, and miR-629-5p in OSCC patients were associated with clinicopathological characteristics. did.

As a result, as shown in Table 5 below, high histologic grade was significantly associated with increased expression of miR-92a-3p, miR-92b-3p, miR-320c, and miR-629-5p. It was confirmed that it exists. In addition, increased expression of miR-92a-3p and miR-92b-3p is significantly associated with lymph node metastasis, and increased expression of miR-92b-3p is significantly associated with patients with lymphovascular invasion. It was confirmed that there was a correlation.

Example 4. Monitoring oral cancer treatment using miR-92a-3p, miR-92b-3p, miR-320c and miR-629-5p

Eight OSCC patients [tongue, n=6; buccal mucosa, n=1; To investigate the effect of oral cancer treatment on the expression levels of miRNAs in serum [retromolar trigone, n = 1], serum samples from oral cancer patients were collected before and after surgery (average 3 months after surgery). collected and performed qRT-PCR.

As a result, it was confirmed that the expression levels ofmiR-92a-3p,miR-92b-3p,miR-320c,miR-629-5p in serum were significantly decreased after complete resection of the primary tumor (Figure 4A). One patient relapsed 9 months after complete resection, and the expression levels of the four miRNAs in the serum increased again, but as the recurrence site was resected, the expression levels of the four miRNAs in the serum decreased (Figure 4B).

Therefore, the miR-92a-3p, miR-92b-3p, miR-320c, and miR-629-5p of the present invention can not only diagnose or predict oral cancer at an early stage, but also can be used to evaluate treatment results or recurrence of oral cancer. It could be useful.

Claims (11)

A biomarker composition for diagnosing or predicting oral cancer comprising at least one microRNA selected from the group consisting of miR-92b-3p and miR-629-5p as an active ingredient. The biomarker composition for diagnosing or predicting oral cancer according to claim 1, comprising miR-92b-3p, MiR-629-5p, MiR-92a-3p, and MiR-320c as active ingredients. A composition for diagnosing or predicting oral cancer, comprising an agent for measuring the expression level of one or more microRNAs selected from the group consisting of miR-92b-3p and miR-629-5p. The composition for diagnosing or predicting oral cancer according to claim 3, comprising an agent for measuring the expression levels of miR-92b-3p, miR-629-5p, miR-92a-3p, and miR-320c. The composition for diagnosing or predicting oral cancer according to claim 3, wherein the agent for measuring the expression level of the microRNA is an antisense oligonucleotide, primer, or probe complementary to the microRNA. The method of claim 4, wherein the miR-92b-3p is the nucleotide sequence of SEQ ID NO: 1, the miR-629-5p is the nucleotide sequence of SEQ ID NO: 2, and the miR-92a-3p is the nucleotide sequence of SEQ ID NO: 3. -320c is a composition for diagnosing or predicting oral cancer, characterized in that it consists of the base sequence of SEQ ID NO: 4. A kit for diagnosing or predicting oral cancer comprising the composition according to any one of claims 3 to 6. (1) measuring the expression level of one or more microRNAs selected from the group consisting of miR-92b-3p and miR-629-5p from an isolated biological sample from a patient suspected of oral cancer;
(2) comparing the expression level with a normal control sample; and
(3) A method of providing information for diagnosing oral cancer, including the step of determining oral cancer when the expression level is higher than that of a normal control sample. (1) Measuring the expression levels of MiR-92b-3p, MiR-629-5p, MiR-92a-3p, and MiR-320c from isolated biological samples from patients suspected of oral cancer;
(2) comparing the expression level with a normal control sample; and
(3) A method of providing information for diagnosing oral cancer, including the step of determining oral cancer when the expression level is higher than that of a normal control sample. A screening method for an oral cancer therapeutic agent comprising measuring the expression level of one or more microRNAs selected from the group consisting of miR-92b-3p and miR-629-5p after administration of a candidate substance expected to treat oral cancer. A screening method for a therapeutic agent for oral cancer, comprising measuring the expression levels of miR-92b-3p, miR-629-5p, miR-92a-3p, and miR-320c after administration of a candidate substance expected to treat oral cancer.