KR20240040035A - Chimeric Antigen Receptor Cell Prepared Using CRISPR/Cas9 Knock―and Uses Thereof - Google Patents

Abstract

The present invention relates to the number of chimeric antigens produced using gene scissors knock-in.
Relates to chimeric antigen receptor (CAR) cells and their uses. More specifically, single guide RNA (sgRNA) for TGFBR2 (TGF beta receptor 2) knock-out, chimeric specific for cancer cells. It relates to a method of producing immune effector cells in which the antigen receptor and the TGFBR2 expression gene are knocked out and the chimeric antigen receptor gene specific for cancer cells is knocked in.

Description

Chimeric antigen receptor cell prepared using gene scissors knock-in and uses thereof {Chimeric Antigen Receptor Cell Prepared Using CRISPR/Cas9 Knock-and Uses Thereof}

The present invention relates to chimeric antigen receptor (CAR) cells manufactured using gene scissors knock-in and their use, and more specifically, to TGFBR2 (TGF beta receptor 2) knock-in. A single guide RNA (sgRNA) for knock-out, a chimeric antigen receptor specific for cancer cells, and an immune effector in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for cancer cells is knocked in. It relates to cell manufacturing methods.

In recent years, development of cancer treatment treatments using chimeric antigen receptor-T cells (CAR-T cells) has been underway. Anti-CD19 CAR-T cells have shown significant therapeutic efficacy in the treatment of hematological malignancies, and two products received FDA approval in 2017. However, despite many attempts, CAR-T cells targeting various tumor-related antigens have failed to show favorable clinical outcomes in patients with solid tumors (Na Tang et.al., JCI Insight, 27;5(4):e133977 , 2020).

In 2021, B cell maturation antigen (BCMA)-specific CAR-T cells were approved for the treatment of multiple myeloma (MM), but due to their relatively high cost and time-consuming production, insufficient introduction into solid tumors, and lack of immune effectors ( Problems include induced cytotoxic effects, including immune effector cell-associated neurologic syndrome (ICANS) and cytokine release syndrome (CRS). Therefore, it is important to solve the above problems while protecting and enhancing CAR activity, and among other immune cell platforms (e.g., γ/δ T cells, NKT cells), natural killer (NK) cells can be used for CAR-using genetics. It is considered an alternative to engineering. CAR NK cells have shown several advantages over CAR T cells that may improve efficiency and safety, and the first clinical use of CD19 CAR-NK cells in patients with relapsed/refractory lymphoid malignancies was CAR. -The persistence of NK cells was demonstrated (Ali Bashiri Dezfouli et. al., Cells, 1;10(12):3390,2021).

Meanwhile, the immunosuppressive tumor microenvironment (TME) that exists in solid tumors includes numerous cell types in addition to cancer cells as well as extracellular matrix components and inflammatory mediators. In this complex microenvironment, immune effector cells introduced with CAR genes are subject to many inhibitory cells and molecules that can impair their survival, activation, proliferation, and effector functions. In a recent study, the TGFBR2 gene was knocked down using gene scissors. -Out natural killer cells were shown to have increased anticancer effects in glioblastoma multiforme (GBM) (Hila Shaim et.al., J Clin Invest., 131(14):e142116, 2021).

Accordingly, in the present invention, the negative effects of TGF-β are eliminated by knocking out TGFBR2 using the CRISPR/Cas9 system, and at the same time, the cancer cell-related antigen is targeted at the site where the TGFBR2 gene was knocked out. CAR-NK cells were produced by knocking in the CAR gene, and it was confirmed that the CAR-NK cells produced by the method of the present invention had an excellent cancer cell killing effect, and the present invention was completed.

Therefore, the purpose of the present invention is to provide a single guide RNA (sgRNA) for TGFBR2 (TGF beta receptor 2) knock-out and a TGFBR2 knock-out method using the same.

In order to achieve the above object, the present invention provides a TGFBR2 (TGF beta receptor 2) comprising one or more single guides selected from the group consisting of single guide RNAs (sgRNAs) represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6. ) Provides a single guide RNA for knock-out.

In addition, the present invention provides a single guide RNA for TGFBR2 knock-out; and

TGFBR2 (TGF beta receptor 2) knock-out, comprising any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein. Provides a composition for

In addition, the present invention provides at least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6, and

Provides a TGFBR2 knock-out method comprising treating human-derived cells with any one gene scissors selected from the group consisting of a Cas9 protein, a base sequence encoding the Cas9 protein, a Cpf1 protein, and a base sequence encoding the Cpf1 protein. do.

In a specific embodiment of the present invention, the human-derived cells are selected from the group consisting of T cells, natural killer (NK) cells, macrophages, monocytes, and dendritic cells. It may be any one immune effector cell.

In another specific embodiment of the present invention, the single guide RNA and gene scissors are delivered to immune effector cells through electroporation or a gene transfer vector, and the electroporation is performed at 1000 V to 2500 V, 5 ms to 50 ms. , and 1 pulse to 5 pulse conditions, and the gene delivery vector may be a plasmid, viral vector, or non-viral vector.

In order to achieve other purposes, the present invention,

base sequence encoding a promoter;

A base sequence encoding a signal peptide;

A base sequence encoding a cancer cell antigen-binding domain;

base sequence encoding a transmembrane domain;

base sequence encoding a costimulatory domain; and

DNA construct for chimeric antigen receptor (CAR) knock-in specific for cancer cell antigens, containing a base sequence encoding an intracellular signal transduction domain provides.

The present invention also provides a DNA fragment containing the above DNA construct.

In a preferred embodiment of the present invention, the promoter may be pSFFV, pCMV, or pEF1A, and preferably may be pSFFV represented by the base sequence of SEQ ID NO: 13.

In another preferred embodiment of the present invention, the cancer cell antigen is mesothelin (MSLN), CD22, CD19, HER2 (human epidermal growth factor receptor type 2), GD2, folate receptor, and MUC1 (Mucin 1). ), ErbB2 (Erythroblastic oncogene B-2 gene), EphA2 (EPH receptor A2), or EGFR (Epidermal growth factor receptor). Preferably, the cancer cell antigen-binding domain is mesothelin represented by the amino acid sequence of SEQ ID NO: 18. -It may be a binding domain.

In another preferred embodiment of the present invention, the transmembrane domain consists of CD8α, CD4, CD28, CD137, CD80, CD86, CD152, PD1, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46, NKG2C and OX40. the co-stimulatory domain is any one selected from the group consisting of CD28, OX-40, ICOS, NKG2D, 4-1BB, 2B4, NKp30, NKp44, NKp46 and NKG2C, and the intracellular signaling domain may be of CD3ζ origin.

In another preferred embodiment of the present invention, the signal peptide is represented by the amino acid sequence of SEQ ID NO: 14, the transmembrane domain is CD8 represented by the amino acid sequence of SEQ ID NO: 20, and the co-stimulatory domain is represented by the amino acid sequence of SEQ ID NO: 20 It is 4-1BB represented by the amino acid sequence of SEQ ID NO: 22, and the intracellular signaling domain may be CD3ζ represented by the amino acid sequence of SEQ ID NO: 24.

In another preferred embodiment of the present invention, between the base sequence encoding the signal peptide and the base sequence encoding the cancer cell antigen-binding domain, a base sequence encoding FLAG represented by the amino acid sequence of SEQ ID NO: 16 This may be additionally included.

In another preferred embodiment of the present invention, a base sequence encoding an HA (homology arm)-tag may be additionally included at the 5'-end and 3'-end of the polynucleotide.

In another preferred embodiment of the present invention, the base sequence encoding the HA (homology arm)-tag may be 200bp to 1500bp.

In another preferred embodiment of the present invention, a poly A sequence or a DNA nuclear targeting sequence (DTS) may be additionally included at the 3'-end of the polynucleotide.

To achieve another object, the present invention provides (1) at least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6;

(2) any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein; and

(3) comprising the step of treating immune effector cells with a DNA construct or DNA fragment thereof for chimeric antigen receptor (CAR) knock-in specific to the cancer cell antigen, A method for producing immune effector cells in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in is provided.

In a preferred embodiment of the present invention, the immune effector cells may be T cells, natural killer (NK) cells, macrophages, monocytes, or dendritic cells.

In another specific embodiment of the present invention, the single guide RNA, gene scissors, and DNA fragment are delivered to immune effector cells through electroporation or a gene transfer vector, and the electroporation is performed at 1000 V to 2500 V for 5 ms. Processing is performed under the conditions of ~50 ms and 1 pulse~5 pulse, and the gene delivery vector may be a plasmid, viral vector, or non-viral vector.

In another preferred embodiment of the present invention, the single guide RNA, gene scissors, and DNA fragments are treated with IL-2, IL-15, IL-21, and TGF-β1 before or after treating the immune effector cells. Immune effector cells may be additionally treated with one or more cytokines selected from the group consisting of.

In addition, the present invention provides immune effector cells prepared by the above method in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in.

Additionally, the present invention provides a pharmaceutical composition for preventing or treating cancer containing the immune effector cells.

In a preferred embodiment of the present invention, the cancer is squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung, mesothelial cancer, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, and glioma. , cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatocellular carcinoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver carcinoma, leukemia and other lymphoproliferative diseases. It may be any one selected from the group consisting of a disorder, and head and neck cancer.

In the present invention, it was confirmed that TGFBR2 expression in NK cells was effectively suppressed by single guide RNA (sgRNA) for TGFBR2 knock-out. In addition, the negative effects of TGF-β are eliminated by knocking out TGFBR2 using the CRISPR/Cas9 system, and at the same time, a CAR gene targeting cancer cell-related antigens is installed at the site where the TGFBR2 gene was knocked out. CAR-NK cells with knock-in were manufactured, and it was confirmed that CAR-NK cells prepared by the method of the present invention had an excellent cancer cell killing effect.

Therefore, the immune effector cells of the present invention in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for cancer cell antigen is knocked in can be usefully used as a composition for preventing or treating cancer.

Figure 1 is a schematic diagram showing various crRNA (CRISPR RNA) target locations within the TGFBR2 gene location.
Figure 2 shows data comparing the editing efficiency of sgRNA sequences for double knock-out using the T7E1 assay.
Figures 3(a) and 3(b) show data confirming the degree of decreased expression of editing genes using FACS.
Figure 4 is data confirming the assassination effect of TGFBR2 knock-out NK cells according to the sgRNA target location, Figure 4(a) is a schematic diagram of the experiment, Figure 4(b) is data confirming TGFBR2 knock-out efficiency, and Figure 4(c) ) is data confirming the assassination effect of NK cells.
Figure 5 shows data confirming the expression level of the CD107a marker, a degranulation marker, of TGFBR2 knock-out NK cells according to the sgRNA target location.
Figure 6 shows data confirming the degree of reduction of Phospho-Smad2/3 (p-Smad2/3) in TGFBR2 knock-out NK cells according to the sgRNA target location.
Figure 7 is data confirming the gene editing efficiency based on the T7E1 assay according to various electroporation conditions.
Figure 8 is data confirming the FACS-based gene editing efficiency according to various electroporation conditions.
Figure 9 shows data comparing the survival rate of primary NK cells according to various electroporation conditions.
Figure 10 is a schematic diagram showing the DNA construct and production process for inserting a chimeric antigen receptor (CAR) gene for mesothelin (MSLN) cancer antigen targeting.
Figure 11 is data confirming the knock-in efficiency of the CAR gene according to the knock-in of the CAR gene after single sgRNA or double sgRNA knock-out. Figure 11(a) is a schematic diagram showing the experimental process and Figure 11(b) is a schematic diagram showing the experimental process. This data confirms the knock-in efficiency of the CAR gene using the junction PCR method.
Figure 12 is a comparison of CAR gene knock-in and TGFBR2 knock-out efficiencies according to sgRNA input amount and electroporation conditions, and is data comparing CAR gene knock-in efficiency using the junction PCR method and T7E1 assay.
Figure 13 shows data comparing CAR gene knock-in efficiency according to sgRNA input amount and electroporation conditions using a FACS-based surface CAR protein detection method.
Figure 14 shows data comparing CAR gene knock-in and TGFBR2 knock-out efficiencies according to various material treatment conditions using junction PCR and T7E1 assay.
Figure 15 shows data comparing CAR gene knock-in efficiency according to various material processing conditions using a FACS-based surface CAR protein detection method.
Figure 16 is data confirming the CAR gene knock-in efficiency according to the cytokine combination, Figure 16(a) is the knock-in efficiency of the CAR gene using the junction PCR method, and Figure 16(b) is the assassination of CAR-NK cells. This is data comparing the effects of awards.
Figure 17 shows data comparing the CAR gene knock-in efficiency according to the HA length (300, 500, 700, 1000 bp) in the DNA construct for CAR gene insertion using the junction PCR method.
Figure 18 shows data confirming the cancer cell killing effect due to wild-type (wild)-CAR gene and mutant-CAR gene knock-in, and Figure 18(a) shows the wild-type (wild)-CAR gene and mutant-CAR gene knock-in. CAR gene DNA construct schematic diagram, Figure 18(b) shows the knock-in efficiency of the CAR gene using the junction PCR method, Figure 18(c) shows the degree of reduction in surface TGFBR2 expression of CAR-NK cells, and Figure 18(d) shows the knock-in efficiency of the CAR gene using the junction PCR method. This data confirms the assassination effect of CAR-NK cells.
Figure 19 is data confirming the CAR gene knock-in efficiency according to the insertion of a poly A sequence and an additional DNA nuclear targeting sequence (DTS) at the 3'-end of the CAR gene knock-in DNA construct, Figure 19 (a) ) is the poly A sequence; Or, it is a schematic diagram of the CAR gene DNA construct into which the poly A sequence and the DTS sequence of SV40, CREB, or GRE are inserted, and Figure 19(b) shows the CAR gene knock-in efficiency according to the insertion of this sequence using FACS-based surface CAR. This is data compared by protein detection method.
Figure 20 shows data comparing the knock-in efficiency of the CAR gene using a viral vector using a FACS-based surface CAR protein detection method.

Hereinafter, the present invention will be described in detail.

Using genetic scissors, it is possible to precisely knock-in the CAR gene at a specific genomic location, and by removing the unwanted gene and inserting the CAR gene at the same time, a synergy of anticancer effects can be induced. Furthermore, there is the advantage of facilitating mass production by producing CAR-NK cells using NK cells, but the activity of NK cells is reduced due to TGF-β signaling within NK cells, and the assassination effect is reduced. There is a problem.

Accordingly, in the present invention, the negative effects of TGF-β are eliminated by knocking out TGFBR2 using the CRISPR/Cas9 system, and at the same time, the cancer cell-related antigen is targeted at the site where the TGFBR2 gene was knocked out. CAR-NK cells were prepared by knocking in the CAR gene.

sgRNA for TGFBR2 knock-out

Consistently, the present invention provides a TGFBR2 (TGF beta receptor 2) knock-out method comprising at least one single guide selected from the group consisting of single guide RNAs (sgRNAs) represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6. It is about a single guide RNA for knock-out.

In another aspect, the present invention provides a single guide RNA for TGFBR2 knock-out; and

TGFBR2 (TGF beta receptor 2) knock-out, comprising any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein. It relates to a composition for use.

In the present invention, the term “single guide RNA” refers to a naturally occurring version of a two-piece guide RNA complex consisting of a single continuous sequence. A simplified single guide RNA is used to instruct the Cas9 protein to bind and cut specific DNA sequences for genome editing.

In the present invention, the term "knock-out" refers to modifying or removing a specific gene in a base sequence so that it cannot be expressed, and "knock-in" refers to modifying or removing a specific gene from a base sequence so that it cannot be expressed. It means being introduced into the host's genome so that it can be expressed.

In the present invention, the term "Genome Editing" is an artificial restriction endonuclease that recognizes a specific gene base sequence in the genome and cuts the DNA at the corresponding site, and is used for gene editing (genome editing) in human, animal and plant cells. editing), and gene scissor technology is divided into first generation zinc finger nucleases (ZFN: Zinc Finger Nuleases) and second generation TALEN (Tranion Activator-Like Effector Nucleases) depending on the type of enzyme used to cut out a specific base. ), and is divided into 3rd generation CRISPR (CRISPR/Cas9 or CRISPR/Cpf1). sgRNA, a component of CRISPR (clustered regulatory interspaced short palindromic repeat), has the ability to recognize 20bp of a specific DNA base sequence, and the Cas9 protein or Cpf1 protein cleaves the specific DNA bound to the sgRNA.

In one embodiment of the present invention, as shown in Figure 1, six types of crRNA (CRISPR RNA) regions within the TGFBR2 gene (NCBI Gene ID: 7048) were selected, and six types of sgRNA sequences were designed as shown in Table 1. did.

Specifically, sgRNA (TGFBR2-T1), represented by the base sequence of SEQ ID NO: 1, is a signal peptide (SP) portion of the TGFBR2 gene, and sgRNA (TGFBR2-T2), represented by the base sequence of SEQ ID NO: 2, is a sequence The sgRNA (TGFBR2-T3) represented by the nucleotide sequence of SEQ ID NO: 3 and the sgRNA (TGFBR2-T4) represented by the nucleotide sequence of SEQ ID NO: 4 are the extracellular domain (ECD) portion of the TGFBR2 gene and the nucleotide sequence of SEQ ID NO: 5. The sgRNA (TGFBR2-T5) represented by the base sequence and the sgRNA (TGFBR2-T6) represented by the base sequence of SEQ ID NO: 6 target the intracellular domain (ICD) portion.

In another embodiment of the present invention, to compare the editing efficiency for sgRNA sequences for double knock-out, T1 + T2 sgRNA combination, T3 + T4 sgRNA combination, and T5 + T6 sgRNA combination. As a result of checking the editing efficiency for natural killer cells (primary NK cells), it was confirmed that genes were effectively knocked out by two types of sgRNA treatment (Figure 2). In particular, it was confirmed that TGFBR2 protein expression was reduced to a high level upon treatment with T1 + T2 sgRNA or T5 + T6 sgRNA (Figure 3).

In another embodiment of the present invention, as a result of confirming the assassination effect of TGFBR2 knock-out NK cells according to the sgRNA target location, compared to NK cells in which the extracellular domain (ECD) portion of the TGFBR2 gene was knocked out, the cells Associative effect of NK cells in which the inner domain (ICD) is knocked out (Figure 4), expression level of CD107a marker, a degranulation marker (Figure 5), and phosphorylated smad2/3 (p-Smad2/3) The degree of reduction (Figure 6) was found to be high.

In another embodiment of the present invention, as a result of checking the gene editing efficiency according to various electroporation conditions, five electroporation conditions (1600 V, 10 ms, 3 pulse; 1600 V, 20 ms, 1 pulse; 1700 V, Among the following (10 ms, 3 pulse; 1700 V, 20 ms, 1 pulse; 1800 V, 20 ms, 1 pulse), editing efficiency is high in the 1600 V, 10 ms, 3 pulse condition and the 1700 V, 20 ms, 1 pulse condition. (Figures 7 and 8). In addition, as a result of comparing the survival rate of primary NK cells according to the above five electroporation conditions, it was confirmed that all five conditions did not affect the NK cell survival rate.

In another consistent aspect, the present invention provides at least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6, and

TGFBR2 knock-out method comprising treating human-derived cells with any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein. will be.

In the present invention, the human-derived cells may be any human-derived cells that express TGFBR2, and are preferably T cells, natural killer (NK) cells, macrophages, monocytes, and dendritic cells. It may be any one immune effector cell selected from the group consisting of dendritic cells.

In the present invention, the single guide RNA and gene scissors can be delivered to immune effector cells through electroporation or gene transfer vector.

The electroporation is performed under the conditions of 1000 V to 2500 V, 5 ms to 50 ms, and 1 pulse to 5 pulse, preferably under the conditions of 1600 V to 1900 V, 10 ms to 20 ms, and 1 pulse to 3 pulse. Preferably, 1600 V to 1700 V, 10 ms to 20 ms, and 1 pulse to 3 pulse conditions can be processed.

The gene transfer vector may be a plasmid, a viral vector, or a non-viral vector, and the viral vector may be an adenovirus, a retrovirus, or an adeno-associated virus (AAV). Nonviral vectors include macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

CAR gene knock-in DNA construct for targeting cancer antigens

The present invention is another consistent point,

base sequence encoding a promoter;

A base sequence encoding a signal peptide;

A base sequence encoding a cancer cell antigen-binding domain;

base sequence encoding a transmembrane domain;

base sequence encoding a costimulatory domain; and

DNA construct for chimeric antigen receptor (CAR) knock-in specific for cancer cell antigens, containing a base sequence encoding an intracellular signal transduction domain It is about (construct).

As used herein, the term “chimeric antigen receptor (CAR)” generally refers to a fusion protein containing an extracellular domain that has the ability to bind an antigen and one or more intracellular domains. CARs are chimeric antigen receptors - a core part of immune effector cells, and may include an antigen-binding domain, a transmembrane domain, a co-stimulatory domain, and an intracellular signaling domain.

In the present invention, the term “promoter” refers to the minimal sequence sufficient to direct transcription. Additionally, promoter constructs sufficient to cause regulatable promoter-dependent expression of the gene induced by cell type-specific or external signals or agents may be included, and these constructs may be located in the 5' or 3' portion of the gene. . Both conservative and inducible promoters are included. Promoter sequences may be from prokaryotes, eukaryotes, or viruses. The promoter may be pSFFV, pCMV or pEF1A. Preferably, in the present invention, the pSFFV promoter represented by the nucleotide sequence of SEQ ID NO: 13 was used, and if necessary, 90% or more, 93% or more of the nucleotide sequence of SEQ ID NO: 13. , may include sequences that are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical.

In the present invention, the term “signal peptide” generally refers to a peptide chain for guiding protein delivery. The signal peptide may be a short peptide having a length of 5 to 30 amino acids. Preferably, the DNA construct of the present invention may include a base sequence encoding a signal peptide represented by the amino acid sequence of SEQ ID NO: 14, and more preferably, the base sequence may be represented by SEQ ID NO: 15.

In the present invention, in order to determine whether CAR is expressed, a base sequence encoding FLAG represented by the amino acid sequence of SEQ ID NO: 16 is provided between the base sequence encoding the signal peptide and the base sequence encoding the cancer cell antigen-binding domain. This may be additionally included, and preferably the base sequence may be represented by SEQ ID NO: 17.

In the present invention, the term “cancer cell antigen-binding domain” generally refers to a domain capable of specifically binding to a cancer cell antigen protein. For example, the cancer cell antigen-binding domain includes mesothelin (MSLN), CD22, CD19, HER2 (human epidermal growth factor receptor type 2), GD2, folate receptor, and MUC1 (MSLN) expressed on the surface of cancer cells. It may contain antibodies or fragments thereof that can specifically bind to Mucin 1), ErbB2 (Erythroblastic oncogene B-2 gene), EphA2 (EPH receptor A2), or EGFR (Epidermal growth factor receptor) polypeptides or fragments thereof. . Preferably, the DNA construct of the present invention may include a base sequence encoding the mesothelin-binding domain represented by the amino acid sequence of SEQ ID NO: 18, and more preferably, the base sequence may be represented by SEQ ID NO: 19. .

In the present invention, the term “binding domain” refers to “extracellular domain,” “extracellular binding domain,” and “antigen-specific binding domain.” "and "extracellular antigen-specific binding domain" may be used interchangeably and refer to a CAR domain or fragment that has the ability to specifically bind to a target antigen.

In the present invention, the “transmembrane domain” generally refers to a CAR domain that passes through the cell membrane and is connected to an intracellular signaling domain to play a role in signaling. The transmembrane domain may be derived from a protein selected from the group consisting of CD8α, CD4, CD28, CD137, CD80, CD86, CD152, PD1, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46, NKG2C and OX40. Preferably, the DNA construct of the present invention may include a base sequence encoding CD8 represented by the amino acid sequence of SEQ ID NO: 20, and more preferably, the base sequence may be represented by SEQ ID NO: 21.

In the present invention, the “costimulatory domain” generally refers to an intracellular domain capable of providing immunostimulatory molecules, which are cell surface molecules necessary for an effective response to antigens in lymphocytes. The costimulatory domains described above may include costimulatory domains selected from the group consisting of CD28, OX-40, ICOS, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46 and NKG2C. Preferably, the DNA construct of the present invention may include a base sequence encoding 4-1BB represented by the amino acid sequence of SEQ ID NO: 22, and more preferably, the base sequence may be represented by SEQ ID NO: 23.

In the present invention, “intracellular signal transduction domain” generally refers to a domain located inside a cell and capable of transmitting signals. In the present invention, the intracellular signaling domain is the intracellular signaling domain of a chimeric antigen receptor. For example, the intracellular signaling domain can be selected from the CD3ζ intracellular domain, CD28 intracellular domain, CD28 intracellular domain, 4-1BB intracellular domain, and OX40 intracellular domain. Preferably, the DNA construct of the present invention may include a base sequence encoding CD3ζ represented by the amino acid sequence of SEQ ID NO: 24, and more preferably, the base sequence may be represented by SEQ ID NO: 25.

In the present invention, as shown in the schematic diagram of FIG. 10, a CAR gene knock-quote DNA construct for targeting mesothelin was designed. Specifically, the DNA construct is a structure in which the base sequences encoding each are arranged in the following order: pSFFV promoter - signal peptide - FLAG - mesothelin-binding domain - CD8 - 4-1BB - CD3ζ, for TGFBR2 knock-out of the present invention. It is characterized by insertion into the region knocked out by sgRNA.

In the present invention, a base sequence encoding HA (homology arm) may be included at the 5'-end and 3'-end of the DNA construct, and the length of the base sequence encoding HA is 200bp to 1500bp, preferably. May be 300bp to 1000bp, more preferably 500bp to 1000bp.

In another embodiment of the present invention, as a result of confirming the CAR gene knock-in efficiency according to the length of the HA (homology arm) in the vector (donor DNA) containing the CAR gene knock-quote DNA construct, the HA length was 700bp. Alternatively, it was confirmed that the knock-in efficiency increased in the case of 1000bp (FIG. 17).

In another embodiment of the present invention, as a result of confirming the knock-in efficiency of the wild-type (wild)-CAR gene and the mutant (mutant)-CAR gene DNA construct, the knock-in efficiency of the wild-type CAR gene DNA construct ( It was confirmed that the degree of reduction in surface TGFBR2 expression of etched NK cells (FIG. 18(b)), the degree of reduction in surface TGFBR2 expression of etched NK cells (FIG. 18(c)), and the assassination effect of etched NK cells (FIG. 18(d)) were all excellent.

In the present invention, a polyadenylation sequence (poly A sequence) may be included at the 3'-end of the DNA construct. Here, the term “poly A site” or “poly A sequence” refers to a DNA sequence that directs both termination and polyadenylation of the nascent RNA transcript by RNA polymerase II. Polyadenylation sequences may improve mRNA stability by adding a poly A tail to the 3' end of the coding sequence, contributing to increased translation efficiency. Because transcripts lacking the poly A tail are unstable and rapidly degraded, efficient polyadenylation of recombinant transcripts is desirable. Illustrative examples of poly A signals that can be used in the vector in the present invention include ideal poly A sequences (e.g., AATAAA, ATTAAA, AGTAAA), bovine growth hormone poly A sequence (BGHpA), rabbit β-globin poly A sequence (rβgpA), or another suitable heterologous or endogenous poly A sequence known in the art. Preferably, the 3'-end of the DNA construct of the present invention may contain a poly A sequence including the base sequence of SEQ ID NO: 43.

In another embodiment of the present invention, as a result of checking the CAR gene knock-in efficiency depending on whether or not a poly A sequence is inserted at the 3'-end of the CAR gene knock-quoting DNA construct, when the poly A sequence is inserted It was confirmed that the knock-in efficiency increased (FIG. 19).

In the present invention, a DNA nuclear targeting sequence (DTS) may be further included at the 3'-end of the DNA construct. In the present invention, DTS is a recognition sequence for a cell-endogenous DNA-binding protein, and the use of DTS in the vector can also increase the ability to localize the vector to the nucleus. For example, DTS can be selected from SV40 enhancer, NFκB, CREB and GRE. Preferably, the 3'-end of the DNA construct of the present invention includes SV40 DTS containing the base sequence of SEQ ID NO: 44, CREB DTS containing the base sequence of SEQ ID NO: 45, and GRE containing the base sequence of SEQ ID NO: 46. DTS, or combinations thereof may be included.

In the present invention, when both the poly A sequence and DTS are included at the 3'-end of the DNA construct, the poly A sequence and DTS may be sequentially included in the direction from the 5'-end to the 3'-end.

In another embodiment of the present invention, as a result of confirming the CAR gene knock-in efficiency depending on whether the poly A sequence and the DTS sequence were inserted at the 3'-end of the CAR gene knock-quoting DNA construct, the poly A sequence and It was confirmed that when the DTS sequences of SV40, CREB, or GRE were inserted together, the knock-in efficiency of CAR increased (FIG. 19).

From another aspect, the present invention provides a DNA fragment ( It is about Fragment.

In the present invention, the DNA fragment may be in the form of ssDNA or dsDNA. Additionally, DNA fragments can be delivered using electroporation or gene transfer vectors.

TGFBR2 expression gene knock-out and CAR gene knock-in immune effector cells

In another consistent aspect, the present invention provides: (1) at least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6;

(2) any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein; and

(3) comprising the step of processing a DNA construct or a DNA fragment thereof for knock-in of a chimeric antigen receptor (CAR) specific for the cancer cell antigen to an immune effector cell, It relates to a method of producing immune effector cells in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in.

In another aspect, the present invention relates to immune effector cells prepared by the above method in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in.

In the present invention, the immune effector cells may be T cells, natural killer (NK) cells, macrophages, monocytes, or dendritic cells, and are preferably natural killer (NK) cells. NK) cells.

Immune effector cells for producing immune effector cells expressing a chimeric antigen receptor (CAR) can be obtained from a subject, wherein the “subject” is a living organism (e.g., a mammal) against which an immune response can be elicited. Includes. Examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof.

In the present invention, the sgRNA can be used as a mixture of one type or two types of sgRNA, and can be treated at a concentration of 40 to 400 pmol.

In the present invention, the single guide RNA, gene scissors, and DNA fragment are delivered to immune effector cells through electroporation or gene transfer vector, and the electroporation is performed at 1000 V to 2500 V, 5 ms to 50 ms, and 1 pulse. Processed under ~5 pulse conditions, the gene delivery vector may be a plasmid, viral vector, or non-viral vector.

The electroporation is performed under the conditions of 1000 V to 2500 V, 5 ms to 50 ms, and 1 pulse to 5 pulse, preferably under the conditions of 1600 V to 1900 V, 10 ms to 20 ms, and 1 pulse to 3 pulse. Preferably, 1600 V to 1700 V, 10 ms to 20 ms, and 1 pulse to 3 pulse conditions can be processed.

In one embodiment of the present invention, as shown in the schematic diagram of FIG. 11, when sgRNA is treated alone (single K.O & CAR K.I), or sgRNA is treated double (double K.O & CAR K.I), CAR gene knock-in efficiency As a result of comparison, it was confirmed that both single and double sgRNA efficiently knock-in the CAR gene.

In another example of the present invention, as a result of comparing CAR gene knock-in efficiency according to sgRNA input amount and electroporation conditions, when 400 pmol of sgRNA was electroporated under 1600 V, 10 ms, and 3 pulse conditions, the highest It was confirmed that high knock-in efficiency was observed (FIGS. 12 and 13).

In the present invention, before or after treating the single guide RNA, gene scissors, and DNA fragments to immune effector cells, at least one selected from the group consisting of IL-2, IL-15, IL-21, and TGF-β1 Cytokines can be further treated with immune effector cells. Preferably, treatment may be performed with IL-21, a combination of IL-2 + IL-21, or a combination of IL-21 + TGF-β1, and more preferably, treatment may be performed with IL-21 alone. Additionally, the cytokines can be treated using cytokine-expressing feeder cells or cytokine-secreting cells, if necessary.

In another embodiment of the present invention, to compare CAR gene knock-in efficiency according to treatment with various substances, Valnemulin, IL-21, IL-2 + IL-21, and IL-2 + IL- As a result of treatment with 15 + IL-21, it was confirmed that the CAR gene knock-in efficiency was significantly increased by treatment with IL-21 or IL-2 + IL-21 (Figures 14 and 15), and the As a result of checking the CAR gene knock-in efficiency, the CAR gene knock-in efficiency was increased by IL-21 pretreatment or IL-21 + TGF-β1 pretreatment. In particular, in the case of IL-21 pretreatment, NK with the CAR gene knocked in The cytotoxic effect of cells increased (Figure 16).

Composition for preventing or treating cancer comprising an immune effector with TGFBR2 expression gene knock-out and CAR gene knock-in

In another aspect, the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising immune effector cells in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in. .

In the present invention, the cancer cell antigen may be CD22, CD19, or mesothelin (MSLN), preferably mesothelin, and the cancer or tumor may be a normal control group, or a cancer or tumor that overexpresses mesothelin compared to normal cells. It's a tumor. More specifically, squamous cell cancer, small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung, mesothelial cancer, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioma, cervical cancer, ovarian cancer, liver cancer, and bladder cancer. , consisting of hepatocellular carcinoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver carcinoma, leukemia and other lymphoproliferative disorders, and various types of head and neck cancer. may be selected from the military.

Below, preferred embodiments are presented to aid understanding of the present invention.

However, the following examples are provided only to make the present invention easier to understand, and the content of the present invention is not limited by the following examples.

[Example 1] Selection of various crRNA regions within the TGFBR2 gene location and design of sgRNA sequences

In the present invention, as shown in Figure 1, six types of crRNA (CRISPR RNA) regions within the TGFBR2 gene (NCBI Gene ID: 7048) were selected, and six types of sgRNA sequences were designed as shown in Table 1.

sgRNA for TGFBR2 knock-out sgRNA sequence Targeted domain sequence number TGFBR2-T1 (-) CCTGAGCAGCCCCCCGACCCA SP (384 - 403) SEQ ID NO: 1 TGFBR2-T2 (+) CCCACCGCACGTTCAGAAGT ECD (454 - 473) SEQ ID NO: 2 TGFBR2-T3 (+) CCCCTACCATGACTTTATTC ECD (775 - 794) SEQ ID NO: 3 TGFBR2-T4 (-) ATTGCACTCATCAGAGCTAC ECD (870 - 889) SEQ ID NO: 4 TGFBR2-T5 (-) GCTTCTGCTGCCGGTTAACG ICD (1027 - 1046) SEQ ID NO: 5 TGFBR2-T6 (+) GCCCATTGAGCTGGACACCC ICD (1183 - 1202) SEQ ID NO: 6

The sgRNA (TGFBR2-T1) represented by the nucleotide sequence of SEQ ID NO: 1 is the signal peptide (SP) portion of the TGFBR2 gene, and the sgRNA (TGFBR2-T2) represented by the nucleotide sequence of SEQ ID NO: 2 is the signal peptide (SP) portion of the TGFBR2 gene. The sgRNA (TGFBR2-T3) expressed by the base sequence and the sgRNA (TGFBR2-T4) expressed by the base sequence of SEQ ID NO: 4 are composed of the extracellular domain (ECD) part of the TGFBR2 gene with the base sequence of SEQ ID NO: 5. The indicated sgRNA (TGFBR2-T5) and the sgRNA (TGFBR2-T6) indicated by the base sequence of SEQ ID NO: 6 target the intracellular domain (ICD) portion.

[Example 2] Comparison of editing efficiency according to sgRNA combination - T7E1 assay

In the present invention, to compare the editing efficiency according to the sgRNA combination for double knock-out, “T1 sgRNA and T2 sgRNA combination (T1 + T2)”, “T3 sgRNA and T4 sgRNA combination” in Table 1 (T3 + T4)", and "T5 sgRNA and T6 sgRNA combination (T5 + T6)" were used to confirm the editing efficiency for natural killer cells (primary NK cells).

First, primary NK cells were obtained by co-culturing human PBMC cells with irradiated K562-GE (mbIL18/21 overexpressed K562) cells for 3 weeks under conditions treated with IL-2 and IL-15 cytokines. .

Next, to prepare Cas9-sgRNA ribonucleoprotein (RNP) complex (Cas9 RNP complex), each corresponding sgRNA (400 pmole) and spCas9 (1 ㎍/㎕, 4 ㎕ = 24.2 pmol) were mixed and stored at room temperature. It was reacted at (RT) for 20 minutes. Afterwards, 100 ㎕ Cas9 RNP complex and ²

To confirm the editing effect according to the sgRNA combination of the present invention, a T7E1 assay experiment was performed. First, genomic DNA was extracted from primary NK cells using the QiAmp DNA mini kit (qiagen), and PCR amplicon containing the edited portion was obtained using each corresponding primer.

Primer sequences for PCR amplicon amplification Amplicon Primer sequence sequence number T1+T2 GTTGAGTGAGTCACTCGC SEQ ID NO: 7 CTCAAACTTCCCTTTCGG SEQ ID NO: 8 T3+T4 GTCTGCTCCAGGTGATGTTTAT SEQ ID NO: 9 GGGCCTGAGAATCTGCATTTA SEQ ID NO: 10 T5+T6 GCAGGGGATGACGAAC SEQ ID NO: 11 CTGCCCACTGTTAGCC SEQ ID NO: 12

Next, 200 ng PCR amplicons and 10 -> 2nd stage annealing 95 ~ 85℃, -2℃/sec, 85 ~ 25℃, -0.1℃/sec, hold 4℃). Then, hybridization DNA (19 ㎕) and T7E1 enzyme (NEB, M0302) 1 ㎕ were reacted together at 37°C for 15 minutes, electrophoresis was performed, and the edited band was analyzed using a gel-DOC machine. It was confirmed using

As a result, as shown in Figure 2, it was confirmed that the gene was effectively knocked out by sgRNA treatment (Figure 2).

[Example 3] Comparison of editing efficiency according to sgRNA combination - FACS

Editing according to sgRNA combination for double knock-out

To compare efficiency, the expression level of the target gene, TGFBR2, was measured using FACS.

First, NK cells were treated with gene scissors for 72 hours in the same manner as in Example 2, and then NK cells were obtained and transferred to a tube for FACS measurement, and then washed with PBS. Next, stain with Live/dead dye (eBioscience™ Fixable Viability Dye eFluor™ 506) for 20 minutes at 4°C in dark conditions, wash with PBS, add 100 ㎕ of IC fixation buffer, and dye at room temperature in dark conditions. It was reacted for 20 minutes. After washing twice with Perm/wash buffer, treated with APC anti-human TGFBR2 antibody (APC anti-human TGFBR2 antibody, 5 ㎕) / perm buffer (100 ㎕) and incubated at room temperature in the dark. Staining was performed for 20 minutes under these conditions. After washing twice with perm/wash buffer, it was suspended in 100 to 200 ㎕ of PBS and then subjected to FACS analysis.

In addition, to confirm the expression of TGFBR2 located on the cell membrane in primary NK cells, the NK cells treated with the gene scissors were stained with TGFbR2-APC (1:100, Biolegend) antibody, and then FACS analysis was performed. did.

As a result, as shown in Figures 3(a) and 3(b), TGFBR2 protein expression was confirmed to be reduced by about 82% and 81.4% based on population when treated with T1 + T2 sgRNA or T5 + T6 sgRNA. It has been done.

[Example 4] Comparison of TGFBR2 knock-out NK cell efficacy according to sgRNA target location - Confirmation of assassination effect

Primary NK cells were electroporated (1800 V, 20 ms, 1 pulse) with spCas9 gene scissors protein in the same manner as in Example 2 with sgRNA (T1 + T2) and sgRNA (T5 + T6), and then IL- Edited primary NK cells were cultured in RPMI1640 medium containing 2 and IL-15 cytokines.

On the 6th and 7th days after electroporation, each edited primary NK cell (Effector; E) was treated with TGF-b1 cytokine at a concentration of 10 ng/ml, and then on the 8th day, at 37°C and 5% CO2 humidified conditions. and luciferase overexpressing-AsPC1 cancer cells (Target; T) were co-cultured at a 2:1 ratio. For co ^- culture, ⁵ The assassination capacity of NK cells was compared.

Luciferase was measured using the Nano-Glo® Luciferase Assay System kit, and the fluorescence signal for Luc-AsPC1 cells was detected using the GloMax® equipment according to the manufacturer's protocol in the following process. Target cells were lysed using a lysis buffer, centrifuged at 13,000 rpm, 15 to 20 minutes, 4°C, and the buffer included in Promega (cat.no.N1110): Substrate was mixed at 50%: Mixed in 2 proportions. After adding 50 μl of each target cell eluate and 50 μl of buffer/substrate mixture into each 96-well, fluorescence was measured and quantified to confirm the cancer cell killing effect.

As a result, as shown in Figure 4, compared to NK cells in which the extracellular domain (ECD) part of the TGFBR2 gene was knocked out, the assassination effect of NK cells in which the intracellular domain (ICD) part was knocked out was superior. confirmed.

[Example 5] Comparison of TGFBR2 knock-out NK cell efficacy according to sgRNA target location - Confirmation of NK cell degranulation marker expression

First, sgRNA (T1+T2) and sgRNA (T5+T6) (100 pmol/λ, 4 μl, total 400 pmol) were mixed with spCas9 (1 μg/μl, 4 μl = 24.2 pmol) at room temperature (RT). After reacting for 20 minutes, 52 ㎕ of nuclease free buffer was added to prepare a Cas9 RNP complex. Primary NK cells were suspended in T buffer at 2 M/60 ㎕, then Cas9 RNP (60 ㎕) was added to the primary NK cells (60 ㎕), and gene editing was performed by electroporation under the conditions of 1800 V, 20 ms, 1 pulse. was delivered.

Primary NK cells edited by the above method were cultured in RPMI1640 medium containing IL-2 and IL-15 cytokines, and TGF-b (10 ng/ml) was additionally added on days 5 and 6. On the 7th day of culture, the edited NK cells were co-cultured with the luciferase-expressing AsPC1 cancer cells (0.25M cells/1 ㎖, using RPMI1640 medium) inoculated in a 24-well plate the previous day at a 2:1 ratio. Additionally, IL-2 and APC-anti-human CD107a antibodies (5 μl) mixed to a final volume of 1 ml were added to 0.25 ml of RPMI (011-51) medium.

As a positive control, primary NK cells were treated with PMA (2.5 μg/ml) and ionomycin (0.5 μg/ml) and co-cultured in the same manner as above.

After 1 hour of co-culture, BFA (5 ㎍/㎖) and monensin (6 ㎍/㎖) were added and cultured for 5 hours, then the cells were harvested, washed with PBS, and treated with Live/Dead dye and CD56 antibody. After staining, FACS analysis was performed.

As a result, as shown in Figure 5, compared to NK cells in which the extracellular domain (ECD) part of the TGFBR2 gene was knocked out, the degranulation marker of NK cells in which the intracellular domain (ICD) part was knocked out ) was confirmed to have increased the level of expression of the CD107a marker.

[Example 6] Comparison of efficacy of TGFBR2 knock-out NK cells according to sgRNA target location - Confirmation of reduction of p-Smad2/3 in NK cells

After 5 days of gene scissors treatment in the same manner as in Example 5, the edited NK cells were treated with TGF-b1 (10 ng/ml) for 3 hours, and then Western blotting was performed to determine the TGF-b1 signaling process ( The phosphorylation levels of SMAD2/3 proteins in Figure 6) were compared.

First, ¹ -orthovanadate, 1X protease inhibitor) was added to obtain a cell lysate, and then sampled to prepare a sample for Western blotting. The sample was electrophoresed on SDS-PAGE, transferred to a nitrocellulose membrane, and blocked using skim milk powder. Next, to process the primary antibody, anti-SMAD2/3 antibody (CST #8685, cell signaling technology, USA) and anti-p-SMAD2/3 antibody (CST#8828) were diluted at a ratio of 1:1000 on the membrane. , cell signaling technology, USA), and anti-β-actin antibody (SantaCruz) diluted at a ratio of 1:5000, respectively, and reacted at 4°C overnight. After washing the membrane, it was treated with HRP (horseradish peroxidase)-conjugated secondary antibody (1:5000), which can bind to the primary antibody, and reacted at room temperature for 2 hours. Afterwards, the band was visualized by chemiluminescence using Western ECL substrate (Thermo scientific), and the obtained luminescence image was analyzed with Chemidoc (biorad).

As a result, as shown in Figure 6, compared to NK cells in which the extracellular domain (ECD) part of the TGFBR2 gene was knocked out, smad2/3 was phosphorylated in NK cells in which the intracellular domain (ICD) part was knocked out. The degree of decrease in (p-Smad2/3) was found to be high.

[Example 7] Confirmation of editing efficiency according to various electroporation conditions - based on T7E1 assay

7-1: T7E1 assay analysis

Cas9 RNP (T5+T6 sgRNA) complex in primary NK cells was prepared in the same manner as in Example 2, and used to prepare 4 electroporation conditions (1600 V, 10 ms, 3 pulse/1800 V, 20 ms, 1 The editing effect according to pulse/1850 V, 10 ms, 2 pulse/1900 V, 20 ms, 1 pulse) was compared using the T7E1 assay.

As a result, as shown in Figure 7, when confirmed with the T7E1 assay, it was confirmed that the editing efficiency was similar depending on the electroporation conditions.

7-2: FACS analysis

Cas9 RNP (T5+T6 sgRNA) complex in primary NK cells was prepared in the same manner as in Example 2, and used to prepare 5 electroporation conditions (1600 V, 10 ms, 3 pulse; 1600 V, 20 ms, 1 pulse). The editing effect according to (pulse; 1700 V, 10 ms, 3 pulse; 1700 V, 20 ms, 1 pulse; 1800 V, 20 ms, 1 pulse) was compared through FACS analysis. FACS analysis was performed in the same manner as Example 3.

As a result, as shown in Figure 8, editing efficiency was found to be high under the 1600 V, 10 ms, 3 pulse conditions and the 1700 V, 20 ms, 1 pulse conditions.

7-3: Confirmation of NK cell survival rate according to electroporation conditions

Cas9 RNP (T5+T6 sgRNA) complex in primary NK cells was prepared in the same manner as in Example 2, and used to prepare 5 electroporation conditions (1600 V, 10 ms, 3 pulse; 1600 V, 20 ms, 1 pulse). Primary NK cell survival rate was confirmed according to pulse; 1700 V, 10 ms, 3 pulse; 1700 V, 20 ms, 1 pulse; 1800 V, 20 ms, 1 pulse).

NK cells were harvested on the 5th day after electroporation, and then FACS analysis was performed using eBioscience™ Fixable Viability Dye eFluor™ 506 dye staining for live/dead population analysis.

As a result, as shown in Figure 9, it was confirmed that all of the five electroporation conditions did not affect NK cell survival rate.

[Example 8] Construction of CAR gene knock-in DNA construct for cancer antigen targeting

In the present invention, a CAR gene knock-in DNA construct was designed to target mesothelin.

As shown in the schematic diagram of Figure 10, the CAR knock-quote DNA construct of the present invention includes pSFFV promoter (SEQ ID NO: 13) - signal peptide (SEQ ID NO: 14) - FLAG (SEQ ID NO: 16) - mesothelin-binding domain (SS) scFv, SEQ ID NO: 18) - CD8 (SEQ ID NO: 20) - 4-1BB (SEQ ID NO: 22) - CD3ζ (SEQ ID NO: 24) A structure in which the base sequences encoding each are arranged in the following order (SEQ ID NO: 26), the present invention It is inserted into the region knocked out by the sgRNA for TGFBR2 knock-out, and a 200bp to 1500bp long base sequence encoding HA (homology arm) is added to the 5'-end and 3'-end of the DNA construct. Includes.

To prepare a vector containing the CAR knock-quote DNA construct, first pCMV3 vector was cut with Spe1 and Xba1 enzymes, and then the 5'-HA fragment, CAR knock-quote DNA construct and 3 were added. Each '-HA fragment was synthesized and a vector was prepared through infusion cloning. In addition, DNA fragments were prepared so that the 5'-HA and 3'-HA lengths were 300bp (SEQ ID NO: 27), 500bp (SEQ ID NO: 28), 700bp (SEQ ID NO: 29), and 1000 bp (SEQ ID NO: 30).

PCR primer sequences for amplifying DNA fragments according to HA length HA size Primer sequence sequence number 300bp TTTCCCCATCAGAATATAACACCAg SEQ ID NO: 31 GCAGGTCCTCCCAGC SEQ ID NO: 32 500bp AAGGAAGAGCAGGGGATGAC SEQ ID NO: 33 AGCCAGGTCATCCACAGAC SEQ ID NO: 34 700bp AGTTCCCTGTCCGTGG SEQ ID NO: 35 CATTAGCAAAAATGCTCAGGc SEQ ID NO: 36 1000bp TCTCCCTGTCACCCATGGG SEQ ID NO: 37 TTACTTTCAATGTTCAAGGCATTG SEQ ID NO: 38

Next, in order to obtain a DNA fragment containing the CAR gene knock-quote DNA construct for targeting cancer antigens through PCR, specific primers for each HA length were prepared as shown in Table 3 above and PCR was performed. After obtaining each amplicon, the corresponding DNA fragments were purified and obtained using a gel elution kit.

[Example 9] Comparison of CAR gene knock-in efficiency by sgRNA single or dual treatment

In the present invention, as shown in the schematic diagram of FIG. 11(a), the CAR gene knock-in efficiency is compared when sgRNA is treated alone (single K.O & CAR K.I) or sgRNA is treated double (double K.O & CAR K.I). I wanted to do it.

First, a Cas9 RNP complex was prepared by mixing sgRNA (T6) and sgRNA (T5 + T6) with spCas9 in the same manner as in Example 2, and then CAR knock-quote DNA with an HA length of 700 bp prepared in Example 8. DNA fragments (500 ng) containing the construct were treated together with primary NK cells and electroporated under the conditions of 1600 V, 10 ms, 3 pulses.

Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed using the primers in Table 4 to secure a PCR amplicon containing the edited gene.

5′ junction PCR primer sequence for HA 700bp Primer sequence sequence number CCCAATGTCCTGAGCTTAGATAA SEQ ID NO: 39 GCTTATCGTCGTCATCCTTG SEQ ID NO: 40

As a result, as shown in Figure 11, it was confirmed that both single and double sgRNA efficiently knocked-in the CAR gene.

[Example 10] Comparison of CAR gene knock-in efficiency according to sgRNA input amount and electroporation conditions

In the present invention, in order to compare the CAR gene knock-in efficiency according to the sgRNA input amount and electroporation conditions, the amount of sgRNA (T6) was set to 40 pmol, 100 pmol, and 400 pmol, respectively, in the same manner as in Example 9. Primary NK cells were treated using a DNA fragment containing a CAR knock-quote DNA construct with an HA length of 700bp, under the conditions of 1600 V, 10 ms, 3 pulses and 1800 V, 20 ms, 1 pulse, respectively. Electroporation was performed.

10-1: 5' junction PCR analysis

Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed in the same manner as in Example 9 using the primers in Table 4. Additionally, 5' junction PCR was performed in the same manner as in Example 2 using the primers in Table 5. T7E1 assay was performed.

Primer sequence for PCR amplicon amplification when HA is 700bp Primer sequence sequence number CCCAATGTCCTGAGCTTAGATAA SEQ ID NO: 39 GAGCAGAAAGGACTGAGTACAA SEQ ID NO: 41

As a result, as shown in Figure 12, the T7E1 assay confirmed that the gene was effectively knocked out by sgRNA treatment under all conditions. In addition, in the 5' junction PCR analysis, it was confirmed that the amount of PCR amplicon was highest when 400 pmol of sgRNA was treated under the conditions of 1600 V, 10 ms, and 3 pulse.

10-2: FACS-based surface CAR protein detection

FACS analysis was performed to compare the level of surface CAR protein expression expressed on CAR-NK cell membranes.

First, harvest the NK cells and then react with 100 μl PBS solution containing 0.5 μg of biotin-conjugated MSLN (mesothelin) ECD protein and ¹ I ordered it. Next, after washing with PBS, 100 ㎕ of PBS solution containing 0.08 ㎍ streptavidin-PE antibody was additionally added, reacted under the same conditions as above, washed, and then FACS analysis was performed.

As a result, as shown in Figure 13, when 400 pmol of sgRNA was electroporated under 1600 V, 10 ms, and 3 pulse conditions, the mesothelin antibody expression rate was found to be the highest.

[Example 11] Comparison of CAR gene knock-in efficiency according to treatment with various substances

In order to compare the CAR gene knock-in efficiency according to various material treatments, a Cas9 RNP complex was prepared by mixing 400 pmol of sgRNA (T6) with spCas9 in the same manner as in Example 2, and then mixed with Cas9 RNP and Example 8. Primary NK cells were treated with DNA fragments containing the prepared CAR knock-quote DNA construct with an HA length of 700bp, and electroporated under the conditions of 1600 V, 10 ms, and 3 pulses.

After electroporation, edited primary NK cells were incubated with valnemulin (1 μM), IL-21 (400 ng/ml), IL-2 (200 IU/ml)/IL-21 (400 ng/ml), and IL-2 ( The cells were cultured in medium containing 200 IU/ml)/IL-15 (10 ng/ml)/IL-21 (400 ng/ml), respectively, and the medium was changed after 48 hours.

11-1: 5' junction PCR analysis

Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed in the same manner as in Example 9 using the primers in Table 4. Additionally, 5' junction PCR was performed in the same manner as in Example 2 using the primers in Table 5. T7E1 assay was performed.

As a result, as shown in Figure 14, the amount of PCR amplicon was found to be the largest when treated with IL-21.

11-2: FACS-based surface CAR protein detection

To compare the level of surface CAR protein expression expressed in the CAR-NK cell membrane, FACS analysis was performed by the method of Example 10-2 above.

As a result, as shown in Figure 15, when treated with IL-2/IL-21, the mesothelin antibody expression rate was found to be highest.

[Example 12] Comparison of CAR gene knock-in efficiency according to cytokine combination and treatment time

In the present invention, we sought to compare CAR gene knock-in efficiency according to IL-21, TGF-β1 combination and treatment time.

A Cas9 RNP complex was prepared by mixing 400 pmol of sgRNA (T6) with spCas9 in the same manner as in Example 2, and then Cas9 RNP and the CAR knock-quote DNA construct with an HA length of 700 bp prepared in Example 8 were mixed. The DNA fragment containing the cells was treated with primary NK cells and electroporated under the conditions of 1600 V, 10 ms, 3 pulses. At this time, as shown in Figure 16a, IL-21 and/or TGF-β1 were treated separately before or after electroporation.

12-1: 5' junction PCR analysis

Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed in the same manner as in Example 9 using the primers in Table 4. Additionally, 5' junction PCR was performed in the same manner as in Example 2 using the primers in Table 5. T7E1 assay was performed.

As a result, as shown in Figure 16(a), it was confirmed that CAR gene knock-in efficiency increased when IL-21 or IL-21/TGF-β1 was treated before electroporation.

12-2: Confirmation of assassination effect of CAR-NK cells

The assassination effect of CAR-NK cells was confirmed in the same manner as in Example 4 above.

As a result, as shown in Figure 16(b), when treated with IL-21 before electroporation, it was confirmed that the killing effect of NK cells with the CAR gene knocked-in was significantly increased.

[Example 13] Comparison of CAR gene knock-in efficiency according to HA length

In the present invention, we sought to confirm the CAR gene knock-in efficiency according to the length of the HA (homology arm) in the vector (donor DNA) containing the CAR gene knock-in DNA construct.

A Cas9 RNP complex was prepared by mixing 400 pmol of sgRNA (T6) with spCas9 in the same manner as in Example 2, and then the Cas9 RNP and the 5'-HA and 3'-HA prepared in Example 8 were 300bp in length. , DNA fragments containing CAR gene knock-quote DNA constructs of 500bp, 700bp, and 1000bp were respectively treated with primary NK cells and electroporated under the conditions of 1600 V, 10 ms, and 3 pulses.

Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed in the same manner as Example 9 using the primers in Table 6.

5′ junction PCR primer sequence for HA 1000bp Primer sequence sequence number CTATTTCACCAGAGCCAACAAGG SEQ ID NO: 42 GCTTATCGTCGTCATCCTTG SEQ ID NO: 40

As a result, as shown in Figure 17, it was confirmed that the knock-in efficiency increased when the HA length was 700bp or 1000bp.

[Example 14] Comparison of assassination effects according to wild type (WT)/mutant CAR gene knock-in

In the present invention, the gene knock-in efficiency of wild-type (wild)-CAR gene and mutant-CAR gene knock-in DNA constructs was compared.

First, as shown in the schematic diagram of FIG. 18(a), the wild type includes the 5'-HA and 3'-HA CAR gene knock-quote DNA constructs prepared in Example 8 with a length of 1000 bp. A DNA fragment was used, and as a mutant, a CAR gene knock-in DNA construct vector with the 4-1BB base sequence and CD3ζ base sequence removed was used.

A Cas9 RNP complex was prepared by mixing 400 pmol of sgRNA (T6) with spCas9 in the same manner as in Example 2, and then vectors containing Cas9 RNP and the wild-type and mutant CAR gene knock-in DNA constructs were added to each primary Wild-type CAR-NK cells and mutant CAR-NK cells were prepared by treating NK cells and electroporating them at 1600 V, 10 ms, 3 pulse conditions.

14-1: 5' junction PCR analysis

Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed in the same manner as Example 9 using the primers in Table 5.

As a result, as shown in Figure 18(b), the knock-in efficiency of wild-type CAR-NK cells and mutant CAR-NK cells was found to be similar.

14-2: FACS-based surface TGFBR2 protein detection

To compare the level of surface TGFBR2 protein expression expressed in CAR-NK cell membranes, FACS analysis was performed using the method of Example 7-2 above.

As a result, as shown in Figure 18(c), the degree of reduction in TGFBR2 expression in wild-type CAR-NK cells and mutant CAR-NK cells was also confirmed to be similar.

14-3: Confirmation of the assassination effect of CAR-NK cells

The assassination effect of CAR-NK cells was confirmed in the same manner as in Example 4 above.

As a result, as shown in Figure 18(d), it was confirmed that the killing effect of wild-type CAR-NK cells was significantly superior to that of mutant cells.

[Example 15] Comparison of CAR gene knock-in efficiency according to the addition of DTS (DNA nuclear targeting sequence)

In the present invention, we sought to confirm the CAR gene knock-in efficiency by inserting a poly A sequence and an additional DNA nuclear targeting sequence (DTS) at the 3'-end of the CAR gene knock-in DNA construct.

A CAR gene knock-quote DNA construct was produced as in Example 8, but as shown in the schematic diagram of FIG. 19(a), the SV40 poly A sequence shown in Table 7 below was added to the 3'-end of the DNA construct (sequence No. 43) Alone or together with these nucleotide sequences, the DTS sequence additionally included the SV40 sequence (SEQ ID NO: 44), the CREB sequence (SEQ ID NO: 45), or the GRE sequence (SEQ ID NO: 46). A DNA fragment encoding HA (homology arm) with a length of 1000 bp was inserted into the 5'-end and 3'-end of this DNA construct. Afterwards, a vector containing the CAR knock-quote DNA construct was prepared in the same manner as in Example 8.

Poly A sequence and DNA nuclear targeting sequence (DTS) division base sequence sequence number Poly A sequence AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA 43 DTS SV40 GGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCA 44 CREB TGACGTCAAGATCTA 45 GRE GGTACATTTTGTTCTAGAACAAAATGTACCGGTACATTTTGTTCTGGTACATTTTGTTCT 46

Next, to prepare the Cas9-sgRNA ribonucleoprotein (RNP) complex (Cas9 RNP complex), sgRNA (100pmol/λ, 4 μl, total 400pmol) and Cas9 (1 μg/μl, 4 μl=24.2 pmol) and reacted at room temperature (RT) for 20 minutes. Afterwards, under knock-out conditions, 244.4 fmol of DNA construct and nuclease free buffer were added to make a total of 52 μl. PBNK cells were suspended in T buffer at 2M/60 ㎕, Cas9 RNPs (60 ㎕) and cells (60 ㎕) were collected, and then electroporator (neon electroporator) was used under the conditions of 1820V, 20 ms, 1 pulse. After rotary electroporation, electroporation was performed once under the conditions of 500V, 10ms, and 1 pulse.

After obtaining NK cells on days 5, 9, and 19 after culturing in an incubator (37°C, CO ₂ 5%), 0.5 μg of biotin-conjugated MSLN ECD protein was added to ¹⁰⁰ μl of PBS solution at a cell count of 1 were incubated with NK cells in dark conditions at 4°C for 20 minutes. After washing, 100 μl of a PBS solution containing 0.08 μg of streptavidin-PE antibody was added and reacted under the same conditions. FACS analysis was performed to compare the level of surface CAR protein expression expressed on CAR-NK cell membranes.

As a result, as shown in Figure 19, when a poly A sequence or a poly A sequence and a DTS sequence such as SV40, CREB, or GRE are additionally inserted into the 3'-end of the CAR DNA construct, mesothelin in NK cells The antibody expression rate was found to be increased.

[Example 16] Comparison of CAR gene knock-in efficiency by viral vectors

In the present invention, in order to confirm whether CAR gene knock-in is performed efficiently even when a viral vector is used as a delivery vector for the CAR gene knock-in DNA construct, CAR gene knock-in is performed in cells using an adeno-associated virus (AAV) vector. Knock-in and then knock-out using Cas9 RNP (AAV → KO), or knock-out using Cas9 RNP in cells and then knock-in the CAR gene using an adeno-associated virus (AAV) vector (KO → AAV). carried out.

Specifically, when CAR gene knock-in using AAV was performed after TGFBR2 knock-out, expressed as "KO → AAV", sgRNA (100 pmol/λ, 4 μl, total 400 pmol) was used in the same manner as in Example 15. and Cas9 (1 ㎍/㎕, 4 ㎕=24.2 pmol) to prepare a Cas9 RNP complex, and then treat PBMC cells with Cas9 RNP, once under 1820V 20ms 1 pulse condition and once under 500V 10ms 1 pulse condition. Electroporation was performed under the following conditions. After inoculating only 0.1 M (6 ㎕) of the knock-out sample into a 96 well plate, add the amount of medium minus the amount of adeno-associated virus in 200 ul, and incubate in an incubator (37 ℃, CO ₂ 5%) for 30 minutes. It was incubated for a while. Afterwards, adeno-associated virus (AAV) cloned from the DNA fragment containing the 5'-HA and 3'-HA CAR gene knock-quote DNA constructs with a length of 1000 bp prepared in Example 8 was added, and then centrifuged. Separation (400g, 90 minutes, 32°C) was performed and cultured in an incubator.

Next, when TGFBR2 knock-out was performed after CAR gene knock-in using AAV, which is expressed as "AAV → KO", 0.1 M of primary NK cells were inoculated into a 96 well plate and then cloned as above with adeno After mixing the associated viruses, a total of 200 ㎕ was added to the medium. After centrifugation (400g, 90 minutes, 32°C) and cultured in an incubator for one day, cells were obtained the next day and knocked-out was performed using the Cas9 RNP complex in the same manner as in “KO → AAV”.

As for other controls, only knock-out was performed using the Cas9 RNP complex in the same manner as in "KO → AAV", or only CAR gene knock-in was performed using the AAV vector.

After obtaining NK cells on the 7th ^day of culture in each group, 1 μg of biotin-conjugated MSLN ECD protein was incubated with 1 After washing, 100 μl of a PBS solution containing 0.08 μg of streptavidin-PE antibody was added and reacted under the same conditions. FACS analysis was performed to compare the level of surface CAR protein expression expressed on CAR-NK cell membranes.

As a result, as shown in Figure 20, even when using the AAV vector, which is a viral vector, it was seen that the CAR gene was knocked-in in NK cells and mesothelin antibody was expressed on the NK cell membrane, and the CAR gene was expressed in the above-mentioned method. When TGFBR2 knock-out was performed together with knock-in using the Cas9 RNP complex according to the present invention, the CAR gene knock-in efficiency was seen to be further increased. However, even in this case, the expression of mesothelin antibodies was highest in cells in which TGFBR2 knock-out was followed by CAR gene knock-in using an AAV vector.

Claims (21)

Single guide RNA (sgRN) represented by the base sequence of SEQ ID NO: 1 to SEQ ID NO: 6
A) A single guide RNA for TGFBR2 (TGF beta receptor 2) knock-out, comprising at least one single guide selected from the group consisting of. A single guide RNA for TGFBR2 (TGF beta receptor 2) knock-out of claim 1; and
TGFBR2 (TGF beta receptor 2) knock-out, comprising any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein. Composition for. At least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6, and
TGFBR2 (TGF beta receptor 2), comprising the step of treating human-derived cells with any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein. Knock-out method. According to paragraph 3,
The human-derived cells are characterized in that they are any one immune effector cell selected from the group consisting of T cells, natural killer (NK) cells, macrophages, monocytes, and dendritic cells. TGFBR2 (TGF beta receptor 2) knock-out method. According to paragraph 3,
The single guide RNA and gene scissors are delivered to immune effector cells through electroporation or gene transfer vector,
The electroporation is performed under the conditions of 1000 V to 2500 V, 5 ms to 50 ms, and 1 pulse to 5 pulse,
A TGFBR2 (TGF beta receptor 2) knock-out method, wherein the gene transfer vector is a plasmid, a viral vector, or a non-viral vector. base sequence encoding a promoter;
A base sequence encoding a signal peptide;
A base sequence encoding a cancer cell antigen-binding domain;
base sequence encoding a transmembrane domain;
base sequence encoding a costimulatory domain; and
DNA construct for chimeric antigen receptor (CAR) knock-in specific for cancer cell antigens, containing a nucleotide sequence encoding an intracellular signal transduction domain . According to clause 6,
A DNA construct for chimeric antigen receptor (CAR) knock-in specific to a cancer cell antigen, wherein the promoter is pSFFV, pCMV or pEF1A. According to clause 6,
The cancer cell antigens include mesothelin (MSLN), CD22, CD19, HER2 (human epidermal growth factor receptor type 2), GD2, folate receptor, MUC1 (Mucin 1), ErbB2 (Erythroblastic oncogene B-2 gene) ), chimeric antigen receptor (CAR) knock-in specific for cancer cell antigens, characterized as EphA2 (EPH receptor A2) or EGFR (Epidermal growth factor receptor). Truckt. According to clause 8,
When the cancer cell antigen is mesothelin (MSLN),
A DNA construct for chimeric antigen receptor (CAR) knock-in specific to a cancer cell antigen, wherein the cancer cell antigen-binding domain is represented by the amino acid sequence of SEQ ID NO: 18. crack. According to clause 6,
The transmembrane domain is any one selected from the group consisting of CD8α, CD4, CD28, CD137, CD80, CD86, CD152, PD1, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46, NKG2C and OX40,
The costimulatory domain is any one selected from the group consisting of CD28, OX-40, ICOS, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46 and NKG2C, and the intracellular signaling domain is derived from CD3ζ, DNA construct for chimeric antigen receptor (CAR) knock-in specific for cancer cell antigens. According to clause 6,
The signal peptide is represented by the amino acid sequence of SEQ ID NO: 14,
The transmembrane domain is CD8 represented by the amino acid sequence of SEQ ID NO: 20,
The costimulatory domain is 4-1BB represented by the amino acid sequence of SEQ ID NO: 22,
DNA for chimeric antigen receptor (CAR) knock-in specific to cancer cell antigen, characterized in that the intracellular signaling domain is CD3ζ represented by the amino acid sequence of SEQ ID NO: 24 Construct. According to clause 6,
A cancer cell, characterized in that a base sequence encoding FLAG represented by the amino acid sequence of SEQ ID NO: 16 is further included between the base sequence encoding the signal peptide and the base sequence encoding the cancer cell antigen-binding domain. DNA construct for antigen-specific chimeric antigen receptor (CAR) knock-in. According to clause 6,
The DNA construct is a chimeric antigen specific to a cancer cell antigen, characterized in that it additionally contains a base sequence of 200bp to 1500bp in length encoding an HA (homology arm) tag at the 5'-end and 3'-end. DNA construct for chimeric antigen receptor (CAR) knock-in. According to clause 6,
The DNA construct is a chimeric antigen receptor specific for cancer cell antigen, characterized in that it additionally contains a poly A sequence or a DNA nuclear targeting sequence (DTS) at the 3'-end. : CAR) DNA construct for knock-in. (1) at least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6;
(2) any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein; and
(3) base sequence encoding the promoter;
A base sequence encoding a signal peptide;
A base sequence encoding a cancer cell antigen-binding domain;
base sequence encoding a transmembrane domain;
base sequence encoding a costimulatory domain; and
DNA construct for chimeric antigen receptor (CAR) knock-in specific for cancer cell antigens, containing a base sequence encoding an intracellular signal transduction domain Or a method of producing immune effector cells in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in, comprising the step of processing a DNA fragment containing the same to an immune effector cell. According to clause 15,
Expressing TGFBR2, characterized in that the immune effector cell is any one selected from the group consisting of T cells, natural killer (NK) cells, macrophages, monocytes, and dendritic cells. A method of producing an immune effector cell in which a gene is knocked out and a chimeric antigen receptor gene specific for a cancer cell antigen is knocked in. According to clause 15,
The single guide RNA, gene scissors and DNA fragment are delivered to immune effector cells through electroporation or gene transfer vector,
The electroporation is performed under the conditions of 1000 V to 2500 V, 5 ms to 50 ms, and 1 pulse to 5 pulse,
A method of producing an immune effector cell in which the TGFBR2 expression gene is knocked out and a chimeric antigen receptor gene specific for a cancer cell antigen is knocked in, wherein the gene transfer vector is a plasmid, a viral vector, or a non-viral vector. . According to clause 15,
Before or after treating the single guide RNA, gene scissors, and DNA fragments to the immune effector cells, one or more cytokines selected from the group consisting of IL-2, IL-15, IL-21, and TGF-β1 are applied to the immune effector cells. A method of producing immune effector cells in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in, characterized in that the cells are further treated. The TGFBR2 expression gene is knocked out by one or more single guide RNAs for TGFBR2 (TGF beta receptor 2) knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6. -Out, and a chimeric antigen receptor (CAR) specific for the cancer cell antigen of any one of claims 6 to 13 is knocked in at the site where the TGFBR2 expression gene is knocked out. Immune effector cells into which the dragon DNA construct has been inserted. A pharmaceutical composition for preventing or treating cancer, comprising the immune effector cell of claim 19 as an active ingredient. According to clause 20,
The above cancers include squamous cell cancer, small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung, mesothelial cancer, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioma, cervical cancer, ovarian cancer, liver cancer, and bladder cancer. selected from the group consisting of hepatocellular carcinoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, renal cancer, prostate cancer, vulvar cancer, thyroid cancer, liver carcinoma, leukemia and other lymphoproliferative disorders, and head and neck cancer. A pharmaceutical composition for preventing or treating cancer, characterized in that it is one of the following.