KR20240039656A - Liquid biopsy-based biomarker for endometrial cancer diagnosis and use thereof - Google Patents

Abstract

The present invention relates to a liquid biopsy-based diagnostic biomarker for endometrial cancer and its use. Specifically, the biomarker, which is a mutant gene detected in peritoneal fluid and plasma ctDNA as well as tissue gDNA of the endometrial cancer genome at the whole exome level, is used. This allows you to diagnose endometrial cancer or monitor recurrence. In other words, the present invention confirmed the mutational environment of endometrial cancer in peritoneal fluid and plasma ctDNA and complemented tissue heterogeneity. Furthermore, the biomarkers can be used to develop genetic in vitro diagnostic compositions, diagnostic kits, or medical devices for diagnosing endometrial cancer and monitoring recurrence.

Description

Liquid biopsy-based biomarker for endometrial cancer diagnosis and use thereof}

The present invention relates to a liquid biopsy-based diagnostic biomarker for endometrial cancer and its use. More specifically, a biomarker for diagnosing endometrial cancer, which is a mutant gene detected in ctDNA of peritoneal fluid and/or plasma, and a method for detecting the biomarker. It relates to a composition for diagnosing or monitoring recurrence of endometrial cancer containing a substance capable of detecting and diagnosing cancer, and a diagnostic kit.

Endometrial cancer (EC) is the most common gynecological cancer affecting the endometrium. Molecular classification of endometrial cancer plays an important role in determining treatment. The Cancer Genome Atlas (TCGA) classifies endometrial cancer into four groups (POLE hypermutation, MSI hypermutation, CN (copy number) low, CN high). However, the methodology used in molecular classification in TCGA studies is very complex and expensive for clinical application. Therefore, a relatively practical methodology was developed. In a previous study, TP53 mutation testing/p53 immunohistochemistry (IHC) was performed to determine p53 status to classify the CN high TCGA group. This approach demonstrated risk discrimination capabilities similar to that provided by the European Society of Medical Oncology (ESMO) risk stratification system. A recent European Society of Gynecological Oncology guideline specifies (1) POLE mutation, (2) P53-abnormality, (3) mismatch repair deficiency (MMRd), and (4) non-specific molecular profile. -specific molecular profile (NSMP) presented the possibility of integrating various treatment options based on molecular classification for tumors. Patients with POLE-mutated tumors have an excellent prognosis, patients with p53-abnormal tumors have a poor prognosis, and patients with MMRd or NSMP have an intermediate prognosis.

Cell free DNA (cfDNA) molecules were first discovered in the human circulation in 1948, and many studies have demonstrated their potential use as noninvasive biomarkers for several cancer phenotypes. Circulating tumor DNA (ctDNA), which represents a small percentage of cfDNA, originates from primary sites, metastatic sites, or circulating tumor cells (CTCs). Compared to tissue biopsy, liquid biopsy is a minimally invasive method for the investigation of circulating tumor cells (CTC), circulating tumor DNA (ctDNA), and tumor-derived exosomes.

Previous studies have suggested that ctDNA from peritoneal fluid may provide additional genomic information that cannot be obtained from tumor and plasma ctDNA of various cancers. ctDNA may be useful in clinical practice. According to the National Comprehensive Cancer Network (NCCN) guidelines (https://www.nccn.org/, accessed September 10, 2021), peritoneal fluid should be included in surgical procedures. Cytology alone has no impact on staging, but data should be collected because positive cytology is considered an adverse risk factor. Recent genomic studies of tumor ctDNA isolated from plasma and peritoneal fluid were performed using targeted sequencing approaches. Concomitant KRAS and PIK3CA mutations between tumor, plasma, and peritoneal fluid are reported in endometrial cancer through targeted sequencing of tissue-derived gDNA and quantitative polymerase chain reaction (PCR) analysis of ctDNA derived from plasma and peritoneal fluid. It has been done. Additionally, a study using a custom panel targeting 30 hotspot mutations in four genes (CTNNB1, KRAS, PTEN, and PIK3CA) found that 33% of endometrial cancer patients had plasma mutations consistent with mutations in the tumor. I have confirmed it. Another study suggested that plasma ctDNA can detect microsatellite instability (MSI) status in endometrial cancer. However, to date, no genomic studies have been reported comparing plasma and peritoneal fluid cfDNA/ctDNA from endometrial cancer patients at the whole-genome or whole-exome level, with well-known EC-related gene mutations including TP53, PTEN, KRAS, and PIK3CA. In addition, there is a need to investigate the mutational profile of EC.

Accordingly, the present inventors performed whole-exome sequencing (WES) on gDNA extracted from tissues of endometrial cancer (EC) patients and ctDNA extracted from plasma and peritoneal fluid, and analyzed comprehensive mutation profile, copy number variation (CNA), Mutation consistency was confirmed by analyzing MSI status and mutation signature, and p53 immunohistochemistry was performed for a more comprehensive study to complete the present invention.

The purpose of the present invention is to provide a liquid biopsy-based biomarker for diagnosing endometrial cancer and its use.

In order to achieve the above object, the present invention provides a biomarker detected in ctDNA extracted from plasma and/or peritoneal fluid, the biomarker including TP53, PTEN, KRAS, PIK3CA, POLE, ARID1A, CTNNB1, KMT2C, PRKAR1A, NOTCH2, Provides a biomarker for predicting, diagnosing or monitoring recurrence of endometrial cancer, characterized in that it is at least one selected from the group consisting of USP6, SDHA, POLQ, PREX2, CASP8, SF3B1, SOX17, MYCN, CDH1 and MYC.

In the present invention, the biomarker is TP53, and when one or more mutations selected from the group consisting of the following are detected in TP53, endometrial cancer can be characterized as positive or recurrent:

(a) frameshift mutation (p.P20fs, p.S37fs, p.C3fs, or p.K250fs);

(b) nonsense mutation (p.R174X); and

(c) Missense mutation (p.R248Q or p.R181C).

In the present invention, the biomarker is PTEN, and when a missense mutation (p.R130Q and/or p.Y27N) is detected in PTEN, endometrial cancer can be characterized as positive or recurrent.

In the present invention, the biomarker is KRAS, and when a missense mutation (p.G13D and/or p.G12A) is detected in KRAS, endometrial cancer can be characterized as positive or recurrent.

In the present invention, the biomarker is PIK3CA, and when one or more missense mutations selected from the group consisting of p.R38H, p.Q546P, p.H1047Y, and p.R38C are detected in PIK3CA, the endometrium It may be characterized as cancer-positive or recurrent.

In the present invention, the biomarker is POLE, and when one or more mutations selected from the group consisting of the following are detected in POLE, endometrial cancer can be characterized as positive or recurrent:

(a) frameshift mutation (p.V1446fs); and

(b) Missense mutation (p.A465V or p.R2165H).

In the present invention, the biomarker is ARID1A, and when one or more mutations selected from the group consisting of the following are detected in ARID1A, endometrial cancer can be characterized as positive or recurrent:

(a) In frame mutation (p.1326_1327del)

(b) frameshift mutations (p.S2179fs, p.M793fs, p.D2260fs, p.P1467fs, p.P1897fs, p.V132fs, p.P2139fs, p.A1517fs, p.G1848fs, p.P549fs, p.Y1324fs, or p.Y222fs);

(c) nonsense mutation (p.R2158X, p.Y1012X, p.R1276X, or p.Q537X); and

(d) Missense mutation (M1388V or p.T1649I).

In the present invention, the biomarker is CTNNB1, and in CTNNB1, one or more missense mutations selected from the group consisting of p.D32Y, p.R486C, p.D32N, p.H737Q, and p.I35S are detected. If so, it can be characterized as benign or recurrent endometrial cancer.

In the present invention, the biomarker is KMT2C, and when one or more mutations selected from the group consisting of the following are detected in KMT2C, endometrial cancer can be characterized as positive or recurrent:

(a) frameshift mutation (p.K2797fs);

(b) nonsense mutation (p.Q755X); and

(c) Missense mutations (p.A3366T, p.R380L, p.G315S, p.R284Q, p.S764F, p.D348N, p.K339N, p.S338L, p.E765G, p.G315C, p.G865D, p.E387Q, p.L4264M, p.Q2632P, p.S349N, p.A3222V, p.T820I, or p.K3620N).

In the present invention, the biomarker is PRKAR1A, and when a nonsense mutation (p.

In the present invention, the biomarker is NOTCH2, and when one or more missense mutations selected from the group consisting of p.N2265K, p.H107P, p.I2310L and p.H1390L are detected in NOTCH2, the endometrium It may be characterized as cancer-positive or recurrent.

In the invention, the biomarker is USP6, and when one or more mutations selected from the group consisting of the following are detected in USP6, endometrial cancer can be characterized as positive or recurrent.

(a) In frame mutation (c.201_202GT);

(b) Frameshift mutation (p.R1249fs); and

(c) missense mutation (p.M80I, p.K66Q, p.R69W, p.L121S, p.G125R, p.R126K, p.Q128K, or p.S1148L).

In the invention, the biomarker is SDHA, and when one or more mutations selected from the group consisting of the following are detected in SDHA, endometrial cancer can be characterized as positive or recurrent.

(a) Frameshift mutation (p.T567fs); and

(b) Missense mutation (p.A69T, A466T, p.R465Q, p.V446A, p.A449V, p.S456L, p.C467S, or p.A454T).

In the invention, the biomarker is POLQ, and when one or more mutations selected from the group consisting of the following are detected in the POLQ, endometrial cancer can be characterized as positive or recurrent.

(a) Frameshift mutation (p.L1430fs); and

(b) Missense mutation (p.R137W or p.R2347H).

In the present invention, the biomarker is PREX2, and when a missense mutation (p.N473K) is detected in PREX2, endometrial cancer can be characterized as positive or recurrent.

In the present invention, the biomarker is CASP8, and when a nonsense mutation (p.Y319X) and/or a missense mutation (p.A326V) is detected in CASP8, endometrial cancer is positive or relapsed. It can be characterized as:

In the invention, the biomarker is SF3B1, and when one or more mutations selected from the group consisting of the following are detected in SF3B1, endometrial cancer may be positive or relapsed.

(a) Frameshift mutation (p.M378fs);

(b) In frame mutation (p.S377delinsTPC); and

(c) Missense mutation (p.Q29P, p.G742D, or p.R387W).

In the invention, the biomarker is MYCN, and when one or more mutations selected from the group consisting of the following are detected in MYCN, endometrial cancer can be characterized as positive or recurrent.

(a) Frameshift mutation (p.H29fs);

(b) In frame mutation (p.H29delinsHPPPP); and

(c) Missense mutation (p.R31P, p.G159D, p.G34R, or p.G37R).

In the invention, the biomarker is MYC, and when an in frame mutation (p.70_74del and/or p.41_41del) is detected in MYC, endometrial cancer can be characterized as positive or recurrent.

In the present invention, the biomarker is one or more selected from the group consisting of POLQ, PREX2, and SOX17, and when copy number gain is detected in the biomarker, endometrial cancer is positive or relapsed. can do.

In the present invention, the biomarker is one or more selected from the group consisting of MYCN, SF3B1, and CASP8, and when copy number loss is detected in the biomarker, endometrial cancer is positive or relapsed. can do.

The present invention also provides a composition for predicting, diagnosing, or monitoring recurrence of endometrial cancer, comprising a substance capable of detecting the biomarker.

In the present invention, the composition capable of detecting the biomarker may be characterized as a probe or primer.

The present invention also provides a kit for diagnosing or monitoring recurrence of endometrial cancer comprising the composition.

The present invention also provides an information providing method for predicting, diagnosing or monitoring recurrence of endometrial cancer comprising the following steps:

(a) extracting gDNA from tissue isolated from a biological sample of a diagnostic object, ctDNA from peritoneal fluid, and/or ctDNA from plasma;

(b) TP53, PTEN, KRAS, PIK3CA, POLE, ARID1A, CTNNB1, KMT2C, PRKAR1A, NOTCH2, USP6, SDHA, POLQ, PREX2, CASP8, SF3B1, SOX17, MYCN, CDH1 and Detecting mutations in one or more genes selected from the group consisting of MYC; and

(c) Determining endometrial cancer when a mutation in the gene is detected.

In the present invention, the biological sample may be one or more selected from the group consisting of tumor tissue, blood, and peritoneal cell fluid.

The biomarker, which is a mutant gene detected in peritoneal fluid and/or plasma ctDNA of the present invention, can be applied to endometrial cancer diagnosis or recurrence monitoring. In particular, the presence or absence of mutations in peritoneal fluid ctDNA can be meaningful in predicting the prognosis of endometrial cancer as it can replace cancer cells not found in ascites. Therefore, the biomarkers can be used to develop genetic in vitro diagnostic compositions, diagnostic kits, or medical devices for diagnosing endometrial cancer and monitoring recurrence, and to determine the use of targeted anticancer drugs.

Figure 1A relates to a flow diagram of sample collection and data analysis from a patient.
Figure 2b compares the mutant allele frequency (MAF) of mutations shared between tissue and plasma, tissue and peritoneal fluid, and plasma and peritoneal fluid. Mutant allele frequencies (MAF) are shown on the x- and y-axes.
Figure 1c shows the results of analyzing somatic mutations and microsatellite instability in matched tissue and ctDNA samples through the top 20 endometrial cancer (EC)-related genes. Samples are indicated on the x-axis and EC-related genes are listed on the y-axis. Nonsynonymous mutations and nonsense mutations are shown in orange and yellow, respectively. Colors are displayed differently depending on MSI status (MSS or MSI).
Figure 2 relates to the results of analysis of recurrent somatic mutations (≥3 samples) in matched tissue and ctDNA samples through 401 cancer-related genes. Figure 2a shows tissue and plasma samples, and Figure 2b shows tissue, plasma, and peritoneal fluid samples. The size of each dot represents the number of repeats, and the color of each dot represents the type of somatic mutation. Samples are displayed on the x-axis and genes are listed on the y-axis.
Figure 3 shows the results of P53 immunohistochemical staining (left) and the results of confirming TP53 mutation (right) through sanger sequencing (tumor tissue) and whole-exome sequencing snapshot (peritoneal fluid). In Figure 3, the tissues are from EC1, EC3, and EC7, and the peritoneal fluid is from EC1, EC3, and EC4.
As a result of P53 immunohistochemical staining in Figure 3A, cancer cells show extensive and strong nuclear staining in almost all nuclei. Additionally, TP53 mutations were verified using EC1 tissue and peritoneal fluid.
In Figure 3b, P53 immunohistochemical staining results show that the tumor cells show a wild-type pattern. Additionally, TP53 mutations were verified using EC3 tissue and peritoneal fluid.
P53 immunohistochemical staining in Figure 3C shows that tumor cells show a wild-type pattern with “high” focal expression on a “low” wild-type background. Additionally, TP53 mutation was verified using peritoneal fluid from EC4.
In Figure 3D, P53 immunohistochemical staining shows that tumor cells are completely negative in all tumor cell nuclei. Additionally, TP53 mutation was verified using tissue samples from EC7.
Figure 4 relates to recurrent copy number alterations (CNAs) in endometrial cancer (EC). GISTIC2.0 analysis showing recurrent focal amplified regions (Figures 4A-4C) and deletion regions (Figures 4D-4F) in tissue, plasma and peritoneal fluid samples from EC patients. The x-axis represents the FDR q-value and the y-axis represents the chromosomes. Cancer-related genes are indicated in each peak. The red line represents the amplification peak and the blue line represents the deletion peak. The green line represents the q-value threshold of 0.25.
Figure 5 relates to the mutational signature of endometrial cancer (EC). Single-bas-substitution (SBS) (Figures 5a to 5c) and small insertion-and-deletion (small ID) of the COSMIC data base identified in tissue, plasma, and peritoneal fluid of EC patients 5D to 5E) (cosine similarity ≥ 0.9). Bar plots represent the proportion of each signature.
Figure 6 relates to mutation verification through Sanger sequencing.
Figure 7 relates to copy number variation (CNA) of tissue, plasma and peritoneal fluid samples from three EC patients. Specifically, CNAs from the entire chromosomal region of EC4 (A), CNAs from chromosome 8 from EC4 (B), CNAs from chromosome 2 from EC1 (C), and CNAs from paired tissue and plasma samples from EC7 (D) are shown. The x-axis represents the location, the y-axis represents the log2 copy number ratio, and the genes associated with each EC are indicated.
In Figure 8, samples were hierarchically clustered based on CNA and classified into four groups according to MSI status, POLE EDM, and copy number cluster. Figure 8A is a heatmap showing the CNA of each tumor gDNA (horizontal axis) plotted against cancer-related genes from the Cancer Gene Census and genes previously reported in EC (vertical axis). Figure 8B shows samples classified into four groups from each tumor gDNA, plasma ctDNA, and peritoneal fluid ctDNA.
Figure 9 shows the reference sequences of TP53, PTEN, KRAS, PIK3CA, POLE, ARID1A, CTNNB1, KMT2C, PRKAR1A, NOTCH2, USP6, SDHA, POLQ, PREX2, CASP8, SF3B1, SOX17, MYCN, CDH1 and MYC. It's about.
Figure 10 relates to SNP ref/alt allele (reference allele and alternative allele that do not affect the phenotype in SNP (single nucleotide polymorphism)) information.

Hereinafter, the present invention will be described in detail.

Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

The amino acid sequence used in the present invention is abbreviated as follows. Amino acid abbreviations: Alanine (Ala; A), Arginine (Arg; R), Asparagine (Asn; N), Asparatic Acid (Asp; D), Cysteine (Cys; C), Glutamic Acid (Glu; E), Glutamine (Gln; Q), Glycine (Gly; G), Histidine (His; H), isoleucine (Ile; I), Leucine ; Leu; L), Lysine (Lys; K), Methionine (Met; M), Phenylalanine (Phe; F), Proline (Pro; P), Serine (Ser; S) , Threonine (Thr; T), Tryptophan (Trp; W), Tyrosine (Tyrosine; Y), Valine (Val; V).

In the present invention, the abbreviation “X” in relation to amino acid sequences refers to all amino acids or unknown.

In the present invention, mutations include single nucleotide polymorphism, gene copy number variation, base insertion, base deletion, base duplication, and/or base inversion. Including, but not limited to, mutations caused by

In the present invention, mutations are described at the DNA level, and explanations can be added at the protein and RNA levels. Mutations should be described in relation to an approved reference sequence. Reference sequences must be publicly published and clearly described.

The following prefixes can be used to describe the tpye of the reference sequence: c (coding DNA reference sequence), g (linear genomic reference sequence), p (protein reference sequence), r (RNA reference sequence).

In the present invention, the abbreviations “>” are substitution, “del” is deletion, “dup” is duplication, “ins” is insertion, “inv” is inversion, “ “delins” is Deletion-insertion, “con” is conversion, “fs” is frame shift, “ext” is extension, and “chr” is chromosome. it means.

In the present invention, ":" (colon) is used as a separator between the reference sequence file identifier (accession.version-number) and the actual description of the variant (e.g., NM_001126115:exon1:c.59delC:p.P20fs).

We investigated a comprehensive genomic profile of endometrial cancer (EC) to determine the clinical utility of ctDNA in peritoneal fluid and plasma samples through WES and p53 immunohistochemistry.

As a result, it was confirmed that genetic analysis of liquid biopsy samples (peritoneal fluid and plasma ctDNA) can compensate for tissue heterogeneity. Additionally, it was confirmed that EC patients with negative peritoneal fluid had important genetic characteristics similar to EC patients with positive peritoneal fluid. Furthermore, tissue, peritoneal fluid, and plasma showed reliable mutational correlations with respect to MAF, genetic traits, and mutational signatures, but these parameters were not identical across the three DNA samples.

In one embodiment according to the present invention, patient EC4 had disease recurrence 15 months after surgery, and tissue gDNA showed a TP53wt phenotype. However, p53 immunohistochemical analysis showed that EC4 displayed a wild-type pattern with “high” local expression in a “low” wild-type background ( Fig. 3C ). Abrupt and complete regional aberrant p53 expression in less than 10% is generally defined as a 'subclonal' region. However, EC4 tissue was not sufficient to be characterized as a “subclone” because it showed less than 10% aberrant p53 expression. EC4 patients had no TP53 mutations detected in tissues, but TP53 mutations were detected in both peritoneal fluid and plasma. This may explain the ‘heterogeneity’ of P53 observed in immunohistochemistry. Through molecular characterization, it was confirmed that patient EC4 had ‘multiple classifier EC’ including POLEmut (peritoneal fluid, plasma), TP53mut (peritoneal fluid, plasma), and MMRd (tissue, peritoneal fluid) (Table 2).

Our data support the NCCN guidelines, including peritoneal/ascitic fluid cytology, as the guiding principle for surgery, but positive peritoneal fluid does not impact prognosis. WES was performed using peritoneal fluid ctDNA from EC patients (4/10 patients). Of the four EC patients, two (EC2 and EC4) had positive peritoneal fluid and two (EC1 and EC3) had negative peritoneal fluid. Non-silent TP53 mutations were found in the peritoneal fluid of EC patients with negative peritoneal fluid, despite the absence of cancer cells (Tables 1 and 2, Figures 3a and 3b). Additionally, ctDNA extracted from peritoneal fluid of EC1 patients showed MSI-H status similar to tissue gDNA. These data indicate that molecular characterization of the peritoneal fluid, rather than the detection of malignant cells in the peritoneal fluid, is important for the stratification of EC.

The present inventors confirmed that ctDNA from liquid biopsy samples (peritoneal fluid and plasma) contained important genetic biomarkers and that there was significant correlation between them. Additionally, we confirmed that endometrial cancer harbors not only known mutations in driver genes such as ARID1A, CTNNB1, PIK3CA, and PTEN, but also novel mutations in cancer-related genes such as KMT2C and PRKAR1A. In particular, strong mutation matches were confirmed between tissue gDNA and ctDNA from plasma and peritoneal fluid in well-known cancer-related genes (ARID1A, PIK3CA, KMT2C and PRKAR1A, TP53). KMT2C was the most frequently mutated gene among the three DNA sources. This gene was previously known to be a chromatin remodeling-related gene in EC. In KMT2C, at least one of the same recurrent missense mutations was identified in all samples (Figure 2a). Additionally, missense or nonsense mutations were identified in the recurrently mutated genes NOTCH2, PRKAR1A, USP6, and SDHA in EC.

The present invention suggests that chromosomal mutation information collected from ctDNA in peritoneal fluid and plasma is a useful tool not only for diagnosing endometrial cancer but also for monitoring recurrence after treatment. In the present study, most endometrial cancer recurrent copy number alterations (CNAs) were identified in tissues as gains at 8q24.21, 8q11.2, 12p12.1 and 3q26-27 and losses at 4p16.3 and 3p14.2. This is largely consistent with what was described in previous endometrial cancer genome research. To date, there have been no reports of recurrent copy number alterations (CNAs) in endometrial cancer in peritoneal fluid or plasma samples. However, using WES, we identified loss at 4p15.32 (tissue, plasma, and peritoneal fluid) and gain at 12p13.31 (tissue and peritoneal fluid) as the most frequently occurring recurrent copy number mutations in EC. In terms of cancer-related genes, novel recurrent copy number mutations were identified in PREX2 (gained 8q) and POLQ (gained 3q) in peritoneal fluid, plasma and tissue. Frequent loss of 2q33.1 in CASP8 in peritoneal fluid, plasma, and tissue, known to be highly associated with apoptosis and drug resistance, is a novel copy number variant that has not been previously reported in EC.

MSI or MMR status was confirmed using mutational signature analysis and MSI analysis of tissue, peritoneal fluid, and plasma. In our study, both tumor gDNA and ctDNA of liquid biopsy samples (tumor gDNA and peritoneal fluid ctDNA (75% match), tumor gDNA and plasma ctDNA (50% match)) of most EC patients showed the same MSI status. SBS1, SBS5 and SBS15 mutation signatures have been found in uterine and cervical cancers, of which SBS15 is initiated by defective DNA mismatch repair. Additionally, ID2 and ID7 signatures were identified with high levels of cosine similarity in tissue and peritoneal fluid DNA sources from EC patients, and these signatures are known to be associated with defective DNA mismatch repair. ID2 indels are caused by slippage of poly T repeats during DNA replication. MMR has been reported to occur in microsatellites, identifying and correcting erroneous indels that may occur during DNA replication and recombination. The MSI status of EC is an important factor in diagnosis and treatment. MSI status can be used to diagnose the type of EC, predict risk of Lynch syndrome, identify prognosis, and predict the potential utility of immune checkpoint inhibitors and targeted therapies.

In the present invention, the four molecular subtypes of the EC genome were confirmed as follows (FIG. 8b). TCGA showed that ECs with POLE mutations exhibited a high mutational burden in tumor gDNA, and all samples with POLE mutations were examined to further confirm ctDNA matches. In addition, because most endometrioid endometrial cancers (endometrioid EC) have little copy number variation, TCGA classified the CN low group as the endometrioid group. In the present study, all EC patients had endometrioid EC, and 23 out of 24 samples including gDNA and ctDNA were classified into the CN low group. These results indicate that subtyping results for tumor gDNA and ctDNA are consistent with TCGA results.

Accordingly, in one aspect, the present invention is a biomarker detected in ctDNA extracted from plasma and/or peritoneal fluid, and the biomarker includes TP53, PTEN, KRAS, PIK3CA, POLE, ARID1A, CTNNB1, KMT2C, PRKAR1A, NOTCH2, and USP6. , SDHA, POLQ, PREX2, CASP8, SF3B1, SOX17, MYCN, CDH1 and MYC. It relates to a biomarker for predicting, diagnosing or monitoring recurrence of endometrial cancer.

In the present invention, the endometrial cancer may be characterized as having one or more molecular subtypes selected from the group consisting of POLE (polymerase epsilon exonuclease), MSI-H, CN-low, and CN-high. Not limited.

In the present invention, the biomarker is TP53, and when one or more mutations selected from the group consisting of the following are detected in TP53, endometrial cancer may be characterized as positive or recurrent, but is not limited thereto.

(a) frameshift mutation (p.P20fs, p.S37fs, p.C3fs, or p.K250fs);

(b) nonsense mutation (p.R174X); and

(c) Missense mutation (p.R248Q or p.R181C).

In the present invention, the mutation of TP53 can be determined by comparison with the reference sequence NG_017013.2 represented by SEQ ID NO: 1, but is not limited thereto. For example, NM_000546 (transcript variant 1, https://www.ncbi.nlm.nih.gov/nuccore/NM_000546), NM_001126115 (transcript variant 5, https://www.ncbi.nlm.nih.gov/nuccore/NM_001126115 ) can be compared and judged based on such criteria.

In the present invention, the biomarker is PTEN, and when a missense mutation (p.R130Q and/or p.Y27N) is detected in PTEN, endometrial cancer can be characterized as positive or recurrent. It is not limited to this.

In the present invention, the mutation of PTEN can be determined by comparison with the reference sequence NG_007466.2 represented by SEQ ID NO: 2, but is not limited thereto. For example, it can be determined by comparison based on NM_000314 (transcript variant 1, https://www.ncbi.nlm.nih.gov/nuccore/NM_000314).

In the present invention, the biomarker is KRAS, and when a missense mutation (p.G13D and/or p.G12A) is detected in KRAS, endometrial cancer can be positive or relapsed, but is limited to this. It doesn't work.

In the present invention, the KRAS mutation can be determined by comparison with the reference sequence NG_007524.2 represented by SEQ ID NO: 3, but is not limited thereto. For example, it can be judged by comparison based on NM_001369786 (transcript variant c, https://www.ncbi.nlm.nih.gov/nuccore/NM_001369786).

In the present invention, the biomarker is PIK3CA, and when one or more missense mutations selected from the group consisting of p.R38H, p.Q546P, p.H1047Y, and p.R38C are detected in PIK3CA, the endometrium It may be characterized as cancer-positive or recurrent, but is not limited thereto.

In the present invention, the mutation of PIK3CA can be determined by comparison with the reference sequence NG_012113.2 represented by SEQ ID NO: 4, but is not limited thereto. For example, it can be judged by comparison based on NM_006218 (https://www.ncbi.nlm.nih.gov/nuccore/NM_006218).

In the present invention, the biomarker is POLE, and when one or more mutations selected from the group consisting of the following are detected in POLE, endometrial cancer may be characterized as positive or recurrent, but is not limited thereto.

(a) frameshift mutation (p.V1446fs); and

(b) Missense mutation (p.A465V or p.R2165H).

In the present invention, the mutation of POLE can be determined by comparison with the reference sequence NG_033840.1 represented by SEQ ID NO: 5, but is not limited thereto. For example, it can be judged by comparison based on NM_006231 (https://www.ncbi.nlm.nih.gov/nuccore/NM_006231).

In the present invention, the biomarker is ARID1A, and when one or more mutations selected from the group consisting of the following are detected in ARID1A, endometrial cancer may be characterized as positive or recurrent, but is not limited thereto.

(a) In frame mutation (p.1326_1327del)

(b) frameshift mutations (p.S2179fs, p.M793fs, p.D2260fs, p.P1467fs, p.P1897fs, p.V132fs, p.P2139fs, p.A1517fs, p.G1848fs, p.P549fs, p.Y1324fs, or p.Y222fs);

(c) nonsense mutation (p.R2158X, p.Y1012X, p.R1276X, or p.Q537X); and

(d) Missense mutation (M1388V or p.T1649I).

In the present invention, the mutation of ARID1A can be determined by comparison with the reference sequence NG_029965.1 represented by SEQ ID NO: 6, but is not limited thereto. For example, it can be determined by comparison based on NM_006015 (transcript variant 1, https://www.ncbi.nlm.nih.gov/nuccore/NM_006015).

In the present invention, the biomarker is CTNNB1, and in CTNNB1, one or more missense mutations selected from the group consisting of p.D32Y, p.R486C, p.D32N, p.H737Q, and p.I35S are detected. In this case, it may be characterized as benign or recurrent endometrial cancer, but is not limited to this.

In the present invention, the mutation of CTNNB1 can be determined by comparison with the reference sequence NG_013302.2 represented by SEQ ID NO: 7, but is not limited thereto. For example, it can be judged by comparison based on NM_001098209 (transcript variant 2, https://www.ncbi.nlm.nih.gov/nuccore/NM_001098209).

In the present invention, the biomarker is KMT2C, and when one or more mutations selected from the group consisting of the following are detected in KMT2C, endometrial cancer may be characterized as positive or recurrent, but is not limited thereto.

(a) frameshift mutation (p.K2797fs);

(b) nonsense mutation (p.Q755X); and

(c) Missense mutations (p.A3366T, p.R380L, p.G315S, p.R284Q, p.S764F, p.D348N, p.K339N, p.S338L, p.E765G, p.G315C, p.G865D, p.E387Q, p.L4264M, p.Q2632P, p.S349N, p.A3222V, p.T820I, or p.K3620N).

In the present invention, the mutation of KMT2C can be determined by comparison with the reference sequence NG_033948.1 represented by SEQ ID NO: 8, but is not limited thereto. For example, it can be judged by comparison based on NM_170606 (https://www.ncbi.nlm.nih.gov/nuccore/NM_170606).

In the present invention, the biomarker is PRKAR1A, and when a nonsense mutation (p.

In the present invention, the mutation of PRKAR1A can be determined by comparison with the reference sequence NG_007093.3 represented by SEQ ID NO: 9, but is not limited thereto. For example, it can be judged by comparison based on NM_001276290 (transcript variant 5, https://www.ncbi.nlm.nih.gov/nuccore/NM_001276290).

In the present invention, the biomarker is NOTCH2, and when one or more missense mutations selected from the group consisting of p.N2265K, p.H107P, p.I2310L and p.H1390L are detected in NOTCH2, the endometrium It may be characterized as cancer-positive or recurrent, but is not limited thereto.

In the present invention, the NOTCH2 mutation can be determined by comparison with the reference sequence NG_008163.1 represented by SEQ ID NO: 10, but is not limited thereto. For example, NM_024408 (transcript variant 1, https://www.ncbi.nlm.nih.gov/nuccore/NM_024408), NM_001200001 (transcript variant 2, https://www.ncbi.nlm.nih.gov/nuccore/NM_001200001 ) can be compared and judged based on such criteria.

In the invention, the biomarker is USP6, and if one or more mutations selected from the group consisting of the following are detected in USP6, endometrial cancer may be characterized as positive or recurrent, but is not limited thereto.

(a) In frame mutation (c.201_202GT);

(b) Frameshift mutation (p.R1249fs); and

(c) missense mutation (p.M80I, p.K66Q, p.R69W, p.L121S, p.G125R, p.R126K, p.Q128K, or p.S1148L).

In the present invention, the mutation of USP6 can be determined by comparison with the reference sequence NC_000017.11 represented by SEQ ID NO: 11, but is not limited thereto. For example, it can be judged by comparison based on NM_004505 (transcript variant 2, https://www.ncbi.nlm.nih.gov/nuccore/NM_004505).

In the invention, the biomarker is SDHA, and when one or more mutations selected from the group consisting of the following are detected in SDHA, endometrial cancer may be characterized as positive or recurrent, but is not limited thereto.

(a) Frameshift mutation (p.T567fs); and

(b) missense mutation (p.A69T, A466T, p.R465Q, p.V446A, p.A449V, p.S456L, p.C467S, or p.A454T).

In the present invention, the mutation of SDHA can be determined by comparison with the reference sequence NG_012339.1 represented by SEQ ID NO: 12, but is not limited thereto. For example, NM_001294332 (ranscript variant 2, https://www.ncbi.nlm.nih.gov/nuccore/NM_001294332), NM_001330758 (transcript variant 3, https://www.ncbi.nlm.nih.gov/nuccore/NM_001330758 ) can be compared and judged based on such criteria.

In the invention, the biomarker is POLQ, and when one or more mutations selected from the group consisting of the following are detected in the POLQ, endometrial cancer may be characterized as positive or recurrent, but is not limited thereto.

(a) Frameshift mutation (p.L1430fs); and

(b) Missense mutation (p.R137W or p.R2347H).

In the present invention, the mutation of POLQ can be determined by comparison with the reference sequence NC_000003.12 represented by SEQ ID NO: 13, but is not limited thereto. For example, it can be judged by comparison based on NM_199420 (https://www.ncbi.nlm.nih.gov/nuccore/NM_199420).

In the present invention, the biomarker is PREX2, and when a missense mutation (p.N473K) is detected in PREX2, endometrial cancer can be characterized as positive or recurrent, but is not limited thereto.

In the present invention, the mutation of PREX2 can be determined by comparison with the reference sequence NG_047022.1 represented by SEQ ID NO: 14, but is not limited thereto. For example, it can be determined by comparison based on NM_024870 (transcript variant 1, https://www.ncbi.nlm.nih.gov/nuccore/NM_024870).

In the present invention, the biomarker is CASP8, and when a nonsense mutation (p.Y319X) and/or a missense mutation (p.A326V) is detected in CASP8, endometrial cancer is positive or relapsed. It may be characterized by, but is not limited to, this.

In the present invention, the mutation of CASP8 can be determined by comparison with the reference sequence NG_007497.1 represented by SEQ ID NO: 15, but is not limited thereto. For example, NM_033356 (transcript variant 3, https://www.ncbi.nlm.nih.gov/nuccore/NM_033356) NM_001080125 (transcript variant 7, https://www.ncbi.nlm.nih.gov/nuccore/NM_001080125) It can be judged by comparison based on etc.

In the invention, the biomarker is SF3B1, and when one or more mutations selected from the group consisting of the following are detected in SF3B1, endometrial cancer may be characterized as positive or recurrent, but is not limited thereto.

(a) Frameshift mutation (p.M378fs);

(b) In frame mutation (p.S377delinsTPC); and

(c) Missense mutation (p.Q29P, p.G742D, or p.R387W).

In the present invention, the mutation of SF3B1 can be determined by comparison with the reference sequence NG_032903.2 represented by SEQ ID NO: 16, but is not limited thereto. For example, NM_012433 (transcript variant 1, https://www.ncbi.nlm.nih.gov/nuccore/NM_012433), NM_001005526 (transcript variant 2, https://www.ncbi.nlm.nih.gov/nuccore/NM_001005526 ) can be compared and judged based on such criteria.

In the invention, the biomarker is MYCN, and when one or more mutations selected from the group consisting of the following are detected in MYCN, endometrial cancer may be characterized as positive or recurrent, but is not limited thereto.

(a) Frameshift mutation (p.H29fs);

(b) In frame mutation (p.H29delinsHPPPP); and

(c) Missense mutation (p.R31P, p.G159D, p.G34R, or p.G37R).

In the present invention, the mutation of MYCN can be determined by comparison with the reference sequence NG_007457.1 represented by SEQ ID NO: 18, but is not limited thereto. For example, it can be judged by comparison based on NM_001293231 (transcript variant 3, https://www.ncbi.nlm.nih.gov/nuccore/NM_001293231).

In the invention, the biomarker is MYC, and if an in frame mutation (p.70_74del and/or p.41_41del) is detected in MYC, it may be characterized as positive or recurrent endometrial cancer. Not limited.

In the present invention, the mutation of MYC can be determined by comparison with the reference sequence NG_007161.2 represented by SEQ ID NO: 20, but is not limited thereto. For example, it can be judged by comparison based on NM_001354870 (transcript variant 2, https://www.ncbi.nlm.nih.gov/nuccore/NM_001354870).

In the present invention, the biomarker is one or more selected from the group consisting of POLQ, PREX2, and SOX17, and when copy number gain is detected in the biomarker, endometrial cancer is positive or relapsed. It can be done, but is not limited to this.

In the present invention, the biomarker is one or more selected from the group consisting of MYCN, SF3B1, and CASP8, and when copy number loss is detected in the biomarker, endometrial cancer is positive or relapsed. It can be done, but is not limited to this.

In the present invention, the biomarker includes mutations known in the art in endometrial cancer.

From another aspect, the present invention relates to a composition for predicting, diagnosing, or monitoring recurrence of endometrial cancer, comprising a substance capable of detecting the biomarker.

In the present invention, the composition capable of detecting the biomarker may be characterized as a probe or primer, but is not limited thereto.

From another aspect, the present invention relates to a kit for diagnosing or monitoring recurrence of endometrial cancer comprising the composition.

From another aspect, the present invention relates to a method of providing information for predicting, diagnosing or monitoring recurrence of endometrial cancer, including the following steps.

(a) extracting gDNA from tissue isolated from a biological sample of a diagnostic object, ctDNA from peritoneal fluid, and/or ctDNA from plasma;

(b) TP53, PTEN, KRAS, PIK3CA, POLE, ARID1A, CTNNB1, KMT2C, PRKAR1A, NOTCH2, USP6, SDHA, POLQ, PREX2, CASP8, SF3B1, SOX17, MYCN, CDH1 and Detecting mutations in one or more genes selected from the group consisting of MYC; and

(c) Determining endometrial cancer when a mutation in the gene is detected.

In the present invention, the biological sample may be characterized as one or more selected from the group consisting of tumor tissue, blood, and peritoneal cell fluid, but is not limited thereto.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it is obvious to those skilled in the art that the scope of the present invention should not be construed as limited by these examples.

[Example]

Experimental materials and methods

(Example 1-1) Sample preparation

The present inventors collected samples from patients with endometrial cancer (EC) with approval from the institutional review board of Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea (KC17TNSI0215 and XC16TISI0014K). New tumor tissue and peritoneal cytological fluid were collected during primary staging surgery. Tumor tissues were collected from 10 EC patients. The tissue size of each EC patient was ≥0.5*0.5*0.5 cm ³ . Peritoneal fluid (~10 ml) was collected from 4 of 10 EC patients. 10 ml blood was collected from each patient before surgery. Therefore, a total of 10 tumor tissues, 10 blood samples, 4 peritoneal fluid samples, and 10 buffy coat samples as matched controls were collected from 10 EC patients (Figure 1a).

(Example 1-2) Preparation of gDNA and ctDNA

We used gDNA extracted from tissue and ctDNA extracted from plasma and peritoneal fluid, and captured the exome using the Agilent SureSelect Target Enrichment protocol for Illumina paired-end sequencing library (version C2, December 2018). (capture). The Agilent SureSelect Human All Exon V6 probe set (Agilent Technologies, Santa Clara, CA, USA) was used. After washing and amplifying the captured DNA, the final purified product was quantified using the KAPA Library Quantification kit (Roche Sequencing Solutions, Pleasanton, CA, USA), and the final purified product was quantified using a TapeStation DNA screentape D1000 (Agilent Technologies, Santa Clara, CA, USA). ) was used to evaluate its quality. Sequencing was performed on the Novaseq6000 platform (Illumina, San Diego, CA, USA).

(Example 1-3) WES and somatic mutation

Adapter sequences were removed using Agilent SurecallTrimmer v4.0.1 and trimmed reads were mapped to the human reference genome (GRCh37/hg19) using BWAMEM v0.7.12. ) was done. Poorly mapped reads and duplicated reads with mapping quality less than 20 were identified using Samtools v1.3.1 and LocatIt v4.0.1 (Agilent Technologies, Santa Clara, CA, USA), respectively. It was discarded using . The basic quality of the duplicated reads was recalibrated using the Genome Analysis Toolkit (GATK v3.7) and BaseRecalibrator. Somatic mutations and indel mutations (Identification of insertion/deletion; InDel) were detected using MuTect2. ANNOVAR (annotated variation) and SnpEff v4.3t were used to functionally annotate each mutation in the coding region. Because most ctDNA is derived from dying noncancerous cells, a frequency of 3% for gDNA and 0.1% for ctDNA was applied to evaluate mutations. Germline variants were removed from the Genome Aggregation Database (East Asia) and Korean Variant Archive (KOVA) if the minor allele frequency was >1%. PolyPhen-2, PROVEAN, and SIFT were used to predict the effects of amino acid substitutions on protein function and structure.

(Example 1-4) Mutation signature analysis

Somatic mutational signatures were estimated using SigProfilerMatrixGenerator v1.1.20 (Alexandrov Lab, San Diego, CA, USA) and SigProfilerExtractor v1.0.17 (Alexandrov Lab, San Diego, CA, USA). The optimal mutation signature set was deciphered based on the Non-negative Matrix Factorization (NMF) algorithm. The algorithm used multiple NMF iterations (1024 in most cases), and in each iteration, SigProfilerExtraction minimized the generalized Kullback-Leibler divergence limited to nonnegativity. Single-base-substitution (SBS), double base substitution (DBS), and small insertion-and-deletion (ID) to analyze mutational signatures in tissue, plasma, and peritoneal fluid samples. Similarity was measured using COSMIC (Catalog of Somatic Mutations in Cancer) mutational signature v3.1, which includes the signature. Similarity between mutation signatures was measured using cosine correlation similarity, ranging from 0 (not completely identical) to 1 (exactly identical).

(Example 1-5) Copy number variation

Copy number calling was performed on all paired tumor-normal sequencing data using CNVkit v0.9.7. Copy number aberrations (CNAs) were analyzed using two categories: copy number gain (3-7 copies) and copy number loss (0-1 copies). Genomic aberrations were identified using the CBS algorithm, which uses a modification of binary segmentation to divide regions with equal copy numbers. After segmentation, the GISTIC (genomic identification of significant targets in cancer) algorithm was applied to compare copy number variation (CNA) at the gene level. The significance threshold for the q-value to determine significant amplification and deletion regions was set at 0.25. We collected tissue, plasma and peritoneal fluid samples from each group and analyzed the recurrence area of copy number variation (CNA) for each group. CNTools was used to convert segment data by the sample matrix into genes, and was calculated from the Cancer Gene Census (http://cancer.sanger.ac.uk/census; accessed on 2021.08.10). A total of 666 cancer-related genes and genes previously reported in EC were used. Copy number variation (CNA) data were hierarchically clustered using Manhattan distance and Ward's method.

(Example 1-6) MSI analysis

Microsatellite instability (MSI) status was estimated using the MANTIS algorithm, which was developed to detect MSI with high sensitivity and specificity across various cancer types. The Euclidean distance was used as a metric to determine the MSI state of the sample. Samples with values greater than or equal to the threshold were classified as microsatellite instability (MSI), and the remaining samples were classified as microsatellite stable (MSS). Samples were classified into four molecular groups based on MSI status, DNA polymerase epsilon (POLE) exonuclease domain mutation (EDM), and copy number mutation patterns. MSI is a marker of mismatch repair deficiency (MMRd), and tests for MMRd and MSI have been reported to be correlated. The MSI test is often used to predict MMR protein status.

(Example 1-7) Immunohistochemistry

Formalin-fixed paraffin-embedded blocks were cut into 4-μm-thick sections. Immunohistochemical staining for p53 used a primary antibody against p53 (pre-diluted, DO-7, Roche Diagnostics, IN, USA), and automatic immunohistochemical staining was performed according to the manufacturer's instructions. All tissue slides were stained using an immunohistochemistry (IHC) staining device (BenchMarkXT, Ventana Medical Systems, Tucson, AZ, USA). Staining patterns were classified as follows: (1) overexpression, when more than 80% of tumor cell nuclei showed extensive and strong nuclear staining; (2) complete absence, when tumor cell nuclei do not exhibit benign nuclei; (3) wild type, if tumor cells show a staining pattern between overexpression and complete absence; and (4) cytoplasmic, when tumor cells show obvious cytoplasmic staining. The wild type pattern was interpreted as normal/wild type, and the remaining patterns were interpreted as abnormal/aberrant/mutation type.

Patient, sample and clinical data analysis results

We analyzed 10 tumor tissues, 10 plasma samples, and 4 peritoneal fluid samples from 10 EC patients (Figure 1a). All patients underwent staging surgery. The clinicopathological characteristics of the patients are shown in Table 1. The patients' ages at diagnosis ranged from 45 to 74 years (median, 57 years). Patients were classified into stages I-IV according to the 2009 International Federation of Gynecology and Obstetrics (FIGO) guidelines with histopathological diagnosis of endometrioid adenocarcinoma (n=10). Two patients (20%) were diagnosed with FIGO stage I, 1 patient (10%) with stage II, 6 patients (60%) with stage III, and 1 patient (10%) with stage IV. The grade distribution included 4 people (40%) in grade 1, 2 people (20%) in grade 2, and 4 people (40%) in grade 3. Among these, three EC patients (EC2, EC4, and EC8) tested positive for peritoneal fluid. The follow-up period was 29 to 62 months (median 46 months). Seven of 10 patients showed no recurrence or progression. EC4 (stage 3 patient) showed recurrence 15 months after surgery and achieved NO Evidence of Disease (NED). EC8 progressed and reached NED 5 months after surgery. EC9 (stage 4) showed progression without NED. All patients received adjuvant treatment (chemotherapy and radiotherapy).

According to the European Society of Gynecological Oncology (ESGO) 2016 risk stratification criteria, patient EC3 represents high-intermediate risk, patient 8 represents high risk, and EC9 represents metastatic risk. On the other hand, the evaluation of ESGO 2021 standards is shown in Table 2. After applying ESGO 2021 molecular classification, the risk group of one EC patient (EC6) was changed from 'high risk' to 'high-intermediate risk' as a result of MSI status.

Mutational profiles of EC patient-derived peritoneal fluid ctDNA, plasma ctDNA, and tumor gDNA

We analyzed 34 samples (10 tumor tissues, 10 plasma, 4 peritoneal fluids, and 10 matched buffy coats) that passed quality inspection from 10 EC patients. The coverage range of sequencing depth is 206.7X (174.6-226.4X) for tissue, 171.2X (141.6-216.5X) for plasma, 199.0X (161.3-246.7X) for peritoneal fluid, and matched buffy coat. For the samples, the median value was 206.0X (165.3X-264.1X) (Table 3). gDNA and ctDNA are shown in Table 4. The present inventors identified a total of 401 cancer-related genes in the Cancer Gene Census (http://cancer.sanger.ac.uk/census; accessed 2021.08.10) and identified 20 genes previously reported in EC. . Somatic mutations were analyzed in paired tissue, plasma, and peritoneal fluid samples from 4 EC patients, and tissue and plasma samples from 10 EC patients were analyzed in pairs (Figures 1c, 2a, 2b and Table 5).

Whole-exome sequencing data of the endometrial cancer genome Sample type Sample ID* Sequencing reads Mapped reads Mapped reads in exon (%) Coverage (mean) ^** Mean Mapping Quality buffy EC1 224,730,506 151,016,896 80.6 222.1 56.5117 tissue EC1 189,479,816 140,032,301 91.3 209.4 56.5293 plasma EC1 165,977,900 113,151,124 89.5 167.0 56.3847 peritoneal fluid EC1 202,111,152 142,934,361 85.7 212.3 56.4661 buffy EC2 251,825,862 179,938,613 85.7 264.1 56.6652 tissue EC2 181,860,022 138,319,030 90.8 205.6 56.5418 plasma EC2 188,213,754 136,210,709 91.2 203.6 56.5333 peritoneal fluid EC2 443,586,670 167,422,769 44.1 246.7 56.5096 buffy EC3 147,538,810 110,914,626 90.6 165.3 56.5159 tissue EC3 183,810,604 138,722,834 92.4 207.7 56.6205 plasma EC3 287,469,472 123,305,031 70.6 180.2 56.4865 peritoneal fluid EC3 171,658,744 109,782,486 87.1 161.3 56.4851 buffy EC4 236,858,854 171,636,976 86.4 253.4 56.7039 tissue EC4 183,736,062 142,525,935 92.4 213.0 56.4046 plasma EC4 181,080,854 96,304,681 65.6 141.6 56.4143 peritoneal fluid EC4 172,548,178 124,830,565 86.8 185.6 56.4428 buffy EC5 167,337,398 118,158,845 86.9 176.0 56.4491 tissue EC5 197,144,906 148,347,965 93.6 223.0 56.4757 plasma EC5 180,103,684 112,442,647 84.0 168.0 56.6128 buffy EC6 248,736,180 170,180,548 81.6 251.0 56.7021 tissue EC6 167,554,532 129,065,696 92.6 193.3 56.5042 plasma EC6 167,770,514 105,089,246 81.1 154.8 56.3801 buffy EC7 154,552,448 117,823,516 90.6 175.5 56.5434 tissue EC7 151,410,478 116,551,385 92.3 174.6 56.5004 plasma EC7 168,826,198 96,284,509 71.5 142.5 56.4099 buffy EC8 236,620,804 165,767,735 84.2 244.2 56.6723 tissue EC8 163,583,002 127,564,658 92.1 189.4 56.5105 plasma EC8 163,565,396 117,354,304 86.4 174.4 56.3831 buffy EC9 162,449,848 113,516,546 87.2 170.2 56.4304 tissue EC9 160,655,482 122,134,497 94.5 183.5 56.4697 plasma EC9 326,136,488 147,069,540 71.0 216.5 56.3688 buffy EC10 176,380,818 126,612,033 93.7 189.8 56.4986 tissue EC10 202,844,006 151,226,099 93.8 226.4 56.4701 plasma EC10 316,340,714 142,497,000 64.1 210.6 56.475

In Table 3, normal genomes matching the endometrial cancer genome are marked with 'T' and 'N', respectively. Average coverage was calculated over the target region (Agilent SureSelect Human All Exon V6).

Somatic point mutations and indels identified in the endometrial cancer genome Sample type SampleID Genomic position* Ref alt Cancer-related genes Amino acid change Exonic function Source** COSMIC variant ^{† tissue EC10 chr5:38486030 C.A.G. C LIFR NM_001127671:exon17:c.2386_2387del:p.L796fs Frameshift deletion cancer gene census tissue EC10 chr7:33014363 A G FKBP9 NM_001284341exon3c.A515Gp.N172S Missense Mutation cancer gene census COSM6391782 tissue EC10 chr6:41903701 C A CCND3 NM_001760exon5c.G856Tp.D286Y Missense Mutation cancer gene census tissue EC10 chr16:67645338 C CA CTCF NM_001363916:exon3:c.604dupA:p.A201fs Frameshift insertion cancer gene census, Shukla et al. tissue EC10 chr2:189864107 AAGGTAACTCCACAGCATTCCATTCACCTAGGTTTAAAAAAATGCATTTGATTTCCTTCTGATCATTTATTATTTCTCACTTATTTTC A COL3A1 NM_000090:exon30:c.2120_2121del:p.K707fs Frameshift deletion cancer gene census tissue EC10 chr2:189866174 AAGGTAACCTTAATACTACCTGGATATAAAAAGAAAATGTCTCTCTTTTTGGATGCAAGACAGTGACATGGCTTCTCTTTTTTCC A COL3A1 NM_000090:exon33:c.2336_2337del:p.K779fs Frameshift deletion cancer gene census tissue EC10 chr3:121207488 T T.A. POLQ NM_199420:exon16:c.4289dupT:p.L1430fs Frameshift insertion cancer gene census tissue EC10 chr2:24929691 C T NCOA1 NM_147233exon11c.C1352Tp.A451V Missense Mutation cancer gene census tissue EC10 chr11:17741849 G A MYOD1 NM_002478:exon1:c.G520A:p.A174T Missense Mutation cancer gene census COSM6720819 tissue EC10 chr9:96055448 C T WNK2 NM_001282394exon23c.C5812Tp.R1938W Missense Mutation cancer gene census COSM8383629 tissue EC10 chr3:13612426 C T FBLN2 NM_001004019:exon2:c.C571T:p.R191X Nonsense Mutation cancer gene census tissue EC10 chr1:27088769 TG T ARID1A NM_006015:exon7:c.2379delG:p.M793fs Frameshift deletion cancer gene census, Shukla et al. tissue EC10 chr1:27099947 C T ARID1A NM_006015:exon15:c.C3826T:p.R1276X Nonsense Mutation cancer gene census, Shukla et al. tissue EC10 chr3:71247411 G A FOXP1 NM_001244814exon2c.C122Tp.T41M Missense Mutation cancer gene census tissue EC10 chr1:17949641 G A ARHGEF10L NM_018125exon12c.G1171Ap.E391K Missense Mutation cancer gene census tissue EC10 chr2:16080794 A AC MYCN NM_001293231:exon1:c.87dupC:p.H29fs Frameshift insertion cancer gene census tissue EC10 chr2:16080800 G C MYCN NM_001293231:exon1:c.G92C:p.R31P Missense Mutation cancer gene census tissue EC10 chr1:40366986 T TG MYCL NM_001033081:exon1:c.120dupC:p.T41fs Frameshift insertion cancer gene census tissue EC10 chr8:139163489 C A FAM135B NM_001362965exon13c.G3229Tp.V1077F Missense Mutation cancer gene census tissue EC10 chr2:46605204 G C EPAS1 NM_001430:exon10:c.G1421C:p.S474T Missense Mutation cancer gene census COSM4094398 tissue EC10 chr5:176675268 T.A. T NSD1 NM_022455:exon11:c.4585delA:p.K1529fs Frameshift deletion cancer gene census tissue EC10 chr16:72991948 GC G ZFHX3 NM_006885:exon2:c.2096delG:p.G699fs Frameshift deletion cancer gene census tissue EC10 chr8:113267503 C A CSMD3 NM_198123exon62c.G10016Tp.G3339V Missense Mutation cancer gene census tissue EC10 chr17:20108262 T.A. T SPECC1 NM_001033554:exon2:c.658delA:p.K220fs Frameshift deletion cancer gene census tissue EC10 chr9:139405691 C T NOTCH1 NM_017617:exon16:c.G2500A:p.A834T Missense Mutation cancer gene census tissue EC10 chr1:120458550 A C NOTCH2 NM_024408:exon34:c.T6795G:p.N2265K Missense Mutation cancer gene census tissue EC10 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census tissue EC10 chr3:53810752 G T CACNA1D NM_000720exon37c.G4545Tp.E1515D Missense Mutation cancer gene census tissue EC10 chr1:150917623 T TG SETDB1 NM_001243491:exon9:c.1180dupG:p.G393fs Frameshift insertion cancer gene census tissue EC10 chr21:36164605 A G RUNX1 NM_001754exon9c.T1270Cp.S424P Missense Mutation cancer gene census COSM7346995 tissue EC10 chr4:88035731 CGAAG C AFF1 NM_001313960:exon9:c.640_643del:p.E214fs Frameshift deletion cancer gene census tissue EC10 chr7:98608720 C T TRRAP NM_001244580exon70c.C10942Tp.R3648C Missense Mutation cancer gene census COSM3883776 tissue EC10 chr22:23634764 AT A BCR NM_004327:exon15:c.2820delT:p.Y940fs Frameshift deletion cancer gene census tissue EC10 chr22:23656786 C G BCR NM_004327exon22c.C3611Gp.A1204G Missense Mutation cancer gene census COSM3785508 tissue EC10 chr7:27222461 AT A HOXA11 NM_005523:exon2:c.895delA:p.I299fs Frameshift deletion cancer gene census tissue EC10 chr20:57480535 A ACTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCC GNAS NM_001077489:exon5:c.485_486insCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCC:p.Y162delinsYFLDKIDVIKQADYVP In Frame insertion cancer gene census tissue EC10 chr6:108985176 T TG FOXO3 NM_001455:exon2:c.1141dupG:p.D380fs Frameshift insertion cancer gene census tissue EC10 chr11:118773443 TG T BCL9L NM_182557:exon6:c.1008delC:p.P336fs Frameshift deletion cancer gene census tissue EC10 chr7:151860566 C T KMT2C NM_170606:exon43:c.G10096A:p.A3366T Missense Mutation cancer gene census tissue EC10 chr7:151962168 C A KMT2C NM_170606:exon8:c.G1139T:p.R380L Missense Mutation cancer gene census COSM225885 tissue EC10 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 tissue EC10 chr7:151970859 C T KMT2C NM_170606:exon7:c.G943A:p.G315S Missense Mutation cancer gene census COSM1179668 tissue EC10 chr7:151970951 C T KMT2C NM_170606:exon7:c.G851A:p.R284Q Missense Mutation cancer gene census COSM1179106 tissue EC10 chr1:14108748 CA C PRDM2 NM_001007257:exon3:c.3856delA:p.K1286fs Frameshift deletion cancer gene census tissue EC10 chr14:81563048 C T TSHR NM_000369exon7c.C611Tp.A204V Missense Mutation cancer gene census COSM6921582 tissue EC10 chr19:45252260 GC G BCL3 NM_005178:exon1:c.214delC:p.P72fs Frameshift deletion cancer gene census tissue EC10 chr5:142526871 G A ARHGAP26 NM_001135608exon20c.G1913Ap.S638N Missense Mutation cancer gene census tissue EC10 chr9:110250135 AG A KLF4 NM_001314052:exon3:c.539delC:p.P180fs Frameshift deletion cancer gene census tissue EC10 chr8:101721705 G T PABPC1 NM_002568:exon8:c.C1227A:p.F409L Missense Mutation cancer gene census COSM3269226 tissue EC10 chr6:44229395 T G NFKBIE NM_004556:exon3:c.A1076C:p.H359P Missense Mutation cancer gene census tissue EC10 chr6:18256050 TCA T D.E.K. NM_001134709:exon5:c.381_382del:p.C127fs Frameshift deletion cancer gene census tissue EC10 chr12:6696567 G A CHD4 NM_001273exon25c.C3862Tp.R1288W Missense Mutation cancer gene census COSM8547211 tissue EC10 chr12:6711206 GCTT G CHD4 NM_001297553:exon3:c.334_336del:p.112_112del In Frame deletion cancer gene census tissue EC10 chr5:67588976 T A PIK3R1 NM_181504:exon3:c.T257A:p.L86X Nonsense Mutation cancer gene census, Westin et al. , Shukla et al. tissue EC10 chr22:28195246 A G MN1 NM_002430:exon1:c.T1286C:p.M429T Missense Mutation cancer gene census tissue EC10 chr22:28193074 AG A MN1 NM_002430:exon1:c.3457delC:p.L1153fs Frameshift deletion cancer gene census tissue EC10 chr4:126411731 A T FAT4 NM_024582exon17c.A13754Tp.E4585V Missense Mutation cancer gene census tissue EC10 chr17:56432306 A C RNF43 NM_001305545:exon9:c.T1969G:p.X657G Nonsense Mutation cancer gene census tissue EC10 chr17:56435160 AC A RNF43 NM_001305545:exon8:c.1595delG:p.G532fs Frameshift deletion cancer gene census tissue EC10 chrX:70472853 G GC ZMYM3 NM_001171162:exon2:c.252dupG:p.L85fs Frameshift insertion cancer gene census tissue EC10 chrX:70472962 AG A ZMYM3 NM_001171162:exon2:c.143delC:p.P48fs Frameshift deletion cancer gene census tissue EC10 chr6:138196092 C T TNFAIP3 NM_001270507exon3c.C406Tp.R136C Missense Mutation cancer gene census COSM1196932 tissue EC10 chrX:44949022 C T KDM6A NM_001291416exon25c.C3604Tp.P1202S Missense Mutation cancer gene census tissue EC10 chr10:104157135 C T NFKB2 NM_001261403exon6c.C472Tp.R158W Missense Mutation cancer gene census tissue EC10 chr4:55984879 A C KDR NM_002253:exon3:c.T250G:p.F84V Missense Mutation cancer gene census tissue EC10 chr19:42776354 G A CIC NM_001304815:exon2:c.G419A:p.R140Q Missense Mutation cancer gene census tissue EC10 chr19:42796882 GC G CIC NM_015125:exon14:c.3341delC:p.A1114fs Frameshift deletion cancer gene census tissue EC10 chr19:42796882 GC GCC CIC NM_015125:exon14:c.3341dupC:p.A1114fs Frameshift insertion cancer gene census tissue EC10 chr19:42797375 GC G CIC NM_015125:exon15:c.3738delC:p.S1246fs Frameshift deletion cancer gene census tissue EC2 chr7:33014363 A G FKBP9 NM_001284341exon3c.A515Gp.N172S Missense Mutation cancer gene census COSM6391782 tissue EC2 chr3:105404191 T G CBLB NM_001321788exon14c.A2174Cp.H725P Missense Mutation cancer gene census tissue EC2 chr1:36933486 T G CSF3R NM_000760exon14c.A1801Cp.M601L Missense Mutation cancer gene census tissue EC2 chr10:89692905 G A PTEN NM_000314exon5c.G389Ap.R130Q Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM5033 tissue EC2 chr1:11273575 T G MTOR NM_004958:exon21:c.A3166C:p.I1056L Missense Mutation cancer gene census tissue EC2 chr16:3786721 T G CREBBP NM_001079846:exon26:c.A4376C:p.K1459T Missense Mutation cancer gene census tissue EC2 chr1:110888971 C A RBM15 NM_001201545:exon2:c.C2905A:p.L969I Missense Mutation cancer gene census tissue EC2 chr13:20577255 ACT A ZMYM2 NM_001190965:exon4:c.1114_1115del:p.L372fs Frameshift deletion cancer gene census tissue EC2 chr1:27057901 C T ARID1A NM_006015:exon3:c.C1609T:p.Q537X Nonsense Mutation cancer gene census, Shukla et al. tissue EC2 chr1:27107166 GGACA G ARID1A NM_006015:exon20:c.6778_6781del:p.D2260fs Frameshift deletion cancer gene census, Shukla et al. tissue EC2 chr1:17914021 T G ARHGEF10L NM_001011722exon2c.T104Gp.F35C Missense Mutation cancer gene census}

^{tissue EC2 chr1:17949510 T G ARHGEF10L NM_018125exon12c.T1040Gp.M347R Missense Mutation cancer gene census tissue EC2 chr19:16192851 T G TPM4 NM_001145160exon3c.T369Gp.S123R Missense Mutation cancer gene census tissue EC2 chr1:120458417 T G NOTCH2 NM_024408:exon34:c.A6928C:p.I2310L Missense Mutation cancer gene census tissue EC2 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census tissue EC2 chr11:85742536 T G PICALM NM_001008660exon2c.A248Cp.H83P Missense Mutation cancer gene census tissue EC2 chr4:1806678 G A FGFR3 NM_022965:exon8:c.G1058A:p.W353X Nonsense Mutation cancer gene census tissue EC2 chr19:18856739 G A CRTC1 NM_001098482exon4c.G398Ap.R133Q Missense Mutation cancer gene census tissue EC2 chr17:5036249 G T USP6 NM_004505exon5c.G240Tp.M80I Missense Mutation cancer gene census COSM4598023 tissue EC2 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 tissue EC2 chr8:128750673 GCTGCCCACCCCGCCC G MYC NM_001354870:exon2:c.208_222del:p.70_74del In Frame deletion cancer gene census, Shukla et al. tissue EC2 chr12:25398281 C T KRAS NM_001369786exon2c.G38Ap.G13D Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM532 tissue EC2 chr8:101721705 G T PABPC1 NM_002568:exon8:c.C1227A:p.F409L Missense Mutation cancer gene census COSM3269226 tissue EC2 chr8:101721709 T A PABPC1 NM_002568:exon8:c.A1223T:p.Y408F Missense Mutation cancer gene census COSM3774310 tissue EC2 chr12:6697027 G GTGA CHD4 NM_001297553:exon23:c.3532_3533insTCA:p.T1178delinsIT In Frame insertion cancer gene census tissue EC2 chr5:67589138 G A PIK3R1 NM_181523exon10c.G1126Ap.G376R Missense Mutation cancer gene census, Westin et al. , Shukla et al. COSM35827 tissue EC2 chrX:53440058 C G SMC1A NM_006306exon5c.G646Cp.V216L Missense Mutation cancer gene census tissue EC2 chr22:39631853 A C PDGFB NM_002608:exon2:c.T90G:p.Y30X Nonsense Mutation cancer gene census tissue EC2 chr1:198718573 T G PTPRC NM_002838exon28c.T2967Gp.H989Q Missense Mutation cancer gene census tissue EC2 chr5:256483 CTT C SDHA NM_001330758:exon13:c.1701_1702del:p.T567fs Frameshift deletion cancer gene census tissue EC2 chr17:66547263 T G PRKAR1A NM_001276290:exon10:c.T1012G:p.X338E Nonsense Mutation cancer gene census tissue EC5 chr7:33044951 C G FKBP9 NM_001284341exon11c.C1860Gp.H620Q Missense Mutation cancer gene census COSM5000147 tissue EC5 chr2:189864107 AAGGTAACTCCACAGCATTCCATTCACCTAGGTTTAAAAAAATGCATTTGATTTCCTTCTGATCATTTATTATTTCTCACTTATTTTC A COL3A1 NM_000090:exon30:c.2120_2121del:p.K707fs Frameshift deletion cancer gene census tissue EC5 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 tissue EC5 chr3:41266107 T G CTNNB1 NM_001098209exon3c.T104Gp.I35S Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM5674 tissue EC5 chr11:108788634 GTGA G DDX10 NM_004398:exon17:c.2340_2342del:p.780_781del In Frame deletion cancer gene census tissue EC5 chr4:54319247 C.A.G. C FIP1L1 NM_001134938:exon13:c.1225_1226del:p.R409fs Frameshift deletion cancer gene census tissue EC5 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. tissue EC5 chr2:46605201 CCAG C EPAS1 NM_001430:exon10:c.1419_1421del:p.473_474del In Frame deletion cancer gene census tissue EC5 chr10:70432681 C T TET1 NM_030625:exon8:c.C4703T:p.P1568L Missense Mutation cancer gene census tissue EC5 chr2:109371421 G A RANBP2 NM_006267:exon16:c.G2263A:p.D755N Missense Mutation cancer gene census tissue EC5 chr19:15379770 C G BRD4 NM_001330384exon3c.G369Cp.Q123H Missense Mutation cancer gene census tissue EC5 chr8:38285913 GTCA G FGFR1 NM_001174066:exon3:c.129_131del:p.43_44del In Frame deletion cancer gene census tissue EC5 chr1:144906426 T G PDE4DIP NM_001350521exon21c.A2842Cp.I948L Missense Mutation cancer gene census tissue EC5 chr1:144863438 G T PDE4DIP NM_001350520:exon33:c.C6451A:p.Q2151K Missense Mutation cancer gene census COSM1472513 tissue EC5 chr6:152419922 T A ESR1 NM_000125exon8c.T1609Ap.Y537N Missense Mutation cancer gene census COSM1074635 tissue EC5 chr17:5036210 TC GT USP6 NM_004505:exon5:c.201_202GT In Frame Substitution cancer gene census tissue EC5 chr17:5036205 A C USP6 NM_004505exon5c.A196Cp.K66Q Missense Mutation cancer gene census COSM1610489 tissue EC5 chr17:5036214 C T USP6 NM_004505exon5c.C205Tp.R69W Missense Mutation cancer gene census COSM4130411 tissue EC5 chr17:5036823 T C USP6 NM_004505exon6c.T362Cp.L121S Missense Mutation cancer gene census COSM4591808 tissue EC5 chr20:57480535 A ACTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCC GNAS NM_001077489:exon5:c.485_486insCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCC:p.Y162delinsYFLDKIDVIKQADYVP In Frame insertion cancer gene census tissue EC5 chr6:108985176 T TG FOXO3 NM_001455:exon2:c.1141dupG:p.D380fs Frameshift insertion cancer gene census tissue EC5 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 tissue EC5 chr7:151970859 C A KMT2C NM_170606:exon7:c.G943T:p.G315C Missense Mutation cancer gene census COSM4381930 tissue EC5 chr7:128845997 T G SMO NM_005631:exon5:c.T927G:p.N309K Missense Mutation cancer gene census tissue EC5 chr6:29911239 TT CA HLA-A NM_001242758:exon3:c.538_539CA In Frame Substitution cancer gene census tissue EC5 chrX:39921444 T C BCOR NM_001123385exon10c.A4376Gp.N1459S Missense Mutation cancer gene census tissue EC5 chr5:256483 CTT C SDHA NM_001330758:exon13:c.1701_1702del:p.T567fs Frameshift deletion cancer gene census tissue EC9 chr7:91682159 TTT GGG AKAP9 NM_005751:exon22:c.5488_5490GGG In Frame Substitution cancer gene census tissue EC9 chr10:89624305 T A PTEN NM_000314exon1c.T79Ap.Y27N Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM5268 tissue EC9 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 tissue EC9 chr3:41266097 G T CTNNB1 NM_001098209exon3c.G94Tp.D32Y Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM5661 tissue EC9 chr1:204507412 C A MDM4 NM_001204171exon7c.C487Ap.H163N Missense Mutation cancer gene census tissue EC9 chr11:117042462 A G PAFAH1B2 NM_001184746:exon6:c.A536G:p.Q179R Missense Mutation cancer gene census tissue EC9 chr1:27106925 GC G ARID1A NM_006015:exon20:c.6537delC:p.S2179fs Frameshift deletion cancer gene census, Shukla et al. tissue EC9 chr2:46605201 CCAG C EPAS1 NM_001430:exon10:c.1419_1421del:p.473_474del In Frame deletion cancer gene census tissue EC9 chr9:139390944 TGTG T NOTCH1 NM_017617:exon34:c.7244_7246del:p.2415_2416del In Frame deletion cancer gene census tissue EC9 chr1:144856955 C T PDE4DIP NM_001350520:exon36:c.G7016A:p.G2339D Missense Mutation cancer gene census COSM5754149 tissue EC9 chrX:129155009 G T BCORL1 NM_001184772exon4c.G3491Tp.R1164M Missense Mutation cancer gene census tissue EC9 chr17:5036823 T C USP6 NM_004505exon6c.T362Cp.L121S Missense Mutation cancer gene census COSM4591808 tissue EC9 chr17:5036834 G A USP6 NM_004505exon6c.G373Ap.G125R Missense Mutation cancer gene census COSM4591349 tissue EC9 chr17:5036838 G A USP6 NM_004505exon6c.G377Ap.R126K Missense Mutation cancer gene census COSM4591351 tissue EC9 chr17:5036843 C A USP6 NM_004505exon6c.C382Ap.Q128K Missense Mutation cancer gene census COSM4590856 tissue EC9 chr7:151970859 C A KMT2C NM_170606:exon7:c.G943T:p.G315C Missense Mutation cancer gene census COSM4381930 tissue EC9 chrX:152823732 G A ATP2B3 NM_001001344exon15c.G2596Ap.V866M Missense Mutation cancer gene census tissue EC9 chr7:128850258 T G SMO NM_005631:exon9:c.T1521G:p.C507W Missense Mutation cancer gene census tissue EC9 chr8:101721692 G A PABPC1 NM_002568:exon8:c.C1240T:p.P414S Missense Mutation cancer gene census COSM3367142 tissue EC9 chr5:67592163 C CTG PIK3R1 NM_001242466:exon8:c.890_891insTG:p.S297fs Frameshift insertion cancer gene census, Westin et al. , Shukla et al. tissue EC9 chrX:53448878 C A SMC1A NM_001281463:exon2:c.G10T:p.V4L Missense Mutation cancer gene census tissue EC9 chrX:39921444 T C BCOR NM_001123385exon10c.A4376Gp.N1459S Missense Mutation cancer gene census tissue EC9 chr17:66547263 T G PRKAR1A NM_001276290:exon10:c.T1012G:p.X338E Nonsense Mutation cancer gene census tissue EC1 chr11:64572092 CG C MEN1 NM_000244:exon10:c.1561delC:p.R521fs Frameshift deletion cancer gene census tissue EC1 chr7:33014363 A G FKBP9 NM_001284341exon3c.A515Gp.N172S Missense Mutation cancer gene census COSM6391782 tissue EC1 chr3:178916726 G A PIK3CA NM_006218:exon2:c.G113A:p.R38H Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM745 tissue EC1 chr8:1882056 C T ARHGEF10 NM_001308152:exon25:c.C3056T:p.A1019V Missense Mutation cancer gene census tissue EC1 chr1:36935322 TG T CSF3R NM_000760:exon11:c.1404delC:p.P468fs Frameshift deletion cancer gene census tissue EC1 chr10:8097689 C A GATA3 NM_001002295exon2c.C71Ap.P24Q Missense Mutation cancer gene census tissue EC1 chr7:91732115 G A AKAP9 NM_005751:exon46:c.G11305A:p.V3769I Missense Mutation cancer gene census COSM6844033 tissue EC1 chr19:21720352 T.A. T ZNF429 NM_001346916:exon3:c.1306delA:p.K436fs Frameshift deletion cancer gene census tissue EC1 chr10:89692905 G A PTEN NM_000314exon5c.G389Ap.R130Q Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM5033 tissue EC1 chr3:30691871 GA G TGFBR2 NM_003242:exon3:c.374delA:p.E125fs Frameshift deletion cancer gene census tissue EC1 chr5:35873634 C A IL7R NM_002185:exon5:c.C590A:p.P197Q Missense Mutation cancer gene census tissue EC1 chr19:4363385 G A SH3GL1 NM_003025exon7c.C710Tp.A237V Missense Mutation cancer gene census COSM4399493 tissue EC1 chr1:65306996 GT G JAK1 NM_001321852:exon19:c.2580delA:p.K860fs Frameshift deletion cancer gene census tissue EC1 chr1:65339110 CT C JAK1 NM_001321852:exon5:c.425delA:p.K142fs Frameshift deletion cancer gene census tissue EC1 chr1:65339110 CT CTT JAK1 NM_001321852:exon5:c.424dupA:p.K142fs Frameshift insertion cancer gene census tissue EC1 chr1:11264698 G T MTOR NM_004958:exon26:c.C3864A:p.S1288R Missense Mutation cancer gene census}

^{tissue EC1 chr18:45422959 G A SMAD2 NM_001003652:exon2:c.C169T:p.R57X Nonsense Mutation cancer gene census tissue EC1 chr16:15802686 TG T MYH11 NM_022844:exon41:c.5798delC:p.P1933fs Frameshift deletion cancer gene census tissue EC1 chr19:52714556 G A PPP2R1A NM_014225:exon4:c.G314A:p.R105Q Missense Mutation cancer gene census, Shukla et al. COSM1000437 tissue EC1 chr18:48591862 C A SMAD4 NM_005359:exon9:c.C1025A:p.P342H Missense Mutation cancer gene census tissue EC1 chr18:50961517 G A D.C.C. NM_005215:exon22:c.G3167A:p.R1056H Missense Mutation cancer gene census tissue EC1 chr8:71078921 C T NCOA2 NM_001321703exon7c.G610Ap.V204I Missense Mutation cancer gene census tissue EC1 chr16:3831211 GC G CREBBP NM_001079846:exon6:c.1555delG:p.A519fs Frameshift deletion cancer gene census tissue EC1 chr2:24930309 T A NCOA1 NM_147233exon11c.T1970Ap.V657D Missense Mutation cancer gene census tissue EC1 chr1:3328253 C A PRDM16 NM_022114exon9c.C1492Ap.L498M Missense Mutation cancer gene census tissue EC1 chr2:107041248 CT C RGPD3 NM_001144013:exon20:c.3174delA:p.K1058fs Frameshift deletion cancer gene census tissue EC1 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 tissue EC1 chr2:30143516 TG T ALK NM_004304:exon1:c.9delC:p.A3fs Frameshift deletion cancer gene census tissue EC1 chr2:29450509 C T ALK NM_004304:exon17:c.G2845A:p.E949K Missense Mutation cancer gene census COSM2941481 tissue EC1 chr2:30142886 G A ALK NM_004304:exon1:c.C640T:p.R214C Missense Mutation cancer gene census COSM4436841 tissue EC1 chr22:39381947 C T APOBEC3B NM_001270411exon3c.C305Tp.A102V Missense Mutation cancer gene census tissue EC1 chr3:41275290 C T CTNNB1 NM_001098209exon9c.C1456Tp.R486C Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM51394 tissue EC1 chr4:54319247 C.A.G. C FIP1L1 NM_001134938:exon13:c.1225_1226del:p.R409fs Frameshift deletion cancer gene census tissue EC1 chr16:2138118 G A TSC2 NM_000548exon40c.G5138Ap.R1713H Missense Mutation cancer gene census COSM3277614 tissue EC1 chr6:157406007 G A ARID1B NM_001346813exon5c.G2210Ap.R737Q Missense Mutation cancer gene census tissue EC1 chr1:27057936 GC G ARID1A NM_006015:exon3:c.1645delC:p.P549fs Frameshift deletion cancer gene census, Shukla et al. tissue EC1 chr1:27101116 AC A ARID1A NM_006015:exon18:c.4399delC:p.P1467fs Frameshift deletion cancer gene census, Shukla et al. tissue EC1 chr1:27106077 GC G ARID1A NM_006015:exon20:c.5689delC:p.P1897fs Frameshift deletion cancer gene census, Shukla et al. tissue EC1 chr8:145741892 G C RECQL4 NM_004260:exon5:c.C611G:p.A204G Missense Mutation cancer gene census COSM1455690 tissue EC1 chr8:145737136 G A RECQL4 NM_004260:exon21:c.C3430T:p.R1144C Missense Mutation cancer gene census tissue EC1 chr1:17939624 TG T ARHGEF10L NM_018125:exon8:c.682delG:p.G228fs Frameshift deletion cancer gene census tissue EC1 chr1:17952490 G A ARHGEF10L NM_018125exon14c.G1357Ap.G453R Missense Mutation cancer gene census tissue EC1 chr1:7811328 CA C CAMTA1 NM_001349613:exon10:c.1889delA:p.Q630fs Frameshift deletion cancer gene census tissue EC1 chr19:1622053 C A TCF3 NM_001136139:exon10:c.G822T:p.M274I Missense Mutation cancer gene census tissue EC1 chr19:1612385 C T TCF3 NM_001136139exon18c.G1634Ap.R545Q Missense Mutation cancer gene census tissue EC1 chr10:61666044 C A CCDC6 NM_005436:exon1:c.G139T:p.G47W Missense Mutation cancer gene census tissue EC1 chr16:72821959 CG C ZFHX3 NM_001164766:exon9:c.7473delC:p.P2491fs Frameshift deletion cancer gene census tissue EC1 chr16:72833968 G A ZFHX3 NM_001164766:exon7:c.C1183T:p.R395X Nonsense Mutation cancer gene census tissue EC1 chr8:114326902 C T CSMD3 NM_001363185exon2c.G299Ap.R100Q Missense Mutation cancer gene census COSM3644438 tissue EC1 chr5:180030323 G A FLT4 NM_182925:exon30:c.C3961T:p.R1321W Missense Mutation cancer gene census COSM6913857 tissue EC1 chr19:50919734 C T POLD1 NM_001256849exon23c.C2902Tp.R968C Missense Mutation cancer gene census COSM8565350 tissue EC1 chr22:36696947 GCTC G MYH9 NM_002473:exon22:c.2785_2787del:p.929_929del In Frame deletion cancer gene census tissue EC1 chr2:148683685 T.A. T ACVR2A NM_001278580:exon10:c.979delA:p.K327fs Frameshift deletion cancer gene census tissue EC1 chr10:70412316 G T TET1 NM_030625:exon6:c.G4426T:p.G1476W Missense Mutation cancer gene census tissue EC1 chrX:107977802 GC G IRS4 NM_003604:exon1:c.1772delG:p.G591fs Frameshift deletion cancer gene census tissue EC1 chr12:112229926 TG T ALDH2 NM_001204889:exon7:c.717delG:p.L239fs Frameshift deletion cancer gene census tissue EC1 chr2:109382877 T G RANBP2 NM_006267:exon20:c.T5882G:p.F1961C Missense Mutation cancer gene census tissue EC1 chr2:109383318 T C RANBP2 NM_006267:exon20:c.T6323C:p.L2108S Missense Mutation cancer gene census COSM6330884 tissue EC1 chr16:14038663 C T ERCC4 NM_005236:exon10:c.C1988T:p.A663V Missense Mutation cancer gene census tissue EC1 chr2:48028177 A C MSH6 NM_000179exon4c.A3055Cp.I1019L Missense Mutation cancer gene census tissue EC1 chr17:20013776 C A SPECC1 NM_001033553exon3c.C184Ap.P62T Missense Mutation cancer gene census tissue EC1 chr7:75183817 G T HIP1 NM_001243198exon20c.C1972Ap.L658I Missense Mutation cancer gene census tissue EC1 chr7:75189047 G GA HIP1 NM_001243198:exon14:c.1363dupT:p.S455fs Frameshift insertion cancer gene census tissue EC1 chr17:63533136 CG C AXIN2 NM_004655:exon7:c.1757delC:p.T586fs Frameshift deletion cancer gene census tissue EC1 chr17:63533732 ATGG A AXIN2 NM_001363813:exon6:c.1419_1421del:p.473_474del In Frame deletion cancer gene census tissue EC1 chr16:396731 T C AXIN1 NM_003502exon2c.A295Gp.I99V Missense Mutation cancer gene census tissue EC1 chrX:70342972 T A MED12 NM_005120:exon11:c.T1513A:p.S505T Missense Mutation cancer gene census tissue EC1 chrX:125298773 C T DCAF12L2 NM_001013628:exon1:c.G1135A:p.A379T Missense Mutation cancer gene census tissue EC1 chr16:24185859 C T PRKCB NM_002738exon12c.C1352Tp.A451V Missense Mutation cancer gene census tissue EC1 chr1:156085043 G T LMNA NM_001282626:exon1:c.G334T:p.E112X Nonsense Mutation cancer gene census tissue EC1 chr1:120458550 A C NOTCH2 NM_024408:exon34:c.T6795G:p.N2265K Missense Mutation cancer gene census tissue EC1 chr2:237489668 C T ACKR3 NM_020311:exon2:c.C560T:p.T187M Missense Mutation cancer gene census tissue EC1 chr9:123850693 T G CNTRL NM_007018exon1c.T89Gp.M30R Missense Mutation cancer gene census tissue EC1 chr9:98278958 TTTC T PTCH1 NM_001083603:exon1:c.142_144del:p.48_48del In Frame deletion cancer gene census tissue EC1 chr1:59248123 GGCT G JUN NM_002228:exon1:c.617_619del:p.206_207del In Frame deletion cancer gene census tissue EC1 chr6:136594310 G T BCLAF1 NM_001077440:exon7:c.C1862A:p.S621X Nonsense Mutation cancer gene census tissue EC1 chr6:136599201 C G BCLAF1 NM_001077441exon4c.G818Cp.G273A Missense Mutation cancer gene census tissue EC1 chr6:136599459 G A BCLAF1 NM_001077441exon4c.C560Tp.P187L Missense Mutation cancer gene census COSM9396825 tissue EC1 chr12:56495374 TGAA T ERBB3 NM_001982:exon28:c.3565_3567del:p.1189_1189del In Frame deletion cancer gene census tissue EC1 chr13:32914817 G A BRCA2 NM_000059:exon11:c.G6325A:p.V2109I Missense Mutation cancer gene census tissue EC1 chr17:29653063 G T NF1 NM_001042492exon37c.G5061Tp.R1687S Missense Mutation cancer gene census tissue EC1 chr6:28872418 G A TRIM27 NM_006510:exon8:c.C971T:p.T324M Missense Mutation cancer gene census COSM5483108 tissue EC1 chr17:8047056 G T PER1 NM_002616:exon19:c.C2600A:p.P867H Missense Mutation cancer gene census tissue EC1 chr21:36259267 T C RUNX1 NM_001754exon4c.A224Gp.D75G Missense Mutation cancer gene census tissue EC1 chr15:52680064 C T MYO5A NM_000259exon14c.G1714Ap.V572I Missense Mutation cancer gene census tissue EC1 chr19:11144089 G A SMARCA4 NM_001128845:exon25:c.G3670A:p.V1224M Missense Mutation cancer gene census COSM6784883 tissue EC1 chr22:21347168 G A LZTR1 NM_006767:exon11:c.G1235A:p.R412H Missense Mutation cancer gene census COSM1032421 tissue EC1 chr22:21341825 G A LZTR1 NM_006767:exon4:c.G353A:p.R118H Missense Mutation cancer gene census COSM3308552 tissue EC1 chr17:78320342 T C RNF213 NM_001256071:exon29:c.T8207C:p.V2736A Missense Mutation cancer gene census tissue EC1 chr19:18870878 AG A CRTC1 NM_015321:exon8:c.727delG:p.G243fs Frameshift deletion cancer gene census tissue EC1 chr19:18887992 TC T CRTC1 NM_015321:exon14:c.1706delC:p.S569fs Frameshift deletion cancer gene census tissue EC1 chr11:95826474 G A MAML2 NM_032427:exon2:c.C721T:p.R241X Nonsense Mutation cancer gene census tissue EC1 chr2:100170901 G A AFF3 NM_001025108exon23c.C3506Tp.P1169L Missense Mutation cancer gene census COSM1481767 tissue EC1 chr2:100210409 C T AFF3 NM_001025108exon14c.G1789Ap.A597T Missense Mutation cancer gene census COSM5859749 tissue EC1 chr4:87968591 C T AFF1 NM_001166693exon4c.C904Tp.R302W Missense Mutation cancer gene census COSM1058567 tissue EC1 chr6:117642517 T TTC ROS1 NM_002944:exon35:c.5681_5682insGA:p.E1894fs Frameshift insertion cancer gene census tissue EC1 chr22:29130471 G T CHEK2 NM_001005735exon2c.C239Ap.P80H Missense Mutation cancer gene census tissue EC1 chr9:37020789 C A PAX5 NM_001280547exon2c.G56Tp.G19V Missense Mutation cancer gene census tissue EC1 chr9:36882049 CG C PAX5 NM_001280553:exon7:c.834delC:p.P278fs Frameshift deletion cancer gene census}

^{tissue EC1 chr9:37020768 A C PAX5 NM_001280547exon2c.T77Gp.V26G Missense Mutation cancer gene census COSM85951 tissue EC1 chr3:192516548 C T MB21D2 NM_178496:exon2:c.G1103A:p.C368Y Missense Mutation cancer gene census tissue EC1 chr17:7578474 CG C TP53 NM_001126115:exon1:c.59delC:p.P20fs Frameshift deletion cancer gene census, Westin et al. tissue EC1 chr17:7577538 C T TP53 NM_000546exon7c.G743Ap.R248Q Missense Mutation cancer gene census, Westin et al. COSM10662 tissue EC1 chr2:178096054 G A NFE2L2 NM_006164exon5c.C1277Tp.P426L Missense Mutation cancer gene census tissue EC1 chrX:129155008 AG A BCORL1 NM_001184772:exon4:c.3491delG:p.R1164fs Frameshift deletion cancer gene census tissue EC1 chr22:23656786 C G BCR NM_004327exon22c.C3611Gp.A1204G Missense Mutation cancer gene census COSM3785508 tissue EC1 chr12:57493609 C T STAT6 NM_001178078exon15c.G1685Ap.R562H Missense Mutation cancer gene census COSM9200324 tissue EC1 chr12:57500551 G A STAT6 NM_001178078exon5c.C403Tp.R135W Missense Mutation cancer gene census tissue EC1 chr2:47637374 C T MSH2 NM_000251:exon3:c.C508T:p.Q170X Nonsense Mutation cancer gene census tissue EC1 chr2:47657029 C T MSH2 NM_000251:exon7:c.C1225T:p.Q409X Nonsense Mutation cancer gene census tissue EC1 chr20:50400982 AC A SALL4 NM_001318031:exon4:c.1672delG:p.V558fs Frameshift deletion cancer gene census tissue EC1 chr17:5036834 G A USP6 NM_004505exon6c.G373Ap.G125R Missense Mutation cancer gene census COSM4591349 tissue EC1 chr17:5036838 G A USP6 NM_004505exon6c.G377Ap.R126K Missense Mutation cancer gene census COSM4591351 tissue EC1 chr17:5036843 C A USP6 NM_004505exon6c.C382Ap.Q128K Missense Mutation cancer gene census COSM4590856 tissue EC1 chr17:5072276 C T USP6 NM_004505exon27c.C3443Tp.S1148L Missense Mutation cancer gene census COSM1384531 tissue EC1 chr11:128781217 G C KCNJ5 NM_000890exon2c.G49Cp.V17L Missense Mutation cancer gene census tissue EC1 chr20:57428403 A G GNAS NM_080425:exon1:c.A83G:p.Q28R Missense Mutation cancer gene census tissue EC1 chr20:57484607 C T GNAS NM_080425exon9c.C2620Tp.R874C Missense Mutation cancer gene census tissue EC1 chr17:48266329 G A COL1A1 NM_000088:exon41:c.C2980T:p.R994C Missense Mutation cancer gene census tissue EC1 chr12:57484963 C T NAB2 NM_001330305exon2c.C139Tp.R47W Missense Mutation cancer gene census tissue EC1 chr2:32712836 CTTT C BIRC6 NM_016252:exon41:c.7937_7939del:p.2646_2647del In Frame deletion cancer gene census tissue EC1 chr11:118771770 A AG BCL9L NM_182557:exon6:c.2681dupC:p.P894fs Frameshift insertion cancer gene census tissue EC1 chr8:32406277 GA G NRG1 NM_001160002:exon1:c.34delA:p.K12fs Frameshift deletion cancer gene census tissue EC1 chr8:57079790 T G PLAG1 NM_001114634exon4c.A515Cp.H172P Missense Mutation cancer gene census COSM8522225 tissue EC1 chr7:151935850 C T KMT2C NM_170606:exon15:c.G2594A:p.G865D Missense Mutation cancer gene census tissue EC1 chr1:14108559 G GA PRDM2 NM_001007257:exon3:c.3667dupA:p.K1222fs Frameshift insertion cancer gene census tissue EC1 chr1:14108836 C T PRDM2 NM_012231exon8c.C4546Tp.R1516W Missense Mutation cancer gene census COSM3984157 tissue EC1 chr12:49427714 T G KMT2D NM_003482:exon39:c.A10774C:p.M3592L Missense Mutation cancer gene census tissue EC1 chr17:53345382 G T HLF NM_002126exon2c.G386Tp.R129L Missense Mutation cancer gene census COSM6147193 tissue EC1 chr3:187446269 CG C BCL6 NM_001134738:exon5:c.1418delC:p.P473fs Frameshift deletion cancer gene census tissue EC1 chr3:187447511 G A BCL6 NM_001134738exon4c.C682Tp.R228W Missense Mutation cancer gene census tissue EC1 chr13:28537277 AC A CDX2 NM_001265:exon3:c.916delG:p.V306fs Frameshift deletion cancer gene census tissue EC1 chr8:128750586 CGAG C MYC NM_001354870:exon2:c.121_123del:p.41_41del In Frame deletion cancer gene census, Shukla et al. tissue EC1 chr17:40362446 GT G STAT5B NM_012448:exon14:c.1749delA:p.K583fs Frameshift deletion cancer gene census tissue EC1 chr10:72358783 G A PRF1 NM_001083116exon3c.C694Tp.R232C Missense Mutation cancer gene census tissue EC1 chr2:190719322 A C PMS1 NM_000534exon9c.A1324Cp.S442R Missense Mutation cancer gene census COSM8165272 tissue EC1 chrX:152814194 C T ATP2B3 NM_001001344exon8c.C1220Tp.T407M Missense Mutation cancer gene census tissue EC1 chr11:92087842 C T FAT3 NM_001008781exon1c.C2564Tp.A855V Missense Mutation cancer gene census tissue EC1 chr11:92495256 G A FAT3 NM_001008781exon4c.G3904Ap.G1302R Missense Mutation cancer gene census tissue EC1 chr12:498234 GC G KDM5A NM_001042603:exon1:c.23delG:p.G8fs Frameshift deletion cancer gene census tissue EC1 chr17:34151088 G A TAF15 NM_139215exon7c.G491Ap.R164H Missense Mutation cancer gene census tissue EC1 chr6:29911930 CA TG HLA-A NM_001242758:exon4:c.651_652TG In Frame Substitution cancer gene census tissue EC1 chr4:187538302 C A FAT1 NM_005245:exon11:c.G8932T:p.V2978L Missense Mutation cancer gene census tissue EC1 chr4:187541858 C T FAT1 NM_005245:exon10:c.G5882A:p.G1961D Missense Mutation cancer gene census tissue EC1 chr4:187557308 A G FAT1 NM_005245:exon6:c.T4054C:p.S1352P Missense Mutation cancer gene census tissue EC1 chr4:187627981 C T FAT1 NM_005245:exon2:c.G3001A:p.V1001M Missense Mutation cancer gene census tissue EC1 chr4:187629979 T G FAT1 NM_005245:exon2:c.A1003C:p.T335P Missense Mutation cancer gene census tissue EC1 chr9:8486236 CA C PTPRD NM_002839:exon28:c.2580delT:p.F860fs Frameshift deletion cancer gene census tissue EC1 chr9:8501057 G A PTPRD NM_002839:exon24:c.C1825T:p.P609S Missense Mutation cancer gene census COSM9033781 tissue EC1 chrX:53409466 A C SMC1A NM_006306exon21c.T3246Gp.D1082E Missense Mutation cancer gene census tissue EC1 chrX:53407986 C T SMC1A NM_006306exon23c.G3460Ap.V1154I Missense Mutation cancer gene census tissue EC1 chr12:57112549 C T NACA NM_001365896:exon3:c.G2765A:p.R922Q Missense Mutation cancer gene census tissue EC1 chr22:28193568 TC T MN1 NM_002430:exon1:c.2963delG:p.G988fs Frameshift deletion cancer gene census tissue EC1 chr4:126373044 G A FAT4 NM_024582exon9c.G10873Ap.G3625S Missense Mutation cancer gene census COSM3600023 tissue EC1 chr4:126241504 C A FAT4 NM_001291285exon1c.C3938Ap.P1313H Missense Mutation cancer gene census tissue EC1 chr17:56432306 A C RNF43 NM_001305545:exon9:c.T1969G:p.X657G Nonsense Mutation cancer gene census tissue EC1 chr17:56435372 G C RNF43 NM_001305544exon9c.C1765Gp.P589A Missense Mutation cancer gene census tissue EC1 chr17:56435160 AC A RNF43 NM_001305545:exon8:c.1595delG:p.G532fs Frameshift deletion cancer gene census tissue EC1 chrX:37027640 G A FAM47C NM_001013736:exon1:c.G1157A:p.R386H Missense Mutation cancer gene census tissue EC1 chr16:74694873 G A RFWD3 NM_001370534exon2c.C475Tp.R159W Missense Mutation cancer gene census COSM6765338 tissue EC1 chr11:118851213 T C FOXR1 NM_181721:exon5:c.T625C:p.F209L Missense Mutation cancer gene census tissue EC1 chr3:89391155 T G EPHA3 NM_005233exon5c.T1221Gp.F407L Missense Mutation cancer gene census tissue EC1 chr7:124482867 T G POT1 NM_015450exon13c.A1157Cp.H386P Missense Mutation cancer gene census tissue EC1 chr9:133738258 C T ABL1 NM_007313exon4c.C715Tp.R239C Missense Mutation cancer gene census tissue EC1 chr12:124831354 C T NCOR2 NM_001077261:exon32:c.G4085A:p.R1362H Missense Mutation cancer gene census tissue EC1 chr17:16062109 G A NCOR1 NM_001190440exon5c.C697Tp.R233C Missense Mutation cancer gene census tissue EC1 chr5:31401568 GCT G DROSHA NM_001100412:exon35:c.3983_3984del:p.E1328fs Frameshift deletion cancer gene census tissue EC1 chr1:85733512 GA G BCL10 NM_001320715:exon3:c.466delT:p.S156fs Frameshift deletion cancer gene census tissue EC1 chr19:18561449 G T ELL NM_006532:exon8:c.C1303A:p.Q435K Missense Mutation cancer gene census tissue EC1 chr19:18561475 C T ELL NM_006532:exon8:c.G1277A:p.G426D Missense Mutation cancer gene census tissue EC1 chr19:18576248 A G ELL NM_006532:exon4:c.T443C:p.V148A Missense Mutation cancer gene census tissue EC1 chrX:39923667 T G BCOR NM_001123383exon7c.A3424Cp.S1142R Missense Mutation cancer gene census tissue EC1 chr18:22805548 GT G ZNF521 NM_001308225:exon3:c.1673delA:p.N558fs Frameshift deletion cancer gene census tissue EC1 chr19:42778479 GC G CIC NM_001304815:exon2:c.2545delC:p.P849fs Frameshift deletion cancer gene census tissue EC1 chr19:42797375 GC G CIC NM_015125:exon15:c.3738delC:p.S1246fs Frameshift deletion cancer gene census tissue EC1 chr19:42776954 GC G CIC NM_001304815:exon2:c.1020delC:p.R340fs Frameshift deletion cancer gene census tissue EC1 chr19:42778303 G A CIC NM_001304815:exon2:c.G2368A:p.G790S Missense Mutation cancer gene census tissue EC1 chr2:158595058 G A ACVR1 NM_001105exon10c.C1289Tp.P430L Missense Mutation cancer gene census COSM5860334 tissue EC1 chr2:158630626 C T ACVR1 NM_001105exon6c.G617Ap.R206H Missense Mutation cancer gene census COSM1008053 tissue EC1 chr2:60688968 AG A BCL11A NM_001363864:exon3:c.976delC:p.L326fs Frameshift deletion cancer gene census tissue EC1 chr2:60679778 G A BCL11A NM_018014:exon5:c.C2254T:p.R752C Missense Mutation cancer gene census tissue EC1 chr14:99724144 C T BCL11B NM_022898exon2c.G91Ap.E31K Missense Mutation cancer gene census COSM959471 tissue EC1 chr13:21562462 G T LATS2 NM_014572:exon4:c.C1457A:p.A486D Missense Mutation cancer gene census tissue EC1 chr10:102891767 G A TLX1 NM_001195517exon1c.G469Ap.V157M Missense Mutation cancer gene census tissue EC1 chr12:57860074 TG TGG GLI1 NM_001160045:exon6:c.431dupG:p.W144fs Frameshift insertion cancer gene census tissue EC1 chr12:57860074 TG T GLI1 NM_001160045:exon6:c.431delG:p.W144fs Frameshift deletion cancer gene census tissue EC1 chr22:30035181 C T NF2 NM_181828:exon2:c.C217T:p.Q73X Nonsense Mutation cancer gene census}

^{tissue EC1 chr9:117797538 CG C TNC NM_002160:exon22:c.5731delC:p.R1911fs Frameshift deletion cancer gene census tissue EC1 chr7:137600663 C T CREB3L2 NM_001253775exon3c.G415Ap.V139I Missense Mutation cancer gene census tissue EC1 chr5:224529 G A SDHA NM_001294332exon3c.G205Ap.A69T Missense Mutation cancer gene census COSM1196322 tissue EC1 chr5:236678 G A SDHA NM_001330758exon10c.G1396Ap.A466T Missense Mutation cancer gene census COSM3947404 tissue EC8 chr7:33044951 C G FKBP9 NM_001284341exon11c.C1860Gp.H620Q Missense Mutation cancer gene census COSM5000147 tissue EC8 chr3:105404191 T G CBLB NM_001321788exon14c.A2174Cp.H725P Missense Mutation cancer gene census tissue EC8 chr7:91632395 C A AKAP9 NM_005751:exon8:c.C3164A:p.S1055Y Missense Mutation cancer gene census COSM1092885 tissue EC8 chr18:42532072 A C SETBP1 NM_015559:exon4:c.A2767C:p.I923L Missense Mutation cancer gene census tissue EC8 chr2:107029579 T G RGPD3 NM_001144013:exon22:c.A5227C:p.S1743R Missense Mutation cancer gene census tissue EC8 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 tissue EC8 chr2:45233332 T G SIX2 NM_016932:exon2:c.A853C:p.N285H Missense Mutation cancer gene census tissue EC8 chr5:149503907 A C PDGFRB NM_002609exon14c.T1929Gp.S643R Missense Mutation cancer gene census tissue EC8 chr10:909789 A C LARP4B NM_001351277exon5c.T324Gp.H108Q Missense Mutation cancer gene census tissue EC8 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census tissue EC8 chr11:85742634 A C PICALM NM_001008660exon2c.T150Gp.N50K Missense Mutation cancer gene census tissue EC8 chr21:36164610 T C RUNX1 NM_001754exon9c.A1265Gp.E422G Missense Mutation cancer gene census tissue EC8 chr11:96074720 C T MAML2 NM_032427:exon1:c.G340A:p.A114T Missense Mutation cancer gene census tissue EC8 chr1:36762331 G A THRAP3 NM_001321473exon9c.G2263Ap.E755K Missense Mutation cancer gene census tissue EC8 chr17:5036823 T C USP6 NM_004505exon6c.T362Cp.L121S Missense Mutation cancer gene census COSM4591808 tissue EC8 chr11:118769546 T G BCL9L NM_182557:exon8:c.A4078C:p.M1360L Missense Mutation cancer gene census tissue EC8 chr7:151962148 C G KMT2C NM_170606:exon8:c.G1159C:p.E387Q Missense Mutation cancer gene census tissue EC8 chr7:151945225 T C KMT2C NM_170606:exon14:c.A2294G:p.E765G Missense Mutation cancer gene census COSM227525 tissue EC8 chr7:151962168 C A KMT2C NM_170606:exon8:c.G1139T:p.R380L Missense Mutation cancer gene census COSM225885 tissue EC8 chr7:151962265 C T KMT2C NM_170606:exon8:c.G1042A:p.D348N Missense Mutation cancer gene census COSM228110 tissue EC8 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 tissue EC8 chr7:151962294 G A KMT2C NM_170606:exon8:c.C1013T:p.S338L Missense Mutation cancer gene census COSM6056929 tissue EC8 chr7:151970859 C T KMT2C NM_170606:exon7:c.G943A:p.G315S Missense Mutation cancer gene census COSM1179668 tissue EC8 chr12:49425065 T G KMT2D NM_003482:exon39:c.A13423C:p.S4475R Missense Mutation cancer gene census tissue EC8 chr10:72357954 A C PRF1 NM_001083116exon3c.T1523Gp.V508G Missense Mutation cancer gene census tissue EC8 chr7:128845046 T G SMO NM_005631:exon3:c.T540G:p.N180K Missense Mutation cancer gene census tissue EC8 chr8:68981347 T G PREX2 NM_024870exon12c.T1419Gp.N473K Missense Mutation cancer gene census tissue EC8 chr1:179077557 T G ABL2 NM_007314exon12c.A2845Cp.I949L Missense Mutation cancer gene census tissue EC8 chr1:201980279 T G ELF3 NM_001114309exon2c.T15Gp.C5W Missense Mutation cancer gene census tissue EC8 chr22:39631853 A C PDGFB NM_002608:exon2:c.T90G:p.Y30X Nonsense Mutation cancer gene census tissue EC8 chr21:42840424 T G TMPRSS2 NM_001135099exon12c.A1324Cp.I442L Missense Mutation cancer gene census tissue EC4 chr7:33014363 A G FKBP9 NM_001284341exon3c.A515Gp.N172S Missense Mutation cancer gene census COSM6391782 tissue EC4 chr3:128204926 C T GATA2 NM_001145662exon3c.G515Ap.G172D Missense Mutation cancer gene census tissue EC4 chr7:91603084 G GA AKAP9 NM_005751:exon2:c.109dupA:p.Q36fs Frameshift insertion cancer gene census tissue EC4 chr16:67660556 C T CTCF NM_001191022:exon6:c.C472T:p.Q158X Nonsense Mutation cancer gene census, Shukla et al. tissue EC4 chr3:136261014 G A STAG1 NM_005862:exon6:c.C418T:p.R140X Nonsense Mutation cancer gene census tissue EC4 chr7:101891852 G A CUX1 NM_001202543exon24c.G4081Ap.A1361T Missense Mutation cancer gene census COSM9230592 tissue EC4 chr3:121260261 G A POLQ NM_199420:exon3:c.C409T:p.R137W Missense Mutation cancer gene census COSM4982874 tissue EC4 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 tissue EC4 chr19:49458970 TG T BAX NM_001291429:exon2:c.3delG:p.M1fs Frameshift deletion cancer gene census tissue EC4 chr19:45281364 C A CBLC NM_001130852exon1c.C176Ap.A59D Missense Mutation cancer gene census COSM3103349 tissue EC4 chr12:1289726 G T ERC1 NM_001301248exon8c.G1758Tp.Q586H Missense Mutation cancer gene census tissue EC4 chr4:54280840 G A FIP1L1 NM_030917exon11c.G874Ap.V292I Missense Mutation cancer gene census tissue EC4 chr9:96015276 AGT A WNK2 NM_001282394:exon8:c.1947_1948del:p.Q649fs Frameshift deletion cancer gene census tissue EC4 chr5:112175650 T.A. T APC NM_001127511:exon14:c.4306delA:p.K1436fs Frameshift deletion cancer gene census tissue EC4 chr5:112175303 C T APC NM_001127511:exon14:c.C3958T:p.Q1320X Nonsense Mutation cancer gene census tissue EC4 chr13:49281696 CCAT C CYSLTR2 NM_001308471:exon2:c.744_746del:p.248_249del In Frame deletion cancer gene census tissue EC4 chr2:16080794 A ACCCCCCCCCCCC MYCN NM_001293231:exon1:c.86_87insCCCCCCCCCCCC:p.H29delinsHPPPP In Frame insertion cancer gene census tissue EC4 chr2:16080800 G C MYCN NM_001293231:exon1:c.G92C:p.R31P Missense Mutation cancer gene census tissue EC4 chr5:176639004 G A NSD1 NM_022455exon5c.G3604Ap.E1202K Missense Mutation cancer gene census tissue EC4 chr11:108139302 C T ATM NM_000051exon18c.C2804Tp.T935M Missense Mutation cancer gene census COSM7185156 tissue EC4 chr16:72821959 CG C ZFHX3 NM_001164766:exon9:c.7473delC:p.P2491fs Frameshift deletion cancer gene census tissue EC4 chr16:72991734 C T ZFHX3 NM_006885:exon2:c.G2311A:p.G771R Missense Mutation cancer gene census COSM9143554 tissue EC4 chr2:148683685 T.A. T ACVR2A NM_001278580:exon10:c.979delA:p.K327fs Frameshift deletion cancer gene census tissue EC4 chr10:890938 GT G LARP4B NM_001351277:exon6:c.487delA:p.T163fs Frameshift deletion cancer gene census tissue EC4 chr2:109382881 CA C RANBP2 NM_006267:exon20:c.5887delA:p.K1963fs Frameshift deletion cancer gene census tissue EC4 chr3:100432666 G A T.F.G. NM_001007565exon2c.G137Ap.G46E Missense Mutation cancer gene census tissue EC4 chr19:45871974 T C ERCC2 NM_000400exon5c.A274Gp.N92D Missense Mutation cancer gene census tissue EC4 chr2:48027016 A G MSH6 NM_000179exon4c.A1894Gp.K632E Missense Mutation cancer gene census tissue EC4 chr16:23847510 C T PRKCB NM_002738exon1c.C14Tp.A5V Missense Mutation cancer gene census tissue EC4 chr1:156105701 A C LMNA NM_001282626exon6c.A946Cp.K316Q Missense Mutation cancer gene census tissue EC4 chr9:123886324 C T CNTRL NM_007018exon11c.C1766Tp.T589M Missense Mutation cancer gene census COSM3699385 tissue EC4 chr9:98220396 C T PTCH1 NM_000264exon18c.G3067Ap.G1023S Missense Mutation cancer gene census tissue EC4 chr9:134073269 C T NUP214 NM_001318325:exon4:c.C866T:p.P289L Missense Mutation cancer gene census COSM5592186 tissue EC4 chr17:8050696 C T PER1 NM_002616:exon13:c.G1501A:p.V501I Missense Mutation cancer gene census tissue EC4 chr4:87701620 G A PTPN13 NM_080685exon36c.G5972Ap.G1991D Missense Mutation cancer gene census tissue EC4 chr1:145021150 T C PDE4DIP NM_001350521exon2c.A251Gp.D84G Missense Mutation cancer gene census tissue EC4 chr2:100210570 A G AFF3 NM_001025108exon14c.T1628Cp.L543P Missense Mutation cancer gene census tissue EC4 chr7:98573836 C T TRRAP NM_001244580exon53c.C7883Tp.T2628M Missense Mutation cancer gene census tissue EC4 chr1:162725021 C T DDR2 NM_001354982exon6c.C493Tp.R165W Missense Mutation cancer gene census tissue EC4 chr2:178096304 C A NFE2L2 NM_006164exon5c.G1027Tp.D343Y Missense Mutation cancer gene census tissue EC4 chr11:57564191 A G CTNND1 NM_001085462exon5c.A683Gp.Y228C Missense Mutation cancer gene census tissue EC4 chr22:23656786 C G BCR NM_004327exon22c.C3611Gp.A1204G Missense Mutation cancer gene census COSM3785508}

^{tissue EC4 chr7:27224466 CCGCGCTGGG C HOXA11 NM_005523:exon1:c.289_297del:p.97_99del In Frame deletion cancer gene census tissue EC4 chr17:5036249 G T USP6 NM_004505exon5c.G240Tp.M80I Missense Mutation cancer gene census COSM4598023 tissue EC4 chr17:48276678 C G COL1A1 NM_000088:exon5:c.G380C:p.G127A Missense Mutation cancer gene census tissue EC4 chr8:95143148 T C CDH17 NM_001144663exon16c.A2240Gp.N747S Missense Mutation cancer gene census tissue EC4 chr12:57486861 C T NAB2 NM_001330305exon5c.C1159Tp.H387Y Missense Mutation cancer gene census tissue EC4 chr2:187511536 G A ITGAV NM_002210exon13c.G1283Ap.R428Q Missense Mutation cancer gene census COSM6688135 tissue EC4 chr7:151962168 C A KMT2C NM_170606:exon8:c.G1139T:p.R380L Missense Mutation cancer gene census COSM225885 tissue EC4 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 tissue EC4 chr7:151970859 C T KMT2C NM_170606:exon7:c.G943A:p.G315S Missense Mutation cancer gene census COSM1179668 tissue EC4 chr12:49443666 AC A KMT2D NM_003482:exon11:c.3704delG:p.G1235fs Frameshift deletion cancer gene census tissue EC4 chr13:28537277 AC A CDX2 NM_001265:exon3:c.916delG:p.V306fs Frameshift deletion cancer gene census tissue EC4 chr3:77542501 GA G ROBO2 NM_001290039:exon5:c.775delA:p.K259fs Frameshift deletion cancer gene census tissue EC4 chr11:92533711 C T FAT3 NM_001008781exon9c.C7532Tp.A2511V Missense Mutation cancer gene census tissue EC4 chr6:29912345 A T HLA-A NM_001242758exon5c.A964Tp.I322F Missense Mutation cancer gene census COSM4160533 tissue EC4 chr15:93480818 CA C CHD2 NM_001042572:exon6:c.515delA:p.Q172fs Frameshift deletion cancer gene census tissue EC4 chrX:53407978 A C SMC1A NM_006306exon23c.T3468Gp.D1156E Missense Mutation cancer gene census tissue EC4 chr3:189612269 G A TP63 NM_003722exon14c.G2021Ap.R674H Missense Mutation cancer gene census COSM3591250 tissue EC4 chr5:31493373 C G DROSHA NM_013235exon12c.G1783Cp.D595H Missense Mutation cancer gene census tissue EC4 chr14:99641279 CCCCGCCG C BCL11B NM_001282238:exon3:c.1671_1677del:p.G557fs Frameshift deletion cancer gene census tissue EC4 chr22:19188887 C T CLTCL1 NM_001835exon23c.G3718Ap.A1240T Missense Mutation cancer gene census tissue EC4 chr8:41834603 TC T KAT6A NM_001305878:exon7:c.1285delG:p.E429fs Frameshift deletion cancer gene census tissue EC4 chr6:128319906 T G PTPRK NM_001135648:exon16:c.A2638C:p.M880L Missense Mutation cancer gene census tissue EC4 chr5:236676 G A SDHA NM_001330758exon10c.G1394Ap.R465Q Missense Mutation cancer gene census COSM5468136 tissue EC4 chr5:236678 G A SDHA NM_001330758exon10c.G1396Ap.A466T Missense Mutation cancer gene census COSM3947404 tissue EC3 chr7:33014363 A G FKBP9 NM_001284341exon3c.A515Gp.N172S Missense Mutation cancer gene census COSM6391782 tissue EC3 chr3:178936095 A C PIK3CA NM_006218:exon10:c.A1637C:p.Q546P Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM767 tissue EC3 chr3:178952084 C T PIK3CA NM_006218:exon21:c.C3139T:p.H1047Y Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM774 tissue EC3 chr1:36933743 AG A CSF3R NM_000760:exon13:c.1655delC:p.P552fs Frameshift deletion cancer gene census tissue EC3 chr10:8097728 A C GATA3 NM_001002295exon2c.A110Cp.D37A Missense Mutation cancer gene census tissue EC3 chr14:65544747 C T MAX NM_002382exon4c.G179Ap.R60Q Missense Mutation cancer gene census COSM166665 tissue EC3 chr12:4388002 T C CCND2 NM_001759:exon3:c.T488C:p.I163T Missense Mutation cancer gene census tissue EC3 chr7:91736657 T C AKAP9 NM_005751:exon48:c.T11467C:p.Y3823H Missense Mutation cancer gene census tissue EC3 chr16:67645338 C CA CTCF NM_001363916:exon3:c.604dupA:p.A201fs Frameshift insertion cancer gene census, Shukla et al. tissue EC3 chr3:30691844 G T TGFBR2 NM_001024847exon4c.G421Tp.A141S Missense Mutation cancer gene census tissue EC3 chr1:65306996 GT G JAK1 NM_001321852:exon19:c.2580delA:p.K860fs Frameshift deletion cancer gene census tissue EC3 chr1:65325832 CG C JAK1 NM_001321852:exon9:c.1289delC:p.P430fs Frameshift deletion cancer gene census tissue EC3 chr12:6787520 AG A ZNF384 NM_001135734:exon6:c.458delC:p.P153fs Frameshift deletion cancer gene census tissue EC3 chr6:134492286 T C SGK1 NM_001143676exon12c.A1198Gp.M400V Missense Mutation cancer gene census tissue EC3 chr3:186507044 G A EIF4A2 NM_001967:exon11:c.G1210A:p.A404T Missense Mutation cancer gene census tissue EC3 chr3:155611424 T C GMPS NM_003875:exon2:c.T145C:p.F49L Missense Mutation cancer gene census tissue EC3 chr2:61144031 T G REL NM_001291746exon5c.T414Gp.N138K Missense Mutation cancer gene census tissue EC3 chr9:135771951 C T TSC1 NM_000368exon23c.G3166Ap.A1056T Missense Mutation cancer gene census tissue EC3 chr1:110882872 AC A RBM15 NM_001201545:exon1:c.846delC:p.H282fs Frameshift deletion cancer gene census tissue EC3 chr3:52584582 A AG PBRM1 NM_001350075:exon29:c.4586dupC:p.P1529fs Frameshift insertion cancer gene census tissue EC3 chr3:52651319 T C PBRM1 NM_001350075exon15c.A1777Gp.M593V Missense Mutation cancer gene census tissue EC3 chr20:39791911 AG A PLCG1 NM_002660:exon8:c.786delG:p.Q262fs Frameshift deletion cancer gene census tissue EC3 chr11:17742894 G A MYOD1 NM_002478:exon3:c.G802A:p.A268T Missense Mutation cancer gene census tissue EC3 chr4:54319215 G T FIP1L1 NM_030917exon16c.G1414Tp.D472Y Missense Mutation cancer gene census tissue EC3 chr6:163899919 TAA T QKI NM_001301085:exon3:c.394_395del:p.K132fs Frameshift deletion cancer gene census tissue EC3 chr6:163899919 TAA T.A. QKI NM_001301085:exon3:c.395delA:p.K132fs Frameshift deletion cancer gene census tissue EC3 chr7:138602271 C T KIAA1549 NM_001164665exon2c.G2101Ap.E701K Missense Mutation cancer gene census COSM2860350 tissue EC3 chr3:13679166 C T FBLN2 NM_001004019exon18c.C3443Tp.A1148V Missense Mutation cancer gene census tissue EC3 chr17:38512369 CG C RARA NM_001145302:exon7:c.990delG:p.P330fs Frameshift deletion cancer gene census tissue EC3 chr2:45233332 T G SIX2 NM_016932:exon2:c.A853C:p.N285H Missense Mutation cancer gene census tissue EC3 chr2:45235838 C T SIX2 NM_016932:exon1:c.G412A:p.V138M Missense Mutation cancer gene census tissue EC3 chr8:119123018 A G EXT1 NM_000127:exon1:c.T268C:p.S90P Missense Mutation cancer gene census tissue EC3 chr6:157405953 C CG ARID1B NM_001346813:exon5:c.2157dupG:p.P719fs Frameshift insertion cancer gene census tissue EC3 chr6:157505458 C T ARID1B NM_001363725:exon11:c.C1309T:p.Q437X Nonsense Mutation cancer gene census tissue EC3 chr1:27023289 TG T ARID1A NM_006015:exon1:c.396delG:p.V132fs Frameshift deletion cancer gene census, Shukla et al. tissue EC3 chr1:27100880 A G ARID1A NM_006015:exon18:c.A4162G:p.M1388V Missense Mutation cancer gene census, Shukla et al. tissue EC3 chr1:27106803 AC A ARID1A NM_006015:exon20:c.6415delC:p.P2139fs Frameshift deletion cancer gene census, Shukla et al. tissue EC3 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. tissue EC3 chr1:78444640 C A FUBP1 NM_001303433exon1c.G49Tp.G17C Missense Mutation cancer gene census tissue EC3 chr1:17958883 G A ARHGEF10L NM_018125exon16c.G1652Ap.R551H Missense Mutation cancer gene census tissue EC3 chr19:1625638 T C TCF3 NM_001136139:exon7:c.A436G:p.T146A Missense Mutation cancer gene census tissue EC3 chr5:176637648 GCT G NSD1 NM_022455:exon5:c.2249_2250del:p.A750fs Frameshift deletion cancer gene census tissue EC3 chr5:176721712 CA C NSD1 NM_022455:exon23:c.7344delA:p.S2448fs Frameshift deletion cancer gene census tissue EC3 chr16:72821267 GGA G ZFHX3 NM_001164766:exon9:c.8164_8165del:p.S2722fs Frameshift deletion cancer gene census tissue EC3 chr16:72821467 T C ZFHX3 NM_006885exon10c.A10708Gp.S3570G Missense Mutation cancer gene census tissue EC3 chr16:72821959 CG C ZFHX3 NM_001164766:exon9:c.7473delC:p.P2491fs Frameshift deletion cancer gene census tissue EC3 chr16:72831399 G C ZFHX3 NM_006885exon9c.C5182Gp.Q1728E Missense Mutation cancer gene census tissue EC3 chr11:114121086 T TC ZBTB16 NM_001354752:exon5:c.1745dupC:p.S582fs Frameshift insertion cancer gene census tissue EC3 chr4:153332900 A G FBXW7 NM_033632exon2c.T56Cp.L19P Missense Mutation cancer gene census, The Cancer Genome Atlas Research Network, Shukla et al. tissue EC3 chr2:148683685 T.A. T ACVR2A NM_001278580:exon10:c.979delA:p.K327fs Frameshift deletion cancer gene census tissue EC3 chr4:106164914 G A TET2 NM_001127208:exon6:c.G3782A:p.R1261H Missense Mutation cancer gene census COSM211643 tissue EC3 chr3:138664820 C T FOXL2 NM_023067:exon1:c.G745A:p.A249T Missense Mutation cancer gene census tissue EC3 chr2:109384346 C T RANBP2 NM_006267:exon20:c.C7351T:p.P2451S Missense Mutation cancer gene census tissue EC3 chr7:27205008 A C HOXA9 NM_152739:exon1:c.T69G:p.D23E Missense Mutation cancer gene census tissue EC3 chr2:48030639 AC A MSH6 NM_001281492:exon3:c.2864delC:p.T955fs Frameshift deletion cancer gene census tissue EC3 chr17:20108176 G T SPECC1 NM_001033553exon4c.G814Tp.D272Y Missense Mutation cancer gene census tissue EC3 chr17:20108262 T.A. T SPECC1 NM_001033554:exon2:c.658delA:p.K220fs Frameshift deletion cancer gene census}

^{tissue EC3 chr12:105150838 G A CHST11 NM_018413exon3c.G316Ap.D106N Missense Mutation cancer gene census tissue EC3 chr9:139412290 T C NOTCH1 NM_017617:exon8:c.A1355G:p.D452G Missense Mutation cancer gene census tissue EC3 chr11:85692947 T C PICALM NM_007166exon15c.A1616Gp.D539G Missense Mutation cancer gene census tissue EC3 chr7:127447556 C T SND1 NM_014390:exon11:c.C1171T:p.R391C Missense Mutation cancer gene census COSM203430 tissue EC3 chr5:56177773 T G MAP3K1 NM_005921:exon14:c.T2746G:p.C916G Missense Mutation cancer gene census tissue EC3 chr6:136599436 G T BCLAF1 NM_001077441exon4c.C583Ap.P195T Missense Mutation cancer gene census tissue EC3 chr9:134073296 C T NUP214 NM_001318325:exon4:c.C893T:p.S298L Missense Mutation cancer gene census tissue EC3 chr9:134073967 A G NUP214 NM_001318325:exon4:c.A1564G:p.T522A Missense Mutation cancer gene census tissue EC3 chr15:90630405 AC A IDH2 NM_001290114:exon5:c.515delG:p.G172fs Frameshift deletion cancer gene census tissue EC3 chr10:123256145 A C FGFR2 NM_001144914:exon10:c.T1428G:p.Y476X Nonsense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. tissue EC3 chr21:36164605 A C RUNX1 NM_001754exon9c.T1270Gp.S424A Missense Mutation cancer gene census COSM7346815 tissue EC3 chr15:52700262 G A MYO5A NM_000259:exon7:c.C832T:p.R278X Nonsense Mutation cancer gene census tissue EC3 chr14:62188253 A G HIF1A NM_001243084exon3c.A325Gp.K109E Missense Mutation cancer gene census tissue EC3 chr1:2238188 C A SKI NM_003036:exon7:c.C2171A:p.A724E Missense Mutation cancer gene census tissue EC3 chr6:33287620 C T DAXX NM_001141969exon6c.G1477Ap.D493N Missense Mutation cancer gene census tissue EC3 chr6:33287212 A AG DAXX NM_001254717:exon5:c.1659dupC:p.C554fs Frameshift insertion cancer gene census tissue EC3 chr1:144922583 G T PDE4DIP NM_001002811:exon3:c.C1313A:p.S438X Nonsense Mutation cancer gene census tissue EC3 chr17:7579577 G GA TP53 NM_000546:exon4:c.109dupT:p.S37fs Frameshift insertion cancer gene census, Westin et al. tissue EC3 chr12:122248216 G GC SETD1B NM_001353345:exon5:c.1366dupC:p.P455fs Frameshift insertion cancer gene census tissue EC3 chr1:156834151 T A NTRK1 NM_001012331exon2c.T218Ap.I73N Missense Mutation cancer gene census tissue EC3 chrX:129147745 G A BCORL1 NM_001184772exon3c.G997Ap.V333I Missense Mutation cancer gene census tissue EC3 chrX:129190010 T TC BCORL1 NM_021946:exon12:c.5036dupC:p.S1679fs Frameshift insertion cancer gene census tissue EC3 chr12:57493667 T C STAT6 NM_001178078exon15c.A1627Gp.S543G Missense Mutation cancer gene census tissue EC3 chr20:50401031 C T SALL4 NM_020436exon4c.G2935Ap.G979S Missense Mutation cancer gene census COSM1130603 tissue EC3 chr17:5074001 CG C USP6 NM_004505:exon28:c.3746delG:p.R1249fs Frameshift deletion cancer gene census tissue EC3 chr20:57429164 G A GNAS NM_080425:exon1:c.G844A:p.G282S Missense Mutation cancer gene census COSM4099804 tissue EC3 chr20:57429691 G T GNAS NM_001077490:exon1:c.G1184T:p.R395L Missense Mutation cancer gene census tissue EC3 chr20:57470723 A G GNAS NM_080425exon2c.A2125Gp.N709D Missense Mutation cancer gene census tissue EC3 chr16:64982522 G A CDH11 NM_001308392:exon13:c.C2063T:p.T688I Missense Mutation cancer gene census tissue EC3 chr16:65016102 C T CDH11 NM_001308392exon8c.G1102Ap.V368M Missense Mutation cancer gene census tissue EC3 chr7:151874147 CT C KMT2C NM_170606:exon38:c.8390delA:p.K2797fs Frameshift deletion cancer gene census tissue EC3 chr7:151945228 G A KMT2C NM_170606:exon14:c.C2291T:p.S764F Missense Mutation cancer gene census COSM5941288 tissue EC3 chr7:151945256 G A KMT2C NM_170606:exon14:c.C2263T:p.Q755X Nonsense Mutation cancer gene census tissue EC3 chr7:151962265 C T KMT2C NM_170606:exon8:c.G1042A:p.D348N Missense Mutation cancer gene census COSM228110 tissue EC3 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 tissue EC3 chr7:151962294 G A KMT2C NM_170606:exon8:c.C1013T:p.S338L Missense Mutation cancer gene census COSM6056929 tissue EC3 chr1:14108748 CA C PRDM2 NM_001007257:exon3:c.3856delA:p.K1286fs Frameshift deletion cancer gene census tissue EC3 chr12:49427714 T G KMT2D NM_003482:exon39:c.A10774C:p.M3592L Missense Mutation cancer gene census tissue EC3 chr11:128677120 A G FLI1 NM_002017exon7c.A767Gp.Q256R Missense Mutation cancer gene census tissue EC3 chr11:128628148 C T FLI1 NM_002017exon2c.C157Tp.P53S Missense Mutation cancer gene census COSM7266680 tissue EC3 chr17:40371762 G A STAT5B NM_012448:exon6:c.C649T:p.R217C Missense Mutation cancer gene census tissue EC3 chr5:131326641 C T ACSL6 NM_001009185exon3c.G290Ap.R97Q Missense Mutation cancer gene census tissue EC3 chr11:92086633 G T FAT3 NM_001008781exon1c.G1355Tp.G452V Missense Mutation cancer gene census tissue EC3 chr11:92087094 G A FAT3 NM_001008781exon1c.G1816Ap.D606N Missense Mutation cancer gene census tissue EC3 chr12:459872 T A KDM5A NM_001042603:exon10:c.A1223T:p.E408V Missense Mutation cancer gene census tissue EC3 chr6:29911239 TT CA HLA-A NM_001242758:exon3:c.538_539CA In Frame Substitution cancer gene census tissue EC3 chr19:10935790 C T DNM2 NM_001005360exon18c.C1951Tp.R651W Missense Mutation cancer gene census tissue EC3 chr12:6700879 C T CHD4 NM_001273exon21c.G3203Ap.R1068H Missense Mutation cancer gene census COSM2098488 tissue EC3 chr12:6701714 CA C CHD4 NM_001297553:exon18:c.2771delT:p.L924fs Frameshift deletion cancer gene census tissue EC3 chr20:31022441 AGG A ASXL1 NM_001363734:exon11:c.1744_1745del:p.G582fs Frameshift deletion cancer gene census tissue EC3 chr4:187534472 AG A FAT1 NM_005245:exon13:c.9253delC:p.L3085fs Frameshift deletion cancer gene census tissue EC3 chr13:35770297 A G NBEA NM_015678:exon31:c.A5224G:p.N1742D Missense Mutation cancer gene census tissue EC3 chr4:126373366 AT A FAT4 NM_001291285:exon9:c.11202delT:p.H3734fs Frameshift deletion cancer gene census tissue EC3 chrX:37027361 A C FAM47C NM_001013736:exon1:c.A878C:p.H293P Missense Mutation cancer gene census tissue EC3 chrX:37028333 A C FAM47C NM_001013736:exon1:c.A1850C:p.H617P Missense Mutation cancer gene census tissue EC3 chrX:37028648 G A FAM47C NM_001013736:exon1:c.G2165A:p.R722H Missense Mutation cancer gene census tissue EC3 chr2:176973662 G A HOXD11 NM_021192:exon2:c.G809A:p.R270H Missense Mutation cancer gene census tissue EC3 chr7:50467747 C T IKZF1 NM_006060exon8c.C982Tp.R328C Missense Mutation cancer gene census COSM6982713 tissue EC3 chr12:124856982 G A NCOR2 NM_006312exon22c.C2393Tp.P798L Missense Mutation cancer gene census tissue EC3 chr19:18562379 A C ELL NM_006532:exon7:c.T949G:p.S317A Missense Mutation cancer gene census tissue EC3 chr14:95562798 AT A DICER1 NM_001195573:exon22:c.4458delA:p.K1486fs Frameshift deletion cancer gene census tissue EC3 chr14:95569720 G A DICER1 NM_001195573exon20c.C4013Tp.A1338V Missense Mutation cancer gene census tissue EC3 chr19:42790927 G A CIC NM_015125:exon2:c.G72A:p.W24X Nonsense Mutation cancer gene census tissue EC3 chr19:42776954 GC G CIC NM_001304815:exon2:c.1020delC:p.R340fs Frameshift deletion cancer gene census tissue EC3 chr2:141762945 G C LRP1B NM_018557:exon15:c.C2462G:p.A821G Missense Mutation cancer gene census tissue EC3 chr2:141291668 G A LRP1B NM_018557:exon47:c.C7684T:p.R2562C Missense Mutation cancer gene census COSM106997 tissue EC3 chr12:57860074 TG T GLI1 NM_001160045:exon6:c.431delG:p.W144fs Frameshift deletion cancer gene census tissue EC3 chr12:70929822 A G PTPRB NM_001109754exon29c.T6064Cp.C2022R Missense Mutation cancer gene census tissue EC3 chr2:25467478 T C DNMT3A NM_022552exon14c.A1598Gp.Y533C Missense Mutation cancer gene census COSM231555 tissue EC3 chr6:128319906 T G PTPRK NM_001135648:exon16:c.A2638C:p.M880L Missense Mutation cancer gene census tissue EC3 chr16:9857080 T C GRIN2A NM_001134407exon13c.A4321Gp.T1441A Missense Mutation cancer gene census COSM1609805 tissue EC3 chr1:198713220 A G PTPRC NM_002838exon26c.A2735Gp.Y912C Missense Mutation cancer gene census tissue EC7 chr6:106553683 A C PRDM1 NM_001198exon5c.A1648Cp.I550L Missense Mutation cancer gene census tissue EC7 chr1:110883113 T G RBM15 NM_001201545exon1c.T1086Gp.D362E Missense Mutation cancer gene census tissue EC7 chr2:45233332 T G SIX2 NM_016932:exon2:c.A853C:p.N285H Missense Mutation cancer gene census tissue EC7 chr1:186344032 A C TPR NM_003292:exon1:c.T129G:p.H43Q Missense Mutation cancer gene census tissue EC7 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. tissue EC7 chr16:12497383 T G SNX29 NM_032167:exon18:c.T2034G:p.Y678X Nonsense Mutation cancer gene census tissue EC7 chr16:72845484 T G ZFHX3 NM_006885exon7c.A3856Cp.I1286L Missense Mutation cancer gene census tissue EC7 chr10:888908 T G LARP4B NM_001351277exon7c.A610Cp.S204R Missense Mutation cancer gene census tissue EC7 chr22:41556673 T G EP300 NM_001429exon20c.T3618Gp.N1206K Missense Mutation cancer gene census tissue EC7 chr10:118687354 G T SHTN1 NM_001127211exon11c.C1061Ap.P354Q Missense Mutation cancer gene census tissue EC7 chr1:164781344 C T PBX1 NM_001204961exon6c.C955Tp.H319Y Missense Mutation cancer gene census tissue EC7 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census tissue EC7 chr1:150921730 T T.A. SETDB1 NM_001145415:exon11:c.1401dupA:p.L467fs Frameshift insertion cancer gene census tissue EC7 chr17:41245918 G T BRCA1 NM_007294exon10c.C1630Ap.Q544K Missense Mutation cancer gene census tissue EC7 chr17:41245919 ACCATTCTGCT A BRCA1 NM_007297:exon9:c.1478_1487del:p.E493fs Frameshift deletion cancer gene census tissue EC7 chr10:114925408 T A TCF7L2 NM_001367943exon15c.T1537Ap.S513T Missense Mutation cancer gene census tissue EC7 chr7:98569512 C A TRRAP NM_001244580exon52c.C7762Ap.L2588M Missense Mutation cancer gene census tissue EC7 chr17:7578526 CA C TP53 NM_001126115:exon1:c.7delT:p.C3fs Frameshift deletion cancer gene census, Westin et al.}

^{tissue EC7 chr22:23656786 C G BCR NM_004327exon22c.C3611Gp.A1204G Missense Mutation cancer gene census COSM3785508 tissue EC7 chr2:198288641 T G SF3B1 NM_001005526exon2c.A86Cp.Q29P Missense Mutation cancer gene census tissue EC7 chr7:151945225 T C KMT2C NM_170606:exon14:c.A2294G:p.E765G Missense Mutation cancer gene census COSM227525 tissue EC7 chr7:151962168 C A KMT2C NM_170606:exon8:c.G1139T:p.R380L Missense Mutation cancer gene census COSM225885 tissue EC7 chr7:151970859 C T KMT2C NM_170606:exon7:c.G943A:p.G315S Missense Mutation cancer gene census COSM1179668 tissue EC7 chr17:47696719 C G SPOP NM_001007228exon4c.G229Cp.D77H Missense Mutation cancer gene census tissue EC7 chr1:243828161 C A AKT3 NM_181690exon3c.G197Tp.R66L Missense Mutation cancer gene census COSM324691 tissue EC7 chr12:25398284 C G KRAS NM_001369786exon2c.G35Cp.G12A Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM522 tissue EC7 chr11:92087030 GG TT FAT3 NM_001008781:exon1:c.1752_1753TT In Frame Substitution cancer gene census tissue EC7 chr12:6711206 GCTT G CHD4 NM_001297553:exon3:c.334_336del:p.112_112del In Frame deletion cancer gene census tissue EC7 chr9:8517870 T.A. AT PTPRD NM_001171025:exon8:c.1490_1491AT In Frame Substitution cancer gene census tissue EC7 chrX:44966777 G A KDM6A NM_001291416exon27c.G4022Ap.C1341Y Missense Mutation cancer gene census tissue EC7 chr15:74337108 T G PML NM_033238:exon9:c.T2408G:p.V803G Missense Mutation cancer gene census tissue EC7 chr19:18555603 T G ELL NM_006532:exon12:c.A1825C:p.I609L Missense Mutation cancer gene census tissue EC7 chr5:236678 G A SDHA NM_001330758exon10c.G1396Ap.A466T Missense Mutation cancer gene census COSM3947404 tissue EC7 chr17:66547263 T G PRKAR1A NM_001276290:exon10:c.T1012G:p.X338E Nonsense Mutation cancer gene census tissue EC6 chr5:38482133 A G LIFR NM_001127671exon20c.T2858Cp.I953T Missense Mutation cancer gene census tissue EC6 chr3:178916726 G A PIK3CA NM_006218:exon2:c.G113A:p.R38H Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM745 tissue EC6 chr3:105404191 T G CBLB NM_001321788exon14c.A2174Cp.H725P Missense Mutation cancer gene census tissue EC6 chr11:120350903 CTT C ARHGEF12 NM_001198665:exon37:c.3945_3946del:p.S1315fs Frameshift deletion cancer gene census tissue EC6 chr11:3720388 GT G NUP98 NM_001365129:exon24:c.3791delA:p.N1264fs Frameshift deletion cancer gene census tissue EC6 chr3:128204841 AC A GATA2 NM_001145662:exon3:c.599delG:p.G200fs Frameshift deletion cancer gene census tissue EC6 chr19:4362346 C A SH3GL1 NM_003025exon9c.G890Tp.R297L Missense Mutation cancer gene census tissue EC6 chr18:42532072 A C SETBP1 NM_015559:exon4:c.A2767C:p.I923L Missense Mutation cancer gene census tissue EC6 chr1:65306996 GT G JAK1 NM_001321852:exon19:c.2580delA:p.K860fs Frameshift deletion cancer gene census tissue EC6 chr7:101839973 GC G CUX1 NM_001202543:exon15:c.1316delC:p.A439fs Frameshift deletion cancer gene census tissue EC6 chr12:54332815 CG C HOXC13 NM_017410:exon1:c.126delG:p.A42fs Frameshift deletion cancer gene census tissue EC6 chrX:153585889 T G FLNA NM_001110556exon29c.A4858Cp.I1620L Missense Mutation cancer gene census tissue EC6 chr16:15820794 GCTT G MYH11 NM_002474:exon28:c.3766_3768del:p.1256_1256del In Frame deletion cancer gene census tissue EC6 chr10:43615650 A G RET NM_020630exon15c.A2729Gp.Q910R Missense Mutation cancer gene census tissue EC6 chr12:48392212 G C COL2A1 NM_001844exon3c.C295Gp.Q99E Missense Mutation cancer gene census tissue EC6 chr1:110882872 AC A RBM15 NM_001201545:exon1:c.846delC:p.H282fs Frameshift deletion cancer gene census tissue EC6 chr1:3328749 C T PRDM16 NM_022114exon9c.C1988Tp.A663V Missense Mutation cancer gene census tissue EC6 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 tissue EC6 chr19:6833957 T G VAV1 NM_001258206exon19c.T1770Gp.N590K Missense Mutation cancer gene census tissue EC6 chr21:39817506 AAAC A E.R.G. NM_001331025:exon2:c.54_56del:p.18_19del In Frame deletion cancer gene census tissue EC6 chr17:37682548 A C CDK12 NM_015083exon13c.A3739Cp.M1247L Missense Mutation cancer gene census tissue EC6 chr10:3824115 C T KLF6 NM_001160124exon2c.G394Ap.E132K Missense Mutation cancer gene census COSM917999 tissue EC6 chr12:122758654 T C CLIP1 NM_001247997exon25c.A4022Gp.K1341R Missense Mutation cancer gene census tissue EC6 chr12:121432117 GC G HNF1A NM_000545:exon4:c.865delC:p.P289fs Frameshift deletion cancer gene census tissue EC6 chr4:54319247 C.A.G. C FIP1L1 NM_001134938:exon13:c.1225_1226del:p.R409fs Frameshift deletion cancer gene census tissue EC6 chr8:41550626 G A ANK1 NM_000037exon30c.C3626Tp.A1209V Missense Mutation cancer gene census tissue EC6 chr7:138603907 A C KIAA1549 NM_001164665exon2c.T465Gp.D155E Missense Mutation cancer gene census tissue EC6 chrX:47426708 C T ARAF NM_001654exon10c.C953Tp.T318M Missense Mutation cancer gene census tissue EC6 chr9:96055028 TC T WNK2 NM_006648:exon22:c.5282delC:p.S1761fs Frameshift deletion cancer gene census tissue EC6 chr16:2110731 A C TSC2 NM_000548exon11c.A1036Cp.I346L Missense Mutation cancer gene census tissue EC6 chr6:157099165 GTCC G ARID1B NM_001346813:exon1:c.103_105del:p.35_35del In Frame deletion cancer gene census tissue EC6 chr1:27094328 T G ARID1A NM_006015:exon11:c.T3036G:p.Y1012X Nonsense Mutation cancer gene census, Shukla et al. tissue EC6 chr1:27101267 G GC ARID1A NM_006015:exon18:c.4550dupC:p.A1517fs Frameshift insertion cancer gene census, Shukla et al. tissue EC6 chr1:205589676 T C ELK4 NM_001973:exon3:c.A498G:p.I166M Missense Mutation cancer gene census tissue EC6 chr19:1611726 T C TCF3 NM_001136139:exon19:c.A1936G:p.N646D Missense Mutation cancer gene census tissue EC6 chr19:1620977 C A TCF3 NM_001136139:exon13:c.G1083T:p.Q361H Missense Mutation cancer gene census tissue EC6 chr5:176675268 T.A. T NSD1 NM_022455:exon11:c.4585delA:p.K1529fs Frameshift deletion cancer gene census tissue EC6 chr5:176707683 C T NSD1 NM_022455exon18c.C5740Tp.R1914C Missense Mutation cancer gene census COSM1066287 tissue EC6 chr16:72984598 T G ZFHX3 NM_006885exon3c.A2986Cp.K996Q Missense Mutation cancer gene census tissue EC6 chr16:72991696 T TGCC ZFHX3 NM_006885:exon2:c.2348_2349insGGC:p.A783delinsAA In Frame insertion cancer gene census tissue EC6 chr16:72991696 T TGCCGCC ZFHX3 NM_006885:exon2:c.2348_2349insGGCGGC:p.A783delinsAAA In Frame insertion cancer gene census tissue EC6 chr5:180047694 A C FLT4 NM_001354989exon16c.T2321Gp.M774R Missense Mutation cancer gene census tissue EC6 chr5:149440478 T C CSF1R NM_001288705exon13c.A1916Gp.H639R Missense Mutation cancer gene census tissue EC6 chr16:89865583 A C FANCA NM_000135exon10c.T884Gp.V295G Missense Mutation cancer gene census tissue EC6 chr2:148683685 T.A. T ACVR2A NM_001278580:exon10:c.979delA:p.K327fs Frameshift deletion cancer gene census tissue EC6 chr4:106156369 A G TET2 NM_001127208:exon3:c.A1270G:p.S424G Missense Mutation cancer gene census tissue EC6 chr15:34649469 CA C NUTM1 NM_001284293:exon7:c.3231delA:p.A1077fs Frameshift deletion cancer gene census tissue EC6 chrX:107979139 G A IRS4 NM_003604:exon1:c.C436T:p.R146C Missense Mutation cancer gene census tissue EC6 chr1:2491291 T C TNFRSF14 NM_001297605exon4c.T334Cp.S112P Missense Mutation cancer gene census COSM8245920 tissue EC6 chr2:109381590 T.A. T RANBP2 NM_006267:exon20:c.4596delA:p.L1532fs Frameshift deletion cancer gene census tissue EC6 chr2:48025856 T T.A. MSH6 NM_001281492:exon2:c.345dupA:p.I115fs Frameshift insertion cancer gene census tissue EC6 chr19:13210142 C A LYL1 NM_005583:exon4:c.G834T:p.E278D Missense Mutation cancer gene census tissue EC6 chr17:63532584 G GC AXIN2 NM_001363813:exon7:c.1799dupG:p.G600fs Frameshift insertion cancer gene census tissue EC6 chr13:48878082 ACCG A RB1 NM_000321:exon1:c.35_37del:p.12_13del In Frame deletion cancer gene census tissue EC6 chrX:70338669 C T MED12 NM_005120:exon1:c.C65T:p.P22L Missense Mutation cancer gene census tissue EC6 chr7:2968322 CG C CARD11 NM_032415:exon13:c.1663delC:p.R555fs Frameshift deletion cancer gene census tissue EC6 chr12:105150763 C T CHST11 NM_018413exon3c.C241Tp.R81W Missense Mutation cancer gene census COSM3416414 tissue EC6 chr9:139390918 C T NOTCH1 NM_017617:exon34:c.G7273A:p.A2425T Missense Mutation cancer gene census COSM6966420 tissue EC6 chr1:120458550 A C NOTCH2 NM_024408:exon34:c.T6795G:p.N2265K Missense Mutation cancer gene census tissue EC6 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census tissue EC6 chr2:237489743 T G ACKR3 NM_020311:exon2:c.T635G:p.M212R Missense Mutation cancer gene census tissue EC6 chr10:76735336 C T KAT6B NM_001256468exon8c.C1241Tp.T414I Missense Mutation cancer gene census COSM7259589}

^{tissue EC6 chr10:76789020 G A KAT6B NM_001370136exon18c.G4438Ap.D1480N Missense Mutation cancer gene census tissue EC6 chr3:53844145 GCAGT G CACNA1D NM_001128839:exon45:c.5941_5944del:p.Q1981fs Frameshift deletion cancer gene census tissue EC6 chr17:29677257 T G NF1 NM_001042492exon50c.T7378Gp.S2460A Missense Mutation cancer gene census tissue EC6 chr2:212568865 G GA ERBB4 NM_001042599:exon11:c.1252dupT:p.S418fs Frameshift insertion cancer gene census tissue EC6 chr15:90630416 TGAG T IDH2 NM_001290114:exon5:c.502_504del:p.168_168del In Frame deletion cancer gene census tissue EC6 chr17:8051410 AG A PER1 NM_002616:exon10:c.1138delC:p.L380fs Frameshift deletion cancer gene census tissue EC6 chr10:123310914 C T FGFR2 NM_001144913exon4c.G514Ap.A172T Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM6925650 tissue EC6 chr14:51190254 ATCT A NIN NM_020921:exon31:c.6326_6328del:p.2109_2110del In Frame deletion cancer gene census tissue EC6 chr14:51214736 T G NIN NM_020921exon22c.A5038Cp.K1680Q Missense Mutation cancer gene census tissue EC6 chr10:32337433 T G KIF5B NM_004521:exon2:c.A173C:p.Q58P Missense Mutation cancer gene census tissue EC6 chr10:114925408 T A TCF7L2 NM_001367943exon15c.T1537Ap.S513T Missense Mutation cancer gene census tissue EC6 chr10:114925418 T A TCF7L2 NM_001367943exon15c.T1547Ap.L516Q Missense Mutation cancer gene census tissue EC6 chr10:114925316 GA G TCF7L2 NM_001198530:exon11:c.1151delA:p.E384fs Frameshift deletion cancer gene census tissue EC6 chr17:47882770 G A KAT7 NM_001199155exon5c.G626Ap.C209Y Missense Mutation cancer gene census tissue EC6 chr19:11123782 C A SMARCA4 NM_001128845:exon15:c.C2432A:p.P811H Missense Mutation cancer gene census tissue EC6 chr19:11134251 C T SMARCA4 NM_001128845:exon19:c.C2917T:p.R973W Missense Mutation cancer gene census COSM1161250 tissue EC6 chr17:78280189 G A RNF213 NM_001256071:exon12:c.G2348A:p.R783H Missense Mutation cancer gene census COSM2803547 tissue EC6 chr7:98534893 T G TRRAP NM_001244580exon29c.T4226Gp.M1409R Missense Mutation cancer gene census tissue EC6 chr7:98553911 G T TRRAP NM_001244580exon41c.G6059Tp.R2020M Missense Mutation cancer gene census COSM379426 tissue EC6 chr7:98509724 G A TRRAP NM_001244580exon18c.G2087Ap.R696H Missense Mutation cancer gene census COSM1673336 tissue EC6 chr6:152419920 T C ESR1 NM_000125exon8c.T1607Cp.L536P Missense Mutation cancer gene census COSM6906109 tissue EC6 chr12:115112509 C T TBX3 NM_016569exon7c.G1231Ap.A411T Missense Mutation cancer gene census tissue EC6 chr8:103289348 CT C UBR5 NM_001282873:exon45:c.6360delA:p.K2120fs Frameshift deletion cancer gene census tissue EC6 chr2:198266611 C T SF3B1 NM_012433:exon16:c.G2225A:p.G742D Missense Mutation cancer gene census COSM145923 tissue EC6 chr20:57429164 G A GNAS NM_080425:exon1:c.G844A:p.G282S Missense Mutation cancer gene census COSM4099804 tissue EC6 chr2:32733295 C T BIRC6 NM_016252:exon51:c.C9949T:p.L3317F Missense Mutation cancer gene census tissue EC6 chr2:32689787 G A BIRC6 NM_016252:exon25:c.G5152A:p.V1718I Missense Mutation cancer gene census COSM4440799 tissue EC6 chr6:108985176 T TG FOXO3 NM_001455:exon2:c.1141dupG:p.D380fs Frameshift insertion cancer gene census tissue EC6 chr2:204591542 CA C CD28 NM_006139:exon2:c.240delA:p.S80fs Frameshift deletion cancer gene census tissue EC6 chr10:90768707 CT C FAS NM_000043:exon4:c.397delT:p.F133fs Frameshift deletion cancer gene census tissue EC6 chr9:20413951 CT C MLLT3 NM_001286691:exon5:c.883delA:p.R295fs Frameshift deletion cancer gene census tissue EC6 chr8:31497514 G A NRG1 NM_013962:exon1:c.G14A:p.R5H Missense Mutation cancer gene census tissue EC6 chr10:104934666 G A NT5C2 NM_001134373exon2c.C50Tp.A17V Missense Mutation cancer gene census tissue EC6 chr7:151846222 A T KMT2C NM_170606:exon52:c.T12790A:p.L4264M Missense Mutation cancer gene census tissue EC6 chr7:151874643 T G KMT2C NM_170606:exon38:c.A7895C:p.Q2632P Missense Mutation cancer gene census tissue EC6 chr7:151962168 C A KMT2C NM_170606:exon8:c.G1139T:p.R380L Missense Mutation cancer gene census COSM225885 tissue EC6 chr7:151962265 C T KMT2C NM_170606:exon8:c.G1042A:p.D348N Missense Mutation cancer gene census COSM228110 tissue EC6 chr11:118344185 AC A KMT2A NM_001197104:exon3:c.2312delC:p.T771fs Frameshift deletion cancer gene census tissue EC6 chr11:118371737 G A KMT2A NM_001197104exon25c.G6194Ap.R2065H Missense Mutation cancer gene census COSM1239438 tissue EC6 chr12:49434491 AG A KMT2D NM_003482:exon31:c.7061delC:p.P2354fs Frameshift deletion cancer gene census tissue EC6 chr12:49416531 C T KMT2D NM_003482:exon51:c.G16180A:p.E5394K Missense Mutation cancer gene census COSM6697373 tissue EC6 chr12:49443773 T G KMT2D NM_003482:exon11:c.A3598C:p.I1200L Missense Mutation cancer gene census tissue EC6 chr12:49445979 G A KMT2D NM_003482:exon10:c.C1487T:p.P496L Missense Mutation cancer gene census tissue EC6 chr18:60985815 C T BCL2 NM_000633exon2c.G85Ap.E29K Missense Mutation cancer gene census COSM6208879 tissue EC6 chr12:111884639 T G SH2B3 NM_005475exon3c.T815Gp.L272R Missense Mutation cancer gene census tissue EC6 chr3:9066993 G A SRGAP3 NM_014850exon14c.C1630Tp.P544S Missense Mutation cancer gene census tissue EC6 chr17:40368040 C T STAT5B NM_012448:exon12:c.G1465A:p.A489T Missense Mutation cancer gene census tissue EC6 chrX:152821599 C CA ATP2B3 NM_001001344:exon12:c.2152dupA:p.A717fs Frameshift insertion cancer gene census tissue EC6 chr3:77617566 C T ROBO2 NM_002942exon13c.C1952Tp.T651M Missense Mutation cancer gene census tissue EC6 chr6:29911930 CA TG HLA-A NM_001242758:exon4:c.651_652TG In Frame Substitution cancer gene census tissue EC6 chr17:57743854 T A CLTC NM_004859exon12c.T1796Ap.I599N Missense Mutation cancer gene census tissue EC6 chr11:85979507 T G EED NM_001308007exon9c.T870Gp.I290M Missense Mutation cancer gene census tissue EC6 chr4:187630350 T G FAT1 NM_005245:exon2:c.A632C:p.D211A Missense Mutation cancer gene census tissue EC6 chr5:67588131 G T PIK3R1 NM_181523exon8c.G961Tp.G321C Missense Mutation cancer gene census, Westin et al. , Shukla et al. COSM4714457 tissue EC6 chr5:67591091 C A PIK3R1 NM_181523exon13c.C1684Ap.R562S Missense Mutation cancer gene census, Westin et al. , Shukla et al. tissue EC6 chr5:67591106 A G PIK3R1 NM_181523exon13c.A1699Gp.K567E Missense Mutation cancer gene census, Westin et al. , Shukla et al. COSM1069611 tissue EC6 chr4:126238303 A AC FAT4 NM_001291285:exon1:c.738dupC:p.N246fs Frameshift insertion cancer gene census tissue EC6 chr4:126241549 T G FAT4 NM_001291285exon1c.T3983Gp.M1328R Missense Mutation cancer gene census tissue EC6 chr17:56448296 GC G RNF43 NM_001305544:exon3:c.350delG:p.R117fs Frameshift deletion cancer gene census tissue EC6 chr17:56435160 AC A RNF43 NM_001305545:exon8:c.1595delG:p.G532fs Frameshift deletion cancer gene census tissue EC6 chr17:56448298 G T RNF43 NM_001305544exon3c.C349Ap.R117S Missense Mutation cancer gene census COSM5470718 tissue EC6 chr7:13935606 C T ETV1 NM_001163151:exon9:c.G1145A:p.R382H Missense Mutation cancer gene census COSM6914075 tissue EC6 chr6:138200392 A G TNFAIP3 NM_001270507exon7c.A1810Gp.T604A Missense Mutation cancer gene census tissue EC6 chrX:66941805 A C AR NM_000044exon6c.A2449Cp.I817L Missense Mutation cancer gene census tissue EC6 chr12:124819118 T G NCOR2 NM_001077261:exon42:c.A6427C:p.S2143R Missense Mutation cancer gene census tissue EC6 chr12:124841250 C CG NCOR2 NM_001077261:exon24:c.3148dupC:p.R1050fs Frameshift insertion cancer gene census tissue EC6 chr12:124846815 CG C NCOR2 NM_001077261:exon23:c.2902delC:p.R968fs Frameshift deletion cancer gene census tissue EC6 chr17:15989648 GT G NCOR1 NM_001190440:exon22:c.3172delA:p.T1058fs Frameshift deletion cancer gene census tissue EC6 chr5:31410867 G A DROSHA NM_013235exon30c.C3653Tp.A1218V Missense Mutation cancer gene census COSM1436988 tissue EC6 chr12:66346195 T.A. T HMGA2 NM_001300918:exon5:c.343delA:p.K115fs Frameshift deletion cancer gene census tissue EC6 chr4:55962435 T G KDR NM_002253:exon19:c.A2689C:p.N897H Missense Mutation cancer gene census tissue EC6 chr19:42778293 AC A CIC NM_001304815:exon2:c.2359delC:p.P787fs Frameshift deletion cancer gene census tissue EC6 chr11:71746964 GC G NUMA1 NM_006185:exon3:c.25delG:p.A9fs Frameshift deletion cancer gene census tissue EC6 chr13:21555712 C A LATS2 NM_014572:exon6:c.G2558T:p.R853M Missense Mutation cancer gene census tissue EC6 chr13:21619864 C T LATS2 NM_014572:exon2:c.G302A:p.R101Q Missense Mutation cancer gene census tissue EC6 chrX:129201444 G A ELF4 NM_001127197exon9c.C1244Tp.S415L Missense Mutation cancer gene census tissue EC6 chr2:141072619 A C LRP1B NM_018557:exon83:c.T12690G:p.N4230K Missense Mutation cancer gene census tissue EC6 chr12:57864217 TC T GLI1 NM_001160045:exon10:c.1311delC:p.F437fs Frameshift deletion cancer gene census tissue EC6 chr22:39631853 A C PDGFB NM_002608:exon2:c.T90G:p.Y30X Nonsense Mutation cancer gene census tissue EC6 chr9:117819482 C T TNC NM_002160:exon15:c.G4529A:p.G1510E Missense Mutation cancer gene census tissue EC6 chr22:19196590 G T CLTCL1 NM_001835exon21c.C3284Ap.A1095E Missense Mutation cancer gene census}

^{tissue EC6 chr7:6438326 C T RAC1 NM_018890:exon4:c.C259T:p.R87W Missense Mutation cancer gene census tissue EC6 chr8:41801276 G A KAT6A NM_001305878exon13c.C2218Tp.R740C Missense Mutation cancer gene census COSM8640280 tissue EC6 chr1:198718573 T G PTPRC NM_002838exon28c.T2967Gp.H989Q Missense Mutation cancer gene census tissue EC6 chr17:66547263 T G PRKAR1A NM_001276290:exon10:c.T1012G:p.X338E Nonsense Mutation cancer gene census plasma EC3 chr7:33014363 A G FKBP9 NM_001284341exon3c.A515Gp.N172S Missense Mutation cancer gene census COSM6391782 plasma EC3 chr11:3724044 G A NUP98 NM_016320exon23c.C3161Tp.P1054L Missense Mutation cancer gene census COSM1703358 plasma EC3 chr16:2090185 G C NTHL1 NM_001318193:exon4:c.C569G:p.A190G Missense Mutation cancer gene census plasma EC3 chrX:153599258 A T FLNA NM_001110556exon2c.T356Ap.I119N Missense Mutation cancer gene census plasma EC3 chr16:15818572 C T MYH11 NM_001040113exon31c.G4069Ap.D1357N Missense Mutation cancer gene census plasma EC3 chr16:15853440 A T MYH11 NM_001040113exon13c.T1415Ap.I472N Missense Mutation cancer gene census plasma EC3 chr16:15931991 G A MYH11 NM_001040113exon2c.C119Tp.S40L Missense Mutation cancer gene census plasma EC3 chr2:74590423 T G DCTN1 NM_004082exon28c.A3343Cp.K1115Q Missense Mutation cancer gene census plasma EC3 chr2:74596575 C T DCTN1 NM_004082exon14c.G1436Ap.R479H Missense Mutation cancer gene census plasma EC3 chr16:3786740 G T CREBBP NM_001079846:exon26:c.C4357A:p.Q1453K Missense Mutation cancer gene census COSM166408 plasma EC3 chr21:34400054 G C OLIG2 NM_005806:exon2:c.G884C:p.C295S Missense Mutation cancer gene census plasma EC3 chr11:17742958 G A MYOD1 NM_002478:exon3:c.G866A:p.S289N Missense Mutation cancer gene census COSM4750575 plasma EC3 chr4:40154523 G T N4BP2 NM_018177exon17c.G5267Tp.R1756M Missense Mutation cancer gene census plasma EC3 chr14:92477378 C G TRIP11 NM_004239exon9c.G1266Cp.M422I Missense Mutation cancer gene census plasma EC3 chr3:13649626 C A FBLN2 NM_001004019exon3c.C1371Ap.D457E Missense Mutation cancer gene census plasma EC3 chr2:45233332 T G SIX2 NM_016932:exon2:c.A853C:p.N285H Missense Mutation cancer gene census plasma EC3 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. plasma EC3 chr1:18023759 T A ARHGEF10L NM_018125exon29c.T3724Ap.S1242T Missense Mutation cancer gene census plasma EC3 chr2:16082662 G A MYCN NM_001293228exon2c.G476Ap.G159D Missense Mutation cancer gene census plasma EC3 chr9:35074978 C CTAG FANCG NM_004629:exon12:c.1581_1582insCTA:p.G528delinsLG In Frame insertion cancer gene census plasma EC3 chr9:35074980 C CCCCTGCCACCCTGGCTTGGACAGCACTGGCTCTCGG FANCG NM_004629:exon12:c.1579_1580insCCGGAGGCCAGTGCTGTCCAAGCCAGGGTGGCAGGG:p.S527delinsTGGQCCPSQGGRG In Frame insertion cancer gene census plasma EC3 chr19:10602430 G A KEAP1 NM_012289exon3c.C1148Tp.S383L Missense Mutation cancer gene census plasma EC3 chr20:62165648 G A PTK6 NM_005975exon3c.C373Tp.R125W Missense Mutation cancer gene census plasma EC3 chr19:33793191 C A CEBPA NM_004364exon1c.G130Tp.A44S Missense Mutation cancer gene census plasma EC3 chr17:63526196 A C AXIN2 NM_004655exon11c.T2430Gp.D810E Missense Mutation cancer gene census plasma EC3 chrX:70356306 C CT MED12 NM_005120:exon37:c.5201_5202insT:p.P1734fs Frameshift insertion cancer gene census plasma EC3 chr16:24166128 C T PRKCB NM_002738exon10c.C1189Tp.P397S Missense Mutation cancer gene census plasma EC3 chr1:156105818 C T LMNA NM_001257374:exon6:c.C727T:p.Q243X Nonsense Mutation cancer gene census plasma EC3 chr2:79750430 G A CTNNA2 NM_001282598:exon1:c.G92A:p.G31D Missense Mutation cancer gene census plasma EC3 chr17:37881632 AC A ERBB2 NM_001289937:exon22:c.2703delC:p.H901fs Frameshift deletion cancer gene census plasma EC3 chr9:139396737 A G NOTCH1 NM_017617:exon28:c.T5371C:p.S1791P Missense Mutation cancer gene census plasma EC3 chr1:120468270 T A NOTCH2 NM_024408:exon25:c.A4169T:p.H1390L Missense Mutation cancer gene census plasma EC3 chr17:41243706 T G BRCA1 NM_007294exon10c.A3842Cp.Q1281P Missense Mutation cancer gene census plasma EC3 chr15:90634824 A C IDH2 NM_002168exon2c.T168Gp.D56E Missense Mutation cancer gene census plasma EC3 chr15:52611411 T G MYO5A NM_001142495:exon37:c.A4924C:p.N1642H Missense Mutation cancer gene census plasma EC3 chr14:62193512 G A HIF1A NM_001243084exon5c.G618Ap.M206I Missense Mutation cancer gene census plasma EC3 chr1:2160731 C T SKI NM_003036:exon1:c.C526T:p.L176F Missense Mutation cancer gene census plasma EC3 chr1:2160737 AC TT SKI NM_003036:exon1:c.532_533TT In Frame Substitution cancer gene census plasma EC3 chr2:198272827 CAT C SF3B1 NM_012433:exon9:c.1132_1133del:p.M378fs Frameshift deletion cancer gene census plasma EC3 chr2:198272831 C CAGGGGGG SF3B1 NM_012433:exon9:c.1129_1130insCCCCCT:p.S377delinsTPC In Frame insertion cancer gene census plasma EC3 chr2:198272802 G A SF3B1 NM_012433:exon9:c.C1159T:p.R387W Missense Mutation cancer gene census COSM247272 plasma EC3 chr20:50405642 G T SALL4 NM_020436exon3c.C2500Ap.P834T Missense Mutation cancer gene census plasma EC3 chr6:108986035 T A FOXO3 NM_001455exon2c.T1999Ap.S667T Missense Mutation cancer gene census plasma EC3 chr7:151945228 G A KMT2C NM_170606:exon14:c.C2291T:p.S764F Missense Mutation cancer gene census COSM5941288 plasma EC3 chr7:151962265 C T KMT2C NM_170606:exon8:c.G1042A:p.D348N Missense Mutation cancer gene census COSM228110 plasma EC3 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 plasma EC3 chr7:151962294 G A KMT2C NM_170606:exon8:c.C1013T:p.S338L Missense Mutation cancer gene census COSM6056929 plasma EC3 chr1:147095701 G T BCL9 NM_004326:exon10:c.G3222T:p.M1074I Missense Mutation cancer gene census plasma EC3 chr3:187446222 C A BCL6 NM_001134738exon5c.G1466Tp.C489F Missense Mutation cancer gene census plasma EC3 chr14:105239704 TGA T AKT1 NM_001014431:exon10:c.839_840del:p.L280fs Frameshift deletion cancer gene census, Westin et al. plasma EC3 chr11:92087428 C T FAT3 NM_001008781exon1c.C2150Tp.S717L Missense Mutation cancer gene census COSM7746759 plasma EC3 chr6:29911239 TT CA HLA-A NM_001242758:exon3:c.538_539CA In Frame Substitution cancer gene census plasma EC3 chr15:93524619 C T CHD2 NM_001271:exon24:c.C2998T:p.R1000W Missense Mutation cancer gene census COSM1493539 plasma EC3 chr22:28193516 T G MN1 NM_002430:exon1:c.A3016C:p.T1006P Missense Mutation cancer gene census plasma EC3 chr7:124532340 G A POT1 NM_015450:exon6:c.C104T:p.P35L Missense Mutation cancer gene census COSM6752781 plasma EC3 chr19:18562379 A C ELL NM_006532:exon7:c.T949G:p.S317A Missense Mutation cancer gene census plasma EC3 chr15:91428796 T A FES NM_001143784exon2c.T368Ap.L123Q Missense Mutation cancer gene census plasma EC3 chr14:95579451 G T DICER1 NM_001195573:exon11:c.C2018A:p.S673X Nonsense Mutation cancer gene census plasma EC3 chr5:170737237 C G TLX3 NM_021025:exon2:c.C505G:p.P169A Missense Mutation cancer gene census plasma EC3 chr22:19222144 G A CLTCL1 NM_001835exon7c.C1055Tp.A352V Missense Mutation cancer gene census plasma EC3 chr22:19175234 T C CLTCL1 NM_007098:exon29:c.A4441G:p.R1481G Missense Mutation cancer gene census plasma EC3 chr8:41834811 G T KAT6A NM_001305878exon7c.C1078Ap.P360T Missense Mutation cancer gene census plasma EC3 chr6:159188460 C G EZR NM_003379exon12c.G1429Cp.V477L Missense Mutation cancer gene census plasma EC3 chr5:236619 T C SDHA NM_001330758exon10c.T1337Cp.V446A Missense Mutation cancer gene census COSM5071098 plasma EC3 chr5:236628 C T SDHA NM_001330758exon10c.C1346Tp.A449V Missense Mutation cancer gene census COSM3734016 plasma EC3 chr5:236649 C T SDHA NM_001330758exon10c.C1367Tp.S456L Missense Mutation cancer gene census COSM3774177 plasma EC3 chr5:236676 G A SDHA NM_001330758exon10c.G1394Ap.R465Q Missense Mutation cancer gene census COSM5468136 plasma EC3 chr5:236678 G A SDHA NM_001330758exon10c.G1396Ap.A466T Missense Mutation cancer gene census COSM3947404 plasma EC3 chr5:236681 T A SDHA NM_001330758exon10c.T1399Ap.C467S Missense Mutation cancer gene census plasma EC5 chr7:33044951 C G FKBP9 NM_001284341exon11c.C1860Gp.H620Q Missense Mutation cancer gene census COSM5000147 plasma EC5 chr7:86416326 A C GRM3 NM_000840exon3c.A1218Cp.K406N Missense Mutation cancer gene census plasma EC5 chr6:134583262 T A SGK1 NM_001143676:exon2:c.A94T:p.M32L Missense Mutation cancer gene census COSM3174439 plasma EC5 chr11:119155706 A G CBL NM_005188:exon10:c.A1459G:p.M487V Missense Mutation cancer gene census plasma EC5 chr6:106553683 A C PRDM1 NM_001198exon5c.A1648Cp.I550L Missense Mutation cancer gene census plasma EC5 chr12:133202740 C T POLE NM_006231:exon46:c.G6494A:p.R2165H Missense Mutation cancer gene census plasma EC5 chr12:133220098 CCA C POLE NM_006231:exon34:c.4337_4338del:p.V1446fs Frameshift deletion cancer gene census plasma EC5 chr9:135801087 C T TSC1 NM_000368exon5c.G250Ap.A84T Missense Mutation cancer gene census COSM3212863 plasma EC5 chr1:110882196 C T RBM15 NM_001201545exon1c.C169Tp.R57C Missense Mutation cancer gene census plasma EC5 chr1:153430424 A G S100A7 NM_002963:exon3:c.T164C:p.L55P Missense Mutation cancer gene census plasma EC5 chr1:116926683 TAAAAAAGGGC T ATP1A1 NM_000701:exon2:c.61_69del:p.21_23del In Frame deletion cancer gene census plasma EC5 chr3:70014199 C A MITF NM_001354604exon10c.C1381Ap.L461I Missense Mutation cancer gene census plasma EC5 chr9:96021712 CGCTGCCCCCTCAACCTGTGTTGCCCCCGCAACCCACACGGCCCCTCAACCTGTGCTGCCCCCGCAACCCAT C WNK2 NM_001282394:exon11:c.2883_2954del:p.961_985del In Frame deletion cancer gene census plasma EC5 chr9:96055338 A G WNK2 NM_001282394exon23c.A5702Gp.K1901R Missense Mutation cancer gene census}

^{plasma EC5 chr5:159507764 C T PWWP2A NM_052927:exon3:c.G1563A:p.W521X Nonsense Mutation cancer gene census plasma EC5 chr14:35272067 A C BAZ1A NM_013448exon7c.T854Gp.I285S Missense Mutation cancer gene census plasma EC5 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. plasma EC5 chr20:50048687 G A NFATC2 NM_012340exon9c.C2639Tp.P880L Missense Mutation cancer gene census plasma EC5 chr2:16080794 A ACCCCCCCCCC MYCN NM_001293231:exon1:c.86_87insCCCCCCCCCC:p.H29fs Frameshift insertion cancer gene census plasma EC5 chr2:16080800 G C MYCN NM_001293231:exon1:c.G92C:p.R31P Missense Mutation cancer gene census plasma EC5 chr5:149515232 C T PDGFRB NM_002609exon3c.G250Ap.V84M Missense Mutation cancer gene census COSM205993 plasma EC5 chr13:28674628 T C FLT3 NM_004119:exon1:c.A20G:p.D7G Missense Mutation cancer gene census COSM4147677 plasma EC5 chr10:875437 G A LARP4B NM_001351277exon11c.C1013Tp.A338V Missense Mutation cancer gene census plasma EC5 chr10:70406293 A C TET1 NM_030625:exon4:c.A3807C:p.K1269N Missense Mutation cancer gene census COSM6920533 plasma EC5 chr3:100467292 C T T.F.G. NM_001007565exon8c.C1120Tp.P374S Missense Mutation cancer gene census COSM7190700 plasma EC5 chr20:62164944 C G PTK6 NM_005975:exon4:c.G630C:p.W210C Missense Mutation cancer gene census COSM7482943 plasma EC5 chrX:125299685 G C DCAF12L2 NM_001013628:exon1:c.C223G:p.L75V Missense Mutation cancer gene census plasma EC5 chr1:47717238 G A STIL NM_001048166exon17c.C3437Tp.A1146V Missense Mutation cancer gene census COSM4592384 plasma EC5 chr9:98209526 G A PTCH1 NM_000264exon23c.C4012Tp.R1338C Missense Mutation cancer gene census COSM8805094 plasma EC5 chr7:143054020 C T FAM131B NM_001031690exon7c.G706Ap.D236N Missense Mutation cancer gene census plasma EC5 chr11:95712488 A G MAML2 NM_032427:exon5:c.T3095C:p.M1032T Missense Mutation cancer gene census plasma EC5 chr1:144863438 G T PDE4DIP NM_001350520:exon33:c.C6451A:p.Q2151K Missense Mutation cancer gene census COSM1472513 plasma EC5 chr1:145021150 T C PDE4DIP NM_001350521exon2c.A251Gp.D84G Missense Mutation cancer gene census plasma EC5 chr6:117622231 G T ROS1 NM_002944:exon42:c.C6639A:p.D2213E Missense Mutation cancer gene census COSM3157630 plasma EC5 chr1:19062429 G A PAX7 NM_002584exon8c.G1459Ap.A487T Missense Mutation cancer gene census plasma EC5 chr1:156834527 G A NTRK1 NM_001012331exon3c.G295Ap.V99M Missense Mutation cancer gene census COSM5429038 plasma EC5 chr12:122481882 C T BCL7A NM_001024808exon4c.C362Tp.S121L Missense Mutation cancer gene census plasma EC5 chr17:5036210 TC GT USP6 NM_004505:exon5:c.201_202GT In Frame Substitution cancer gene census plasma EC5 chr17:5036205 A C USP6 NM_004505exon5c.A196Cp.K66Q Missense Mutation cancer gene census COSM1610489 plasma EC5 chr17:5036214 C T USP6 NM_004505exon5c.C205Tp.R69W Missense Mutation cancer gene census COSM4130411 plasma EC5 chr17:5036823 T C USP6 NM_004505exon6c.T362Cp.L121S Missense Mutation cancer gene census COSM4591808 plasma EC5 chr17:5036834 G A USP6 NM_004505exon6c.G373Ap.G125R Missense Mutation cancer gene census COSM4591349 plasma EC5 chr17:5036838 G A USP6 NM_004505exon6c.G377Ap.R126K Missense Mutation cancer gene census COSM4591351 plasma EC5 chr17:5036843 C A USP6 NM_004505exon6c.C382Ap.Q128K Missense Mutation cancer gene census COSM4590856 plasma EC5 chr20:57428893 T C GNAS NM_001077490:exon1:c.T386C:p.L129P Missense Mutation cancer gene census plasma EC5 chr6:108985176 T TG FOXO3 NM_001455:exon2:c.1141dupG:p.D380fs Frameshift insertion cancer gene census plasma EC5 chr7:26236637 C CCTCTCTTG HNRNPA2B1 NM_002137:exon4:c.264_265insCAAGAGAG:p.E89fs Frameshift insertion cancer gene census plasma EC5 chr8:57079092 T C PLAG1 NM_001114634exon4c.A1213Gp.I405V Missense Mutation cancer gene census COSM95020 plasma EC5 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 plasma EC5 chr12:49426905 TTGC T KMT2D NM_003482:exon39:c.11580_11582del:p.3860_3861del In Frame deletion cancer gene census plasma EC5 chr11:92495293 C A FAT3 NM_001008781exon4c.C3941Ap.S1314Y Missense Mutation cancer gene census COSM4683589 plasma EC5 chr6:29911114 GG AC HLA-A NM_001242758:exon3:c.413_414AC In Frame Substitution cancer gene census plasma EC5 chr6:29911227 GA TG HLA-A NM_001242758:exon3:c.526_527TG In Frame Substitution cancer gene census plasma EC5 chr6:29911239 TT CA HLA-A NM_001242758:exon3:c.538_539CA In Frame Substitution cancer gene census plasma EC5 chr6:29911260 AC CG HLA-A NM_001242758:exon3:c.559_560CG In Frame Substitution cancer gene census plasma EC5 chr20:31021530 T C ASXL1 NM_015338exon11c.T1529Cp.L510P Missense Mutation cancer gene census plasma EC5 chr6:41658829 TTGC T TFEB NM_001167827:exon2:c.162_164del:p.54_55del In Frame deletion cancer gene census plasma EC5 chr4:126328128 C T FAT4 NM_001291285exon3c.C5401Tp.R1801W Missense Mutation cancer gene census COSM3009350 plasma EC5 chr12:7061231 A G PTPN6 NM_002831exon3c.A217Gp.T73A Missense Mutation cancer gene census plasma EC5 chr2:219846852 C T FEV NM_017521:exon3:c.G254A:p.R85Q Missense Mutation cancer gene census plasma EC5 chr19:42777340 C G CIC NM_001304815:exon2:c.C1405G:p.R469G Missense Mutation cancer gene census plasma EC5 chr19:42796979 C T CIC NM_015125exon14c.C3437Tp.P1146L Missense Mutation cancer gene census COSM3287150 plasma EC5 chr2:141092084 T G LRP1B NM_018557:exon79:c.A12161C:p.E4054A Missense Mutation cancer gene census COSM5019250 plasma EC5 chr22:30090766 G A NF2 NM_181833:exon5:c.G473A:p.R158Q Missense Mutation cancer gene census COSM6977928 plasma EC5 chr9:117849420 C T TNC NM_002160:exon3:c.G590A:p.R197Q Missense Mutation cancer gene census COSM3321507 plasma EC5 chr6:128388740 TGGTA T PTPRK NM_001291983:exon11:c.1690_1693del:p.Y564fs Frameshift deletion cancer gene census plasma EC5 chr7:140534534 T C BRAF NM_001354609exon3c.A379Gp.S127G Missense Mutation cancer gene census plasma EC5 chr5:256483 CTT C SDHA NM_001330758:exon13:c.1701_1702del:p.T567fs Frameshift deletion cancer gene census plasma EC2 chr22:29445818 ACAG A ZNRF3 NM_001206998:exon8:c.1650_1652del:p.550_551del In Frame deletion cancer gene census plasma EC2 chr12:133220098 CCA C POLE NM_006231:exon34:c.4337_4338del:p.V1446fs Frameshift deletion cancer gene census plasma EC2 chr2:74593447 A C DCTN1 NM_004082exon23c.T2684Gp.I895S Missense Mutation cancer gene census COSM7189297 plasma EC2 chr19:54651895 A C CNOT3 NM_014516:exon11:c.A907C:p.N303H Missense Mutation cancer gene census plasma EC2 chr9:96051373 TGCAG T WNK2 NM_006648:exon19:c.4338_4341del:p.V1446fs Frameshift deletion cancer gene census plasma EC2 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. plasma EC2 chr17:9820616 C T GAS7 NM_201433exon14c.G1360Ap.A454T Missense Mutation cancer gene census plasma EC2 chr2:128046943 CTCT C ERCC3 NM_000122:exon6:c.789_791del:p.263_264del In Frame deletion cancer gene census plasma EC2 chr7:2968278 T G CARD11 NM_032415exon13c.A1708Cp.N570H Missense Mutation cancer gene census plasma EC2 chr1:120458550 A C NOTCH2 NM_024408:exon34:c.T6795G:p.N2265K Missense Mutation cancer gene census plasma EC2 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census plasma EC2 chr10:114925408 T A TCF7L2 NM_001367943exon15c.T1537Ap.S513T Missense Mutation cancer gene census plasma EC2 chr6:33289620 A T DAXX NM_001141969exon2c.T83Ap.L28H Missense Mutation cancer gene census plasma EC2 chr6:33289630 A T DAXX NM_001141969exon2c.T73Ap.S25T Missense Mutation cancer gene census plasma EC2 chr1:162725072 C A DDR2 NM_001354982exon6c.C544Ap.L182I Missense Mutation cancer gene census plasma EC2 chr17:5280459 C T RABEP1 NM_001083585exon14c.C2074Tp.R692W Missense Mutation cancer gene census plasma EC2 chr1:47691538 T G TAL1 NM_001287347exon3c.A23Cp.E8A Missense Mutation cancer gene census plasma EC2 chr1:47691542 T G TAL1 NM_001287347exon3c.A19Cp.S7R Missense Mutation cancer gene census plasma EC2 chr17:5036249 G T USP6 NM_004505exon5c.G240Tp.M80I Missense Mutation cancer gene census COSM4598023 plasma EC2 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 plasma EC2 chr7:151970859 C A KMT2C NM_170606:exon7:c.G943T:p.G315C Missense Mutation cancer gene census COSM4381930 plasma EC2 chr1:14107511 C A PRDM2 NM_012231exon8c.C3221Ap.S1074Y Missense Mutation cancer gene census plasma EC2 chr12:49425065 T G KMT2D NM_003482:exon39:c.A13423C:p.S4475R Missense Mutation cancer gene census plasma EC2 chr2:202149738 T G CASP8 NM_033356:exon7:c.T957G:p.Y319X Nonsense Mutation cancer gene census plasma EC2 chr11:92565085 C T FAT3 NM_001008781exon13c.C9779Tp.A3260V Missense Mutation cancer gene census plasma EC2 chr8:101721705 G T PABPC1 NM_002568:exon8:c.C1227A:p.F409L Missense Mutation cancer gene census COSM3269226 plasma EC2 chr8:101721709 T A PABPC1 NM_002568:exon8:c.A1223T:p.Y408F Missense Mutation cancer gene census COSM3774310 plasma EC2 chr22:40817008 T G MRTFA NM_001282660exon7c.A724Cp.I242L Missense Mutation cancer gene census plasma EC2 chr22:40817010 T G MRTFA NM_001282660exon7c.A722Cp.Y241S Missense Mutation cancer gene census plasma EC2 chr22:40816886 GTGC G MRTFA NM_001282660:exon7:c.843_845del:p.281_282del In Frame deletion cancer gene census plasma EC2 chr15:74290760 G A PML NM_002675exon2c.G545Ap.R182H Missense Mutation cancer gene census}

^{plasma EC2 chr19:18562379 A C ELL NM_006532:exon7:c.T949G:p.S317A Missense Mutation cancer gene census plasma EC2 chr14:99642092 TGGCG T BCL11B NM_001282238:exon3:c.861_864del:p.P287fs Frameshift deletion cancer gene census plasma EC2 chr5:170738472 C A TLX3 NM_021025:exon3:c.C745A:p.Q249K Missense Mutation cancer gene census plasma EC2 chr2:141356360 A C LRP1B NM_018557:exon43:c.T7034G:p.M2345R Missense Mutation cancer gene census plasma EC2 chr6:37141724 A C PIM1 NM_002648exon6c.A799Cp.I267L Missense Mutation cancer gene census plasma EC2 chr5:236642 G A SDHA NM_001330758exon10c.G1360Ap.A454T Missense Mutation cancer gene census plasma EC2 chr5:256483 CTT C SDHA NM_001330758:exon13:c.1701_1702del:p.T567fs Frameshift deletion cancer gene census plasma EC6 chr5:38523672 T G LIFR NM_001127671exon5c.A410Cp.D137A Missense Mutation cancer gene census plasma EC6 chr3:30713527 T G TGFBR2 NM_003242:exon4:c.T852G:p.Y284X Nonsense Mutation cancer gene census plasma EC6 chr1:11300497 TT GG MTOR NM_004958:exon11:c.1648_1649CC In Frame Substitution cancer gene census plasma EC6 chr2:61118934 AA CC REL NM_001291746:exon2:c.127_128CC In Frame Substitution cancer gene census plasma EC6 chr2:61118937 AA CC REL NM_001291746:exon2:c.130_131CC In Frame Substitution cancer gene census plasma EC6 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 plasma EC6 chr4:54319247 C.A.G. C FIP1L1 NM_001134938:exon13:c.1225_1226del:p.R409fs Frameshift deletion cancer gene census plasma EC6 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. plasma EC6 chr2:128016991 C G ERCC3 NM_000122exon14c.G2098Cp.D700H Missense Mutation cancer gene census plasma EC6 chr3:53529192 GGAT G CACNA1D NM_001128839:wholegene Frameshift deletion cancer gene census plasma EC6 chr2:100210325 C T AFF3 NM_001025108exon14c.G1873Ap.A625T Missense Mutation cancer gene census plasma EC6 chr2:113977684 T G PAX8 NM_003466:exon11:c.A1261C:p.N421H Missense Mutation cancer gene census plasma EC6 chr6:108985176 T TG FOXO3 NM_001455:exon2:c.1141dupG:p.D380fs Frameshift insertion cancer gene census plasma EC6 chr7:151945228 G A KMT2C NM_170606:exon14:c.C2291T:p.S764F Missense Mutation cancer gene census COSM5941288 plasma EC6 chr7:151962168 C A KMT2C NM_170606:exon8:c.G1139T:p.R380L Missense Mutation cancer gene census COSM225885 plasma EC6 chr7:151962265 C T KMT2C NM_170606:exon8:c.G1042A:p.D348N Missense Mutation cancer gene census COSM228110 plasma EC6 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 plasma EC6 chr7:151962294 G A KMT2C NM_170606:exon8:c.C1013T:p.S338L Missense Mutation cancer gene census COSM6056929 plasma EC6 chr7:151970859 C T KMT2C NM_170606:exon7:c.G943A:p.G315S Missense Mutation cancer gene census COSM1179668 plasma EC6 chr6:29911930 CA TG HLA-A NM_001242758:exon4:c.651_652TG In Frame Substitution cancer gene census plasma EC6 chr17:57743881 A C CLTC NM_004859exon12c.A1823Cp.Y608S Missense Mutation cancer gene census plasma EC6 chr17:57743884 A C CLTC NM_004859exon12c.A1826Cp.D609A Missense Mutation cancer gene census plasma EC6 chr8:17867065 G A PCM1 NM_001352652exon30c.G4972Ap.A1658T Missense Mutation cancer gene census COSM6407182 plasma EC6 chr6:159188460 C G EZR NM_003379exon12c.G1429Cp.V477L Missense Mutation cancer gene census plasma EC6 chr5:236649 C T SDHA NM_001330758exon10c.C1367Tp.S456L Missense Mutation cancer gene census COSM3774177 plasma EC6 chr5:236676 G A SDHA NM_001330758exon10c.G1394Ap.R465Q Missense Mutation cancer gene census COSM5468136 plasma EC6 chr5:236678 G A SDHA NM_001330758exon10c.G1396Ap.A466T Missense Mutation cancer gene census COSM3947404 plasma EC7 chr15:40498519 T G BUB1B NM_001211:exon15:c.T1869G:p.H623Q Missense Mutation cancer gene census plasma EC7 chr3:105404191 T G CBLB NM_001321788exon14c.A2174Cp.H725P Missense Mutation cancer gene census plasma EC7 chr11:120292526 C T ARHGEF12 NM_015313exon6c.C313Tp.R105W Missense Mutation cancer gene census plasma EC7 chr1:116916135 T G ATP1A1 NM_000701:exon1:c.T2G:p.M1R Missense Mutation cancer gene census plasma EC7 chr2:45233332 T G SIX2 NM_016932:exon2:c.A853C:p.N285H Missense Mutation cancer gene census plasma EC7 chr19:51380177 T G KLK2 NM_001002231exon4c.T543Gp.N181K Missense Mutation cancer gene census plasma EC7 chr1:27106861 C T ARID1A NM_006015:exon20:c.C6472T:p.R2158X Nonsense Mutation cancer gene census, Shukla et al. plasma EC7 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. plasma EC7 chr5:176720894 T G NSD1 NM_022455exon23c.T6525Gp.C2175W Missense Mutation cancer gene census plasma EC7 chr8:38162266 A C NSD3 NM_023034:exon14:c.T2450G:p.M817R Missense Mutation cancer gene census plasma EC7 chr5:180047694 A C FLT4 NM_001354989exon16c.T2321Gp.M774R Missense Mutation cancer gene census plasma EC7 chr3:168807852 TT GG MECOM NM_001163999:exon13:c.2748_2749CC In Frame Substitution cancer gene census plasma EC7 chr4:153332604 TCTC T FBXW7 NM_033632:exon2:c.349_351del:p.117_117del In Frame deletion cancer gene census, The Cancer Genome Atlas Research Network, Shukla et al. plasma EC7 chr2:128016991 C G ERCC3 NM_000122exon14c.G2098Cp.D700H Missense Mutation cancer gene census plasma EC7 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census plasma EC7 chr3:53529192 GGAT G CACNA1D NM_001128840:wholegene Frameshift deletion cancer gene census plasma EC7 chr16:88945846 C G CBFA2T3 NM_005187exon11c.G1494Cp.K498N Missense Mutation cancer gene census plasma EC7 chr10:32337433 T G KIF5B NM_004521:exon2:c.A173C:p.Q58P Missense Mutation cancer gene census plasma EC7 chr10:114925408 T A TCF7L2 NM_001367943exon15c.T1537Ap.S513T Missense Mutation cancer gene census plasma EC7 chr6:117724307 T G ROS1 NM_002944:exon6:c.A572C:p.H191P Missense Mutation cancer gene census plasma EC7 chr5:11110988 TTTC T CTNND2 NM_001288716:exon11:c.1431_1433del:p.477_478del In Frame deletion cancer gene census plasma EC7 chr22:23656786 C G BCR NM_004327exon22c.C3611Gp.A1204G Missense Mutation cancer gene census COSM3785508 plasma EC7 chr16:64982648 A C CDH11 NM_001308392:exon13:c.T1937G:p.M646R Missense Mutation cancer gene census plasma EC7 chr7:151962261 C T KMT2C NM_170606:exon8:c.G1046A:p.S349N Missense Mutation cancer gene census plasma EC7 chr7:151945225 T C KMT2C NM_170606:exon14:c.A2294G:p.E765G Missense Mutation cancer gene census COSM227525 plasma EC7 chr7:151962168 C A KMT2C NM_170606:exon8:c.G1139T:p.R380L Missense Mutation cancer gene census COSM225885 plasma EC7 chr7:151970859 C T KMT2C NM_170606:exon7:c.G943A:p.G315S Missense Mutation cancer gene census COSM1179668 plasma EC7 chr13:28537370 A C CDX2 NM_001354700:exon3:c.T820G:p.X274G Nonsense Mutation cancer gene census plasma EC7 chr11:118626986 C T DDX6 NM_001257191exon11c.G1157Ap.R386H Missense Mutation cancer gene census plasma EC7 chrX:53448866 T G SMC1A NM_001281463:exon2:c.A22C:p.T8P Missense Mutation cancer gene census plasma EC7 chr12:57111185 A T NACA NM_001365896:exon3:c.T4129A:p.S1377T Missense Mutation cancer gene census plasma EC7 chr4:55962435 T G KDR NM_002253:exon19:c.A2689C:p.N897H Missense Mutation cancer gene census plasma EC7 chr9:117783441 C T TNC NM_002160:exon28:c.G6601A:p.A2201T Missense Mutation cancer gene census COSM3413295 plasma EC7 chr5:236649 C T SDHA NM_001330758exon10c.C1367Tp.S456L Missense Mutation cancer gene census COSM3774177 plasma EC7 chr5:236676 G A SDHA NM_001330758exon10c.G1394Ap.R465Q Missense Mutation cancer gene census COSM5468136 plasma EC7 chr5:236678 G A SDHA NM_001330758exon10c.G1396Ap.A466T Missense Mutation cancer gene census COSM3947404 plasma EC7 chr17:66547263 T G PRKAR1A NM_001276290:exon10:c.T1012G:p.X338E Nonsense Mutation cancer gene census plasma EC8 chr3:105404191 T G CBLB NM_001321788exon14c.A2174Cp.H725P Missense Mutation cancer gene census plasma EC8 chr7:91632395 C A AKAP9 NM_005751:exon8:c.C3164A:p.S1055Y Missense Mutation cancer gene census COSM1092885 plasma EC8 chr18:42532072 A C SETBP1 NM_015559:exon4:c.A2767C:p.I923L Missense Mutation cancer gene census plasma EC8 chr2:96919780 ATGC A TMEM127 NM_001193304:exon4:c.480_482del:p.160_161del In Frame deletion cancer gene census plasma EC8 chr22:29445818 ACAG A ZNRF3 NM_001206998:exon8:c.1650_1652del:p.550_551del In Frame deletion cancer gene census plasma EC8 chrX:153585889 T G FLNA NM_001110556exon29c.A4858Cp.I1620L Missense Mutation cancer gene census plasma EC8 chrX:47044750 C T RBM10 NM_005676exon19c.C2150Tp.A717V Missense Mutation cancer gene census plasma EC8 chr1:3301736 T G PRDM16 NM_022114exon4c.T459Gp.S153R Missense Mutation cancer gene census plasma EC8 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 plasma EC8 chr12:121426812 G A HNF1A NM_000545exon2c.G503Ap.R168H Missense Mutation cancer gene census COSM6932592}

^{plasma EC8 chr8:42129620 T G IKBKB NM_001556:exon2:c.T2G:p.M1R Missense Mutation cancer gene census plasma EC8 chr3:13679138 A C FBLN2 NM_001004019exon18c.A3415Cp.N1139H Missense Mutation cancer gene census plasma EC8 chr2:45233332 T G SIX2 NM_016932:exon2:c.A853C:p.N285H Missense Mutation cancer gene census plasma EC8 chr8:118842485 A G EXT1 NM_000127:exon4:c.T1268C:p.V423A Missense Mutation cancer gene census plasma EC8 chr1:27094328 T G ARID1A NM_006015:exon11:c.T3036G:p.Y1012X Nonsense Mutation cancer gene census, Shukla et al. plasma EC8 chr5:149515211 T G PDGFRB NM_002609exon3c.A271Cp.T91P Missense Mutation cancer gene census plasma EC8 chr9:97876914 T G FANCC NM_000136exon12c.A1151Cp.H384P Missense Mutation cancer gene census plasma EC8 chr1:120458550 A C NOTCH2 NM_024408:exon34:c.T6795G:p.N2265K Missense Mutation cancer gene census plasma EC8 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census plasma EC8 chr2:237489743 T G ACKR3 NM_020311:exon2:c.T635G:p.M212R Missense Mutation cancer gene census plasma EC8 chr9:98238402 C T PTCH1 NM_000264exon12c.G1642Ap.V548M Missense Mutation cancer gene census COSM4631416 plasma EC8 chr5:56177773 T G MAP3K1 NM_005921:exon14:c.T2746G:p.C916G Missense Mutation cancer gene census plasma EC8 chr12:56478891 C T ERBB3 NM_001005915exon3c.C347Tp.A116V Missense Mutation cancer gene census plasma EC8 chr19:11172461 A C SMARCA4 NM_001128845:exon33:c.A4823C:p.D1608A Missense Mutation cancer gene census plasma EC8 chr6:33289620 A T DAXX NM_001141969exon2c.T83Ap.L28H Missense Mutation cancer gene census plasma EC8 chr5:132232823 T G AFF4 NM_014423:exon11:c.A1499C:p.Q500P Missense Mutation cancer gene census plasma EC8 chr6:117630032 T G ROS1 NM_002944:exon41:c.A6494C:p.H2165P Missense Mutation cancer gene census plasma EC8 chr5:11110988 TTTC T CTNND2 NM_001288716:exon11:c.1431_1433del:p.477_478del In Frame deletion cancer gene census plasma EC8 chr17:5036823 T C USP6 NM_004505exon6c.T362Cp.L121S Missense Mutation cancer gene census COSM4591808 plasma EC8 chr2:187534494 A C ITGAV NM_002210exon26c.A2659Cp.I887L Missense Mutation cancer gene census plasma EC8 chr7:151962148 C G KMT2C NM_170606:exon8:c.G1159C:p.E387Q Missense Mutation cancer gene census plasma EC8 chr7:151962168 C A KMT2C NM_170606:exon8:c.G1139T:p.R380L Missense Mutation cancer gene census COSM225885 plasma EC8 chr7:151962265 C T KMT2C NM_170606:exon8:c.G1042A:p.D348N Missense Mutation cancer gene census COSM228110 plasma EC8 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 plasma EC8 chr7:151962294 G A KMT2C NM_170606:exon8:c.C1013T:p.S338L Missense Mutation cancer gene census COSM6056929 plasma EC8 chr7:151970859 C A KMT2C NM_170606:exon7:c.G943T:p.G315C Missense Mutation cancer gene census COSM4381930 plasma EC8 chr7:151970859 C T KMT2C NM_170606:exon7:c.G943A:p.G315S Missense Mutation cancer gene census COSM1179668 plasma EC8 chr12:49427714 T G KMT2D NM_003482:exon39:c.A10774C:p.M3592L Missense Mutation cancer gene census plasma EC8 chr12:49443773 T G KMT2D NM_003482:exon11:c.A3598C:p.I1200L Missense Mutation cancer gene census plasma EC8 chr12:49445189 TGGCTCCTCAGGCCGGGGGGGACAGGGTGC T KMT2D NM_003482:exon10:c.2250_2276del:p.750_759del In Frame deletion cancer gene census plasma EC8 chr8:101721692 G A PABPC1 NM_002568:exon8:c.C1240T:p.P414S Missense Mutation cancer gene census COSM3367142 plasma EC8 chr12:6682339 T G CHD4 NM_001297553:exon37:c.A5437C:p.T1813P Missense Mutation cancer gene census plasma EC8 chr4:187539379 A C FAT1 NM_005245:exon10:c.T8361G:p.H2787Q Missense Mutation cancer gene census plasma EC8 chr12:124915300 T G NCOR2 NM_001077261exon11c.A916Cp.M306L Missense Mutation cancer gene census plasma EC8 chr19:18562379 A C ELL NM_006532:exon7:c.T949G:p.S317A Missense Mutation cancer gene census plasma EC8 chr22:39631853 A C PDGFB NM_002608:exon2:c.T90G:p.Y30X Nonsense Mutation cancer gene census plasma EC8 chr20:40790131 T G PTPRT NM_007050:exon17:c.A2543C:p.H848P Missense Mutation cancer gene census plasma EC8 chr17:66547263 T G PRKAR1A NM_001276290:exon10:c.T1012G:p.X338E Nonsense Mutation cancer gene census plasma EC9 chr11:64572158 G A MEN1 NM_000244exon10c.C1496Tp.P499L Missense Mutation cancer gene census plasma EC9 chr7:101892132 ACAG A CUX1 NM_001202543:exon24:c.4362_4364del:p.1454_1455del In Frame deletion cancer gene census plasma EC9 chr22:29445818 ACAG A ZNRF3 NM_001206998:exon8:c.1650_1652del:p.550_551del In Frame deletion cancer gene census plasma EC9 chr11:119149355 TATG T CBL NM_005188:exon9:c.1364_1366del:p.455_456del In Frame deletion cancer gene census plasma EC9 chrX:153585889 T G FLNA NM_001110556exon29c.A4858Cp.I1620L Missense Mutation cancer gene census plasma EC9 chr12:48367967 T G COL2A1 NM_001844exon53c.A4222Cp.K1408Q Missense Mutation cancer gene census plasma EC9 chr16:3789646 C T CREBBP NM_001079846:exon24:c.G4099A:p.V1367M Missense Mutation cancer gene census COSM1377832 plasma EC9 chr12:122817534 C A CLIP1 NM_001247997exon15c.G2867Tp.R956I Missense Mutation cancer gene census plasma EC9 chr19:54647477 A C CNOT3 NM_014516:exon5:c.A250C:p.I84L Missense Mutation cancer gene census COSM7350360 plasma EC9 chr9:96021668 ACAACCCACACTGCCCCCACAACCCGTGCTGCCCCCG A WNK2 NM_001282394:exon11:c.2839_2874del:p.947_958del In Frame deletion cancer gene census plasma EC9 chr2:45233332 T G SIX2 NM_016932:exon2:c.A853C:p.N285H Missense Mutation cancer gene census plasma EC9 chr1:27106925 GC G ARID1A NM_006015:exon20:c.6537delC:p.S2179fs Frameshift deletion cancer gene census, Shukla et al. plasma EC9 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. plasma EC9 chr2:16080808 G C MYCN NM_001293231:exon1:c.G100C:p.G34R Missense Mutation cancer gene census plasma EC9 chr2:16080817 G C MYCN NM_001293231:exon1:c.G109C:p.G37R Missense Mutation cancer gene census plasma EC9 chr16:72831015 TCTG T ZFHX3 NM_001164766:exon8:c.2821_2823del:p.941_941del In Frame deletion cancer gene census plasma EC9 chr9:131451874 G A SET NM_003011:exon1:c.G13A:p.A5T Missense Mutation cancer gene census plasma EC9 chr9:131451884 T C SET NM_003011:exon1:c.T23C:p.V8A Missense Mutation cancer gene census plasma EC9 chr7:20199290 T C MACC1 NM_182762:exon5:c.A694G:p.I232V Missense Mutation cancer gene census plasma EC9 chr14:56084852 G GAAAATGCTGAA KTN1 NM_001079521:exon4:c.832_833insAAAATGCTGAA:p.E278fs Frameshift insertion cancer gene census plasma EC9 chr20:62160889 TCAGGTCG T PTK6 NM_005975:exon8:c.1349_1355del:p.P450fs Frameshift deletion cancer gene census plasma EC9 chr17:63526196 A C AXIN2 NM_004655exon11c.T2430Gp.D810E Missense Mutation cancer gene census plasma EC9 chr2:61708416 A ATTCTTGTAGGTGAGGGAAGGCCGACTTAAGGAGATTAGC XPO1 NM_003400:exon24:c.2972_2973insGCTAATCTCCTTAAGTCGGCCTTCCCTCACCTACAAGA:p.D991fs Frameshift insertion cancer gene census plasma EC9 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census plasma EC9 chr9:123900883 C A CNTRL NM_007018exon14c.C2263Ap.L755I Missense Mutation cancer gene census plasma EC9 chr3:53769453 A C CACNA1D NM_000720exon21c.A2734Cp.I912L Missense Mutation cancer gene census plasma EC9 chr2:225371657 C T CUL3 NM_003590exon7c.G947Ap.C316Y Missense Mutation cancer gene census plasma EC9 chr17:41209124 A T BRCA1 NM_007297:exon18:c.T5081A:p.V1694D Missense Mutation cancer gene census plasma EC9 chr17:29663733 T G NF1 NM_001042492exon42c.T6228Gp.D2076E Missense Mutation cancer gene census plasma EC9 chr14:38060617 C T FOXA1 NM_004496:exon2:c.G1372A:p.A458T Missense Mutation cancer gene census plasma EC9 chr21:36164619 A C RUNX1 NM_001754exon9c.T1256Gp.V419G Missense Mutation cancer gene census COSM7346740 plasma EC9 chr21:36164623 T A RUNX1 NM_001754exon9c.A1252Tp.M418L Missense Mutation cancer gene census plasma EC9 chr15:91181742 C T CRTC3 NM_001042574exon12c.C1331Tp.P444L Missense Mutation cancer gene census plasma EC9 chr12:122252343 T A SETD1B NM_001353345:exon6:c.T2222A:p.I741N Missense Mutation cancer gene census plasma EC9 chr5:11110988 TTTC T CTNND2 NM_001288716:exon11:c.1431_1433del:p.477_478del In Frame deletion cancer gene census plasma EC9 chr17:38711737 T G CCR7 NM_001838exon3c.A394Cp.I132L Missense Mutation cancer gene census plasma EC9 chrX:129155009 G T BCORL1 NM_001184772exon4c.G3491Tp.R1164M Missense Mutation cancer gene census plasma EC9 chr17:5036249 G T USP6 NM_004505exon5c.G240Tp.M80I Missense Mutation cancer gene census COSM4598023 plasma EC9 chr17:5036823 T C USP6 NM_004505exon6c.T362Cp.L121S Missense Mutation cancer gene census COSM4591808 plasma EC9 chr17:5036834 G A USP6 NM_004505exon6c.G373Ap.G125R Missense Mutation cancer gene census COSM4591349 plasma EC9 chr17:5036838 G A USP6 NM_004505exon6c.G377Ap.R126K Missense Mutation cancer gene census COSM4591351 plasma EC9 chr17:5036843 C A USP6 NM_004505exon6c.C382Ap.Q128K Missense Mutation cancer gene census COSM4590856 plasma EC9 chrX:76939102 C T ATRX NM_000489exon9c.G1646Ap.S549N Missense Mutation cancer gene census plasma EC9 chr16:64982648 A C CDH11 NM_001308392:exon13:c.T1937G:p.M646R Missense Mutation cancer gene census plasma EC9 chr6:108882815 C A FOXO3 NM_001455exon1c.C404Ap.P135Q Missense Mutation cancer gene census plasma EC9 chr7:151970859 C A KMT2C NM_170606:exon7:c.G943T:p.G315C Missense Mutation cancer gene census COSM4381930 plasma EC9 chr12:49426905 TTGC T KMT2D NM_003482:exon39:c.11580_11582del:p.3860_3861del In Frame deletion cancer gene census plasma EC9 chr12:111856401 C T SH2B3 NM_005475:exon2:c.C452T:p.A151V Missense Mutation cancer gene census plasma EC9 chr5:142602010 A C ARHGAP26 NM_001349547:exon22:c.A2060C:p.X687S Nonsense Mutation cancer gene census plasma EC9 chr11:118630682 C A DDX6 NM_001257191exon8c.G813Tp.R271S Missense Mutation cancer gene census}

^{plasma EC9 chr6:29911239 TT CA HLA-A NM_001242758:exon3:c.538_539CA In Frame Substitution cancer gene census plasma EC9 chr15:93557953 G T CHD2 NM_001271:exon37:c.G4720T:p.G1574W Missense Mutation cancer gene census plasma EC9 chr5:67592163 C CTG PIK3R1 NM_001242466:exon8:c.890_891insTG:p.S297fs Frameshift insertion cancer gene census, Westin et al. , Shukla et al. plasma EC9 chrX:53407978 A C SMC1A NM_006306exon23c.T3468Gp.D1156E Missense Mutation cancer gene census plasma EC9 chr6:41658829 TTGC T TFEB NM_001167827:exon2:c.162_164del:p.54_55del In Frame deletion cancer gene census plasma EC9 chrX:37028333 A C FAM47C NM_001013736:exon1:c.A1850C:p.H617P Missense Mutation cancer gene census plasma EC9 chrX:37028716 C A FAM47C NM_001013736:exon1:c.C2233A:p.P745T Missense Mutation cancer gene census plasma EC9 chr5:31515295 G A DROSHA NM_013235exon7c.C1090Tp.R364C Missense Mutation cancer gene census COSM1067233 plasma EC9 chr4:48169957 G T TEC NM_003215:exon7:c.C509A:p.P170Q Missense Mutation cancer gene census plasma EC9 chr15:74287199 G C PML NM_002675exon1c.G46Cp.A16P Missense Mutation cancer gene census plasma EC9 chr15:74287203 G C PML NM_002675exon1c.G50Cp.R17P Missense Mutation cancer gene census plasma EC9 chr15:74287209 AG CC PML NM_002675:exon1:c.56_57CC In Frame Substitution cancer gene census plasma EC9 chr15:74287212 A T PML NM_002675exon1c.A59Tp.E20V Missense Mutation cancer gene census plasma EC9 chr15:74287217 A C PML NM_002675exon1c.A64Cp.T22P Missense Mutation cancer gene census plasma EC9 chr15:74287221 T A PML NM_002675exon1c.T68Ap.M23K Missense Mutation cancer gene census plasma EC9 chr15:74287255 GCCCAGC G PML NM_002675:exon1:c.103_108del:p.35_36del In Frame deletion cancer gene census plasma EC9 chrX:39921444 T C BCOR NM_001123385exon10c.A4376Gp.N1459S Missense Mutation cancer gene census plasma EC9 chr14:99641846 T G BCL11B NM_138576exon4c.A1327Cp.I443L Missense Mutation cancer gene census plasma EC9 chr1:201982155 T G ELF3 NM_001114309exon6c.T679Gp.F227V Missense Mutation cancer gene census plasma EC9 chr8:41812876 A C KAT6A NM_001305878exon9c.T1536Gp.I512M Missense Mutation cancer gene census plasma EC9 chr6:159188460 C G EZR NM_003379exon12c.G1429Cp.V477L Missense Mutation cancer gene census plasma EC9 chr5:236619 T C SDHA NM_001330758exon10c.T1337Cp.V446A Missense Mutation cancer gene census COSM5071098 plasma EC9 chr5:236628 C T SDHA NM_001330758exon10c.C1346Tp.A449V Missense Mutation cancer gene census COSM3734016 plasma EC9 chr5:236649 C T SDHA NM_001330758exon10c.C1367Tp.S456L Missense Mutation cancer gene census COSM3774177 plasma EC9 chr5:236676 G A SDHA NM_001330758exon10c.G1394Ap.R465Q Missense Mutation cancer gene census COSM5468136 plasma EC9 chr5:236678 G A SDHA NM_001330758exon10c.G1396Ap.A466T Missense Mutation cancer gene census COSM3947404 plasma EC9 chr17:66547263 T G PRKAR1A NM_001276290:exon10:c.T1012G:p.X338E Nonsense Mutation cancer gene census plasma EC4 chr3:178916725 C T PIK3CA NM_006218:exon2:c.C112T:p.R38C Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM744 plasma EC4 chr3:105404191 T G CBLB NM_001321788exon14c.A2174Cp.H725P Missense Mutation cancer gene census plasma EC4 chr3:128200673 T A GATA2 NM_001145662:exon5:c.A1090T:p.K364X Nonsense Mutation cancer gene census plasma EC4 chr16:2094737 G A NTHL1 NM_001318194:exon3:c.C89T:p.A30V Missense Mutation cancer gene census plasma EC4 chr16:67650770 G A CTCF NM_001363916exon5c.G1075Ap.A359T Missense Mutation cancer gene census, Shukla et al. COSM6637239 plasma EC4 chr16:67660556 C T CTCF NM_001191022:exon6:c.C472T:p.Q158X Nonsense Mutation cancer gene census, Shukla et al. plasma EC4 chr19:4363820 C T SH3GL1 NM_003025exon6c.G521Ap.R174Q Missense Mutation cancer gene census COSM3288658 plasma EC4 chr12:6787366 G A ZNF384 NM_001135734exon6c.C613Tp.P205S Missense Mutation cancer gene census plasma EC4 chr11:119144682 G A CBL NM_005188:exon4:c.G695A:p.C232Y Missense Mutation cancer gene census plasma EC4 chr3:121260261 G A POLQ NM_199420:exon3:c.C409T:p.R137W Missense Mutation cancer gene census COSM4982874 plasma EC4 chr15:89876655 CG C POLG NM_001126131:exon2:c.330delC:p.H110fs Frameshift deletion cancer gene census plasma EC4 chr12:133249829 G A POLE NM_006231:exon14:c.C1394T:p.A465V Missense Mutation cancer gene census COSM937316 plasma EC4 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 plasma EC4 chr19:49458970 TG T BAX NM_001291429:exon2:c.3delG:p.M1fs Frameshift deletion cancer gene census plasma EC4 chr19:45281364 C A CBLC NM_001130852exon1c.C176Ap.A59D Missense Mutation cancer gene census COSM3103349 plasma EC4 chr3:41266097 G A CTNNB1 NM_001098209exon3c.G94Ap.D32N Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM5672 plasma EC4 chr4:54280840 G A FIP1L1 NM_030917exon11c.G874Ap.V292I Missense Mutation cancer gene census plasma EC4 chr8:41543759 C A ANK1 NM_000037exon36c.G4301Tp.R1434M Missense Mutation cancer gene census plasma EC4 chr22:29695721 G A EWSR1 NM_013986exon17c.G1826Ap.G609D Missense Mutation cancer gene census plasma EC4 chr7:138601659 C T KIAA1549 NM_001164665exon2c.G2713Ap.A905T Missense Mutation cancer gene census COSM5750215 plasma EC4 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. plasma EC4 chr1:27105930 TG T ARID1A NM_006015:exon20:c.5542delG:p.G1848fs Frameshift deletion cancer gene census, Shukla et al. plasma EC4 chr8:145739647 C T RECQL4 NM_004260:exon11:c.G1804A:p.A602T Missense Mutation cancer gene census plasma EC4 chr3:71101750 G GT FOXP1 NM_001244813:exon3:c.147dupA:p.Q50fs Frameshift insertion cancer gene census plasma EC4 chr20:39729985 C T TOP1 NM_003286:exon13:c.C1300T:p.R434X Nonsense Mutation cancer gene census plasma EC4 chr5:176639004 G A NSD1 NM_022455exon5c.G3604Ap.E1202K Missense Mutation cancer gene census plasma EC4 chr11:108139302 C T ATM NM_000051exon18c.C2804Tp.T935M Missense Mutation cancer gene census COSM7185156 plasma EC4 chr16:72821395 T G ZFHX3 NM_006885exon10c.A10780Cp.N3594H Missense Mutation cancer gene census plasma EC4 chr16:72830806 AC A ZFHX3 NM_001164766:exon8:c.3032delG:p.G1011fs Frameshift deletion cancer gene census plasma EC4 chr16:72991734 C T ZFHX3 NM_006885:exon2:c.G2311A:p.G771R Missense Mutation cancer gene census COSM9143554 plasma EC4 chr11:113934429 C T ZBTB16 NM_001354752exon1c.C407Tp.T136I Missense Mutation cancer gene census plasma EC4 chr9:35076833 G A FANCG NM_004629:exon7:c.C812T:p.A271V Missense Mutation cancer gene census plasma EC4 chr2:148683685 T.A. T ACVR2A NM_001278580:exon10:c.979delA:p.K327fs Frameshift deletion cancer gene census plasma EC4 chr3:138664988 TG T FOXL2 NM_023067:exon1:c.576delC:p.P192fs Frameshift deletion cancer gene census plasma EC4 chr12:112229926 TG T ALDH2 NM_001204889:exon7:c.717delG:p.L239fs Frameshift deletion cancer gene census plasma EC4 chr2:109380719 A T RANBP2 NM_006267:exon20:c.A3724T:p.I1242F Missense Mutation cancer gene census plasma EC4 chr7:27205008 A C HOXA9 NM_152739:exon1:c.T69G:p.D23E Missense Mutation cancer gene census plasma EC4 chr2:48030639 A AC MSH6 NM_001281492:exon3:c.2864dupC:p.T955fs Frameshift insertion cancer gene census plasma EC4 chr7:75184771 C T HIP1 NM_001243198exon19c.G1912Ap.A638T Missense Mutation cancer gene census COSM8191841 plasma EC4 chrX:70345324 C T MED12 NM_005120:exon16:c.C2350T:p.R784C Missense Mutation cancer gene census plasma EC4 chr9:102590452 G A NR4A3 NM_173200exon4c.G161Ap.G54D Missense Mutation cancer gene census plasma EC4 chr16:23847510 C T PRKCB NM_002738exon1c.C14Tp.A5V Missense Mutation cancer gene census plasma EC4 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census plasma EC4 chr9:123886324 C T CNTRL NM_007018exon11c.C1766Tp.T589M Missense Mutation cancer gene census COSM3699385 plasma EC4 chr9:98220396 C T PTCH1 NM_000264exon18c.G3067Ap.G1023S Missense Mutation cancer gene census plasma EC4 chr9:98238333 G A PTCH1 NM_000264exon12c.C1711Tp.R571W Missense Mutation cancer gene census COSM6418613 plasma EC4 chr3:53699759 T C CACNA1D NM_000720exon6c.T839Cp.F280S Missense Mutation cancer gene census plasma EC4 chr9:134064464 C T NUP214 NM_001318324:exon26:c.C3490T:p.P1164S Missense Mutation cancer gene census plasma EC4 chr9:134073269 C T NUP214 NM_001318325:exon4:c.C866T:p.P289L Missense Mutation cancer gene census COSM5592186 plasma EC4 chr22:31737552 C T PATZ1 NM_032051:exon3:c.G1453A:p.A485T Missense Mutation cancer gene census plasma EC4 chr10:123256134 C T FGFR2 NM_001144913exon12c.G1778Ap.R593H Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. plasma EC4 chr4:87701620 G A PTPN13 NM_080685exon36c.G5972Ap.G1991D Missense Mutation cancer gene census plasma EC4 chr17:78320843 G A RNF213 NM_001256071:exon29:c.G8708A:p.G2903D Missense Mutation cancer gene census plasma EC4 chr1:145021150 T C PDE4DIP NM_001350521exon2c.A251Gp.D84G Missense Mutation cancer gene census plasma EC4 chr7:98552779 C T TRRAP NM_001244580exon40c.C5768Tp.A1923V Missense Mutation cancer gene census plasma EC4 chr17:7577022 G A TP53 NM_001126115:exon4:c.C520T:p.R174X Nonsense Mutation cancer gene census, Westin et al. plasma EC4 chr17:7578389 G A TP53 NM_000546exon5c.C541Tp.R181C Missense Mutation cancer gene census, Westin et al. COSM11090 plasma EC4 chr1:162740216 G A DDR2 NM_001354982exon12c.G1418Ap.R473H Missense Mutation cancer gene census COSM530257 plasma EC4 chr2:178095968 T G NFE2L2 NM_006164exon5c.A1363Cp.T455P Missense Mutation cancer gene census plasma EC4 chr2:178096304 C A NFE2L2 NM_006164exon5c.G1027Tp.D343Y Missense Mutation cancer gene census}

^{plasma EC4 chr12:115112152 C T TBX3 NM_016569exon7c.G1588Ap.A530T Missense Mutation cancer gene census plasma EC4 chr11:57564191 A G CTNND1 NM_001085462exon5c.A683Gp.Y228C Missense Mutation cancer gene census plasma EC4 chr11:57573427 G A CTNND1 NM_001085462exon9c.G1796Ap.R599H Missense Mutation cancer gene census plasma EC4 chr11:46321578 T G CREB3L1 NM_052854:exon2:c.T195G:p.D65E Missense Mutation cancer gene census plasma EC4 chr7:27224466 CCGCGCTGGG C HOXA11 NM_005523:exon1:c.289_297del:p.97_99del In Frame deletion cancer gene census plasma EC4 chr20:50405515 C A SALL4 NM_020436exon3c.G2627Tp.G876V Missense Mutation cancer gene census plasma EC4 chr17:5036249 G T USP6 NM_004505exon5c.G240Tp.M80I Missense Mutation cancer gene census COSM4598023 plasma EC4 chrX:76763999 T G ATRX NM_000489exon35c.A7309Cp.M2437L Missense Mutation cancer gene census plasma EC4 chr16:64981654 C CA CDH11 NM_001330576:exon12:c.1864_1865insT:p.R622fs Frameshift insertion cancer gene census plasma EC4 chr8:95143148 T C CDH17 NM_001144663exon16c.A2240Gp.N747S Missense Mutation cancer gene census plasma EC4 chr8:95189837 G A CDH17 NM_001144663exon4c.C263Tp.T88I Missense Mutation cancer gene census COSM8925665 plasma EC4 chr12:57486861 C T NAB2 NM_001330305exon5c.C1159Tp.H387Y Missense Mutation cancer gene census plasma EC4 chr8:93029525 G A RUNX1T1 NM_001198634exon2c.C188Tp.T63I Missense Mutation cancer gene census plasma EC4 chr2:187511536 G A ITGAV NM_002210exon13c.G1283Ap.R428Q Missense Mutation cancer gene census COSM6688135 plasma EC4 chr7:151864316 G A KMT2C NM_170606:exon42:c.C9665T:p.A3222V Missense Mutation cancer gene census plasma EC4 chr7:151945225 T C KMT2C NM_170606:exon14:c.A2294G:p.E765G Missense Mutation cancer gene census COSM227525 plasma EC4 chr7:151962168 C A KMT2C NM_170606:exon8:c.G1139T:p.R380L Missense Mutation cancer gene census COSM225885 plasma EC4 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 plasma EC4 chr7:151962294 G A KMT2C NM_170606:exon8:c.C1013T:p.S338L Missense Mutation cancer gene census COSM6056929 plasma EC4 chr7:151970859 C T KMT2C NM_170606:exon7:c.G943A:p.G315S Missense Mutation cancer gene census COSM1179668 plasma EC4 chr12:49427327 G T KMT2D NM_003482:exon39:c.C11161A:p.L3721M Missense Mutation cancer gene census plasma EC4 chr12:49432644 G A KMT2D NM_003482:exon34:c.C8495T:p.A2832V Missense Mutation cancer gene census COSM9502177 plasma EC4 chr14:105240286 C T AKT1 NM_001014431exon8c.G665Ap.R222H Missense Mutation cancer gene census, Westin et al. COSM6938820 plasma EC4 chr15:88678546 TG T NTRK3 NM_001320134:exon8:c.989delC:p.P330fs Frameshift deletion cancer gene census plasma EC4 chr5:142281559 G T ARHGAP26 NM_001135608exon7c.G657Tp.K219N Missense Mutation cancer gene census COSM6033605 plasma EC4 chrX:152815084 C A ATP2B3 NM_001001344exon9c.C1468Ap.L490I Missense Mutation cancer gene census plasma EC4 chr3:12626142 A C RAF1 NM_001354689exon18c.T1878Gp.I626M Missense Mutation cancer gene census plasma EC4 chr16:11349055 C T SOCS1 NM_003745:exon2:c.G281A:p.R94H Missense Mutation cancer gene census plasma EC4 chr11:92533158 G A FAT3 NM_001008781exon9c.G6979Ap.V2327I Missense Mutation cancer gene census plasma EC4 chrX:53225935 C T KDM5C NM_001353978exon19c.G2914Ap.E972K Missense Mutation cancer gene census plasma EC4 chr6:29910715 C CCGG HLA-A NM_001242758:exon2:c.255_256insCGG:p.D85delinsDR In Frame insertion cancer gene census plasma EC4 chr6:29910718 G GACA HLA-A NM_001242758:exon2:c.258_259insACA:p.Q86delinsQT In Frame insertion cancer gene census plasma EC4 chr6:29910722 A ATCTCCAAGACCAACG HLA-A NM_001242758:exon2:c.262_263insTCTCCAAGACCAACG:p.T88delinsISKTNA In Frame insertion cancer gene census plasma EC4 chr6:29912345 A T HLA-A NM_001242758exon5c.A964Tp.I322F Missense Mutation cancer gene census COSM4160533 plasma EC4 chr19:10939914 A G DNM2 NM_001005360exon19c.A2261Gp.D754G Missense Mutation cancer gene census plasma EC4 chr12:6701671 GT G CHD4 NM_001297553:exon18:c.2814delA:p.K938fs Frameshift deletion cancer gene census plasma EC4 chr2:25973188 G A ASXL2 NM_018263exon11c.C1237Tp.P413S Missense Mutation cancer gene census plasma EC4 chr2:25976506 C T ASXL2 NM_018263exon10c.G1039Ap.E347K Missense Mutation cancer gene census plasma EC4 chrX:53448870 G C SMC1A NM_001281463:exon2:c.C18G:p.I6M Missense Mutation cancer gene census plasma EC4 chr3:185766567 G A ETV5 NM_004454:exon13:c.C1394T:p.P465L Missense Mutation cancer gene census COSM3590937 plasma EC4 chrX:70471082 G A ZMYM3 NM_001171162:exon4:c.C724T:p.R242C Missense Mutation cancer gene census plasma EC4 chr12:124885064 TG T NCOR2 NM_001077261:exon17:c.1792delC:p.Q598fs Frameshift deletion cancer gene census plasma EC4 chr22:40816886 GTGC G MRTFA NM_001282660:exon7:c.843_845del:p.281_282del In Frame deletion cancer gene census plasma EC4 chr19:18562379 A C ELL NM_006532:exon7:c.T949G:p.S317A Missense Mutation cancer gene census plasma EC4 chr7:116436149 C T MET NM_001324402:exon20:c.C2854T:p.R952X Nonsense Mutation cancer gene census plasma EC4 chr4:55962435 T G KDR NM_002253:exon19:c.A2689C:p.N897H Missense Mutation cancer gene census plasma EC4 chr11:71716381 A C NUMA1 NM_006185exon23c.T5727Gp.D1909E Missense Mutation cancer gene census plasma EC4 chr11:71725265 G A NUMA1 NM_006185exon15c.C3284Tp.A1095V Missense Mutation cancer gene census plasma EC4 chr5:236649 C T SDHA NM_001330758exon10c.C1367Tp.S456L Missense Mutation cancer gene census COSM3774177 plasma EC4 chr5:236676 G A SDHA NM_001330758exon10c.G1394Ap.R465Q Missense Mutation cancer gene census COSM5468136 plasma EC4 chr5:236678 G A SDHA NM_001330758exon10c.G1396Ap.A466T Missense Mutation cancer gene census COSM3947404 plasma EC10 chr2:189864619 A AG COL3A1 NM_000090:exon32:c.2282dupG:p.R761fs Frameshift insertion cancer gene census plasma EC10 chr22:29445818 ACAG A ZNRF3 NM_001206998:exon8:c.1650_1652del:p.550_551del In Frame deletion cancer gene census plasma EC10 chr11:119077232 GCAC G CBL NM_005188:exon1:c.106_108del:p.36_36del In Frame deletion cancer gene census plasma EC10 chr2:42528528 T C EML4 NM_001145076:exon13:c.T1463C:p.I488T Missense Mutation cancer gene census plasma EC10 chr4:54319247 C.A.G. C FIP1L1 NM_001134938:exon13:c.1225_1226del:p.R409fs Frameshift deletion cancer gene census plasma EC10 chr6:157099165 GTCC G ARID1B NM_001346813:exon1:c.103_105del:p.35_35del In Frame deletion cancer gene census plasma EC10 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. plasma EC10 chr12:112892484 G GCCCTTAACACGACTC PTPN11 NM_001330437:exon5:c.642_643insCCCCTTAACACGACTC:p.Q214fs Frameshift insertion cancer gene census plasma EC10 chr3:71247356 TTGC T FOXP1 NM_001244814:exon2:c.174_176del:p.58_59del In Frame deletion cancer gene census plasma EC10 chr2:16080800 G C MYCN NM_001293231:exon1:c.G92C:p.R31P Missense Mutation cancer gene census plasma EC10 chr2:16080808 G C MYCN NM_001293231:exon1:c.G100C:p.G34R Missense Mutation cancer gene census plasma EC10 chr2:46605204 G C EPAS1 NM_001430:exon10:c.G1421C:p.S474T Missense Mutation cancer gene census COSM4094398 plasma EC10 chr5:180047629 TGAG T FLT4 NM_001354989:exon16:c.2383_2385del:p.795_795del In Frame deletion cancer gene census plasma EC10 chrX:107979509 TGCC T IRS4 NM_003604:exon1:c.63_65del:p.21_22del In Frame deletion cancer gene census plasma EC10 chr9:139400096 C T NOTCH1 NM_017617:exon25:c.G4252A:p.A1418T Missense Mutation cancer gene census COSM487237 plasma EC10 chr11:85701362 C A PICALM NM_007166exon13c.G1339Tp.V447F Missense Mutation cancer gene census plasma EC10 chr3:185390352 C G IGF2BP2 NM_001291869exon10c.G1195Cp.A399P Missense Mutation cancer gene census plasma EC10 chr1:150933570 A T SETDB1 NM_001145415exon16c.A3032Tp.E1011V Missense Mutation cancer gene census plasma EC10 chr7:98533290 C T TRRAP NM_001244580exon28c.C4103Tp.A1368V Missense Mutation cancer gene census COSM1093615 plasma EC10 chr2:178097136 G A NFE2L2 NM_006164exon4c.C578Tp.S193F Missense Mutation cancer gene census plasma EC10 chr5:11385274 CGCG C CTNND2 NM_001288715:exon6:c.404_406del:p.135_136del In Frame deletion cancer gene census plasma EC10 chr5:11110988 TTTC T CTNND2 NM_001288716:exon11:c.1431_1433del:p.477_478del In Frame deletion cancer gene census plasma EC10 chr22:23656786 C G BCR NM_004327exon22c.C3611Gp.A1204G Missense Mutation cancer gene census COSM3785508 plasma EC10 chr8:95178035 C A CDH17 NM_001144663exon10c.G1236Tp.K412N Missense Mutation cancer gene census plasma EC10 chr6:108985176 T TG FOXO3 NM_001455:exon2:c.1141dupG:p.D380fs Frameshift insertion cancer gene census plasma EC10 chr7:151962168 C A KMT2C NM_170606:exon8:c.G1139T:p.R380L Missense Mutation cancer gene census COSM225885 plasma EC10 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 plasma EC10 chr7:151970859 C A KMT2C NM_170606:exon7:c.G943T:p.G315C Missense Mutation cancer gene census COSM4381930 plasma EC10 chr7:151970859 C T KMT2C NM_170606:exon7:c.G943A:p.G315S Missense Mutation cancer gene census COSM1179668 plasma EC10 chr1:147094280 C A BCL9 NM_004326:exon9:c.C3111A:p.D1037E Missense Mutation cancer gene census plasma EC10 chr3:9027283 AGCT A SRGAP3 NM_001033117:exon22:c.3145_3147del:p.1049_1049del In Frame deletion cancer gene census plasma EC10 chr4:25678147 CGCT C SLC34A2 NM_001177998:exon13:c.1847_1849del:p.616_617del In Frame deletion cancer gene census plasma EC10 chr17:62499986 A AAGACAAATGTTTTCCCAGATCCAGTCTGTGCCACTCCAACCATATC DDX5 NM_001320597:exon5:c.441_442insGATATGGTTGGAGTGGCACAGACTGGATCTGGGAAAACATTGTCT:p.Y148delinsDMVGVAQTGSGKTLSY In Frame insertion cancer gene census plasma EC10 chr4:126411731 A T FAT4 NM_024582exon17c.A13754Tp.E4585V Missense Mutation cancer gene census plasma EC10 chr17:56435160 AC A RNF43 NM_001305545:exon8:c.1595delG:p.G532fs Frameshift deletion cancer gene census}

^{plasma EC10 chr3:89499491 C A EPHA3 NM_005233:exon15:c.C2661A:p.S887R Missense Mutation cancer gene census plasma EC10 chr22:40817008 T G MRTFA NM_001282660exon7c.A724Cp.I242L Missense Mutation cancer gene census plasma EC10 chr22:40817010 T G MRTFA NM_001282660exon7c.A722Cp.Y241S Missense Mutation cancer gene census plasma EC10 chr14:95592969 C A DICER1 NM_001195573exon6c.G851Tp.C284F Missense Mutation cancer gene census plasma EC10 chr2:141459732 C T LRP1B NM_018557:exon39:c.G6280A:p.A2094T Missense Mutation cancer gene census plasma EC10 chr6:159188460 C G EZR NM_003379exon12c.G1429Cp.V477L Missense Mutation cancer gene census plasma EC1 chr19:1207048 A C STK11 NM_000455:exon1:c.A136C:p.I46L Missense Mutation cancer gene census plasma EC1 chr18:42281778 G C SETBP1 NM_001130110exon2c.G467Cp.R156T Missense Mutation cancer gene census plasma EC1 chr22:29445818 ACAG A ZNRF3 NM_001206998:exon8:c.1650_1652del:p.550_551del In Frame deletion cancer gene census plasma EC1 chr6:106553683 A C PRDM1 NM_001198exon5c.A1648Cp.I550L Missense Mutation cancer gene census plasma EC1 chr16:15802686 TG T MYH11 NM_022844:exon41:c.5798delC:p.P1933fs Frameshift deletion cancer gene census plasma EC1 chr12:48367967 T G COL2A1 NM_001844exon53c.A4222Cp.K1408Q Missense Mutation cancer gene census plasma EC1 chr2:24930309 T A NCOA1 NM_147233exon11c.T1970Ap.V657D Missense Mutation cancer gene census plasma EC1 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 plasma EC1 chr20:39794303 T C PLCG1 NM_002660exon16c.T1636Cp.S546P Missense Mutation cancer gene census plasma EC1 chr20:39794308 T G PLCG1 NM_002660exon16c.T1641Gp.N547K Missense Mutation cancer gene census plasma EC1 chr21:39772322 G A E.R.G. NM_001291391:exon8:c.C940T:p.H314Y Missense Mutation cancer gene census plasma EC1 chr19:54647477 A C CNOT3 NM_014516:exon5:c.A250C:p.I84L Missense Mutation cancer gene census COSM7350360 plasma EC1 chr8:41572565 C T ANK1 NM_000037exon15c.G1630Ap.A544T Missense Mutation cancer gene census plasma EC1 chr2:45233332 T G SIX2 NM_016932:exon2:c.A853C:p.N285H Missense Mutation cancer gene census plasma EC1 chr2:215657036 C T BARD1 NM_000465exon3c.G349Ap.D117N Missense Mutation cancer gene census plasma EC1 chr6:157528813 A C ARID1B NM_001346813exon20c.A6658Cp.M2220L Missense Mutation cancer gene census plasma EC1 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. plasma EC1 chr8:145737136 G A RECQL4 NM_004260:exon21:c.C3430T:p.R1144C Missense Mutation cancer gene census plasma EC1 chr8:139190801 T G FAM135B NM_001362965exon10c.A1006Cp.T336P Missense Mutation cancer gene census plasma EC1 chr11:108236200 A C ATM NM_000051exon63c.A9136Cp.S3046R Missense Mutation cancer gene census plasma EC1 chr8:113237014 AA CC CSMD3 NM_001363185:exon67:c.10509_10510GG In Frame Substitution cancer gene census plasma EC1 chr8:114326902 C T CSMD3 NM_001363185exon2c.G299Ap.R100Q Missense Mutation cancer gene census COSM3644438 plasma EC1 chr5:180030323 G A FLT4 NM_182925:exon30:c.C3961T:p.R1321W Missense Mutation cancer gene census COSM6913857 plasma EC1 chr15:34645942 T G NUTM1 NM_001284292exon5c.T944Gp.M315R Missense Mutation cancer gene census plasma EC1 chr19:45862125 T G ERCC2 NM_001130867:exon12:c.A1211C:p.H404P Missense Mutation cancer gene census plasma EC1 chrX:70342972 T A MED12 NM_005120:exon11:c.T1513A:p.S505T Missense Mutation cancer gene census plasma EC1 chr1:120458550 A C NOTCH2 NM_024408:exon34:c.T6795G:p.N2265K Missense Mutation cancer gene census plasma EC1 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census plasma EC1 chr2:237489668 C T ACKR3 NM_020311:exon2:c.C560T:p.T187M Missense Mutation cancer gene census plasma EC1 chr6:136599201 C G BCLAF1 NM_001077441exon4c.G818Cp.G273A Missense Mutation cancer gene census plasma EC1 chr16:88949125 T G CBFA2T3 NM_005187exon8c.A1162Cp.T388P Missense Mutation cancer gene census plasma EC1 chr19:11144086 A C SMARCA4 NM_001128845:exon25:c.A3667C:p.N1223H Missense Mutation cancer gene census plasma EC1 chr19:11144089 G A SMARCA4 NM_001128845:exon25:c.G3670A:p.V1224M Missense Mutation cancer gene census COSM6784883 plasma EC1 chr14:62187178 T G HIF1A NM_001243084:exon2:c.T186G:p.Y62X Nonsense Mutation cancer gene census plasma EC1 chr1:144882673 T G PDE4DIP NM_001350521exon27c.A3757Cp.I1253L Missense Mutation cancer gene census plasma EC1 chr2:100210409 C T AFF3 NM_001025108exon14c.G1789Ap.A597T Missense Mutation cancer gene census COSM5859749 plasma EC1 chr4:87968370 T G AFF1 NM_001166693exon4c.T683Gp.L228R Missense Mutation cancer gene census plasma EC1 chr12:57493609 C T STAT6 NM_001178078exon15c.G1685Ap.R562H Missense Mutation cancer gene census COSM9200324 plasma EC1 chr17:5036823 T C USP6 NM_004505exon6c.T362Cp.L121S Missense Mutation cancer gene census COSM4591808 plasma EC1 chr17:5036834 G A USP6 NM_004505exon6c.G373Ap.G125R Missense Mutation cancer gene census COSM4591349 plasma EC1 chr17:5036838 G A USP6 NM_004505exon6c.G377Ap.R126K Missense Mutation cancer gene census COSM4591351 plasma EC1 chr17:5036843 C A USP6 NM_004505exon6c.C382Ap.Q128K Missense Mutation cancer gene census COSM4590856 plasma EC1 chr16:64982648 A C CDH11 NM_001308392:exon13:c.T1937G:p.M646R Missense Mutation cancer gene census plasma EC1 chr7:151874643 T G KMT2C NM_170606:exon38:c.A7895C:p.Q2632P Missense Mutation cancer gene census plasma EC1 chr7:151970859 C A KMT2C NM_170606:exon7:c.G943T:p.G315C Missense Mutation cancer gene census COSM4381930 plasma EC1 chr12:49445156 CAGGTGTGGCTCCTCAGCCTGCGGAGAT C KMT2D NM_003482:exon10:c.2283_2309del:p.761_770del In Frame deletion cancer gene census plasma EC1 chr3:9100052 A C SRGAP3 NM_001033117exon7c.T906Gp.I302M Missense Mutation cancer gene census plasma EC1 chr8:128750586 CGAG C MYC NM_001354870:exon2:c.121_123del:p.41_41del In Frame deletion cancer gene census, Shukla et al. plasma EC1 chr3:77645876 T G ROBO2 NM_002942exon19c.T2829Gp.N943K Missense Mutation cancer gene census plasma EC1 chr6:29911930 CA TG HLA-A NM_001242758:exon4:c.651_652TG In Frame Substitution cancer gene census plasma EC1 chr4:187541858 C T FAT1 NM_005245:exon10:c.G5882A:p.G1961D Missense Mutation cancer gene census plasma EC1 chr4:187629979 T G FAT1 NM_005245:exon2:c.A1003C:p.T335P Missense Mutation cancer gene census plasma EC1 chr9:133738258 C T ABL1 NM_007313exon4c.C715Tp.R239C Missense Mutation cancer gene census plasma EC1 chr17:15978947 G A NCOR1 NM_006311exon27c.C3571Tp.P1191S Missense Mutation cancer gene census plasma EC1 chr1:85733512 GA G BCL10 NM_001320715:exon3:c.466delT:p.S156fs Frameshift deletion cancer gene census plasma EC1 chr19:18561475 C T ELL NM_006532:exon8:c.G1277A:p.G426D Missense Mutation cancer gene census plasma EC1 chr19:18562379 A C ELL NM_006532:exon7:c.T949G:p.S317A Missense Mutation cancer gene census plasma EC1 chr15:91428364 T G FES NM_001143783exon1c.T89Gp.M30R Missense Mutation cancer gene census plasma EC1 chr22:30074239 A C NF2 NM_181830:exon12:c.A1252C:p.I418L Missense Mutation cancer gene census plasma EC1 chr9:117825322 T G TNC NM_002160:exon13:c.A3907C:p.T1303P Missense Mutation cancer gene census plasma EC1 chr6:159188460 C G EZR NM_003379exon12c.G1429Cp.V477L Missense Mutation cancer gene census plasma EC1 chr5:236619 T C SDHA NM_001330758exon10c.T1337Cp.V446A Missense Mutation cancer gene census COSM5071098 plasma EC1 chr5:236628 C T SDHA NM_001330758exon10c.C1346Tp.A449V Missense Mutation cancer gene census COSM3734016 plasma EC1 chr5:236649 C T SDHA NM_001330758exon10c.C1367Tp.S456L Missense Mutation cancer gene census COSM3774177 plasma EC1 chr5:236676 G A SDHA NM_001330758exon10c.G1394Ap.R465Q Missense Mutation cancer gene census COSM5468136 plasma EC1 chr5:236678 G A SDHA NM_001330758exon10c.G1396Ap.A466T Missense Mutation cancer gene census COSM3947404 plasma EC1 chr3:52439882 T G BAP1 NM_004656:exon10:c.A830C:p.Q277P Missense Mutation cancer gene census plasma EC1 chr17:66547263 T G PRKAR1A NM_001276290:exon10:c.T1012G:p.X338E Nonsense Mutation cancer gene census peritoneal fluid EC4 chr7:33044951 C G FKBP9 NM_001284341exon11c.C1860Gp.H620Q Missense Mutation cancer gene census COSM5000147 peritoneal fluid EC4 chr3:178916725 C T PIK3CA NM_006218:exon2:c.C112T:p.R38C Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM744 peritoneal fluid EC4 chr3:128200673 T A GATA2 NM_001145662:exon5:c.A1090T:p.K364X Nonsense Mutation cancer gene census peritoneal fluid EC4 chr16:2094737 G A NTHL1 NM_001318194:exon3:c.C89T:p.A30V Missense Mutation cancer gene census peritoneal fluid EC4 chr16:67650770 G A CTCF NM_001363916exon5c.G1075Ap.A359T Missense Mutation cancer gene census, Shukla et al. COSM6637239 peritoneal fluid EC4 chr16:67660556 C T CTCF NM_001191022:exon6:c.C472T:p.Q158X Nonsense Mutation cancer gene census, Shukla et al. peritoneal fluid EC4 chr19:4363820 C T SH3GL1 NM_003025exon6c.G521Ap.R174Q Missense Mutation cancer gene census COSM3288658 peritoneal fluid EC4 chr1:11318570 A C MTOR NM_004958:exon3:c.T243G:p.N81K Missense Mutation cancer gene census peritoneal fluid EC4 chr3:136062753 G A STAG1 NM_005862:exon30:c.C3367T:p.R1123W Missense Mutation cancer gene census peritoneal fluid EC4 chr7:101891852 G A CUX1 NM_001202543exon24c.G4081Ap.A1361T Missense Mutation cancer gene census COSM9230592 peritoneal fluid EC4 chr12:6787366 G A ZNF384 NM_001135734exon6c.C613Tp.P205S Missense Mutation cancer gene census peritoneal fluid EC4 chr11:119144682 G A CBL NM_005188:exon4:c.G695A:p.C232Y Missense Mutation cancer gene census}

^{peritoneal fluid EC4 chrX:153592658 C T FLNA NM_001110556exon14c.G2105Ap.G702D Missense Mutation cancer gene census peritoneal fluid EC4 chrX:153588265 G A FLNA NM_001110556exon23c.C3814Tp.R1272C Missense Mutation cancer gene census peritoneal fluid EC4 chr3:121260261 G A POLQ NM_199420:exon3:c.C409T:p.R137W Missense Mutation cancer gene census COSM4982874 peritoneal fluid EC4 chr15:89876655 CG C POLG NM_001126131:exon2:c.330delC:p.H110fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr12:133249829 G A POLE NM_006231:exon14:c.C1394T:p.A465V Missense Mutation cancer gene census COSM937316 peritoneal fluid EC4 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 peritoneal fluid EC4 chr19:49458970 TG T BAX NM_001291429:exon2:c.3delG:p.M1fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr19:45281364 C A CBLC NM_001130852exon1c.C176Ap.A59D Missense Mutation cancer gene census COSM3103349 peritoneal fluid EC4 chr3:41266097 G A CTNNB1 NM_001098209exon3c.G94Ap.D32N Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM5672 peritoneal fluid EC4 chr3:41280698 T G CTNNB1 NM_001098209exon15c.T2211Gp.H737Q Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. peritoneal fluid EC4 chr4:54280840 G A FIP1L1 NM_030917exon11c.G874Ap.V292I Missense Mutation cancer gene census peritoneal fluid EC4 chr8:41543759 C A ANK1 NM_000037exon36c.G4301Tp.R1434M Missense Mutation cancer gene census peritoneal fluid EC4 chr7:138546010 C T KIAA1549 NM_001164665exon16c.G5122Ap.A1708T Missense Mutation cancer gene census peritoneal fluid EC4 chr7:138601659 C T KIAA1549 NM_001164665exon2c.G2713Ap.A905T Missense Mutation cancer gene census COSM5750215 peritoneal fluid EC4 chr11:44151679 G A EXT2 NM_000401exon7c.G1263Ap.M421I Missense Mutation cancer gene census peritoneal fluid EC4 chr16:2112996 G A TSC2 NM_000548exon14c.G1385Ap.R462H Missense Mutation cancer gene census COSM6971109 peritoneal fluid EC4 chr1:27094328 T G ARID1A NM_006015:exon11:c.T3036G:p.Y1012X Nonsense Mutation cancer gene census, Shukla et al. peritoneal fluid EC4 chr1:27101664 C T ARID1A NM_006015exon18c.C4946Tp.T1649I Missense Mutation cancer gene census, Shukla et al. peritoneal fluid EC4 chr1:27105930 TG T ARID1A NM_006015:exon20:c.5542delG:p.G1848fs Frameshift deletion cancer gene census, Shukla et al. peritoneal fluid EC4 chr8:145739647 C T RECQL4 NM_004260:exon11:c.G1804A:p.A602T Missense Mutation cancer gene census peritoneal fluid EC4 chr3:71101750 G GT FOXP1 NM_001244813:exon3:c.147dupA:p.Q50fs Frameshift insertion cancer gene census peritoneal fluid EC4 chr2:16080800 G C MYCN NM_001293231:exon1:c.G92C:p.R31P Missense Mutation cancer gene census peritoneal fluid EC4 chr20:39729985 C T TOP1 NM_003286:exon13:c.C1300T:p.R434X Nonsense Mutation cancer gene census peritoneal fluid EC4 chr5:176639004 G A NSD1 NM_022455exon5c.G3604Ap.E1202K Missense Mutation cancer gene census peritoneal fluid EC4 chr8:38162180 T G NSD3 NM_023034:exon14:c.A2536C:p.I846L Missense Mutation cancer gene census peritoneal fluid EC4 chr8:38162266 A C NSD3 NM_023034:exon14:c.T2450G:p.M817R Missense Mutation cancer gene census peritoneal fluid EC4 chr11:108139302 C T ATM NM_000051exon18c.C2804Tp.T935M Missense Mutation cancer gene census COSM7185156 peritoneal fluid EC4 chr16:72821959 CG C ZFHX3 NM_001164766:exon9:c.7473delC:p.P2491fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr16:72830806 AC A ZFHX3 NM_001164766:exon8:c.3032delG:p.G1011fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr16:72991734 C T ZFHX3 NM_006885:exon2:c.G2311A:p.G771R Missense Mutation cancer gene census COSM9143554 peritoneal fluid EC4 chr3:142238577 C T ATR NM_001184exon24c.G4316Ap.G1439D Missense Mutation cancer gene census peritoneal fluid EC4 chr11:113934429 C T ZBTB16 NM_001354752exon1c.C407Tp.T136I Missense Mutation cancer gene census peritoneal fluid EC4 chr9:35076833 G A FANCG NM_004629:exon7:c.C812T:p.A271V Missense Mutation cancer gene census peritoneal fluid EC4 chr2:148683685 T.A. T ACVR2A NM_001278580:exon10:c.979delA:p.K327fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr3:138664988 TG T FOXL2 NM_023067:exon1:c.576delC:p.P192fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr22:41556673 T G EP300 NM_001429exon20c.T3618Gp.N1206K Missense Mutation cancer gene census peritoneal fluid EC4 chrX:107978612 A C IRS4 NM_003604:exon1:c.T963G:p.H321Q Missense Mutation cancer gene census peritoneal fluid EC4 chr12:112229926 TG T ALDH2 NM_001204889:exon7:c.717delG:p.L239fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr2:109380719 A T RANBP2 NM_006267:exon20:c.A3724T:p.I1242F Missense Mutation cancer gene census peritoneal fluid EC4 chr2:109382881 CA C RANBP2 NM_006267:exon20:c.5887delA:p.K1963fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr19:45867268 C T ERCC2 NM_000400exon10c.G925Ap.V309M Missense Mutation cancer gene census COSM9495126 peritoneal fluid EC4 chr16:14020478 G A ERCC4 NM_005236:exon3:c.G449A:p.R150H Missense Mutation cancer gene census COSM9113215 peritoneal fluid EC4 chr2:48030639 A AC MSH6 NM_001281492:exon3:c.2864dupC:p.T955fs Frameshift insertion cancer gene census peritoneal fluid EC4 chr7:75184771 C T HIP1 NM_001243198exon19c.G1912Ap.A638T Missense Mutation cancer gene census COSM8191841 peritoneal fluid EC4 chrX:70345324 C T MED12 NM_005120:exon16:c.C2350T:p.R784C Missense Mutation cancer gene census peritoneal fluid EC4 chrX:125298907 G A DCAF12L2 NM_001013628:exon1:c.C1001T:p.P334L Missense Mutation cancer gene census peritoneal fluid EC4 chr9:102590452 G A NR4A3 NM_173200exon4c.G161Ap.G54D Missense Mutation cancer gene census peritoneal fluid EC4 chr16:23847510 C T PRKCB NM_002738exon1c.C14Tp.A5V Missense Mutation cancer gene census peritoneal fluid EC4 chr1:120458550 A C NOTCH2 NM_024408:exon34:c.T6795G:p.N2265K Missense Mutation cancer gene census peritoneal fluid EC4 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census peritoneal fluid EC4 chr9:123886324 C T CNTRL NM_007018exon11c.C1766Tp.T589M Missense Mutation cancer gene census COSM3699385 peritoneal fluid EC4 chr9:98220396 C T PTCH1 NM_000264exon18c.G3067Ap.G1023S Missense Mutation cancer gene census peritoneal fluid EC4 chr9:98238333 G A PTCH1 NM_000264exon12c.C1711Tp.R571W Missense Mutation cancer gene census COSM6418613 peritoneal fluid EC4 chr9:134064464 C T NUP214 NM_001318324:exon26:c.C3490T:p.P1164S Missense Mutation cancer gene census peritoneal fluid EC4 chr9:134073269 C T NUP214 NM_001318325:exon4:c.C866T:p.P289L Missense Mutation cancer gene census COSM5592186 peritoneal fluid EC4 chr1:150933570 A G SETDB1 NM_001145415exon16c.A3032Gp.E1011G Missense Mutation cancer gene census COSM8838117 peritoneal fluid EC4 chr1:150933579 CT GGG SETDB1 NM_001145415:exon16:c.3041_3042GGG Frameshift substitution cancer gene census peritoneal fluid EC4 chr13:32911589 G A BRCA2 NM_000059:exon11:c.G3097A:p.D1033N Missense Mutation cancer gene census COSM5733235 peritoneal fluid EC4 chr17:8050696 C T PER1 NM_002616:exon13:c.G1501A:p.V501I Missense Mutation cancer gene census peritoneal fluid EC4 chr22:31737552 C T PATZ1 NM_032051:exon3:c.G1453A:p.A485T Missense Mutation cancer gene census peritoneal fluid EC4 chr10:123256134 C T FGFR2 NM_001144913exon12c.G1778Ap.R593H Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. peritoneal fluid EC4 chr4:87622606 G GA PTPN13 NM_006264:exon7:c.848dupA:p.E283fs Frameshift insertion cancer gene census peritoneal fluid EC4 chr4:87653836 C T PTPN13 NM_006264exon12c.C1775Tp.T592I Missense Mutation cancer gene census peritoneal fluid EC4 chr4:87701620 G A PTPN13 NM_080685exon36c.G5972Ap.G1991D Missense Mutation cancer gene census peritoneal fluid EC4 chr15:52611411 T G MYO5A NM_001142495:exon37:c.A4924C:p.N1642H Missense Mutation cancer gene census peritoneal fluid EC4 chr17:78320843 G A RNF213 NM_001256071:exon29:c.G8708A:p.G2903D Missense Mutation cancer gene census peritoneal fluid EC4 chr19:18857863 G A CRTC1 NM_001098482exon5c.G430Ap.A144T Missense Mutation cancer gene census peritoneal fluid EC4 chr1:145021150 T C PDE4DIP NM_001350521exon2c.A251Gp.D84G Missense Mutation cancer gene census peritoneal fluid EC4 chr22:29121095 GT G CHEK2 NM_007194:exon4:c.461delA:p.N154fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr7:98552779 C T TRRAP NM_001244580exon40c.C5768Tp.A1923V Missense Mutation cancer gene census peritoneal fluid EC4 chr7:98586417 C T TRRAP NM_001244580exon62c.C9431Tp.A3144V Missense Mutation cancer gene census peritoneal fluid EC4 chr17:79967014 T G ASPSCR1 NM_001251888exon8c.T1035Gp.F345L Missense Mutation cancer gene census peritoneal fluid EC4 chr17:7577022 G A TP53 NM_001126115:exon4:c.C520T:p.R174X Nonsense Mutation cancer gene census, Westin et al. peritoneal fluid EC4 chr17:7578389 G A TP53 NM_000546exon5c.C541Tp.R181C Missense Mutation cancer gene census, Westin et al. COSM11090 peritoneal fluid EC4 chr1:162740216 G A DDR2 NM_001354982exon12c.G1418Ap.R473H Missense Mutation cancer gene census COSM530257 peritoneal fluid EC4 chr2:178096304 C A NFE2L2 NM_006164exon5c.G1027Tp.D343Y Missense Mutation cancer gene census peritoneal fluid EC4 chr12:115112152 C T TBX3 NM_016569exon7c.G1588Ap.A530T Missense Mutation cancer gene census peritoneal fluid EC4 chr11:57564191 A G CTNND1 NM_001085462exon5c.A683Gp.Y228C Missense Mutation cancer gene census peritoneal fluid EC4 chr11:57573427 G A CTNND1 NM_001085462exon9c.G1796Ap.R599H Missense Mutation cancer gene census peritoneal fluid EC4 chr7:27224466 CCGCGCTGGG C HOXA11 NM_005523:exon1:c.289_297del:p.97_99del In Frame deletion cancer gene census peritoneal fluid EC4 chr20:36031708 G A SRC NM_005417:exon14:c.G1537A:p.E513K Missense Mutation cancer gene census COSM9102598}

^{peritoneal fluid EC4 chr20:50405515 C A SALL4 NM_020436exon3c.G2627Tp.G876V Missense Mutation cancer gene census peritoneal fluid EC4 chr17:5036249 G T USP6 NM_004505exon5c.G240Tp.M80I Missense Mutation cancer gene census COSM4598023 peritoneal fluid EC4 chr16:64981654 C CA CDH11 NM_001330576:exon12:c.1864_1865insT:p.R622fs Frameshift insertion cancer gene census peritoneal fluid EC4 chr8:95143148 T C CDH17 NM_001144663exon16c.A2240Gp.N747S Missense Mutation cancer gene census peritoneal fluid EC4 chr8:95189837 G A CDH17 NM_001144663exon4c.C263Tp.T88I Missense Mutation cancer gene census COSM8925665 peritoneal fluid EC4 chr12:57486861 C T NAB2 NM_001330305exon5c.C1159Tp.H387Y Missense Mutation cancer gene census peritoneal fluid EC4 chr2:204594478 G A CD28 NM_001243078:exon2:c.G160A:p.A54T Missense Mutation cancer gene census peritoneal fluid EC4 chr2:187511536 G A ITGAV NM_002210exon13c.G1283Ap.R428Q Missense Mutation cancer gene census COSM6688135 peritoneal fluid EC4 chr8:57079790 T G PLAG1 NM_001114634exon4c.A515Cp.H172P Missense Mutation cancer gene census COSM8522225 peritoneal fluid EC4 chr7:151864316 G A KMT2C NM_170606:exon42:c.C9665T:p.A3222V Missense Mutation cancer gene census peritoneal fluid EC4 chr7:151945225 T C KMT2C NM_170606:exon14:c.A2294G:p.E765G Missense Mutation cancer gene census COSM227525 peritoneal fluid EC4 chr7:151962168 C A KMT2C NM_170606:exon8:c.G1139T:p.R380L Missense Mutation cancer gene census COSM225885 peritoneal fluid EC4 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 peritoneal fluid EC4 chr7:151970859 C T KMT2C NM_170606:exon7:c.G943A:p.G315S Missense Mutation cancer gene census COSM1179668 peritoneal fluid EC4 chr11:118367048 C T KMT2A NM_001197104exon20c.C5630Tp.A1877V Missense Mutation cancer gene census COSM7579611 peritoneal fluid EC4 chr12:49427327 G T KMT2D NM_003482:exon39:c.C11161A:p.L3721M Missense Mutation cancer gene census peritoneal fluid EC4 chr12:49443773 T G KMT2D NM_003482:exon11:c.A3598C:p.I1200L Missense Mutation cancer gene census peritoneal fluid EC4 chr2:202141689 C T CASP8 NM_001080125exon7c.C977Tp.A326V Missense Mutation cancer gene census peritoneal fluid EC4 chr1:147090772 C T BCL9 NM_004326:exon8:c.C811T:p.P271S Missense Mutation cancer gene census peritoneal fluid EC4 chr14:105240286 C T AKT1 NM_001014431exon8c.G665Ap.R222H Missense Mutation cancer gene census, Westin et al. COSM6938820 peritoneal fluid EC4 chr19:40771158 A G AKT2 NM_001330511exon1c.T17Cp.V6A Missense Mutation cancer gene census COSM8208692 peritoneal fluid EC4 chr15:88678546 TG T NTRK3 NM_001320134:exon8:c.989delC:p.P330fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr5:142281559 G T ARHGAP26 NM_001135608exon7c.G657Tp.K219N Missense Mutation cancer gene census COSM6033605 peritoneal fluid EC4 chr11:128642725 C T FLI1 NM_002017exon4c.C434Tp.A145V Missense Mutation cancer gene census peritoneal fluid EC4 chrX:152815084 C A ATP2B3 NM_001001344exon9c.C1468Ap.L490I Missense Mutation cancer gene census peritoneal fluid EC4 chrX:152815684 G A ATP2B3 NM_001001344exon10c.G1763Ap.R588H Missense Mutation cancer gene census peritoneal fluid EC4 chr16:11349055 C T SOCS1 NM_003745:exon2:c.G281A:p.R94H Missense Mutation cancer gene census peritoneal fluid EC4 chr11:92533158 G A FAT3 NM_001008781exon9c.G6979Ap.V2327I Missense Mutation cancer gene census peritoneal fluid EC4 chrX:53225935 C T KDM5C NM_001353978exon19c.G2914Ap.E972K Missense Mutation cancer gene census peritoneal fluid EC4 chr6:29912345 A T HLA-A NM_001242758exon5c.A964Tp.I322F Missense Mutation cancer gene census COSM4160533 peritoneal fluid EC4 chr19:10939914 A G DNM2 NM_001005360exon19c.A2261Gp.D754G Missense Mutation cancer gene census peritoneal fluid EC4 chr12:6701671 GT G CHD4 NM_001297553:exon18:c.2814delA:p.K938fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr2:25973188 G A ASXL2 NM_018263exon11c.C1237Tp.P413S Missense Mutation cancer gene census peritoneal fluid EC4 chr9:8341268 G A PTPRD NM_002839exon41c.C4948Tp.R1650C Missense Mutation cancer gene census COSM5142943 peritoneal fluid EC4 chrX:123181311 C T STAG2 NM_006603:exon8:c.C775T:p.R259X Nonsense Mutation cancer gene census peritoneal fluid EC4 chr22:28194691 C T MN1 NM_002430:exon1:c.G1841A:p.R614H Missense Mutation cancer gene census peritoneal fluid EC4 chr3:185766567 G A ETV5 NM_004454:exon13:c.C1394T:p.P465L Missense Mutation cancer gene census COSM3590937 peritoneal fluid EC4 chrX:70471082 G A ZMYM3 NM_001171162:exon4:c.C724T:p.R242C Missense Mutation cancer gene census peritoneal fluid EC4 chrX:70472962 AG A ZMYM3 NM_001171162:exon2:c.143delC:p.P48fs Frameshift deletion cancer gene census peritoneal fluid EC4 chrX:37028026 T C FAM47C NM_001013736:exon1:c.T1543C:p.S515P Missense Mutation cancer gene census peritoneal fluid EC4 chr12:124857057 A G NCOR2 NM_006312exon22c.T2318Cp.L773P Missense Mutation cancer gene census peritoneal fluid EC4 chr12:124885064 TG T NCOR2 NM_001077261:exon17:c.1792delC:p.Q598fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr5:31493373 C G DROSHA NM_013235exon12c.G1783Cp.D595H Missense Mutation cancer gene census peritoneal fluid EC4 chrX:44732958 G T KDM6A NM_001291415exon1c.G161Tp.S54I Missense Mutation cancer gene census peritoneal fluid EC4 chr8:90965665 CT C NBN NM_002485:exon11:c.1651delA:p.R551fs Frameshift deletion cancer gene census peritoneal fluid EC4 chr19:18562379 A C ELL NM_006532:exon7:c.T949G:p.S317A Missense Mutation cancer gene census peritoneal fluid EC4 chr15:91434233 A C FES NM_002005exon11c.A1342Cp.I448L Missense Mutation cancer gene census peritoneal fluid EC4 chr7:116436149 C T MET NM_001324402:exon20:c.C2854T:p.R952X Nonsense Mutation cancer gene census peritoneal fluid EC4 chr11:71720336 G A NUMA1 NM_006185exon18c.C4817Tp.A1606V Missense Mutation cancer gene census peritoneal fluid EC4 chr11:71725265 G A NUMA1 NM_006185exon15c.C3284Tp.A1095V Missense Mutation cancer gene census peritoneal fluid EC4 chr11:71720164 C T NUMA1 NM_006185exon19c.G4907Ap.R1636Q Missense Mutation cancer gene census peritoneal fluid EC4 chr13:21555688 G A LATS2 NM_014572:exon6:c.C2582T:p.A861V Missense Mutation cancer gene census COSM4046424 peritoneal fluid EC4 chr7:156802960 C A MNX1 NM_005515:exon1:c.G85T:p.A29S Missense Mutation cancer gene census peritoneal fluid EC4 chrX:132670304 C A GPC3 NM_001164617exon9c.G1660Tp.D554Y Missense Mutation cancer gene census peritoneal fluid EC4 chr6:159188460 C G EZR NM_003379exon12c.G1429Cp.V477L Missense Mutation cancer gene census peritoneal fluid EC4 chr16:9858436 T G GRIN2A NM_001134407exon13c.A2965Cp.N989H Missense Mutation cancer gene census peritoneal fluid EC4 chr5:236649 C T SDHA NM_001330758exon10c.C1367Tp.S456L Missense Mutation cancer gene census COSM3774177 peritoneal fluid EC4 chr17:66547263 T G PRKAR1A NM_001276290:exon10:c.T1012G:p.X338E Nonsense Mutation cancer gene census peritoneal fluid EC3 chr10:8097728 A C GATA3 NM_001002295exon2c.A110Cp.D37A Missense Mutation cancer gene census peritoneal fluid EC3 chr14:65544747 C T MAX NM_002382exon4c.G179Ap.R60Q Missense Mutation cancer gene census COSM166665 peritoneal fluid EC3 chr12:4388002 T C CCND2 NM_001759:exon3:c.T488C:p.I163T Missense Mutation cancer gene census peritoneal fluid EC3 chr16:67645338 C CA CTCF NM_001363916:exon3:c.604dupA:p.A201fs Frameshift insertion cancer gene census, Shukla et al. peritoneal fluid EC3 chr12:12871222 G T CDKN1B NM_004064:exon1:c.G449T:p.G150V Missense Mutation cancer gene census peritoneal fluid EC3 chr1:65306996 GT G JAK1 NM_001321852:exon19:c.2580delA:p.K860fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr1:65325832 CG C JAK1 NM_001321852:exon9:c.1289delC:p.P430fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr12:6787520 AG A ZNF384 NM_001135734:exon6:c.458delC:p.P153fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr6:134492286 T C SGK1 NM_001143676exon12c.A1198Gp.M400V Missense Mutation cancer gene census peritoneal fluid EC3 chr3:186507044 G A EIF4A2 NM_001967:exon11:c.G1210A:p.A404T Missense Mutation cancer gene census peritoneal fluid EC3 chr1:110882872 AC A RBM15 NM_001201545:exon1:c.846delC:p.H282fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr3:52584582 A AG PBRM1 NM_001350075:exon29:c.4586dupC:p.P1529fs Frameshift insertion cancer gene census peritoneal fluid EC3 chr3:52651319 T C PBRM1 NM_001350075exon15c.A1777Gp.M593V Missense Mutation cancer gene census peritoneal fluid EC3 chr7:55211167 T G EGFR NM_001346897exon3c.T410Gp.M137R Missense Mutation cancer gene census, Westin et al. peritoneal fluid EC3 chr20:39791911 AG A PLCG1 NM_002660:exon8:c.786delG:p.Q262fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr11:17742894 G A MYOD1 NM_002478:exon3:c.G802A:p.A268T Missense Mutation cancer gene census peritoneal fluid EC3 chr6:163899919 T.A. T QKI NM_001301085:exon3:c.394delA:p.K132fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr7:138602271 C T KIAA1549 NM_001164665exon2c.G2101Ap.E701K Missense Mutation cancer gene census COSM2860350 peritoneal fluid EC3 chr17:38512369 CG C RARA NM_001145302:exon7:c.990delG:p.P330fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr2:45235838 C T SIX2 NM_016932:exon1:c.G412A:p.V138M Missense Mutation cancer gene census peritoneal fluid EC3 chr6:157522189 GC G ARID1B NM_001363725:exon16:c.2332delC:p.P778fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr1:27100880 A G ARID1A NM_006015:exon18:c.A4162G:p.M1388V Missense Mutation cancer gene census, Shukla et al. peritoneal fluid EC3 chr1:27106803 AC A ARID1A NM_006015:exon20:c.6415delC:p.P2139fs Frameshift deletion cancer gene census, Shukla et al. peritoneal fluid EC3 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. peritoneal fluid EC3 chr1:17958883 G A ARHGEF10L NM_018125exon16c.G1652Ap.R551H Missense Mutation cancer gene census peritoneal fluid EC3 chr19:1625638 T C TCF3 NM_001136139:exon7:c.A436G:p.T146A Missense Mutation cancer gene census}

^{peritoneal fluid EC3 chr19:16192856 GGT CCC TPM4 NM_001367837:exon2:c.G266C:p.R89T Missense Mutation cancer gene census peritoneal fluid EC3 chr5:176637648 GCT G NSD1 NM_022455:exon5:c.2249_2250del:p.A750fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr5:176721712 CA C NSD1 NM_022455:exon23:c.7344delA:p.S2448fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr16:72821267 GGA G ZFHX3 NM_001164766:exon9:c.8164_8165del:p.S2722fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr16:72821959 CG C ZFHX3 NM_001164766:exon9:c.7473delC:p.P2491fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr16:72831399 G C ZFHX3 NM_006885exon9c.C5182Gp.Q1728E Missense Mutation cancer gene census peritoneal fluid EC3 chr11:114121086 T TC ZBTB16 NM_001354752:exon5:c.1745dupC:p.S582fs Frameshift insertion cancer gene census peritoneal fluid EC3 chr4:153332900 A G FBXW7 NM_033632exon2c.T56Cp.L19P Missense Mutation cancer gene census, The Cancer Genome Atlas Research Network, Shukla et al. peritoneal fluid EC3 chr2:148683685 T.A. T ACVR2A NM_001278580:exon10:c.979delA:p.K327fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr4:106164914 G A TET2 NM_001127208:exon6:c.G3782A:p.R1261H Missense Mutation cancer gene census COSM211643 peritoneal fluid EC3 chr1:118166487 A C TENT5C NM_017709:exon2:c.A997C:p.I333L Missense Mutation cancer gene census peritoneal fluid EC3 chr3:138664820 C T FOXL2 NM_023067:exon1:c.G745A:p.A249T Missense Mutation cancer gene census peritoneal fluid EC3 chr2:109384346 C T RANBP2 NM_006267:exon20:c.C7351T:p.P2451S Missense Mutation cancer gene census peritoneal fluid EC3 chr2:48030639 AC A MSH6 NM_001281492:exon3:c.2864delC:p.T955fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr17:20059549 G A SPECC1 NM_001033554exon1c.G40Ap.G14R Missense Mutation cancer gene census peritoneal fluid EC3 chr17:1303343 T G YWHAE NM_006761:exon1:c.A62C:p.D21A Missense Mutation cancer gene census peritoneal fluid EC3 chr12:105150838 G A CHST11 NM_018413exon3c.G316Ap.D106N Missense Mutation cancer gene census peritoneal fluid EC3 chr9:139412290 T C NOTCH1 NM_017617:exon8:c.A1355G:p.D452G Missense Mutation cancer gene census peritoneal fluid EC3 chr9:139390944 TGTG T NOTCH1 NM_017617:exon34:c.7244_7246del:p.2415_2416del In Frame deletion cancer gene census peritoneal fluid EC3 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census peritoneal fluid EC3 chr11:85692947 T C PICALM NM_007166exon15c.A1616Gp.D539G Missense Mutation cancer gene census peritoneal fluid EC3 chr9:134073296 C T NUP214 NM_001318325:exon4:c.C893T:p.S298L Missense Mutation cancer gene census peritoneal fluid EC3 chr9:134073967 A G NUP214 NM_001318325:exon4:c.A1564G:p.T522A Missense Mutation cancer gene census peritoneal fluid EC3 chr4:1806059 G A FGFR3 NM_001163213exon9c.G1084Ap.E362K Missense Mutation cancer gene census peritoneal fluid EC3 chr8:38285913 GTCA G FGFR1 NM_001174066:exon3:c.129_131del:p.43_44del In Frame deletion cancer gene census peritoneal fluid EC3 chr6:33287620 C T DAXX NM_001141969exon6c.G1477Ap.D493N Missense Mutation cancer gene census peritoneal fluid EC3 chr6:33287212 A AG DAXX NM_001254717:exon5:c.1659dupC:p.C554fs Frameshift insertion cancer gene census peritoneal fluid EC3 chr17:7579577 G GA TP53 NM_000546:exon4:c.109dupT:p.S37fs Frameshift insertion cancer gene census, Westin et al. peritoneal fluid EC3 chr12:122248216 G GC SETD1B NM_001353345:exon5:c.1366dupC:p.P455fs Frameshift insertion cancer gene census peritoneal fluid EC3 chr1:156834151 T A NTRK1 NM_001012331exon2c.T218Ap.I73N Missense Mutation cancer gene census peritoneal fluid EC3 chrX:129147745 G A BCORL1 NM_001184772exon3c.G997Ap.V333I Missense Mutation cancer gene census peritoneal fluid EC3 chr12:57493667 T C STAT6 NM_001178078exon15c.A1627Gp.S543G Missense Mutation cancer gene census peritoneal fluid EC3 chr2:47630409 C T MSH2 NM_000251:exon1:c.C79T:p.P27S Missense Mutation cancer gene census COSM6435286 peritoneal fluid EC3 chr20:50401031 C T SALL4 NM_020436exon4c.G2935Ap.G979S Missense Mutation cancer gene census COSM1130603 peritoneal fluid EC3 chr17:5074001 CG C USP6 NM_004505:exon28:c.3746delG:p.R1249fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr20:57429164 G A GNAS NM_080425:exon1:c.G844A:p.G282S Missense Mutation cancer gene census COSM4099804 peritoneal fluid EC3 chr20:57470723 A G GNAS NM_080425exon2c.A2125Gp.N709D Missense Mutation cancer gene census peritoneal fluid EC3 chr16:64982522 G A CDH11 NM_001308392:exon13:c.C2063T:p.T688I Missense Mutation cancer gene census peritoneal fluid EC3 chr16:65016102 C T CDH11 NM_001308392exon8c.G1102Ap.V368M Missense Mutation cancer gene census peritoneal fluid EC3 chr7:151945060 G A KMT2C NM_170606:exon14:c.C2459T:p.T820I Missense Mutation cancer gene census COSM4606481 peritoneal fluid EC3 chr7:151945225 T C KMT2C NM_170606:exon14:c.A2294G:p.E765G Missense Mutation cancer gene census COSM227525 peritoneal fluid EC3 chr7:151945228 G A KMT2C NM_170606:exon14:c.C2291T:p.S764F Missense Mutation cancer gene census COSM5941288 peritoneal fluid EC3 chr7:151962265 C T KMT2C NM_170606:exon8:c.G1042A:p.D348N Missense Mutation cancer gene census COSM228110 peritoneal fluid EC3 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 peritoneal fluid EC3 chr7:151962294 G A KMT2C NM_170606:exon8:c.C1013T:p.S338L Missense Mutation cancer gene census COSM6056929 peritoneal fluid EC3 chr12:49426905 TTGC T KMT2D NM_003482:exon39:c.11580_11582del:p.3860_3861del In Frame deletion cancer gene census peritoneal fluid EC3 chr11:128677120 A G FLI1 NM_002017exon7c.A767Gp.Q256R Missense Mutation cancer gene census peritoneal fluid EC3 chr11:128628148 C T FLI1 NM_002017exon2c.C157Tp.P53S Missense Mutation cancer gene census COSM7266680 peritoneal fluid EC3 chr5:131326641 C T ACSL6 NM_001009185exon3c.G290Ap.R97Q Missense Mutation cancer gene census peritoneal fluid EC3 chr11:92531397 A C FAT3 NM_001008781exon9c.A5218Cp.I1740L Missense Mutation cancer gene census peritoneal fluid EC3 chr12:459872 T A KDM5A NM_001042603:exon10:c.A1223T:p.E408V Missense Mutation cancer gene census peritoneal fluid EC3 chr6:29911239 TT CA HLA-A NM_001242758:exon3:c.538_539CA In Frame substitution cancer gene census peritoneal fluid EC3 chr19:10935790 C T DNM2 NM_001005360exon18c.C1951Tp.R651W Missense Mutation cancer gene census peritoneal fluid EC3 chr12:6700879 C T CHD4 NM_001273exon21c.G3203Ap.R1068H Missense Mutation cancer gene census COSM2098488 peritoneal fluid EC3 chr12:6701714 CA C CHD4 NM_001297553:exon18:c.2771delT:p.L924fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr20:31022441 AGG A ASXL1 NM_001363734:exon11:c.1744_1745del:p.G582fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr4:187534472 AG A FAT1 NM_005245:exon13:c.9253delC:p.L3085fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr13:35770297 A G NBEA NM_015678:exon31:c.A5224G:p.N1742D Missense Mutation cancer gene census peritoneal fluid EC3 chr4:126373366 AT A FAT4 NM_001291285:exon9:c.11202delT:p.H3734fs Frameshift deletion cancer gene census peritoneal fluid EC3 chrX:37028648 G A FAM47C NM_001013736:exon1:c.G2165A:p.R722H Missense Mutation cancer gene census peritoneal fluid EC3 chr7:50467747 C T IKZF1 NM_006060exon8c.C982Tp.R328C Missense Mutation cancer gene census COSM6982713 peritoneal fluid EC3 chr17:15935762 G A NCOR1 NM_006311exon46c.C7171Tp.R2391W Missense Mutation cancer gene census COSM245970 peritoneal fluid EC3 chr19:18562379 A C ELL NM_006532:exon7:c.T949G:p.S317A Missense Mutation cancer gene census peritoneal fluid EC3 chr14:95579536 G A DICER1 NM_001195573exon11c.C1933Tp.P645S Missense Mutation cancer gene census peritoneal fluid EC3 chr14:95569720 G A DICER1 NM_001195573exon20c.C4013Tp.A1338V Missense Mutation cancer gene census peritoneal fluid EC3 chr19:42790927 G A CIC NM_015125:exon2:c.G72A:p.W24X Nonsense Mutation cancer gene census peritoneal fluid EC3 chr19:42776954 GC G CIC NM_001304815:exon2:c.1020delC:p.R340fs Frameshift deletion cancer gene census peritoneal fluid EC3 chr11:71716381 A C NUMA1 NM_006185exon23c.T5727Gp.D1909E Missense Mutation cancer gene census peritoneal fluid EC3 chr3:37059047 G A MLH1 NM_000249exon10c.G841Ap.A281T Missense Mutation cancer gene census peritoneal fluid EC3 chr2:141762945 G C LRP1B NM_018557:exon15:c.C2462G:p.A821G Missense Mutation cancer gene census peritoneal fluid EC3 chr12:70929822 A G PTPRB NM_001109754exon29c.T6064Cp.C2022R Missense Mutation cancer gene census peritoneal fluid EC3 chr2:25467478 T C DNMT3A NM_022552exon14c.A1598Gp.Y533C Missense Mutation cancer gene census COSM231555 peritoneal fluid EC3 chr16:9857080 T C GRIN2A NM_001134407exon13c.A4321Gp.T1441A Missense Mutation cancer gene census COSM1609805 peritoneal fluid EC3 chr1:198713220 A G PTPRC NM_002838exon26c.A2735Gp.Y912C Missense Mutation cancer gene census peritoneal fluid EC3 chr17:66547263 T G PRKAR1A NM_001276290:exon10:c.T1012G:p.X338E Nonsense Mutation cancer gene census peritoneal fluid EC1 chr11:64572092 CG C MEN1 NM_000244:exon10:c.1561delC:p.R521fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr15:45003785 CTCTT C B2M NM_004048:exon1:c.42_45del:p.S14fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr7:33044951 C G FKBP9 NM_001284341exon11c.C1860Gp.H620Q Missense Mutation cancer gene census COSM5000147 peritoneal fluid EC1 chr3:178916726 G A PIK3CA NM_006218:exon2:c.G113A:p.R38H Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM745 peritoneal fluid EC1 chr8:1882056 C T ARHGEF10 NM_001308152:exon25:c.C3056T:p.A1019V Missense Mutation cancer gene census peritoneal fluid EC1 chr1:36935322 TG T CSF3R NM_000760:exon11:c.1404delC:p.P468fs Frameshift deletion cancer gene census}

^{peritoneal fluid EC1 chr10:8097689 C A GATA3 NM_001002295exon2c.C71Ap.P24Q Missense Mutation cancer gene census peritoneal fluid EC1 chr7:91732115 G A AKAP9 NM_005751:exon46:c.G11305A:p.V3769I Missense Mutation cancer gene census COSM6844033 peritoneal fluid EC1 chr10:89692905 G A PTEN NM_000314exon5c.G389Ap.R130Q Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM5033 peritoneal fluid EC1 chr16:67645338 C CA CTCF NM_001363916:exon3:c.604dupA:p.A201fs Frameshift insertion cancer gene census, Shukla et al. peritoneal fluid EC1 chr3:30691871 GA G TGFBR2 NM_003242:exon3:c.374delA:p.E125fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr19:4363385 G A SH3GL1 NM_003025exon7c.C710Tp.A237V Missense Mutation cancer gene census COSM4399493 peritoneal fluid EC1 chr2:189873773 GC G COL3A1 NM_000090:exon48:c.3650delC:p.A1217fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr2:189858966 G A COL3A1 NM_000090:exon18:c.G1201A:p.A401T Missense Mutation cancer gene census COSM6633063 peritoneal fluid EC1 chr1:65301111 GT G JAK1 NM_001321852:exon24:c.3336delA:p.K1112fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr1:65306996 GT G JAK1 NM_001321852:exon19:c.2580delA:p.K860fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr1:65339110 CT C JAK1 NM_001321852:exon5:c.425delA:p.K142fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr1:65339110 CT CTT JAK1 NM_001321852:exon5:c.424dupA:p.K142fs Frameshift insertion cancer gene census peritoneal fluid EC1 chr1:11264698 G T MTOR NM_004958:exon26:c.C3864A:p.S1288R Missense Mutation cancer gene census peritoneal fluid EC1 chr18:45422959 G A SMAD2 NM_001003652:exon2:c.C169T:p.R57X Nonsense Mutation cancer gene census peritoneal fluid EC1 chr7:86416066 G A GRM3 NM_000840exon3c.G958Ap.A320T Missense Mutation cancer gene census COSM6675926 peritoneal fluid EC1 chr16:15802686 TG T MYH11 NM_022844:exon41:c.5798delC:p.P1933fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr3:121179009 C T POLQ NM_199420:exon25:c.G7040A:p.R2347H Missense Mutation cancer gene census peritoneal fluid EC1 chr19:52714556 G A PPP2R1A NM_014225:exon4:c.G314A:p.R105Q Missense Mutation cancer gene census, Shukla et al. COSM1000437 peritoneal fluid EC1 chr18:48591862 C A SMAD4 NM_005359:exon9:c.C1025A:p.P342H Missense Mutation cancer gene census peritoneal fluid EC1 chr18:50961517 G A D.C.C. NM_005215:exon22:c.G3167A:p.R1056H Missense Mutation cancer gene census peritoneal fluid EC1 chr8:71057068 C T NCOA2 NM_001321703exon13c.G2621Ap.R874Q Missense Mutation cancer gene census COSM8191115 peritoneal fluid EC1 chr16:3786721 T G CREBBP NM_001079846:exon26:c.A4376C:p.K1459T Missense Mutation cancer gene census peritoneal fluid EC1 chr2:24930309 T A NCOA1 NM_147233exon11c.T1970Ap.V657D Missense Mutation cancer gene census peritoneal fluid EC1 chr2:24952635 C T NCOA1 NM_147233exon15c.C3152Tp.P1051L Missense Mutation cancer gene census peritoneal fluid EC1 chr2:24964684 G A NCOA1 NM_147233exon17c.G3335Ap.R1112H Missense Mutation cancer gene census COSM7279514 peritoneal fluid EC1 chr1:3328253 C A PRDM16 NM_022114exon9c.C1492Ap.L498M Missense Mutation cancer gene census peritoneal fluid EC1 chr1:3347537 A G PRDM16 NM_022114exon15c.A3386Gp.D1129G Missense Mutation cancer gene census peritoneal fluid EC1 chr2:107039712 C T RGPD3 NM_001144013:exon20:c.G4711A:p.G1571R Missense Mutation cancer gene census COSM4593420 peritoneal fluid EC1 chr2:107041248 CT C RGPD3 NM_001144013:exon20:c.3174delA:p.K1058fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr2:107041612 A C RGPD3 NM_001144013:exon20:c.T2811G:p.S937R Missense Mutation cancer gene census COSM6374549 peritoneal fluid EC1 chr19:49458970 TG T BAX NM_001291429:exon2:c.3delG:p.M1fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr2:30143516 TG T ALK NM_004304:exon1:c.9delC:p.A3fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr2:29450509 C T ALK NM_004304:exon17:c.G2845A:p.E949K Missense Mutation cancer gene census COSM2941481 peritoneal fluid EC1 chr2:30142886 G A ALK NM_004304:exon1:c.C640T:p.R214C Missense Mutation cancer gene census COSM4436841 peritoneal fluid EC1 chr22:39381947 C T APOBEC3B NM_001270411exon3c.C305Tp.A102V Missense Mutation cancer gene census peritoneal fluid EC1 chr12:1291165 CA C ERC1 NM_001301248:exon9:c.1951delA:p.K651fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr6:163899919 T.A. T QKI NM_001301085:exon3:c.394delA:p.K132fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr13:20567819 G GA ZMYM2 NM_001190965:exon3:c.608dupA:p.E203fs Frameshift insertion cancer gene census peritoneal fluid EC1 chr8:41550269 C T ANK1 NM_000037exon31c.G3755Ap.R1252Q Missense Mutation cancer gene census COSM2961407 peritoneal fluid EC1 chr8:41573252 AG A ANK1 NM_000037:exon14:c.1519delC:p.L507fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr16:2129384 T.A. GT TSC2 NM_001318831:exon24:c.2507_2508GT In Frame Substitution cancer gene census peritoneal fluid EC1 chr16:2112986 G T TSC2 NM_000548exon14c.G1375Tp.G459C Missense Mutation cancer gene census peritoneal fluid EC1 chr16:2138118 G A TSC2 NM_000548exon40c.G5138Ap.R1713H Missense Mutation cancer gene census COSM3277614 peritoneal fluid EC1 chr6:157505387 G A ARID1B NM_001346813exon13c.G3488Ap.R1163H Missense Mutation cancer gene census peritoneal fluid EC1 chr6:157528909 C T ARID1B NM_001346813exon20c.C6754Tp.R2252C Missense Mutation cancer gene census COSM7533400 peritoneal fluid EC1 chr1:27057936 GC G ARID1A NM_006015:exon3:c.1645delC:p.P549fs Frameshift deletion cancer gene census, Shukla et al. peritoneal fluid EC1 chr1:27100175 AC A ARID1A NM_006015:exon16:c.3972delC:p.Y1324fs Frameshift deletion cancer gene census, Shukla et al. peritoneal fluid EC1 chr1:27101116 AC A ARID1A NM_006015:exon18:c.4399delC:p.P1467fs Frameshift deletion cancer gene census, Shukla et al. peritoneal fluid EC1 chr1:27106077 GC G ARID1A NM_006015:exon20:c.5689delC:p.P1897fs Frameshift deletion cancer gene census, Shukla et al. peritoneal fluid EC1 chr1:27023559 AC A ARID1A NM_006015:exon1:c.666delC:p.Y222fs Frameshift deletion cancer gene census, Shukla et al. peritoneal fluid EC1 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. peritoneal fluid EC1 chr8:145741892 G C RECQL4 NM_004260:exon5:c.C611G:p.A204G Missense Mutation cancer gene census COSM1455690 peritoneal fluid EC1 chr8:145737136 G A RECQL4 NM_004260:exon21:c.C3430T:p.R1144C Missense Mutation cancer gene census peritoneal fluid EC1 chr1:17939624 TG T ARHGEF10L NM_018125:exon8:c.682delG:p.G228fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr1:17952490 G A ARHGEF10L NM_018125exon14c.G1357Ap.G453R Missense Mutation cancer gene census peritoneal fluid EC1 chr2:16080794 A ACCCCCCCCCCCC MYCN NM_001293231:exon1:c.86_87insCCCCCCCCCCCC:p.H29delinsHPPPP In Frame insertion cancer gene census peritoneal fluid EC1 chr2:16080800 G C MYCN NM_001293231:exon1:c.G92C:p.R31P Missense Mutation cancer gene census peritoneal fluid EC1 chr1:40367556 C T MYCL NM_001033082exon1c.G5Ap.C2Y Missense Mutation cancer gene census peritoneal fluid EC1 chr19:1612385 C T TCF3 NM_001136139exon18c.G1634Ap.R545Q Missense Mutation cancer gene census peritoneal fluid EC1 chr10:61666044 C A CCDC6 NM_005436:exon1:c.G139T:p.G47W Missense Mutation cancer gene census peritoneal fluid EC1 chr5:176721180 G T NSD1 NM_022455exon23c.G6811Tp.G2271W Missense Mutation cancer gene census peritoneal fluid EC1 chr16:72821959 CG C ZFHX3 NM_001164766:exon9:c.7473delC:p.P2491fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr16:72829313 GT G ZFHX3 NM_001164766:exon8:c.4525delA:p.T1509fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr16:72830330 G A ZFHX3 NM_006885exon9c.C6251Tp.P2084L Missense Mutation cancer gene census peritoneal fluid EC1 chr16:72830902 CCT C ZFHX3 NM_001164766:exon8:c.2935_2936del:p.R979fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr16:72833968 G A ZFHX3 NM_001164766:exon7:c.C1183T:p.R395X Nonsense Mutation cancer gene census peritoneal fluid EC1 chr8:114326902 C T CSMD3 NM_001363185exon2c.G299Ap.R100Q Missense Mutation cancer gene census COSM3644438 peritoneal fluid EC1 chr3:142281841 T T.A. ATR NM_001184:exon4:c.402dupT:p.K135_S136delinsX Nonsense Mutation cancer gene census peritoneal fluid EC1 chr5:180030323 G A FLT4 NM_182925:exon30:c.C3961T:p.R1321W Missense Mutation cancer gene census COSM6913857 peritoneal fluid EC1 chr5:180058747 CG C FLT4 NM_001354989:exon2:c.89delC:p.P30fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr19:50909469 G A POLD1 NM_001308632exon10c.G1273Ap.A425T Missense Mutation cancer gene census peritoneal fluid EC1 chr19:50919734 C T POLD1 NM_001256849exon23c.C2902Tp.R968C Missense Mutation cancer gene census COSM8565350 peritoneal fluid EC1 chr22:36696947 GCTC G MYH9 NM_002473:exon22:c.2785_2787del:p.929_929del In Frame deletion cancer gene census peritoneal fluid EC1 chr2:148683685 T.A. T ACVR2A NM_001278580:exon10:c.979delA:p.K327fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr11:3041523 C T CARS NM_001014437exon11c.G1193Ap.R398H Missense Mutation cancer gene census COSM8200273 peritoneal fluid EC1 chrX:107977802 GC G IRS4 NM_003604:exon1:c.1772delG:p.G591fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr12:112229926 TG T ALDH2 NM_001204889:exon7:c.717delG:p.L239fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr2:109382877 T G RANBP2 NM_006267:exon20:c.T5882G:p.F1961C Missense Mutation cancer gene census peritoneal fluid EC1 chr14:56114758 T G KTN1 NM_001079521exon20c.T2223Gp.D741E Missense Mutation cancer gene census peritoneal fluid EC1 chr20:62161465 A C PTK6 NM_005975:exon7:c.T1134G:p.H378Q Missense Mutation cancer gene census peritoneal fluid EC1 chr16:14038663 C T ERCC4 NM_005236:exon10:c.C1988T:p.A663V Missense Mutation cancer gene census peritoneal fluid EC1 chr17:20013776 C A SPECC1 NM_001033553exon3c.C184Ap.P62T Missense Mutation cancer gene census peritoneal fluid EC1 chr7:148506402 CT C EZH2 NM_001203249:exon17:c.1941delA:p.K647fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr7:75183817 G T HIP1 NM_001243198exon20c.C1972Ap.L658I Missense Mutation cancer gene census peritoneal fluid EC1 chr17:63533136 CG C AXIN2 NM_004655:exon7:c.1757delC:p.T586fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr17:63534428 CG C AXIN2 NM_001363813:exon5:c.1092delC:p.P364fs Frameshift deletion cancer gene census}

^{peritoneal fluid EC1 chr16:396253 C T AXIN1 NM_003502exon2c.G773Ap.G258D Missense Mutation cancer gene census peritoneal fluid EC1 chrX:70342972 T A MED12 NM_005120:exon11:c.T1513A:p.S505T Missense Mutation cancer gene census peritoneal fluid EC1 chrX:125298773 C T DCAF12L2 NM_001013628:exon1:c.G1135A:p.A379T Missense Mutation cancer gene census peritoneal fluid EC1 chr16:24185859 C T PRKCB NM_002738exon12c.C1352Tp.A451V Missense Mutation cancer gene census peritoneal fluid EC1 chr1:156085043 G T LMNA NM_001282626:exon1:c.G334T:p.E112X Nonsense Mutation cancer gene census peritoneal fluid EC1 chr1:156106151 G A LMNA NM_001282626exon7c.G1304Ap.R435H Missense Mutation cancer gene census peritoneal fluid EC1 chr17:37868249 G A ERBB2 NM_001289937exon8c.G970Ap.A324T Missense Mutation cancer gene census COSM5852397 peritoneal fluid EC1 chr9:139391317 C A NOTCH1 NM_017617:exon34:c.G6874T:p.G2292W Missense Mutation cancer gene census peritoneal fluid EC1 chr9:139399237 C T NOTCH1 NM_017617:exon26:c.G4906A:p.E1636K Missense Mutation cancer gene census COSM308616 peritoneal fluid EC1 chr1:120458550 A C NOTCH2 NM_024408:exon34:c.T6795G:p.N2265K Missense Mutation cancer gene census peritoneal fluid EC1 chr1:120548047 T G NOTCH2 NM_001200001exon3c.A320Cp.H107P Missense Mutation cancer gene census peritoneal fluid EC1 chr2:237489668 C T ACKR3 NM_020311:exon2:c.C560T:p.T187M Missense Mutation cancer gene census peritoneal fluid EC1 chr1:16262714 G A SPEN NM_015001:exon11:c.G9979A:p.A3327T Missense Mutation cancer gene census COSM5369707 peritoneal fluid EC1 chr9:98278958 TTTC T PTCH1 NM_001083603:exon1:c.142_144del:p.48_48del In Frame deletion cancer gene census peritoneal fluid EC1 chr1:59248065 CTTCA C JUN NM_002228:exon1:c.674_677del:p.L225fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr1:59248460 T TG JUN NM_002228:exon1:c.282dupC:p.T95fs Frameshift insertion cancer gene census peritoneal fluid EC1 chr5:56176539 C T MAP3K1 NM_005921:exon12:c.C2089T:p.R697C Missense Mutation cancer gene census COSM3683862 peritoneal fluid EC1 chr6:136599201 C G BCLAF1 NM_001077441exon4c.G818Cp.G273A Missense Mutation cancer gene census peritoneal fluid EC1 chr6:136599459 G A BCLAF1 NM_001077441exon4c.C560Tp.P187L Missense Mutation cancer gene census COSM9396825 peritoneal fluid EC1 chr9:134016079 C T NUP214 NM_001318324:exon11:c.C1276T:p.R426X Nonsense Mutation cancer gene census peritoneal fluid EC1 chr1:150933158 GC G SETDB1 NM_001145415:exon16:c.2621delC:p.A874fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr1:150917623 T TG SETDB1 NM_001243491:exon9:c.1180dupG:p.G393fs Frameshift insertion cancer gene census peritoneal fluid EC1 chr12:56495374 TGAA T ERBB3 NM_001982:exon28:c.3565_3567del:p.1189_1189del In Frame deletion cancer gene census peritoneal fluid EC1 chr13:32914817 G A BRCA2 NM_000059:exon11:c.G6325A:p.V2109I Missense Mutation cancer gene census peritoneal fluid EC1 chr6:28872418 G A TRIM27 NM_006510:exon8:c.C971T:p.T324M Missense Mutation cancer gene census COSM5483108 peritoneal fluid EC1 chr17:8050996 G A PER1 NM_002616:exon11:c.C1384T:p.R462C Missense Mutation cancer gene census COSM7277718 peritoneal fluid EC1 chr5:176516607 C T FGFR4 NM_022963exon1c.C4Tp.R2W Missense Mutation cancer gene census peritoneal fluid EC1 chr3:47098913 G A SETD2 NM_014159exon15c.C6361Tp.R2121C Missense Mutation cancer gene census COSM6934499 peritoneal fluid EC1 chr4:1807802 C T FGFR3 NM_001163213exon14c.C1867Tp.R623C Missense Mutation cancer gene census peritoneal fluid EC1 chr10:32337433 T G KIF5B NM_004521:exon2:c.A173C:p.Q58P Missense Mutation cancer gene census peritoneal fluid EC1 chr14:38061459 G A FOXA1 NM_004496:exon2:c.C530T:p.S177L Missense Mutation cancer gene census COSM6568788 peritoneal fluid EC1 chr19:11144089 G A SMARCA4 NM_001128845:exon25:c.G3670A:p.V1224M Missense Mutation cancer gene census COSM6784883 peritoneal fluid EC1 chr22:21347168 G A LZTR1 NM_006767:exon11:c.G1235A:p.R412H Missense Mutation cancer gene census COSM1032421 peritoneal fluid EC1 chr22:21341825 G A LZTR1 NM_006767:exon4:c.G353A:p.R118H Missense Mutation cancer gene census COSM3308552 peritoneal fluid EC1 chr17:78320342 T C RNF213 NM_001256071:exon29:c.T8207C:p.V2736A Missense Mutation cancer gene census peritoneal fluid EC1 chr17:78336945 C T RNF213 NM_001256071:exon40:c.C11399T:p.A3800V Missense Mutation cancer gene census COSM5434416 peritoneal fluid EC1 chr19:18870878 AG A CRTC1 NM_015321:exon8:c.727delG:p.G243fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr19:18887992 TC T CRTC1 NM_015321:exon14:c.1706delC:p.S569fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr11:95826474 G A MAML2 NM_032427:exon2:c.C721T:p.R241X Nonsense Mutation cancer gene census peritoneal fluid EC1 chr1:144886159 C A PDE4DIP NM_001350521exon26c.G3486Tp.E1162D Missense Mutation cancer gene census peritoneal fluid EC1 chr2:100170901 G A AFF3 NM_001025108exon23c.C3506Tp.P1169L Missense Mutation cancer gene census COSM1481767 peritoneal fluid EC1 chr2:100210409 C T AFF3 NM_001025108exon14c.G1789Ap.A597T Missense Mutation cancer gene census COSM5859749 peritoneal fluid EC1 chr4:87968591 C T AFF1 NM_001166693exon4c.C904Tp.R302W Missense Mutation cancer gene census COSM1058567 peritoneal fluid EC1 chr6:117642517 T TTC ROS1 NM_002944:exon35:c.5681_5682insGA:p.E1894fs Frameshift insertion cancer gene census peritoneal fluid EC1 chr22:29130471 G T CHEK2 NM_001005735exon2c.C239Ap.P80H Missense Mutation cancer gene census peritoneal fluid EC1 chr9:36882049 CG C PAX5 NM_001280553:exon7:c.834delC:p.P278fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr9:37020768 A C PAX5 NM_001280547exon2c.T77Gp.V26G Missense Mutation cancer gene census COSM85951 peritoneal fluid EC1 chr1:19029647 G A PAX7 NM_001135254exon7c.G1012Ap.G338R Missense Mutation cancer gene census peritoneal fluid EC1 chr3:192516548 C T MB21D2 NM_178496:exon2:c.G1103A:p.C368Y Missense Mutation cancer gene census peritoneal fluid EC1 chr17:7572962 GT G TP53 NM_001126115:exon7:c.750delA:p.K250fs Frameshift deletion cancer gene census, Westin et al. peritoneal fluid EC1 chr17:7578474 CG C TP53 NM_001126115:exon1:c.59delC:p.P20fs Frameshift deletion cancer gene census, Westin et al. peritoneal fluid EC1 chr17:7577538 C T TP53 NM_000546exon7c.G743Ap.R248Q Missense Mutation cancer gene census, Westin et al. COSM10662 peritoneal fluid EC1 chr12:122246180 T TG SETD1B NM_001353345:exon4:c.612dupG:p.V204fs Frameshift insertion cancer gene census peritoneal fluid EC1 chr2:178096054 G A NFE2L2 NM_006164exon5c.C1277Tp.P426L Missense Mutation cancer gene census peritoneal fluid EC1 chr5:11110988 TTTC T CTNND2 NM_001288716:exon11:c.1431_1433del:p.477_478del In Frame deletion cancer gene census peritoneal fluid EC1 chrX:129155008 AG A BCORL1 NM_001184772:exon4:c.3491delG:p.R1164fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr12:57493609 C T STAT6 NM_001178078exon15c.G1685Ap.R562H Missense Mutation cancer gene census COSM9200324 peritoneal fluid EC1 chr12:57500551 G A STAT6 NM_001178078exon5c.C403Tp.R135W Missense Mutation cancer gene census peritoneal fluid EC1 chr2:47637374 C T MSH2 NM_000251:exon3:c.C508T:p.Q170X Nonsense Mutation cancer gene census peritoneal fluid EC1 chr2:47657029 C T MSH2 NM_000251:exon7:c.C1225T:p.Q409X Nonsense Mutation cancer gene census peritoneal fluid EC1 chr20:50400982 AC A SALL4 NM_001318031:exon4:c.1672delG:p.V558fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr17:5036823 T C USP6 NM_004505exon6c.T362Cp.L121S Missense Mutation cancer gene census COSM4591808 peritoneal fluid EC1 chr17:5036834 G A USP6 NM_004505exon6c.G373Ap.G125R Missense Mutation cancer gene census COSM4591349 peritoneal fluid EC1 chr17:5036838 G A USP6 NM_004505exon6c.G377Ap.R126K Missense Mutation cancer gene census COSM4591351 peritoneal fluid EC1 chr17:5036843 C A USP6 NM_004505exon6c.C382Ap.Q128K Missense Mutation cancer gene census COSM4590856 peritoneal fluid EC1 chr17:5072276 C T USP6 NM_004505exon27c.C3443Tp.S1148L Missense Mutation cancer gene census COSM1384531 peritoneal fluid EC1 chr11:128781217 G C KCNJ5 NM_000890exon2c.G49Cp.V17L Missense Mutation cancer gene census peritoneal fluid EC1 chr11:128786360 C T KCNJ5 NM_000890:exon3:c.C994T:p.R332X Nonsense Mutation cancer gene census peritoneal fluid EC1 chr20:57428403 A G GNAS NM_080425:exon1:c.A83G:p.Q28R Missense Mutation cancer gene census peritoneal fluid EC1 chr17:48266329 G A COL1A1 NM_000088:exon41:c.C2980T:p.R994C Missense Mutation cancer gene census peritoneal fluid EC1 chr12:57484963 C T NAB2 NM_001330305exon2c.C139Tp.R47W Missense Mutation cancer gene census peritoneal fluid EC1 chr2:32664600 C T BIRC6 NM_016252:exon16:c.C3656T:p.S1219L Missense Mutation cancer gene census COSM3746541 peritoneal fluid EC1 chr2:32703765 AC A BIRC6 NM_016252:exon36:c.7132delC:p.P2378fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr2:32712836 CTTT C BIRC6 NM_016252:exon41:c.7937_7939del:p.2646_2647del In Frame deletion cancer gene census peritoneal fluid EC1 chr11:118771770 A AG BCL9L NM_182557:exon6:c.2681dupC:p.P894fs Frameshift insertion cancer gene census peritoneal fluid EC1 chr8:32406277 GA G NRG1 NM_001160002:exon1:c.34delA:p.K12fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr5:1294671 GC G TERT NM_001193376:exon2:c.329delG:p.G110fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr7:151859802 C A KMT2C NM_170606:exon43:c.G10860T:p.K3620N Missense Mutation cancer gene census COSM5816425 peritoneal fluid EC1 chr7:151874147 CT C KMT2C NM_170606:exon38:c.8390delA:p.K2797fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr7:151970859 C A KMT2C NM_170606:exon7:c.G943T:p.G315C Missense Mutation cancer gene census COSM4381930 peritoneal fluid EC1 chr11:118343381 C T KMT2A NM_001197104exon3c.C1507Tp.R503W Missense Mutation cancer gene census COSM1638751 peritoneal fluid EC1 chr22:24175856 GAGA G SMARCB1 NM_001007468:exon8:c.1058_1060del:p.353_354del In Frame deletion cancer gene census peritoneal fluid EC1 chr1:14108559 G GA PRDM2 NM_001007257:exon3:c.3667dupA:p.K1222fs Frameshift insertion cancer gene census peritoneal fluid EC1 chr1:14108836 C T PRDM2 NM_012231exon8c.C4546Tp.R1516W Missense Mutation cancer gene census COSM3984157 peritoneal fluid EC1 chr12:49431949 CCTT C KMT2D NM_003482:exon34:c.9187_9189del:p.3063_3063del In Frame deletion cancer gene census peritoneal fluid EC1 chr17:53345382 G T HLF NM_002126exon2c.G386Tp.R129L Missense Mutation cancer gene census COSM6147193 peritoneal fluid EC1 chr1:15833436 CGAG C CASP9 NM_001229:exon4:c.585_587del:p.195_196del In Frame deletion cancer gene census peritoneal fluid EC1 chr1:147091500 AC A BCL9 NM_004326:exon8:c.1540delC:p.P514fs Frameshift deletion cancer gene census}

^{peritoneal fluid EC1 chr3:187446269 CG C BCL6 NM_001134738:exon5:c.1418delC:p.P473fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr3:187447034 T G BCL6 NM_001134738exon4c.A1159Cp.N387H Missense Mutation cancer gene census peritoneal fluid EC1 chr3:187447511 G A BCL6 NM_001134738exon4c.C682Tp.R228W Missense Mutation cancer gene census peritoneal fluid EC1 chr13:28537277 AC A CDX2 NM_001265:exon3:c.916delG:p.V306fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr15:88423656 C T NTRK3 NM_001012338exon19c.G2179Ap.G727R Missense Mutation cancer gene census peritoneal fluid EC1 chr8:128750586 CGAG C MYC NM_001354870:exon2:c.121_123del:p.41_41del In Frame deletion cancer gene census, Shukla et al. peritoneal fluid EC1 chr17:40362440 T G STAT5B NM_012448:exon14:c.A1756C:p.K586Q Missense Mutation cancer gene census peritoneal fluid EC1 chr17:40362446 GT G STAT5B NM_012448:exon14:c.1749delA:p.K583fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr10:72358783 G A PRF1 NM_001083116exon3c.C694Tp.R232C Missense Mutation cancer gene census peritoneal fluid EC1 chr2:190719322 A C PMS1 NM_000534exon9c.A1324Cp.S442R Missense Mutation cancer gene census COSM8165272 peritoneal fluid EC1 chrX:152822440 G A ATP2B3 NM_001001344exon14c.G2392Ap.D798N Missense Mutation cancer gene census peritoneal fluid EC1 chrX:152814194 C T ATP2B3 NM_001001344exon8c.C1220Tp.T407M Missense Mutation cancer gene census peritoneal fluid EC1 chr11:92577349 A G FAT3 NM_001008781exon18c.A10816Gp.I3606V Missense Mutation cancer gene census COSM8731489 peritoneal fluid EC1 chr11:92495256 G A FAT3 NM_001008781exon4c.G3904Ap.G1302R Missense Mutation cancer gene census peritoneal fluid EC1 chr12:498234 GC G KDM5A NM_001042603:exon1:c.23delG:p.G8fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr12:416952 CT C KDM5A NM_001042603:exon23:c.3597delA:p.K1199fs Frameshift deletion cancer gene census peritoneal fluid EC1 chrX:53223533 C T KDM5C NM_001353978exon23c.G3826Ap.E1276K Missense Mutation cancer gene census peritoneal fluid EC1 chr17:34151088 G A TAF15 NM_139215exon7c.G491Ap.R164H Missense Mutation cancer gene census peritoneal fluid EC1 chr6:29911930 CA TG HLA-A NM_001242758:exon4:c.651_652TG In Frame Substitution cancer gene census peritoneal fluid EC1 chr6:44229395 T G NFKBIE NM_004556:exon3:c.A1076C:p.H359P Missense Mutation cancer gene census peritoneal fluid EC1 chr19:10930662 GAGA G DNM2 NM_001005362:exon15:c.1667_1669del:p.556_557del In Frame deletion cancer gene census peritoneal fluid EC1 chr20:31022441 A AG ASXL1 NM_001363734:exon11:c.1744dupG:p.G581fs Frameshift insertion cancer gene census peritoneal fluid EC1 chrX:63411483 C T AMER1 NM_152424:exon2:c.G1684A:p.V562M Missense Mutation cancer gene census peritoneal fluid EC1 chr4:187541858 C T FAT1 NM_005245:exon10:c.G5882A:p.G1961D Missense Mutation cancer gene census peritoneal fluid EC1 chr4:187557308 A G FAT1 NM_005245:exon6:c.T4054C:p.S1352P Missense Mutation cancer gene census peritoneal fluid EC1 chr4:187627981 C T FAT1 NM_005245:exon2:c.G3001A:p.V1001M Missense Mutation cancer gene census peritoneal fluid EC1 chr4:187629979 T G FAT1 NM_005245:exon2:c.A1003C:p.T335P Missense Mutation cancer gene census peritoneal fluid EC1 chr9:8486236 CA C PTPRD NM_002839:exon28:c.2580delT:p.F860fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr9:8501057 G A PTPRD NM_002839:exon24:c.C1825T:p.P609S Missense Mutation cancer gene census COSM9033781 peritoneal fluid EC1 chrX:53407986 C T SMC1A NM_006306exon23c.G3460Ap.V1154I Missense Mutation cancer gene census peritoneal fluid EC1 chr12:57109800 A C NACA NM_001365896exon3c.T5514Gp.D1838E Missense Mutation cancer gene census peritoneal fluid EC1 chr12:57112549 C T NACA NM_001365896:exon3:c.G2765A:p.R922Q Missense Mutation cancer gene census peritoneal fluid EC1 chr22:28193568 TC T MN1 NM_002430:exon1:c.2963delG:p.G988fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr22:28194532 G T MN1 NM_002430:exon1:c.C2000A:p.P667H Missense Mutation cancer gene census peritoneal fluid EC1 chr22:28194559 G A MN1 NM_002430:exon1:c.C1973T:p.P658L Missense Mutation cancer gene census peritoneal fluid EC1 chr4:126373044 G A FAT4 NM_024582exon9c.G10873Ap.G3625S Missense Mutation cancer gene census COSM3600023 peritoneal fluid EC1 chr4:126241504 C A FAT4 NM_001291285exon1c.C3938Ap.P1313H Missense Mutation cancer gene census peritoneal fluid EC1 chr17:56432306 A C RNF43 NM_001305545:exon9:c.T1969G:p.X657G Nonsense Mutation cancer gene census peritoneal fluid EC1 chr17:56435372 G C RNF43 NM_001305544exon9c.C1765Gp.P589A Missense Mutation cancer gene census peritoneal fluid EC1 chr17:56435160 AC A RNF43 NM_001305545:exon8:c.1595delG:p.G532fs Frameshift deletion cancer gene census peritoneal fluid EC1 chrX:37027640 G A FAM47C NM_001013736:exon1:c.G1157A:p.R386H Missense Mutation cancer gene census peritoneal fluid EC1 chr16:74694873 G A RFWD3 NM_001370534exon2c.C475Tp.R159W Missense Mutation cancer gene census COSM6765338 peritoneal fluid EC1 chr11:118851213 T C FOXR1 NM_181721:exon5:c.T625C:p.F209L Missense Mutation cancer gene census peritoneal fluid EC1 chr1:45796969 T G MUTYH NM_001128425exon14c.A1361Cp.Q454P Missense Mutation cancer gene census peritoneal fluid EC1 chr9:133738258 C T ABL1 NM_007313exon4c.C715Tp.R239C Missense Mutation cancer gene census peritoneal fluid EC1 chr12:124831354 C T NCOR2 NM_001077261:exon32:c.G4085A:p.R1362H Missense Mutation cancer gene census peritoneal fluid EC1 chr12:124841250 CG C NCOR2 NM_001077261:exon24:c.3148delC:p.R1050fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr17:16029456 GT G NCOR1 NM_001190438:exon12:c.1246delA:p.T416fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr17:16062109 G A NCOR1 NM_001190440exon5c.C697Tp.R233C Missense Mutation cancer gene census peritoneal fluid EC1 chr5:31401568 GCT G DROSHA NM_001100412:exon35:c.3983_3984del:p.E1328fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr1:85733512 GA G BCL10 NM_001320715:exon3:c.466delT:p.S156fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr19:18561475 C T ELL NM_006532:exon8:c.G1277A:p.G426D Missense Mutation cancer gene census peritoneal fluid EC1 chr19:18576248 A G ELL NM_006532:exon4:c.T443C:p.V148A Missense Mutation cancer gene census peritoneal fluid EC1 chrX:39923667 T G BCOR NM_001123383exon7c.A3424Cp.S1142R Missense Mutation cancer gene census peritoneal fluid EC1 chr18:22805548 GT G ZNF521 NM_001308225:exon3:c.1673delA:p.N558fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr14:95556920 C T DICER1 NM_001271282exon27c.G5684Ap.R1895Q Missense Mutation cancer gene census COSM6935472 peritoneal fluid EC1 chr4:55953854 C.A.G. C KDR NM_002253:exon27:c.3580_3581del:p.L1194fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr19:42777487 C T CIC NM_001304815:exon2:c.C1552T:p.R518X Nonsense Mutation cancer gene census peritoneal fluid EC1 chr19:42778479 GC G CIC NM_001304815:exon2:c.2545delC:p.P849fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr19:42797375 GC G CIC NM_015125:exon15:c.3738delC:p.S1246fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr2:158595058 G A ACVR1 NM_001105exon10c.C1289Tp.P430L Missense Mutation cancer gene census COSM5860334 peritoneal fluid EC1 chr2:158630626 C T ACVR1 NM_001105exon6c.G617Ap.R206H Missense Mutation cancer gene census COSM1008053 peritoneal fluid EC1 chr2:60679778 G A BCL11A NM_018014:exon5:c.C2254T:p.R752C Missense Mutation cancer gene census peritoneal fluid EC1 chr14:99724144 C T BCL11B NM_022898exon2c.G91Ap.E31K Missense Mutation cancer gene census COSM959471 peritoneal fluid EC1 chr10:102891767 G A TLX1 NM_001195517exon1c.G469Ap.V157M Missense Mutation cancer gene census peritoneal fluid EC1 chr2:141356360 A C LRP1B NM_018557:exon43:c.T7034G:p.M2345R Missense Mutation cancer gene census peritoneal fluid EC1 chr12:57860074 T TG GLI1 NM_001160045:exon6:c.431dupG:p.W144fs Frameshift insertion cancer gene census peritoneal fluid EC1 chr12:70981023 C T PTPRB NM_001109754exon9c.G2075Ap.R692H Missense Mutation cancer gene census COSM2100913 peritoneal fluid EC1 chr9:117797538 CG C TNC NM_002160:exon22:c.5731delC:p.R1911fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr7:6441629 C T RAC1 NM_018890exon6c.C476Tp.P159L Missense Mutation cancer gene census COSM3640065 peritoneal fluid EC1 chr8:41834603 TC T KAT6A NM_001305878:exon7:c.1285delG:p.E429fs Frameshift deletion cancer gene census peritoneal fluid EC1 chr8:41838375 C T KAT6A NM_001305878exon5c.G896Ap.R299H Missense Mutation cancer gene census COSM3432439 peritoneal fluid EC1 chr7:137600663 C T CREB3L2 NM_001253775exon3c.G415Ap.V139I Missense Mutation cancer gene census peritoneal fluid EC1 chr5:224529 G A SDHA NM_001294332exon3c.G205Ap.A69T Missense Mutation cancer gene census COSM1196322 peritoneal fluid EC1 chr3:52439169 G A BAP1 NM_004656:exon11:c.C1073T:p.P358L Missense Mutation cancer gene census peritoneal fluid EC2 chr7:33044951 C G FKBP9 NM_001284341exon11c.C1860Gp.H620Q Missense Mutation cancer gene census COSM5000147 peritoneal fluid EC2 chr10:89692905 G A PTEN NM_000314exon5c.G389Ap.R130Q Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM5033 peritoneal fluid EC2 chr22:29446189 G A ZNRF3 NM_001206998exon8c.G2020Ap.E674K Missense Mutation cancer gene census peritoneal fluid EC2 chr22:29445818 ACAG A ZNRF3 NM_001206998:exon8:c.1650_1652del:p.550_551del In Frame deletion cancer gene census peritoneal fluid EC2 chr16:3786740 G T CREBBP NM_001079846:exon26:c.C4357A:p.Q1453K Missense Mutation cancer gene census COSM166408 peritoneal fluid EC2 chr2:107039712 C T RGPD3 NM_001144013:exon20:c.G4711A:p.G1571R Missense Mutation cancer gene census COSM4593420 peritoneal fluid EC2 chr12:1221460 C A ERC1 NM_001301248exon5c.C1397Ap.A466D Missense Mutation cancer gene census peritoneal fluid EC2 chr17:37682186 AA CC CDK12 NM_015083:exon13:c.3377_3378CC In Frame Substitution cancer gene census peritoneal fluid EC2 chr13:20577255 ACT A ZMYM2 NM_001190965:exon4:c.1114_1115del:p.L372fs Frameshift deletion cancer gene census peritoneal fluid EC2 chr19:13054441 AAGTGAGGCCTGGTCCTGGTCCTGATGTCGGGGGCGGGCAGGGCTGGCAGGGGGCAAGGCCCTGAGGTGTGTGCTCTGCCTGC A CALR NM_004343:exon8:c.1052_1053del:p.K351fs Frameshift deletion cancer gene census peritoneal fluid EC2 chr1:27057901 C T ARID1A NM_006015:exon3:c.C1609T:p.Q537X Nonsense Mutation cancer gene census, Shukla et al. peritoneal fluid EC2 chr1:27107166 GGACA G ARID1A NM_006015:exon20:c.6778_6781del:p.D2260fs Frameshift deletion cancer gene census, Shukla et al. peritoneal fluid EC2 chr1:27100181 CGCA C ARID1A NM_006015:exon16:c.3978_3980del:p.1326_1327del In Frame deletion cancer gene census, Shukla et al. peritoneal fluid EC2 chr5:176631130 G A NSD1 NM_022455exon4c.G1073Ap.R358Q Missense Mutation cancer gene census peritoneal fluid EC2 chr5:149786521 G GAGGCTTGGGAAGCTTCATGCGCAGGGTTCTCC CD74 NM_001025158:exon3:c.300_301insGGAGAACCTGCGCATGAAGCTTCCCCAAGCCT:p.P101fs Frameshift insertion cancer gene census peritoneal fluid EC2 chr2:109371421 G A RANBP2 NM_006267:exon16:c.G2263A:p.D755N Missense Mutation cancer gene census peritoneal fluid EC2 chr1:156105103 G GCTGGCAGCCAAGGAGGCGAAGCTTC LMNA NM_001257374:exon5:c.600_601insCTGGCAGCCAAGGAGGCGAAGCTTC:p.Q200fs Frameshift insertion cancer gene census peritoneal fluid EC2 chr1:16259547 G A SPEN NM_015001:exon11:c.G6812A:p.G2271D Missense Mutation cancer gene census peritoneal fluid EC2 chr20:20023097 C A CRNKL1 NM_016652exon9c.G1519Tp.A507S Missense Mutation cancer gene census peritoneal fluid EC2 chr2:223086094 T G PAX3 NM_181457exon6c.A805Cp.N269H Missense Mutation cancer gene census peritoneal fluid EC2 chr5:11110988 TTTC T CTNND2 NM_001288716:exon11:c.1431_1433del:p.477_478del In Frame deletion cancer gene census peritoneal fluid EC2 chr7:27224119 GCGC G HOXA11 NM_005523:exon1:c.642_644del:p.214_215del In Frame deletion cancer gene census peritoneal fluid EC2 chr17:5036249 G T USP6 NM_004505exon5c.G240Tp.M80I Missense Mutation cancer gene census COSM4598023 peritoneal fluid EC2 chr7:151874147 CT C KMT2C NM_170606:exon38:c.8390delA:p.K2797fs Frameshift deletion cancer gene census peritoneal fluid EC2 chr7:151962290 C G KMT2C NM_170606:exon8:c.G1017C:p.K339N Missense Mutation cancer gene census COSM4587276 peritoneal fluid EC2 chr7:151970859 C A KMT2C NM_170606:exon7:c.G943T:p.G315C Missense Mutation cancer gene census COSM4381930 peritoneal fluid EC2 chr12:49445227 GCCGGGGTGCAGAGGTGGCGGCCCCTCGGA G KMT2D NM_003482:exon10:c.2212_2238del:p.738_746del In Frame deletion cancer gene census peritoneal fluid EC2 chr8:128750673 GCTGCCCACCCCGCCC G MYC NM_001354870:exon2:c.208_222del:p.70_74del In Frame deletion cancer gene census, Shukla et al. peritoneal fluid EC2 chr12:25398281 C T KRAS NM_001369786exon2c.G38Ap.G13D Missense Mutation cancer gene census, Westin et al. , The Cancer Genome Atlas Research Network, Shukla et al. COSM532 peritoneal fluid EC2 chr8:101721705 G T PABPC1 NM_002568:exon8:c.C1227A:p.F409L Missense Mutation cancer gene census COSM3269226 peritoneal fluid EC2 chr8:101721709 T A PABPC1 NM_002568:exon8:c.A1223T:p.Y408F Missense Mutation cancer gene census COSM3774310 peritoneal fluid EC2 chr6:29911098 T C HLA-A NM_001242758exon3c.T397Cp.F133L Missense Mutation cancer gene census peritoneal fluid EC2 chr12:6697027 G GTGA CHD4 NM_001297553:exon23:c.3532_3533insTCA:p.T1178delinsIT In Frame insertion cancer gene census peritoneal fluid EC2 chr5:67589138 G A PIK3R1 NM_181523exon10c.G1126Ap.G376R Missense Mutation cancer gene census, Westin et al. , Shukla et al. COSM35827 peritoneal fluid EC2 chr4:126328132 T G FAT4 NM_001291285exon3c.T5405Gp.L1802W Missense Mutation cancer gene census peritoneal fluid EC2 chr5:236619 T C SDHA NM_001330758exon10c.T1337Cp.V446A Missense Mutation cancer gene census COSM5071098 peritoneal fluid EC2 chr5:236628 C T SDHA NM_001330758exon10c.C1346Tp.A449V Missense Mutation cancer gene census COSM3734016 peritoneal fluid EC2 chr5:236649 C T SDHA NM_001330758exon10c.C1367Tp.S456L Missense Mutation cancer gene census COSM3774177 peritoneal fluid EC2 chr5:256483 CTT C SDHA NM_001330758:exon13:c.1701_1702del:p.T567fs Frameshift deletion cancer gene census}

* UCSC GRCh37/hg19

** Cancer Gene Census (http://cancer.sanger.ac.uk/census)

† COSMIC (http://cancer.sanger.ac.uk/cosmic)

First, we investigated the mutation allele frequencies (MAFs) of mutations shared between tissue, plasma, tissue and peritoneal fluid, and plasma and peritoneal fluid samples (Figure 1b). Spearman's correlation analysis was used to confirm significant positive correlation between tissue and peritoneal fluid samples. The coefficient value was r = 0.628 and p-value < 2.2 * 10 ¹⁶ (Figure 1b). A moderate positive correlation was confirmed between tissue and plasma samples and between plasma and peritoneal fluid samples (Figure 1b).

Between peritoneal fluid ctDNA, plasma ctDNA and tumor gDNA in the top 20 EC-related genes based on the COSMIC database (https://cancer.sanger.ac.uk/cosmic; accessed 2021.08.15), consistent with the above correlation analysis. Concordance of somatic mutations was confirmed (Figure 1c). In particular, TP53 and POLE were identified in EC1, EC3, EC4, and EC7. Mutations in this gene have been shown to contribute to the classification of EC into molecular subtypes in previous studies. TP53 non-silent mutations identified in four EC patients (EC1, EC3, EC4, and EC7) were identified in tissues except EC4 (Tables 2, 5, and S3). Nonsense and missense mutations (p.R174X and p.R181C) in TP53 were identified in both peritoneal fluid and plasma ctDNA samples from EC4 patients, but not in tissues (Figure 1c, Tables 2 and 5 ).

One missense mutation (p.A465V) in POLE, which has been reported to be associated with EC, was identified in both plasma and peritoneal fluid ctDNA of EC4 (Figure 1C and Table 5). The mutation is classified as a POLE EDM mutation and is located in the exonuclease domain of POLE, resulting in an abnormally high mutagenic burden. The presence of POLE EDM mutations is one of the criteria used to classify EC into molecular subtypes. Plasma and peritoneal fluid ctDNA from EC4 and EC5 with POLE mutations showed a high tumor mutational burden (TMB) of ≥20 mutations per megabase.

Additionally, ARID1A showed 4 nonsense and 2 missense mutations in 7 EC patients. One nonsense mutation (p.Q537X) in ARID1A was identified in both peritoneal fluid ctDNA and tumor gDNA of EC2 ( Fig. 1C ). PIK3CA, frequently reported to be mutated in EC genome studies, showed five missense mutations in four EC patients. One missense mutation in PIK3CA (p.R38H) was identified in both peritoneal fluid ctDNA and tumor gDNA from a patient with EC1, and another missense mutation in PIK3CA (p.R38C) was identified in both peritoneal fluid and plasma ctDNA from EC4. (Figure 1c).

Then, recurrent non-silent mutations (≥3 samples) in 401 cancer-related genes were analyzed in peritoneal fluid ctDNA, plasma ctDNA, and tumor gDNA samples (Figure 2a,b). We identified non-silent mutations in 46 genes among three DNA sources (tissue, peritoneal fluid, and plasma) and 26 genes in plasma ctDNA and tumor gDNA. Surprisingly, 23 out of 24 samples showed recurrent missense mutations in KMT2C. Additionally, 10 out of 24 samples showed recurrent nonsense mutations in PRKAR1A.

Additionally, most putative driver mutations (672 of 1314, 51%) showed negative effects on protein function, as detected by at least two methods: PolyPhen-2, PROVEAN, and SIFT analysis. (Table 6). Sixteen mutations in 11 genes were verified using Sanger sequencing (Figure 6).

Functional effects of somatic mutations in the endometrial cancer genome. Sample type Sample ID Gene Chr:
Position* Allele (Ref/Alt) Protein Function ^{** Amino acid change Mutation Allele Frequency peritoneal fluid EC4 FKBP9 chr7:33044951 C/G Damaging His620Gln 0.026 peritoneal fluid EC4 PIK3CA chr3:178916725 C/T Damaging Arg38Cys 0.142 peritoneal fluid EC4 NTHL1 chr16:2094737 G/A Benign Ala148Val 0.097 peritoneal fluid EC4 CTCF chr16:67650770 G/A Benign Ala359Thr 0.13 peritoneal fluid EC4 SH3GL1 chr19:4363820 C/T Damaging Arg174Gln 0.09 peritoneal fluid EC4 MTOR chr1:11318570 A/C Damaging Asn81Lys 0.083 peritoneal fluid EC4 STAG1 chr3:136062753 G/A Damaging Arg1123Trp 0.071 peritoneal fluid EC4 CUX1 chr7:101891852 G/A Benign Ala1361Thr 0.046 peritoneal fluid EC4 ZNF384 chr12:6787366 G/A Damaging Pro205Ser 0.097 peritoneal fluid EC4 CBL chr11:119144682 G/A Damaging Cys232Tyr 0.099 peritoneal fluid EC4 FLNA chrX:153592658 C/T Damaging Gly702Asp 0.104 peritoneal fluid EC4 FLNA chrX:153588265 G/A Damaging Arg1272Cys 0.031 peritoneal fluid EC4 POLQ chr3:121260261 G/A Damaging Arg272Trp 0.464 peritoneal fluid EC4 POLE chr12:133249829 G/A Damaging Ala476Val 0.105 peritoneal fluid EC4 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.06 peritoneal fluid EC4 CBLC chr19:45281364 C/A Benign Ala59Asp 0.396 peritoneal fluid EC4 CTNNB1 chr3:41266097 G/A Damaging Asp32Asn 0.126 peritoneal fluid EC4 CTNNB1 chr3:41280698 T/G Benign His737Gln 0.047 peritoneal fluid EC4 FIP1L1 chr4:54280840 G/A Benign Val292Ile 0.515 peritoneal fluid EC4 ANK1 chr8:41543759 C/A Benign Arg1434Met 0.029 peritoneal fluid EC4 KIAA1549 chr7:138546010 C/T Benign Ala1708Thr 0.055 peritoneal fluid EC4 KIAA1549 chr7:138601659 C/T Benign Ala905Thr 0.108 peritoneal fluid EC4 EXT2 chr11:44151679 G/A Damaging Met421Ile 0.086 peritoneal fluid EC4 TSC2 chr16:2112996 G/A Damaging Arg462His 0.049 peritoneal fluid EC4 ARID1A chr1:27101664 C/T Damaging Thr1649Ile 0.063 peritoneal fluid EC4 RECQL4 chr8:145739647 C/T N.A. 0.092 peritoneal fluid EC4 MYCN chr2:16080800 G/C N.A. 0.065 peritoneal fluid EC4 NSD1 chr5:176639004 G/A Benign Glu1202Lys 0.476 peritoneal fluid EC4 NSD3 chr8:38162180 T/G Damaging Ile846Leu 0.056 peritoneal fluid EC4 NSD3 chr8:38162266 A/C Damaging Met817Arg 0.098 peritoneal fluid EC4 ATM chr11:108139302 C/T Benign Thr935Met 0.5 peritoneal fluid EC4 ZFHX3 chr16:72991734 C/T Damaging Gly771Arg 0.496 peritoneal fluid EC4 ATR chr3:142238577 C/T Benign Gly1439Asp 0.067 peritoneal fluid EC4 ZBTB16 chr11:113934429 C/T Benign Thr136Ile 0.127 peritoneal fluid EC4 FANCG chr9:35076833 G/A Benign Ala271Val 0.083 peritoneal fluid EC4 EP300 chr22:41556673 T/G Benign Asn1206Lys 0.115 peritoneal fluid EC4 IRS4 chrX:107978612 A/C Damaging His321Gln 0.048 peritoneal fluid EC4 RANBP2 chr2:109380719 A/T Damaging Ile1242Phe 0.238 peritoneal fluid EC4 ERCC2 chr19:45867268 C/T Damaging Val309Met 0.044 peritoneal fluid EC4 ERCC4 chr16:14020478 G/A Damaging Arg150His 0.122 peritoneal fluid EC4 HIP1 chr7:75184771 C/T Damaging Ala638Thr 0.11 peritoneal fluid EC4 MED12 chrX:70345324 C/T Damaging Arg784Cys 0.13 peritoneal fluid EC4 DCAF12L2 chrX:125298907 G/A Benign Pro334Leu 0.038 peritoneal fluid EC4 NR4A3 chr9:102590452 G/A Benign Gly54Asp 0.091 peritoneal fluid EC4 PRKCB chr16:23847510 C/T Benign Ala5Val 0.499 peritoneal fluid EC4 NOTCH2 chr1:120458550 A/C Benign Asn2265Lys 0.046 peritoneal fluid EC4 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.034 peritoneal fluid EC4 CNTRL chr9:123886324 C/T Benign Thr589Met 0.368 peritoneal fluid EC4 PTCH1 chr9:98220396 C/T Benign Gly1023Ser 0.447 peritoneal fluid EC4 PTCH1 chr9:98238333 G/A Damaging Arg571Trp 0.126 peritoneal fluid EC4 NUP214 chr9:134064464 C/T Benign Pro1153Ser 0.143 peritoneal fluid EC4 NUP214 chr9:134073269 C/T Damaging Pro1442Leu 0.509 peritoneal fluid EC4 SETDB1 chr1:150933570 A/G Benign Glu1011Gly 0.035 peritoneal fluid EC4 BRCA2 chr13:32911589 G/A Damaging Asp1033Asn 0.091 peritoneal fluid EC4 PER1 chr17:8050696 C/T Damaging Val501Ile 0.052 peritoneal fluid EC4 PATZ1 chr22:31737552 C/T Benign Ala485Thr 0.114 peritoneal fluid EC4 FGFR2 chr10:123256134 C/T Damaging Arg593His 0.069 peritoneal fluid EC4 PTPN13 chr4:87653836 C/T Damaging Thr592Ile 0.123 peritoneal fluid EC4 PTPN13 chr4:87701620 G/A Benign Gly1991Asp 0.511 peritoneal fluid EC4 MYO5A chr15:52611411 T/G Damaging Asn1694His 0.027 peritoneal fluid EC4 RNF213 chr17:78320843 G/A Damaging Gly2952Asp 0.104 peritoneal fluid EC4 CRTC1 chr19:18857863 G/A Benign Ala144Thr 0.12 peritoneal fluid EC4 PDE4DIP chr1:145021150 T/C Damaging Asp84Gly 0.137 peritoneal fluid EC4 TRRAP chr7:98552779 C/T Damaging Ala1923Val 0.098 peritoneal fluid EC4 TRRAP chr7:98586417 C/T Damaging Ala3144Val 0.101 peritoneal fluid EC4 ASPSCR1 chr17:79967014 T/G Damaging Phe345Leu 0.16 peritoneal fluid EC4 TP53 chr17:7578389 G/A Damaging Arg181Cys 0.102 peritoneal fluid EC4 DDR2 chr1:162740216 G/A Benign Arg473His 0.089 peritoneal fluid EC4 NFE2L2 chr2:178096304 C/A Damaging Asp343Tyr 0.107 peritoneal fluid EC4 TBX3 chr12:115112152 C/T Benign Ala530Thr 0.094 peritoneal fluid EC4 CTNND1 chr11:57564191 A/G Damaging Tyr228Cys 0.518 peritoneal fluid EC4 CTNND1 chr11:57573427 G/A Benign Arg599His 0.066 peritoneal fluid EC4 SRC chr20:36031708 G/A Damaging Glu519Lys 0.076 peritoneal fluid EC4 SALL4 chr20:50405515 C/A Damaging Gly876Val 0.075 peritoneal fluid EC4 USP6 chr17:5036249 G/T Benign Met80Ile 0.149 peritoneal fluid EC4 CDH17 chr8:95143148 T/C Benign Asn747Ser 0.74 peritoneal fluid EC4 CDH17 chr8:95189837 G/A Benign Thr88Ile 0.094 peritoneal fluid EC4 NAB2 chr12:57486861 C/T N.A. His387Tyr 0.472 peritoneal fluid EC4 CD28 chr2:204594478 G/A Damaging Ala187Thr 0.171 peritoneal fluid EC4 ITGAV chr2:187511536 G/A Benign Arg428Gln 0.471 peritoneal fluid EC4 PLAG1 chr8:57079790 T/G Damaging His172Pro 0.036 peritoneal fluid EC4 KMT2C chr7:151864316 G/A Damaging Ala3222Val 0.074 peritoneal fluid EC4 KMT2C chr7:151945225 T/C Damaging Glu765Gly 0.056 peritoneal fluid EC4 KMT2C chr7:151962168 C/A Damaging Arg380Leu 0.04 peritoneal fluid EC4 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.04 peritoneal fluid EC4 KMT2C chr7:151970859 C/T Damaging Gly315Ser 0.056 peritoneal fluid EC4 KMT2A chr11:118367048 C/T Benign Ala1877Val 0.107 peritoneal fluid EC4 KMT2D chr12:49427327 G/T Benign Leu3721Met 0.056 peritoneal fluid EC4 KMT2D chr12:49443773 T/G Benign Ile1200Leu 0.019 peritoneal fluid EC4 CASP8 chr2:202141689 C/T Damaging Ala326Val 0.103 peritoneal fluid EC4 BCL9 chr1:147090772 C/T Benign Pro271Ser 0.045 peritoneal fluid EC4 AKT1 chr14:105240286 C/T Benign Arg222His 0.101 peritoneal fluid EC4 AKT2 chr19:40771158 A/G Benign Val6Ala 0.044 peritoneal fluid EC4 ARHGAP26 chr5:142281559 G/T Damaging Lys219Asn 0.138 peritoneal fluid EC4 FLI1 chr11:128642725 C/T Benign Ala145Val 0.047 peritoneal fluid EC4 ATP2B3 chrX:152815084 C/A Benign Leu490Ile 0.122 peritoneal fluid EC4 ATP2B3 chrX:152815684 G/A Benign Arg588His 0.016 peritoneal fluid EC4 SOCS1 chr16:11349055 C/T Damaging Arg94His 0.113 peritoneal fluid EC4 FAT3 chr11:92533158 G/A Benign Val2327Ile 0.159}

^{peritoneal fluid EC4 KDM5C chrX:53225935 C/T Benign Glu972Lys 0.086 peritoneal fluid EC4 HLA-A chr6:29912345 A/T Benign Ile322Phe 0.259 peritoneal fluid EC4 DNM2 chr19:10939914 A/G Damaging Asp754Gly 0.083 peritoneal fluid EC4 ASXL2 chr2:25973188 G/A Benign Pro413Ser 0.081 peritoneal fluid EC4 PTPRD chr9:8341268 G/A Damaging Arg1650Cys 0.108 peritoneal fluid EC4 MN1 chr22:28194691 C/T Damaging Arg614His 0.112 peritoneal fluid EC4 ETV5 chr3:185766567 G/A Damaging Pro507Leu 0.094 peritoneal fluid EC4 ZMYM3 chrX:70471082 G/A Damaging Arg244Cys 0.131 peritoneal fluid EC4 FAM47C chrX:37028026 T/C Benign Ser515Pro 0.037 peritoneal fluid EC4 NCOR2 chr12:124857057 A/G Benign Leu773Pro 0.046 peritoneal fluid EC4 DROSHA chr5:31493373 C/G Damaging Asp595His 0.131 peritoneal fluid EC4 KDM6A chrX:44732958 G/T Damaging Ser54Ile 0.113 peritoneal fluid EC4 ELL chr19:18562379 A/C Benign Ser317Ala 0.05 peritoneal fluid EC4 FES chr15:91434233 A/C Benign Ile448Leu 0.05 peritoneal fluid EC4 NUMA1 chr11:71720336 G/A Damaging Ala1606Val 0.058 peritoneal fluid EC4 NUMA1 chr11:71725265 G/A Benign Ala1095Val 0.052 peritoneal fluid EC4 NUMA1 chr11:71720164 C/T Benign Arg1636Gln 0.073 peritoneal fluid EC4 LATS2 chr13:21555688 G/A Damaging Ala861Val 0.122 peritoneal fluid EC4 MNX1 chr7:156802960 C/A Damaging Ala29Ser 0.085 peritoneal fluid EC4 GPC3 chrX:132670304 C/A Damaging Asp554Tyr 0.071 peritoneal fluid EC4 EZR chr6:159188460 C/G Benign Val477Leu 0.018 peritoneal fluid EC4 GRIN2A chr16:9858436 T/G Benign Asn989His 0.03 peritoneal fluid EC4 SDHA chr5:236649 C/T Damaging Ser456Leu 0.019 peritoneal fluid EC3 GATA3 chr10:8097728 A/C Benign Asp37Ala 0.065 peritoneal fluid EC3 MAX chr14:65544747 C/T Damaging Arg60Gln 0.102 peritoneal fluid EC3 CCND2 chr12:4388002 T/C Damaging Ile163Thr 0.092 peritoneal fluid EC3 CDKN1B chr12:12871222 G/T Damaging Gly150Val 0.035 peritoneal fluid EC3 SGK1 chr6:134492286 T/C Damaging Met400Val 0.091 peritoneal fluid EC3 EIF4A2 chr3:186507044 G/A Damaging Ala405Thr 0.084 peritoneal fluid EC3 PBRM1 chr3:52651319 T/C Damaging Met593Val 0.073 peritoneal fluid EC3 EGFR chr7:55211167 T/G Damaging Met137Arg 0.042 peritoneal fluid EC3 MYOD1 chr11:17742894 G/A Benign Ala268Thr 0.09 peritoneal fluid EC3 KIAA1549 chr7:138602271 C/T Benign Glu701Lys 0.135 peritoneal fluid EC3 SIX2 chr2:45235838 C/T Benign Val138Met 0.11 peritoneal fluid EC3 ARID1A chr1:27100880 A/G Benign Met1388Val 0.095 peritoneal fluid EC3 ARHGEF10L chr1:17958883 G/A Damaging Arg551His 0.088 peritoneal fluid EC3 TCF3 chr19:1625638 T/C Benign Thr95Ala 0.083 peritoneal fluid EC3 TPM4 chr19:16192856 GGT/CCC N.A. 0.038 peritoneal fluid EC3 ZFHX3 chr16:72831399 G/C Benign Gln1728Glu 0.105 peritoneal fluid EC3 FBXW7 chr4:153332900 A/G Damaging Leu19Pro 0.078 peritoneal fluid EC3 TET2 chr4:106164914 G/A Damaging Arg1282His 0.062 peritoneal fluid EC3 TENT5C chr1:118166487 A/C Damaging Ile333Leu 0.029 peritoneal fluid EC3 FOXL2 chr3:138664820 C/T Benign Ala249Thr 0.084 peritoneal fluid EC3 RANBP2 chr2:109384346 C/T Damaging Pro2451Ser 0.112 peritoneal fluid EC3 SPECC1 chr17:20059549 G/A Damaging Gly14Arg 0.023 peritoneal fluid EC3 YWHAE chr17:1303343 T/G Damaging Asp21Ala 0.042 peritoneal fluid EC3 CHST11 chr12:105150838 G/A Damaging Asp106Asn 0.076 peritoneal fluid EC3 NOTCH1 chr9:139412290 T/C Damaging Asp452Gly 0.09 peritoneal fluid EC3 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.046 peritoneal fluid EC3 PICALM chr11:85692947 T/C Damaging Asp539Gly 0.128 peritoneal fluid EC3 NUP214 chr9:134073296 C/T Benign Ser1451Leu 0.127 peritoneal fluid EC3 NUP214 chr9:134073967 A/G Damaging Thr1675Ala 0.067 peritoneal fluid EC3 FGFR3 chr4:1806059 G/A Benign Glu362Lys 0.096 peritoneal fluid EC3 DAXX chr6:33287620 C/T Benign Asp493Asn 0.071 peritoneal fluid EC3 NTRK1 chr1:156834151 T/A Damaging Ile73Asn 0.105 peritoneal fluid EC3 BCORL1 chrX:129147745 G/A N.A. Val333Ile 0.059 peritoneal fluid EC3 STAT6 chr12:57493667 T/C Benign Ser543Gly 0.069 peritoneal fluid EC3 MSH2 chr2:47630409 C/T Benign Pro27Ser 0.018 peritoneal fluid EC3 SALL4 chr20:50401031 C/T Damaging Gly979Ser 0.069 peritoneal fluid EC3 GNAS chr20:57429164 G/A Benign Gly282Ser 0.089 peritoneal fluid EC3 GNAS chr20:57470723 A/G Benign Asn709Asp 0.155 peritoneal fluid EC3 CDH11 chr16:64982522 G/A Benign Thr688Ile 0.093 peritoneal fluid EC3 CDH11 chr16:65016102 C/T Damaging Val368Met 0.089 peritoneal fluid EC3 KMT2C chr7:151945060 G/A Damaging Thr820Ile 0.026 peritoneal fluid EC3 KMT2C chr7:151945225 T/C Damaging Glu765Gly 0.069 peritoneal fluid EC3 KMT2C chr7:151945228 G/A Benign Ser764Phe 0.051 peritoneal fluid EC3 KMT2C chr7:151962265 C/T Damaging Asp348Asn 0.059 peritoneal fluid EC3 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.068 peritoneal fluid EC3 KMT2C chr7:151962294 G/A Benign Ser338Leu 0.064 peritoneal fluid EC3 FLI1 chr11:128677120 A/G Benign Gln256Arg 0.092 peritoneal fluid EC3 FLI1 chr11:128628148 C/T Benign Pro53Ser 0.092 peritoneal fluid EC3 ACSL6 chr5:131326641 C/T Benign Arg97Gln 0.052 peritoneal fluid EC3 FAT3 chr11:92531397 A/C Benign Ile1740Leu 0.104 peritoneal fluid EC3 KDM5A chr12:459872 T/A Damaging Glu408Val 0.092 peritoneal fluid EC3 DNM2 chr19:10935790 C/T Damaging Arg651Trp 0.05 peritoneal fluid EC3 CHD4 chr12:6700879 C/T Damaging Arg1068His 0.088 peritoneal fluid EC3 NBEA chr13:35770297 A/G Damaging Asn1742Asp 0.09 peritoneal fluid EC3 FAM47C chrX:37028648 G/A Benign Arg722His 0.12 peritoneal fluid EC3 IKZF1 chr7:50467747 C/T Damaging Arg328Cys 0.099 peritoneal fluid EC3 NCOR1 chr17:15935762 G/A Damaging Arg2391Trp 0.04 peritoneal fluid EC3 ELL chr19:18562379 A/C Benign Ser317Ala 0.086 peritoneal fluid EC3 DICER1 chr14:95579536 G/A Benign Pro645Ser 0.056 peritoneal fluid EC3 DICER1 chr14:95569720 G/A Benign Ala1338Val 0.134 peritoneal fluid EC3 NUMA1 chr11:71716381 A/C Damaging Asp1909Glu 0.019 peritoneal fluid EC3 MLH1 chr3:37059047 G/A Benign Ala281Thr 0.111 peritoneal fluid EC3 LRP1B chr2:141762945 G/C Benign Ala821Gly 0.081 peritoneal fluid EC3 PTPRB chr12:70929822 A/G Damaging Cys2022Arg 0.06 peritoneal fluid EC3 DNMT3A chr2:25467478 T/C Damaging Tyr533Cys 0.077 peritoneal fluid EC3 GRIN2A chr16:9857080 T/C Benign Thr1441Ala 0.112 peritoneal fluid EC3 PTPRC chr1:198713220 A/G Damaging Tyr912Cys 0.192 peritoneal fluid EC1 FKBP9 chr7:33044951 C/G Damaging His620Gln 0.045 peritoneal fluid EC1 PIK3CA chr3:178916726 G/A Damaging Arg38His 0.387 peritoneal fluid EC1 ARHGEF10 chr8:1882056 C/T Damaging Ala1082Val 0.095 peritoneal fluid EC1 GATA3 chr10:8097689 C/A Damaging Pro24Gln 0.168 peritoneal fluid EC1 AKAP9 chr7:91732115 G/A Benign Val3773Ile 0.38 peritoneal fluid EC1 PTEN chr10:89692905 G/A Damaging Arg130Gln 0.371 peritoneal fluid EC1 SH3GL1 chr19:4363385 G/A Benign Ala237Val 0.117 peritoneal fluid EC1 COL3A1 chr2:189858966 G/A Benign Ala401Thr 0.064 peritoneal fluid EC1 MTOR chr1:11264698 G/T Damaging Ser1288Arg 0.156 peritoneal fluid EC1 GRM3 chr7:86416066 G/A Damaging Ala320Thr 0.053 peritoneal fluid EC1 POLQ chr3:121179009 C/T Damaging Arg2483His 0.03}

^{peritoneal fluid EC1 PPP2R1A chr19:52714556 G/A Damaging Arg105Gln 0.316 peritoneal fluid EC1 SMAD4 chr18:48591862 C/A Damaging Pro342His 0.347 peritoneal fluid EC1 D.C.C. chr18:50961517 G/A Benign Arg1056His 0.345 peritoneal fluid EC1 NCOA2 chr8:71057068 C/T Benign Arg874Gln 0.067 peritoneal fluid EC1 CREBBP chr16:3786721 T/G Damaging Lys1527Thr 0.036 peritoneal fluid EC1 NCOA1 chr2:24930309 T/A Benign Val657Asp 0.295 peritoneal fluid EC1 NCOA1 chr2:24952635 C/T Damaging Pro1051Leu 0.054 peritoneal fluid EC1 NCOA1 chr2:24964684 G/A Damaging Arg1112His 0.101 peritoneal fluid EC1 PRDM16 chr1:3328253 C/A Damaging Leu498Met 0.226 peritoneal fluid EC1 PRDM16 chr1:3347537 A/G Benign Asp1129Gly 0.018 peritoneal fluid EC1 RGPD3 chr2:107039712 C/T Damaging Gly1571Arg 0.079 peritoneal fluid EC1 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.078 peritoneal fluid EC1 ALK chr2:29450509 C/T Benign Glu949Lys 0.116 peritoneal fluid EC1 ALK chr2:30142886 G/A Damaging Arg214Cys 0.055 peritoneal fluid EC1 APOBEC3B chr22:39381947 C/T Benign Ala102Val 0.086 peritoneal fluid EC1 ANK1 chr8:41550269 C/T Benign Arg1252Gln 0.02 peritoneal fluid EC1 TSC2 chr16:2112986 G/T Damaging Gly459Cys 0.073 peritoneal fluid EC1 TSC2 chr16:2138118 G/A Damaging Arg1713His 0.346 peritoneal fluid EC1 ARID1B chr6:157505387 G/A Damaging Arg1163His 0.065 peritoneal fluid EC1 ARID1B chr6:157528909 C/T Damaging Arg2252Cys 0.038 peritoneal fluid EC1 RECQL4 chr8:145741892 G/C N.A. 0.128 peritoneal fluid EC1 RECQL4 chr8:145737136 G/A N.A. 0.337 peritoneal fluid EC1 ARHGEF10L chr1:17952490 G/A Damaging Gly453Arg 0.107 peritoneal fluid EC1 MYCN chr2:16080800 G/C N.A. 0.058 peritoneal fluid EC1 MYCL chr1:40367556 C/T Damaging Cys2Tyr 0.091 peritoneal fluid EC1 TCF3 chr19:1612385 C/T Benign Arg545Gln 0.17 peritoneal fluid EC1 CCDC6 chr10:61666044 C/A Damaging Gly47Trp 0.422 peritoneal fluid EC1 NSD1 chr5:176721180 G/T Damaging Gly2271Trp 0.118 peritoneal fluid EC1 ZFHX3 chr16:72830330 G/A Damaging Pro2084Leu 0.035 peritoneal fluid EC1 CSMD3 chr8:114326902 C/T Benign Arg100Gln 0.37 peritoneal fluid EC1 FLT4 chr5:180030323 G/A Benign Arg1321Trp 0.401 peritoneal fluid EC1 POLD1 chr19:50909469 G/A Benign Ala425Thr 0.048 peritoneal fluid EC1 POLD1 chr19:50919734 C/T Damaging Arg968Cys 0.2 peritoneal fluid EC1 CARS chr11:3041523 C/T Damaging Arg398His 0.013 peritoneal fluid EC1 RANBP2 chr2:109382877 T/G Damaging Phe1961Cys 0.143 peritoneal fluid EC1 KTN1 chr14:56114758 T/G Benign Asp741Glu 0.181 peritoneal fluid EC1 PTK6 chr20:62161465 A/C Benign His378Gln 0.018 peritoneal fluid EC1 ERCC4 chr16:14038663 C/T Benign Ala663Val 0.454 peritoneal fluid EC1 SPECC1 chr17:20013776 C/A Damaging Pro62Thr 0.1 peritoneal fluid EC1 HIP1 chr7:75183817 G/T Benign Leu658Ile 0.109 peritoneal fluid EC1 AXIN1 chr16:396253 C/T Benign Gly258Asp 0.066 peritoneal fluid EC1 MED12 chrX:70342972 T/A Benign Ser505Thr 0.282 peritoneal fluid EC1 DCAF12L2 chrX:125298773 C/T Damaging Ala379Thr 0.087 peritoneal fluid EC1 PRKCB chr16:24185859 C/T Benign Ala451Val 0.058 peritoneal fluid EC1 LMNA chr1:156106151 G/A Damaging Arg435His 0.153 peritoneal fluid EC1 ERBB2 chr17:37868249 G/A Benign Ala324Thr 0.045 peritoneal fluid EC1 NOTCH1 chr9:139391317 C/A Damaging Gly2292Trp 0.046 peritoneal fluid EC1 NOTCH1 chr9:139399237 C/T Benign Glu1636Lys 0.03 peritoneal fluid EC1 NOTCH2 chr1:120458550 A/C Benign Asn2265Lys 0.021 peritoneal fluid EC1 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.09 peritoneal fluid EC1 ACKR3 chr2:237489668 C/T Benign Thr187Met 0.337 peritoneal fluid EC1 SPEN chr1:16262714 G/A Benign Ala3327Thr 0.066 peritoneal fluid EC1 MAP3K1 chr5:56176539 C/T Damaging Arg697Cys 0.111 peritoneal fluid EC1 BCLAF1 chr6:136599201 C/G Damaging Gly273Ala 0.147 peritoneal fluid EC1 BCLAF1 chr6:136599459 G/A Benign Pro187Leu 0.174 peritoneal fluid EC1 BRCA2 chr13:32914817 G/A Benign Val2109Ile 0.545 peritoneal fluid EC1 TRIM27 chr6:28872418 G/A Damaging Thr324Met 0.138 peritoneal fluid EC1 PER1 chr17:8050996 G/A Damaging Arg462Cys 0.029 peritoneal fluid EC1 FGFR4 chr5:176516607 C/T Benign Arg2Trp 0.018 peritoneal fluid EC1 SETD2 chr3:47098913 G/A Damaging Arg2121Cys 0.129 peritoneal fluid EC1 FGFR3 chr4:1807802 C/T Damaging Arg623Cys 0.018 peritoneal fluid EC1 KIF5B chr10:32337433 T/G Damaging Gln58Pro 0.113 peritoneal fluid EC1 FOXA1 chr14:38061459 G/A Damaging Ser177Leu 0.037 peritoneal fluid EC1 SMARCA4 chr19:11144089 G/A Benign Val1288Met 0.358 peritoneal fluid EC1 LZTR1 chr22:21347168 G/A Damaging Arg412His 0.114 peritoneal fluid EC1 LZTR1 chr22:21341825 G/A Damaging Arg118His 0.351 peritoneal fluid EC1 RNF213 chr17:78320342 T/C Benign Val2785Ala 0.159 peritoneal fluid EC1 RNF213 chr17:78336945 C/T Benign Ala3849Val 0.067 peritoneal fluid EC1 PDE4DIP chr1:144886159 C/A Benign Glu1162Asp 0.025 peritoneal fluid EC1 AFF3 chr2:100170901 G/A Damaging Pro1169Leu 0.085 peritoneal fluid EC1 AFF3 chr2:100210409 C/T Benign Ala597Thr 0.356 peritoneal fluid EC1 AFF1 chr4:87968591 C/T Damaging Arg302Trp 0.097 peritoneal fluid EC1 CHEK2 chr22:29130471 G/T Damaging Pro80His 0.129 peritoneal fluid EC1 PAX5 chr9:37020768 A/C Damaging Val26Gly 0.109 peritoneal fluid EC1 PAX7 chr1:19029647 G/A Damaging Gly338Arg 0.087 peritoneal fluid EC1 MB21D2 chr3:192516548 C/T Damaging Cys368Tyr 0.195 peritoneal fluid EC1 TP53 chr17:7577538 C/T Damaging Arg248Gln 0.344 peritoneal fluid EC1 NFE2L2 chr2:178096054 G/A Benign Pro426Leu 0.034 peritoneal fluid EC1 STAT6 chr12:57493609 C/T Damaging Arg562His 0.293 peritoneal fluid EC1 STAT6 chr12:57500551 G/A Damaging Arg135Trp 0.129 peritoneal fluid EC1 USP6 chr17:5036823 T/C Benign Leu121Ser 0.094 peritoneal fluid EC1 USP6 chr17:5036834 G/A Benign Gly125Arg 0.096 peritoneal fluid EC1 USP6 chr17:5036838 G/A Benign Arg126Lys 0.094 peritoneal fluid EC1 USP6 chr17:5036843 C/A Benign Gln128Lys 0.094 peritoneal fluid EC1 USP6 chr17:5072276 C/T Benign Ser1148Leu 0.441 peritoneal fluid EC1 KCNJ5 chr11:128781217 G/C Benign Val17Leu 0.14 peritoneal fluid EC1 GNAS chr20:57428403 A/G Damaging Gln28Arg 0.143 peritoneal fluid EC1 COL1A1 chr17:48266329 G/A Damaging Arg994Cys 0.141 peritoneal fluid EC1 NAB2 chr12:57484963 C/T Damaging Arg47Trp 0.379 peritoneal fluid EC1 BIRC6 chr2:32664600 C/T Damaging Ser1219Leu 0.096 peritoneal fluid EC1 KMT2C chr7:151859802 C/A Damaging Lys3620Asn 0.063 peritoneal fluid EC1 KMT2C chr7:151970859 C/A Damaging Gly315Cys 0.022 peritoneal fluid EC1 KMT2A chr11:118343381 C/T Damaging Arg503Trp 0.062 peritoneal fluid EC1 PRDM2 chr1:14108836 C/T Damaging Arg1516Trp 0.187 peritoneal fluid EC1 HLF chr17:53345382 G/T Benign Arg129Leu 0.135 peritoneal fluid EC1 BCL6 chr3:187447034 T/G Damaging Asn387His 0.041 peritoneal fluid EC1 BCL6 chr3:187447511 G/A Damaging Arg228Trp 0.057 peritoneal fluid EC1 NTRK3 chr15:88423656 C/T Damaging Gly727Arg 0.043 peritoneal fluid EC1 STAT5B chr17:40362440 T/G Benign Lys586Gln 0.046 peritoneal fluid EC1 PRF1 chr10:72358783 G/A Damaging Arg232Cys 0.063 peritoneal fluid EC1 PMS1 chr2:190719322 A/C Benign Ser442Arg 0.184 peritoneal fluid EC1 ATP2B3 chrX:152822440 G/A Damaging Asp798Asn 0.036 peritoneal fluid EC1 ATP2B3 chrX:152814194 C/T Damaging Thr407Met 0.258 peritoneal fluid EC1 FAT3 chr11:92577349 A/G Benign Ile3606Val 0.04 peritoneal fluid EC1 FAT3 chr11:92495256 G/A Damaging Gly1302Arg 0.059 peritoneal fluid EC1 KDM5C chrX:53223533 C/T Damaging Glu1276Lys 0.03}

^{peritoneal fluid EC1 TAF15 chr17:34151088 G/A Benign Arg164His 0.376 peritoneal fluid EC1 NFKBIE chr6:44229395 T/G Benign His359Pro 0.031 peritoneal fluid EC1 AMER1 chrX:63411483 C/T Benign Val562Met 0.036 peritoneal fluid EC1 FAT1 chr4:187541858 C/T Benign Gly1963Asp 0.308 peritoneal fluid EC1 FAT1 chr4:187557308 A/G Damaging Ser1352Pro 0.331 peritoneal fluid EC1 FAT1 chr4:187627981 C/T Damaging Val1001Met 0.079 peritoneal fluid EC1 FAT1 chr4:187629979 T/G Damaging Thr335Pro 0.048 peritoneal fluid EC1 PTPRD chr9:8501057 G/A Damaging Pro609Ser 0.179 peritoneal fluid EC1 SMC1A chrX:53407986 C/T Benign Val1154Ile 0.322 peritoneal fluid EC1 NACA chr12:57109800 A/C Damaging Asp1838Glu 0.021 peritoneal fluid EC1 NACA chr12:57112549 C/T Benign Arg922Gln 0.086 peritoneal fluid EC1 MN1 chr22:28194532 G/T Damaging Pro667His 0.031 peritoneal fluid EC1 MN1 chr22:28194559 G/A Damaging Pro658Leu 0.035 peritoneal fluid EC1 FAT4 chr4:126373044 G/A Benign Gly3625Ser 0.276 peritoneal fluid EC1 FAT4 chr4:126241504 C/A Damaging Pro1313His 0.115 peritoneal fluid EC1 RNF43 chr17:56435372 G/C Benign Pro589Ala 0.231 peritoneal fluid EC1 FAM47C chrX:37027640 G/A Benign Arg386His 0.286 peritoneal fluid EC1 RFWD3 chr16:74694873 G/A Benign Arg159Trp 0.43 peritoneal fluid EC1 FOXR1 chr11:118851213 T/C Damaging Phe209Leu 0.122 peritoneal fluid EC1 MUTYH chr1:45796969 T/G Benign Gln454Pro 0.045 peritoneal fluid EC1 ABL1 chr9:133738258 C/T Benign Arg239Cys 0.326 peritoneal fluid EC1 NCOR2 chr12:124831354 C/T Damaging Arg1379His 0.109 peritoneal fluid EC1 NCOR1 chr17:16062109 G/A Damaging Arg233Cys 0.18 peritoneal fluid EC1 ELL chr19:18561475 C/T Benign Gly426Asp 0.349 peritoneal fluid EC1 ELL chr19:18576248 A/G Damaging Val148Ala 0.332 peritoneal fluid EC1 BCOR chrX:39923667 T/G Benign Ser1142Arg 0.14 peritoneal fluid EC1 DICER1 chr14:95556920 C/T Damaging Arg1895Gln 0.055 peritoneal fluid EC1 ACVR1 chr2:158595058 G/A Damaging Pro430Leu 0.087 peritoneal fluid EC1 ACVR1 chr2:158630626 C/T Damaging Arg206His 0.094 peritoneal fluid EC1 BCL11A chr2:60679778 G/A Damaging Arg777Cys 0.329 peritoneal fluid EC1 BCL11B chr14:99724144 C/T Benign Glu31Lys 0.32 peritoneal fluid EC1 TLX1 chr10:102891767 G/A Benign Val157Met 0.101 peritoneal fluid EC1 LRP1B chr2:141356360 A/C Damaging Met2345Arg 0.052 peritoneal fluid EC1 PTPRB chr12:70981023 C/T Benign Arg692His 0.061 peritoneal fluid EC1 RAC1 chr7:6441629 C/T Benign Pro159Leu 0.04 peritoneal fluid EC1 KAT6A chr8:41838375 C/T Damaging Arg299His 0.02 peritoneal fluid EC1 CREB3L2 chr7:137600663 C/T Benign Val139Ile 0.077 peritoneal fluid EC1 SDHA chr5:224529 G/A Damaging Ala69Thr 0.33 peritoneal fluid EC1 BAP1 chr3:52439169 G/A Damaging Pro358Leu 0.033 peritoneal fluid EC2 FKBP9 chr7:33044951 C/G Damaging His620Gln 0.031 peritoneal fluid EC2 PTEN chr10:89692905 G/A Damaging Arg130Gln 0.542 peritoneal fluid EC2 ZNRF3 chr22:29446189 G/A Damaging Glu674Lys 0.026 peritoneal fluid EC2 CREBBP chr16:3786740 G/T Damaging Gln1521Lys 0.017 peritoneal fluid EC2 RGPD3 chr2:107039712 C/T Damaging Gly1571Arg 0.087 peritoneal fluid EC2 ERC1 chr12:1221460 C/A Benign Ala466Asp 0.083 peritoneal fluid EC2 NSD1 chr5:176631130 G/A Benign Arg358Gln 0.058 peritoneal fluid EC2 RANBP2 chr2:109371421 G/A Benign Asp755Asn 0.099 peritoneal fluid EC2 SPEN chr1:16259547 G/A Damaging Gly2271Asp 0.019 peritoneal fluid EC2 CRNKL1 chr20:20023097 C/A Benign Ala507Ser 0.04 peritoneal fluid EC2 PAX3 chr2:223086094 T/G Damaging Asn269His 0.058 peritoneal fluid EC2 USP6 chr17:5036249 G/T Benign Met80Ile 0.117 peritoneal fluid EC2 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.054 peritoneal fluid EC2 KMT2C chr7:151970859 C/A Damaging Gly315Cys 0.024 peritoneal fluid EC2 KRAS chr12:25398281 C/T Damaging Gly13Asp 0.23 peritoneal fluid EC2 PABPC1 chr8:101721705 G/T Benign Phe409Leu 0.092 peritoneal fluid EC2 PABPC1 chr8:101721709 T/A Benign Tyr408Phe 0.091 peritoneal fluid EC2 HLA-A chr6:29911098 T/C Benign Phe133Leu 0.011 peritoneal fluid EC2 PIK3R1 chr5:67589138 G/A Damaging Gly376Arg 0.289 peritoneal fluid EC2 FAT4 chr4:126328132 T/G Damaging Leu1802Trp 0.067 peritoneal fluid EC2 SDHA chr5:236619 T/C Damaging Val446Ala 0.018 peritoneal fluid EC2 SDHA chr5:236628 C/T Damaging Ala449Val 0.017 peritoneal fluid EC2 SDHA chr5:236649 C/T Damaging Ser456Leu 0.016 plasma EC3 FKBP9 chr7:33014363 A/G Benign Asn172Ser 0.044 plasma EC3 NUP98 chr11:3724044 G/A Benign Pro1054Leu 0.028 plasma EC3 NTHL1 chr16:2090185 G/C Benign Ala255Gly 0.021 plasma EC3 FLNA chrX:153599258 A/T Damaging Ile119Asn 0.021 plasma EC3 MYH11 chr16:15818572 C/T Benign Asp1357Asn 0.017 plasma EC3 MYH11 chr16:15853440 A/T Damaging Ile472Asn 0.022 plasma EC3 MYH11 chr16:15931991 G/A Damaging Ser40Leu 0.019 plasma EC3 DCTN1 chr2:74590423 T/G Benign Lys1115Gln 0.046 plasma EC3 DCTN1 chr2:74596575 C/T Damaging Arg479His 0.026 plasma EC3 CREBBP chr16:3786740 G/T Damaging Gln1521Lys 0.054 plasma EC3 OLIG2 chr21:34400054 G/C Damaging Cys295Ser 0.042 plasma EC3 MYOD1 chr11:17742958 G/A Benign Ser289Asn 0.031 plasma EC3 N4BP2 chr4:40154523 G/T Damaging Arg1756Met 0.024 plasma EC3 TRIP11 chr14:92477378 C/G Benign Met422Ile 0.04 plasma EC3 FBLN2 chr3:13649626 C/A Benign Asp457Glu 0.016 plasma EC3 SIX2 chr2:45233332 T/G Benign Asn285His 0.165 plasma EC3 ARHGEF10L chr1:18023759 T/A Benign Ser1242Thr 0.034 plasma EC3 MYCN chr2:16082662 G/A Benign Gly159Asp 0.049 plasma EC3 KEAP1 chr19:10602430 G/A Damaging Ser383Leu 0.027 plasma EC3 PTK6 chr20:62165648 G/A Damaging Arg125Trp 0.015 plasma EC3 CEBPA chr19:33793191 C/A Benign Ala44Ser 0.028 plasma EC3 AXIN2 chr17:63526196 A/C Damaging Asp810Glu 0.08 plasma EC3 PRKCB chr16:24166128 C/T Benign Pro397Ser 0.03 plasma EC3 CTNNA2 chr2:79750430 G/A N.A. Gly31Asp 0.05 plasma EC3 NOTCH1 chr9:139396737 A/G Damaging Ser1791Pro 0.019 plasma EC3 NOTCH2 chr1:120468270 T/A Benign His1390Leu 0.022 plasma EC3 BRCA1 chr17:41243706 T/G Benign Gln1281Pro 0.105 plasma EC3 IDH2 chr15:90634824 A/C Damaging Asp56Glu 0.048 plasma EC3 MYO5A chr15:52611411 T/G Damaging Asn1694His 0.059 plasma EC3 HIF1A chr14:62193512 G/A Benign Met206Ile 0.107 plasma EC3 SKI chr1:2160731 C/T Damaging Leu176Phe 0.03 plasma EC3 SF3B1 chr2:198272802 G/A Damaging Arg387Trp 0.037 plasma EC3 SALL4 chr20:50405642 G/T Damaging Pro834Thr 0.018 plasma EC3 FOXO3 chr6:108986035 T/A Benign Ser667Thr 0.049 plasma EC3 KMT2C chr7:151945228 G/A Benign Ser764Phe 0.027 plasma EC3 KMT2C chr7:151962265 C/T Damaging Asp348Asn 0.046 plasma EC3 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.058 plasma EC3 KMT2C chr7:151962294 G/A Benign Ser338Leu 0.113 plasma EC3 BCL9 chr1:147095701 G/T Damaging Met1074Ile 0.019 plasma EC3 BCL6 chr3:187446222 C/A Damaging Cys489Phe 0.024 plasma EC3 FAT3 chr11:92087428 C/T Damaging Ser717Leu 0.034 plasma EC3 CHD2 chr15:93524619 C/T Damaging Arg1000Trp 0.071 plasma EC3 MN1 chr22:28193516 T/G Damaging Thr1006Pro 0.027 plasma EC3 POT1 chr7:124532340 G/A Damaging Pro35Leu 0.031}

^{plasma EC3 ELL chr19:18562379 A/C Benign Ser317Ala 0.04 plasma EC3 FES chr15:91428796 T/A Damaging Leu123Gln 0.018 plasma EC3 TLX3 chr5:170737237 C/G Damaging Pro169Ala 0.02 plasma EC3 CLTCL1 chr22:19222144 G/A Damaging Ala352Val 0.023 plasma EC3 CLTCL1 chr22:19175234 T/C Damaging Arg1481Gly 0.016 plasma EC3 KAT6A chr8:41834811 G/T Damaging Pro360Thr 0.03 plasma EC3 EZR chr6:159188460 C/G Benign Val477Leu 0.029 plasma EC3 SDHA chr5:236619 T/C Damaging Val446Ala 0.036 plasma EC3 SDHA chr5:236628 C/T Damaging Ala449Val 0.034 plasma EC3 SDHA chr5:236649 C/T Damaging Ser456Leu 0.031 plasma EC3 SDHA chr5:236676 G/A Damaging Arg465Gln 0.03 plasma EC3 SDHA chr5:236678 G/A Damaging Ala466Thr 0.03 plasma EC3 SDHA chr5:236681 T/A Damaging Cys467Ser 0.03 plasma EC5 FKBP9 chr7:33044951 C/G Damaging His620Gln 0.029 plasma EC5 GRM3 chr7:86416326 A/C Benign Lys406Asn 0.201 plasma EC5 SGK1 chr6:134583262 T/A Benign Met32Leu 0.173 plasma EC5 CBL chr11:119155706 A/G Benign Met487Val 0.251 plasma EC5 PRDM1 chr6:106553683 A/C Benign Ile550Leu 0.082 plasma EC5 POLE chr12:133202740 C/T Damaging Arg2176His 0.142 plasma EC5 TSC1 chr9:135801087 C/T Benign Ala84Thr 0.227 plasma EC5 RBM15 chr1:110882196 C/T Damaging Arg57Cys 0.203 plasma EC5 S100A7 chr1:153430424 A/G Damaging Leu55Pro 0.191 plasma EC5 MITF chr3:70014199 C/A Damaging Leu461Ile 0.12 plasma EC5 WNK2 chr9:96055338 A/G Damaging Lys1901Arg 0.204 plasma EC5 BAZ1A chr14:35272067 A/C Benign Ile285Ser 0.166 plasma EC5 NFATC2 chr20:50048687 G/A Damaging Pro880Leu 0.189 plasma EC5 MYCN chr2:16080800 G/C N.A. 0.105 plasma EC5 PDGFRB chr5:149515232 C/T Benign Val84Met 0.181 plasma EC5 FLT3 chr13:28674628 T/C Benign Asp7Gly 0.221 plasma EC5 LARP4B chr10:875437 G/A Benign Ala338Val 0.141 plasma EC5 TET1 chr10:70406293 A/C Damaging Lys1269Asn 0.266 plasma EC5 T.F.G. chr3:100467292 C/T Damaging Pro374Ser 0.15 plasma EC5 PTK6 chr20:62164944 C/G Damaging Trp210Cys 0.157 plasma EC5 DCAF12L2 chrX:125299685 G/C Benign Leu75Val 0.325 plasma EC5 STIL chr1:47717238 G/A Benign Ala1146Val 0.279 plasma EC5 PTCH1 chr9:98209526 G/A Benign Arg1338Cys 0.157 plasma EC5 FAM131B chr7:143054020 C/T Damaging Asp236Asn 0.217 plasma EC5 MAML2 chr11:95712488 A/G Damaging Met1032Thr 0.161 plasma EC5 PDE4DIP chr1:144863438 G/T Damaging Gln2125Lys 0.016 plasma EC5 PDE4DIP chr1:145021150 T/C Damaging Asp84Gly 0.034 plasma EC5 ROS1 chr6:117622231 G/T Benign Asp2213Glu 0.2 plasma EC5 PAX7 chr1:19062429 G/A Benign Ala487Thr 0.206 plasma EC5 NTRK1 chr1:156834527 G/A Benign Val99Met 0.149 plasma EC5 BCL7A chr12:122481882 C/T Benign Ser121Leu 0.163 plasma EC5 USP6 chr17:5036205 A/C Benign Lys66Gln 0.116 plasma EC5 USP6 chr17:5036214 C/T Benign Arg69Trp 0.144 plasma EC5 USP6 chr17:5036823 T/C Benign Leu121Ser 0.053 plasma EC5 USP6 chr17:5036834 G/A Benign Gly125Arg 0.071 plasma EC5 USP6 chr17:5036838 G/A Benign Arg126Lys 0.074 plasma EC5 USP6 chr17:5036843 C/A Benign Gln128Lys 0.075 plasma EC5 GNAS chr20:57428893 T/C N.A. Ala191Ala 0.162 plasma EC5 PLAG1 chr8:57079092 T/C Benign Ile405Val 0.219 plasma EC5 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.096 plasma EC5 FAT3 chr11:92495293 C/A Benign Ser1314Tyr 0.143 plasma EC5 ASXL1 chr20:31021530 T/C Damaging Leu510Pro 0.151 plasma EC5 FAT4 chr4:126328128 C/T Damaging Arg1801Trp 0.142 plasma EC5 PTPN6 chr12:7061231 A/G Benign Thr73Ala 0.148 plasma EC5 FEV chr2:219846852 C/T Damaging Arg85Gln 0.203 plasma EC5 CIC chr19:42777340 C/G N.A. 0.2 plasma EC5 CIC chr19:42796979 C/T Benign Pro1146Leu 0.182 plasma EC5 LRP1B chr2:141092084 T/G Benign Glu4054Ala 0.25 plasma EC5 NF2 chr22:30090766 G/A Benign Glu592Lys 0.167 plasma EC5 TNC chr9:117849420 C/T Benign Arg197Gln 0.223 plasma EC5 BRAF chr7:140534534 T/C Benign Ser127Gly 0.367 plasma EC2 DCTN1 chr2:74593447 A/C Benign Ile895Ser 0.066 plasma EC2 CNOT3 chr19:54651895 A/C Damaging Asn303His 0.05 plasma EC2 GAS7 chr17:9820616 C/T Benign Ala454Thr 0.014 plasma EC2 CARD11 chr7:2968278 T/G Benign Asn570His 0.05 plasma EC2 NOTCH2 chr1:120458550 A/C Benign Asn2265Lys 0.04 plasma EC2 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.035 plasma EC2 TCF7L2 chr10:114925408 T/A Benign Ser513Thr 0.029 plasma EC2 DAXX chr6:33289620 A/T Benign Leu28His 0.068 plasma EC2 DAXX chr6:33289630 A/T Damaging Ser25Thr 0.078 plasma EC2 DDR2 chr1:162725072 C/A Benign Leu182Ile 0.022 plasma EC2 RABEP1 chr17:5280459 C/T Damaging Arg692Trp 0.103 plasma EC2 TAL1 chr1:47691538 T/G Benign Glu8Ala 0.019 plasma EC2 TAL1 chr1:47691542 T/G Benign Ser7Arg 0.019 plasma EC2 USP6 chr17:5036249 G/T Benign Met80Ile 0.077 plasma EC2 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.078 plasma EC2 KMT2C chr7:151970859 C/A Damaging Gly315Cys 0.018 plasma EC2 PRDM2 chr1:14107511 C/A Benign Ser1074Tyr 0.103 plasma EC2 KMT2D chr12:49425065 T/G Benign Ser4475Arg 0.068 plasma EC2 FAT3 chr11:92565085 C/T Damaging Ala3260Val 0.017 plasma EC2 PABPC1 chr8:101721705 G/T Benign Phe409Leu 0.05 plasma EC2 PABPC1 chr8:101721709 T/A Benign Tyr408Phe 0.05 plasma EC2 MRTFA chr22:40817008 T/G Damaging Ile242Leu 0.027 plasma EC2 MRTFA chr22:40817010 T/G Damaging Tyr241Ser 0.03 plasma EC2 PML chr15:74290760 G/A Damaging Arg182His 4.05E-03 plasma EC2 ELL chr19:18562379 A/C Benign Ser317Ala 0.041 plasma EC2 TLX3 chr5:170738472 C/A Benign Gln249Lys 0.041 plasma EC2 LRP1B chr2:141356360 A/C Damaging Met2345Arg 0.105 plasma EC2 PIM1 chr6:37141724 A/C Damaging Ile267Leu 0.082 plasma EC2 SDHA chr5:236642 G/A Damaging Ala454Thr 9.27E-03 plasma EC6 LIFR chr5:38523672 T/G Benign Asp137Ala 0.15 plasma EC6 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.077 plasma EC6 ERCC3 chr2:128016991 C/G Benign Asp700His 0.024 plasma EC6 AFF3 chr2:100210325 C/T Benign Ala625Thr 0.04 plasma EC6 PAX8 chr2:113977684 T/G Damaging Asn421His 0.04 plasma EC6 KMT2C chr7:151945228 G/A Benign Ser764Phe 0.039 plasma EC6 KMT2C chr7:151962168 C/A Damaging Arg380Leu 0.056 plasma EC6 KMT2C chr7:151962265 C/T Damaging Asp348Asn 0.038 plasma EC6 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.059 plasma EC6 KMT2C chr7:151962294 G/A Benign Ser338Leu 0.051}

^{plasma EC6 KMT2C chr7:151970859 C/T Damaging Gly315Ser 0.052 plasma EC6 CLTC chr17:57743881 A/C Damaging Tyr608Ser 0.029 plasma EC6 CLTC chr17:57743884 A/C Damaging Asp609Ala 0.029 plasma EC6 PCM1 chr8:17867065 G/A Benign Ala1658Thr 0.115 plasma EC6 EZR chr6:159188460 C/G Benign Val477Leu 0.053 plasma EC6 SDHA chr5:236649 C/T Damaging Ser456Leu 0.018 plasma EC6 SDHA chr5:236676 G/A Damaging Arg465Gln 0.018 plasma EC6 SDHA chr5:236678 G/A Damaging Ala466Thr 0.018 plasma EC7 BUB1B chr15:40498519 T/G Damaging His637Gln 0.113 plasma EC7 CBLB chr3:105404191 T/G Benign His725Pro 0.088 plasma EC7 ARHGEF12 chr11:120292526 C/T Damaging Arg105Trp 0.056 plasma EC7 ATP1A1 chr1:116916135 T/G Damaging Met1Arg 0.059 plasma EC7 SIX2 chr2:45233332 T/G Benign Asn285His 0.102 plasma EC7 KLK2 chr19:51380177 T/G Damaging Asn181Lys 0.041 plasma EC7 NSD1 chr5:176720894 T/G Damaging Cys2175Trp 0.079 plasma EC7 NSD3 chr8:38162266 A/C Damaging Met817Arg 0.167 plasma EC7 FLT4 chr5:180047694 A/C Damaging Met774Arg 0.141 plasma EC7 ERCC3 chr2:128016991 C/G Benign Asp700His 0.047 plasma EC7 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.133 plasma EC7 CBFA2T3 chr16:88945846 C/G Damaging Lys498Asn 0.039 plasma EC7 KIF5B chr10:32337433 T/G Damaging Gln58Pro 0.077 plasma EC7 TCF7L2 chr10:114925408 T/A Benign Ser513Thr 0.071 plasma EC7 ROS1 chr6:117724307 T/G Benign His191Pro 0.053 plasma EC7 BCR chr22:23656786 C/G Damaging Ala1204Gly 0.056 plasma EC7 CDH11 chr16:64982648 A/C Benign Met646Arg 0.051 plasma EC7 KMT2C chr7:151962261 C/T Damaging Ser349Asn 0.062 plasma EC7 KMT2C chr7:151945225 T/C Damaging Glu765Gly 0.048 plasma EC7 KMT2C chr7:151962168 C/A Damaging Arg380Leu 0.027 plasma EC7 KMT2C chr7:151970859 C/T Damaging Gly315Ser 0.052 plasma EC7 DDX6 chr11:118626986 C/T Damaging Arg386His 0.081 plasma EC7 SMC1A chrX:53448866 T/G Damaging Thr35Pro 0.141 plasma EC7 NACA chr12:57111185 A/T Benign Ser1377Thr 0.151 plasma EC7 KDR chr4:55962435 T/G Damaging Asn897His 0.076 plasma EC7 TNC chr9:117783441 C/T Damaging Ala2201Thr 0.021 plasma EC7 SDHA chr5:236649 C/T Damaging Ser456Leu 0.019 plasma EC7 SDHA chr5:236676 G/A Damaging Arg465Gln 0.019 plasma EC7 SDHA chr5:236678 G/A Damaging Ala466Thr 0.021 plasma EC8 CBLB chr3:105404191 T/G Benign His725Pro 0.145 plasma EC8 AKAP9 chr7:91632395 C/A Damaging Ser1067Tyr 0.381 plasma EC8 SETBP1 chr18:42532072 A/C Benign Ile923Leu 0.047 plasma EC8 FLNA chrX:153585889 T/G Damaging Ile1620Leu 0.057 plasma EC8 RBM10 chrX:47044750 C/T Benign Ala717Val 0.012 plasma EC8 PRDM16 chr1:3301736 T/G Benign Ser153Arg 0.098 plasma EC8 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.037 plasma EC8 HNF1A chr12:121426812 G/A Damaging Arg168His 0.015 plasma EC8 IKBKB chr8:42129620 T/G Damaging Met1Arg 0.088 plasma EC8 FBLN2 chr3:13679138 A/C Damaging Asn1139His 0.033 plasma EC8 SIX2 chr2:45233332 T/G Benign Asn285His 0.12 plasma EC8 EXT1 chr8:118842485 A/G Damaging Val423Ala 0.107 plasma EC8 PDGFRB chr5:149515211 T/G Damaging Thr91Pro 0.034 plasma EC8 FANCC chr9:97876914 T/G Benign His384Pro 0.109 plasma EC8 NOTCH2 chr1:120458550 A/C Benign Asn2265Lys 0.047 plasma EC8 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.114 plasma EC8 ACKR3 chr2:237489743 T/G Damaging Met212Arg 0.052 plasma EC8 PTCH1 chr9:98238402 C/T Damaging Val548Met 0.078 plasma EC8 MAP3K1 chr5:56177773 T/G Benign Cys916Gly 0.061 plasma EC8 ERBB3 chr12:56478891 C/T Damaging Ala116Val 0.018 plasma EC8 SMARCA4 chr19:11172461 A/C Benign Asp1672Ala 0.012 plasma EC8 DAXX chr6:33289620 A/T Benign Leu28His 0.093 plasma EC8 AFF4 chr5:132232823 T/G Benign Gln500Pro 0.051 plasma EC8 ROS1 chr6:117630032 T/G Damaging His2165Pro 0.06 plasma EC8 USP6 chr17:5036823 T/C Benign Leu121Ser 0.132 plasma EC8 ITGAV chr2:187534494 A/C Benign Ile887Leu 0.053 plasma EC8 KMT2C chr7:151962148 C/G Benign Glu387Gln 0.083 plasma EC8 KMT2C chr7:151962168 C/A Damaging Arg380Leu 0.057 plasma EC8 KMT2C chr7:151962265 C/T Damaging Asp348Asn 0.058 plasma EC8 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.075 plasma EC8 KMT2C chr7:151962294 G/A Benign Ser338Leu 0.051 plasma EC8 KMT2C chr7:151970859 C/A Damaging Gly315Cys 0.025 plasma EC8 KMT2C chr7:151970859 C/T Damaging Gly315Ser 0.04 plasma EC8 KMT2D chr12:49427714 T/G Benign Met3592Leu 0.108 plasma EC8 KMT2D chr12:49443773 T/G Benign Ile1200Leu 0.027 plasma EC8 PABPC1 chr8:101721692 G/A Damaging Pro414Ser 0.059 plasma EC8 CHD4 chr12:6682339 T/G Damaging Thr1848Pro 0.115 plasma EC8 FAT1 chr4:187539379 A/C Benign His2789Gln 0.11 plasma EC8 NCOR2 chr12:124915300 T/G Damaging Met306Leu 0.094 plasma EC8 ELL chr19:18562379 A/C Benign Ser317Ala 0.078 plasma EC8 PTPRT chr20:40790131 T/G Damaging His870Pro 0.032 plasma EC9 MEN1 chr11:64572158 G/A Benign Pro499Leu 0.019 plasma EC9 FLNA chrX:153585889 T/G Damaging Ile1620Leu 0.016 plasma EC9 COL2A1 chr12:48367967 T/G Damaging Lys1408Gln 0.021 plasma EC9 CREBBP chr16:3789646 C/T Damaging Val1435Met 0.083 plasma EC9 CLIP1 chr12:122817534 C/A Damaging Arg956Ile 0.065 plasma EC9 CNOT3 chr19:54647477 A/C Damaging Ile84Leu 0.051 plasma EC9 SIX2 chr2:45233332 T/G Benign Asn285His 0.131 plasma EC9 MYCN chr2:16080808 G/C N.A. 0.076 plasma EC9 MYCN chr2:16080817 G/C N.A. 0.064 plasma EC9 SET chr9:131451874 G/A Benign Ala5Thr 0.058 plasma EC9 SET chr9:131451884 T/C Benign Val8Ala 0.056 plasma EC9 MACC1 chr7:20199290 T/C Damaging Ile232Val 0.023 plasma EC9 AXIN2 chr17:63526196 A/C Damaging Asp810Glu 0.043 plasma EC9 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.039 plasma EC9 CNTRL chr9:123900883 C/A Benign Leu755Ile 0.061 plasma EC9 CACNA1D chr3:53769453 A/C Damaging Ile912Leu 0.029 plasma EC9 CUL3 chr2:225371657 C/T Benign Cys316Tyr 0.086 plasma EC9 BRCA1 chr17:41209124 A/T Damaging Val1763Asp 0.048 plasma EC9 NF1 chr17:29663733 T/G Damaging Asp2076Glu 0.056 plasma EC9 FOXA1 chr14:38060617 C/T Benign Ala458Thr 0.016 plasma EC9 RUNX1 chr21:36164619 A/C Damaging Val419Gly 0.051 plasma EC9 RUNX1 chr21:36164623 T/A Benign Met418Leu 0.048 plasma EC9 CRTC3 chr15:91181742 C/T Benign Pro444Leu 0.017 plasma EC9 SETD1B chr12:122252343 T/A Damaging Ile741Asn 0.052 plasma EC9 CCR7 chr17:38711737 T/G Benign Ile132Leu 0.041 plasma EC9 BCORL1 chrX:129155009 G/T N.A. Arg1164Met 0.045 plasma EC9 USP6 chr17:5036249 G/T Benign Met80Ile 0.081 plasma EC9 USP6 chr17:5036823 T/C Benign Leu121Ser 0.141 plasma EC9 USP6 chr17:5036834 G/A Benign Gly125Arg 0.14 plasma EC9 USP6 chr17:5036838 G/A Benign Arg126Lys 0.138 plasma EC9 USP6 chr17:5036843 C/A Benign Gln128Lys 0.138 plasma EC9 ATRX chrX:76939102 C/T Benign Ser549Asn 0.064 plasma EC9 CDH11 chr16:64982648 A/C Benign Met646Arg 0.099 plasma EC9 FOXO3 chr6:108882815 C/A Benign Pro135Gln 0.032 plasma EC9 KMT2C chr7:151970859 C/A Damaging Gly315Cys 0.038 plasma EC9 SH2B3 chr12:111856401 C/T Benign Ala151Val 0.034 plasma EC9 DDX6 chr11:118630682 C/A Damaging Arg271Ser 0.1 plasma EC9 CHD2 chr15:93557953 G/T Damaging Gly1574Trp 0.043 plasma EC9 SMC1A chrX:53407978 A/C Damaging Asp1156Glu 0.112 plasma EC9 FAM47C chrX:37028333 A/C Benign His617Pro 0.04}

^{plasma EC9 FAM47C chrX:37028716 C/A Benign Pro745Thr 7.00E-03 plasma EC9 DROSHA chr5:31515295 G/A Damaging Arg364Cys 0.062 plasma EC9 TEC chr4:48169957 G/T Damaging Pro170Gln 0.052 plasma EC9 PML chr15:74287199 G/C Damaging Ala16Pro 0.032 plasma EC9 PML chr15:74287203 G/C Benign Arg17Pro 0.075 plasma EC9 PML chr15:74287212 A/T Benign Glu20Val 0.029 plasma EC9 PML chr15:74287217 A/C Damaging Thr22Pro 0.028 plasma EC9 PML chr15:74287221 T/A Damaging Met23Lys 0.025 plasma EC9 BCOR chrX:39921444 T/C Damaging Asn1459Ser 0.037 plasma EC9 BCL11B chr14:99641846 T/G Benign Ile443Leu 0.047 plasma EC9 ELF3 chr1:201982155 T/G Benign Phe227Val 0.047 plasma EC9 KAT6A chr8:41812876 A/C Damaging Ile512Met 0.062 plasma EC9 EZR chr6:159188460 C/G Benign Val477Leu 0.027 plasma EC9 SDHA chr5:236619 T/C Damaging Val446Ala 0.025 plasma EC9 SDHA chr5:236628 C/T Damaging Ala449Val 0.024 plasma EC9 SDHA chr5:236649 C/T Damaging Ser456Leu 0.023 plasma EC9 SDHA chr5:236676 G/A Damaging Arg465Gln 0.024 plasma EC9 SDHA chr5:236678 G/A Damaging Ala466Thr 0.024 plasma EC4 PIK3CA chr3:178916725 C/T Damaging Arg38Cys 0.056 plasma EC4 CBLB chr3:105404191 T/G Benign His725Pro 0.089 plasma EC4 NTHL1 chr16:2094737 G/A Benign Ala148Val 0.05 plasma EC4 CTCF chr16:67650770 G/A Benign Ala359Thr 0.055 plasma EC4 SH3GL1 chr19:4363820 C/T Damaging Arg174Gln 0.061 plasma EC4 ZNF384 chr12:6787366 G/A Damaging Pro205Ser 0.052 plasma EC4 CBL chr11:119144682 G/A Damaging Cys232Tyr 0.052 plasma EC4 POLQ chr3:121260261 G/A Damaging Arg272Trp 0.415 plasma EC4 POLE chr12:133249829 G/A Damaging Ala476Val 0.056 plasma EC4 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.031 plasma EC4 CBLC chr19:45281364 C/A Benign Ala59Asp 0.367 plasma EC4 CTNNB1 chr3:41266097 G/A Damaging Asp32Asn 0.033 plasma EC4 FIP1L1 chr4:54280840 G/A Benign Val292Ile 0.515 plasma EC4 ANK1 chr8:41543759 C/A Benign Arg1434Met 0.017 plasma EC4 EWSR1 chr22:29695721 G/A Benign Gly609Asp 0.061 plasma EC4 KIAA1549 chr7:138601659 C/T Benign Ala905Thr 0.041 plasma EC4 RECQL4 chr8:145739647 C/T N.A. 0.028 plasma EC4 NSD1 chr5:176639004 G/A Benign Glu1202Lys 0.5 plasma EC4 ATM chr11:108139302 C/T Benign Thr935Met 0.496 plasma EC4 ZFHX3 chr16:72821395 T/G Benign Asn3594His 0.054 plasma EC4 ZFHX3 chr16:72991734 C/T Damaging Gly771Arg 0.412 plasma EC4 ZBTB16 chr11:113934429 C/T Benign Thr136Ile 0.049 plasma EC4 FANCG chr9:35076833 G/A Benign Ala271Val 0.035 plasma EC4 RANBP2 chr2:109380719 A/T Damaging Ile1242Phe 0.072 plasma EC4 HOXA9 chr7:27205008 A/C Benign Asp23Glu 0.046 plasma EC4 HIP1 chr7:75184771 C/T Damaging Ala638Thr 0.048 plasma EC4 MED12 chrX:70345324 C/T Damaging Arg784Cys 0.041 plasma EC4 NR4A3 chr9:102590452 G/A Benign Gly54Asp 0.042 plasma EC4 PRKCB chr16:23847510 C/T Benign Ala5Val 0.563 plasma EC4 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.044 plasma EC4 CNTRL chr9:123886324 C/T Benign Thr589Met 0.433 plasma EC4 PTCH1 chr9:98220396 C/T Benign Gly1023Ser 0.479 plasma EC4 PTCH1 chr9:98238333 G/A Damaging Arg571Trp 0.05 plasma EC4 CACNA1D chr3:53699759 T/C Damaging Phe280Ser 0.061 plasma EC4 NUP214 chr9:134064464 C/T Benign Pro1153Ser 0.067 plasma EC4 NUP214 chr9:134073269 C/T Damaging Pro1442Leu 0.484 plasma EC4 PATZ1 chr22:31737552 C/T Benign Ala485Thr 0.039 plasma EC4 FGFR2 chr10:123256134 C/T Damaging Arg593His 0.057 plasma EC4 PTPN13 chr4:87701620 G/A Benign Gly1991Asp 0.422 plasma EC4 RNF213 chr17:78320843 G/A Damaging Gly2952Asp 0.038 plasma EC4 PDE4DIP chr1:145021150 T/C Damaging Asp84Gly 0.128 plasma EC4 TRRAP chr7:98552779 C/T Damaging Ala1923Val 0.075 plasma EC4 TP53 chr17:7578389 G/A Damaging Arg181Cys 0.07 plasma EC4 DDR2 chr1:162740216 G/A Benign Arg473His 0.037 plasma EC4 NFE2L2 chr2:178095968 T/G Damaging Thr455Pro 0.11 plasma EC4 NFE2L2 chr2:178096304 C/A Damaging Asp343Tyr 0.042 plasma EC4 TBX3 chr12:115112152 C/T Benign Ala530Thr 0.083 plasma EC4 CTNND1 chr11:57564191 A/G Damaging Tyr228Cys 0.424 plasma EC4 CTNND1 chr11:57573427 G/A Benign Arg599His 0.037 plasma EC4 CREB3L1 chr11:46321578 T/G Benign Asp65Glu 0.066 plasma EC4 SALL4 chr20:50405515 C/A Damaging Gly876Val 0.034 plasma EC4 USP6 chr17:5036249 G/T Benign Met80Ile 0.085 plasma EC4 ATRX chrX:76763999 T/G Damaging Met2437Leu 0.065 plasma EC4 CDH17 chr8:95143148 T/C Benign Asn747Ser 0.568 plasma EC4 CDH17 chr8:95189837 G/A Benign Thr88Ile 0.044 plasma EC4 NAB2 chr12:57486861 C/T N.A. His387Tyr 0.428 plasma EC4 RUNX1T1 chr8:93029525 G/A Damaging Thr63Ile 0.039 plasma EC4 ITGAV chr2:187511536 G/A Benign Arg428Gln 0.387 plasma EC4 KMT2C chr7:151864316 G/A Damaging Ala3222Val 0.044 plasma EC4 KMT2C chr7:151945225 T/C Damaging Glu765Gly 0.056 plasma EC4 KMT2C chr7:151962168 C/A Damaging Arg380Leu 0.047 plasma EC4 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.072 plasma EC4 KMT2C chr7:151962294 G/A Benign Ser338Leu 0.049 plasma EC4 KMT2C chr7:151970859 C/T Damaging Gly315Ser 0.048 plasma EC4 KMT2D chr12:49427327 G/T Benign Leu3721Met 0.026 plasma EC4 KMT2D chr12:49432644 G/A Benign Ala2832Val 0.015 plasma EC4 AKT1 chr14:105240286 C/T Benign Arg222His 0.029 plasma EC4 ARHGAP26 chr5:142281559 G/T Damaging Lys219Asn 0.047 plasma EC4 ATP2B3 chrX:152815084 C/A Benign Leu490Ile 0.042 plasma EC4 RAF1 chr3:12626142 A/C Damaging Ile626Met 0.033 plasma EC4 SOCS1 chr16:11349055 C/T Damaging Arg94His 0.048 plasma EC4 FAT3 chr11:92533158 G/A Benign Val2327Ile 0.065 plasma EC4 KDM5C chrX:53225935 C/T Benign Glu972Lys 0.043 plasma EC4 HLA-A chr6:29912345 A/T Benign Ile322Phe 0.319 plasma EC4 DNM2 chr19:10939914 A/G Damaging Asp754Gly 0.028 plasma EC4 ASXL2 chr2:25973188 G/A Benign Pro413Ser 0.043 plasma EC4 ASXL2 chr2:25976506 C/T Damaging Glu347Lys 0.064 plasma EC4 SMC1A chrX:53448870 G/C N.A. Ile33Met 0.136 plasma EC4 ETV5 chr3:185766567 G/A Damaging Pro507Leu 0.06 plasma EC4 ZMYM3 chrX:70471082 G/A Damaging Arg244Cys 0.037 plasma EC4 ELL chr19:18562379 A/C Benign Ser317Ala 0.064 plasma EC4 KDR chr4:55962435 T/G Damaging Asn897His 0.172 plasma EC4 NUMA1 chr11:71716381 A/C Damaging Asp1909Glu 0.048 plasma EC4 NUMA1 chr11:71725265 G/A Benign Ala1095Val 0.026 plasma EC4 SDHA chr5:236649 C/T Damaging Ser456Leu 0.021 plasma EC4 SDHA chr5:236676 G/A Damaging Arg465Gln 0.022 plasma EC4 SDHA chr5:236678 G/A Damaging Ala466Thr 0.023 plasma EC10 EML4 chr2:42528528 T/C Benign Ile557Thr 0.107 plasma EC10 MYCN chr2:16080800 G/C N.A. 0.047 plasma EC10 MYCN chr2:16080808 G/C N.A. 0.05 plasma EC10 EPAS1 chr2:46605204 G/C Benign Ser474Thr 0.023 plasma EC10 NOTCH1 chr9:139400096 C/T Benign Ala1418Thr 9.37E-03}

^{plasma EC10 PICALM chr11:85701362 C/A Benign Val447Phe 0.094 plasma EC10 IGF2BP2 chr3:185390352 C/G Benign Ala399Pro 0.092 plasma EC10 SETDB1 chr1:150933570 A/T Benign Glu1011Val 0.077 plasma EC10 TRRAP chr7:98533290 C/T Damaging Ala1368Val 0.057 plasma EC10 NFE2L2 chr2:178097136 G/A Damaging Ser193Phe 0.115 plasma EC10 BCR chr22:23656786 C/G Damaging Ala1204Gly 0.039 plasma EC10 CDH17 chr8:95178035 C/A Damaging Lys412Asn 0.06 plasma EC10 KMT2C chr7:151962168 C/A Damaging Arg380Leu 0.035 plasma EC10 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.061 plasma EC10 KMT2C chr7:151970859 C/A Damaging Gly315Cys 0.027 plasma EC10 KMT2C chr7:151970859 C/T Damaging Gly315Ser 0.062 plasma EC10 BCL9 chr1:147094280 C/A Damaging Asp1037Glu 0.032 plasma EC10 FAT4 chr4:126411731 A/T Damaging Glu4585Val 0.037 plasma EC10 EPHA3 chr3:89499491 C/A Damaging Ser887Arg 0.079 plasma EC10 MRTFA chr22:40817008 T/G Damaging Ile242Leu 0.034 plasma EC10 MRTFA chr22:40817010 T/G Damaging Tyr241Ser 0.033 plasma EC10 DICER1 chr14:95592969 C/A Benign Cys284Phe 0.12 plasma EC10 LRP1B chr2:141459732 C/T Benign Ala2094Thr 0.085 plasma EC10 EZR chr6:159188460 C/G Benign Val477Leu 0.031 plasma EC1 STK11 chr19:1207048 A/C Benign Ile46Leu 0.029 plasma EC1 SETBP1 chr18:42281778 G/C Damaging Arg156Thr 0.116 plasma EC1 PRDM1 chr6:106553683 A/C Benign Ile550Leu 0.065 plasma EC1 COL2A1 chr12:48367967 T/G Damaging Lys1408Gln 0.025 plasma EC1 NCOA1 chr2:24930309 T/A Benign Val657Asp 0.022 plasma EC1 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.029 plasma EC1 PLCG1 chr20:39794303 T/C Benign Ser546Pro 5.54E-03 plasma EC1 PLCG1 chr20:39794308 T/G Benign Asn547Lys 0.091 plasma EC1 E.R.G. chr21:39772322 G/A N.A. 0.022 plasma EC1 CNOT3 chr19:54647477 A/C Damaging Ile84Leu 0.123 plasma EC1 ANK1 chr8:41572565 C/T Damaging Ala544Thr 0.048 plasma EC1 SIX2 chr2:45233332 T/G Benign Asn285His 0.118 plasma EC1 BARD1 chr2:215657036 C/T Benign Asp117Asn 0.078 plasma EC1 ARID1B chr6:157528813 A/C Benign Met2220Leu 0.04 plasma EC1 RECQL4 chr8:145737136 G/A N.A. 0.036 plasma EC1 FAM135B chr8:139190801 T/G Damaging Thr336Pro 0.035 plasma EC1 ATM chr11:108236200 A/C Damaging Ser3046Arg 0.134 plasma EC1 CSMD3 chr8:114326902 C/T Benign Arg100Gln 0.07 plasma EC1 FLT4 chr5:180030323 G/A Benign Arg1321Trp 0.023 plasma EC1 NUTM1 chr15:34645942 T/G Damaging Met315Arg 0.037 plasma EC1 ERCC2 chr19:45862125 T/G Benign His404Pro 0.082 plasma EC1 MED12 chrX:70342972 T/A Benign Ser505Thr 0.018 plasma EC1 NOTCH2 chr1:120458550 A/C Benign Asn2265Lys 0.031 plasma EC1 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.031 plasma EC1 ACKR3 chr2:237489668 C/T Benign Thr187Met 0.019 plasma EC1 BCLAF1 chr6:136599201 C/G Damaging Gly273Ala 0.214 plasma EC1 CBFA2T3 chr16:88949125 T/G Damaging Thr388Pro 0.121 plasma EC1 SMARCA4 chr19:11144086 A/C Damaging Asn1287His 0.103 plasma EC1 SMARCA4 chr19:11144089 G/A Benign Val1288Met 0.03 plasma EC1 PDE4DIP chr1:144882673 T/G Benign Ile1253Leu 0.07 plasma EC1 AFF3 chr2:100210409 C/T Benign Ala597Thr 0.045 plasma EC1 AFF1 chr4:87968370 T/G Benign Leu228Arg 0.043 plasma EC1 STAT6 chr12:57493609 C/T Damaging Arg562His 0.037 plasma EC1 USP6 chr17:5036823 T/C Benign Leu121Ser 0.127 plasma EC1 USP6 chr17:5036834 G/A Benign Gly125Arg 0.125 plasma EC1 USP6 chr17:5036838 G/A Benign Arg126Lys 0.125 plasma EC1 USP6 chr17:5036843 C/A Benign Gln128Lys 0.129 plasma EC1 CDH11 chr16:64982648 A/C Benign Met646Arg 0.108 plasma EC1 KMT2C chr7:151874643 T/G Benign Gln2632Pro 0.033 plasma EC1 KMT2C chr7:151970859 C/A Damaging Gly315Cys 0.024 plasma EC1 SRGAP3 chr3:9100052 A/C Benign Ile302Met 0.045 plasma EC1 ROBO2 chr3:77645876 T/G Benign Asn943Lys 0.046 plasma EC1 FAT1 chr4:187541858 C/T Benign Gly1963Asp 0.028 plasma EC1 FAT1 chr4:187629979 T/G Damaging Thr335Pro 0.047 plasma EC1 ABL1 chr9:133738258 C/T Benign Arg239Cys 0.021 plasma EC1 NCOR1 chr17:15978947 G/A Benign Pro1191Ser 0.031 plasma EC1 ELL chr19:18561475 C/T Benign Gly426Asp 0.108 plasma EC1 ELL chr19:18562379 A/C Benign Ser317Ala 0.07 plasma EC1 FES chr15:91428364 T/G Damaging Met30Arg 0.171 plasma EC1 NF2 chr22:30074239 A/C Benign Ile476Leu 0.066 plasma EC1 TNC chr9:117825322 T/G Benign Thr1303Pro 0.096 plasma EC1 EZR chr6:159188460 C/G Benign Val477Leu 0.06 plasma EC1 SDHA chr5:236619 T/C Damaging Val446Ala 0.031 plasma EC1 SDHA chr5:236628 C/T Damaging Ala449Val 0.029 plasma EC1 SDHA chr5:236649 C/T Damaging Ser456Leu 0.028 plasma EC1 SDHA chr5:236676 G/A Damaging Arg465Gln 0.029 plasma EC1 SDHA chr5:236678 G/A Damaging Ala466Thr 0.031 plasma EC1 BAP1 chr3:52439882 T/G Benign Gln277Pro 0.04 tissue EC10 FKBP9 chr7:33014363 A/G Benign Asn172Ser 0.057 tissue EC10 CCND3 chr6:41903701 C/A Damaging Asp286Tyr 0.438 tissue EC10 NCOA1 chr2:24929691 C/T Benign Ala451Val 0.472 tissue EC10 MYOD1 chr11:17741849 G/A Benign Ala174Thr 0.212 tissue EC10 WNK2 chr9:96055448 C/T Damaging Arg1938Trp 0.431 tissue EC10 FOXP1 chr3:71247411 G/A Damaging Thr41Met 0.466 tissue EC10 ARHGEF10L chr1:17949641 G/A Damaging Glu391Lys 0.382 tissue EC10 MYCN chr2:16080800 G/C N.A. 0.053 tissue EC10 FAM135B chr8:139163489 C/A Benign Val1077Phe 0.293 tissue EC10 EPAS1 chr2:46605204 G/C Benign Ser474Thr 0.493 tissue EC10 CSMD3 chr8:113267503 C/A Damaging Gly3339Val 0.079 tissue EC10 NOTCH1 chr9:139405691 C/T Benign Ala834Thr 0.419 tissue EC10 NOTCH2 chr1:120458550 A/C Benign Asn2265Lys 0.04 tissue EC10 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.1 tissue EC10 CACNA1D chr3:53810752 G/T Damaging Glu1515Asp 0.12 tissue EC10 RUNX1 chr21:36164605 A/G Damaging Ser424Pro 0.072 tissue EC10 TRRAP chr7:98608720 C/T Damaging Arg3648Cys 0.433 tissue EC10 BCR chr22:23656786 C/G Damaging Ala1204Gly 0.06 tissue EC10 KMT2C chr7:151860566 C/T Benign Ala3366Thr 0.498 tissue EC10 KMT2C chr7:151962168 C/A Damaging Arg380Leu 0.036 tissue EC10 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.082 tissue EC10 KMT2C chr7:151970859 C/T Damaging Gly315Ser 0.057 tissue EC10 KMT2C chr7:151970951 C/T Damaging Arg284Gln 0.086 tissue EC10 TSHR chr14:81563048 C/T Benign Ala204Val 0.45 tissue EC10 ARHGAP26 chr5:142526871 G/A Benign Ser638Asn 0.548 tissue EC10 PABPC1 chr8:101721705 G/T Benign Phe409Leu 0.044 tissue EC10 NFKBIE chr6:44229395 T/G Benign His359Pro 0.049 tissue EC10 CHD4 chr12:6696567 G/A Damaging Arg1288Trp 0.448 tissue EC10 MN1 chr22:28195246 A/G Damaging Met429Thr 0.445 tissue EC10 FAT4 chr4:126411731 A/T Damaging Glu4585Val 0.487 tissue EC10 TNFAIP3 chr6:138196092 C/T Damaging Arg136Cys 0.396 tissue EC10 KDM6A chrX:44949022 C/T Damaging Pro1202Ser 0.442 tissue EC10 NFKB2 chr10:104157135 C/T Benign Arg158Trp 0.377 tissue EC10 KDR chr4:55984879 A/C Damaging Phe84Val 0.412 tissue EC10 CIC chr19:42776354 G/A N.A. 0.507}

^{tissue EC2 FKBP9 chr7:33014363 A/G Benign Asn172Ser 0.053 tissue EC2 CBLB chr3:105404191 T/G Benign His725Pro 0.055 tissue EC2 CSF3R chr1:36933486 T/G Damaging Met601Leu 0.04 tissue EC2 PTEN chr10:89692905 G/A Damaging Arg130Gln 0.828 tissue EC2 MTOR chr1:11273575 T/G Benign Ile1056Leu 0.064 tissue EC2 CREBBP chr16:3786721 T/G Damaging Lys1527Thr 0.043 tissue EC2 RBM15 chr1:110888971 C/A N.A. 0.073 tissue EC2 ARHGEF10L chr1:17914021 T/G Damaging Phe35Cys 0.043 tissue EC2 ARHGEF10L chr1:17949510 T/G Benign Met347Arg 0.079 tissue EC2 TPM4 chr19:16192851 T/G Damaging Ser123Arg 0.041 tissue EC2 NOTCH2 chr1:120458417 T/G Benign Ile2310Leu 0.069 tissue EC2 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.088 tissue EC2 PICALM chr11:85742536 T/G Damaging His83Pro 0.16 tissue EC2 CRTC1 chr19:18856739 G/A Benign Arg133Gln 0.403 tissue EC2 USP6 chr17:5036249 G/T Benign Met80Ile 0.057 tissue EC2 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.067 tissue EC2 KRAS chr12:25398281 C/T Damaging Gly13Asp 0.333 tissue EC2 PABPC1 chr8:101721705 G/T Benign Phe409Leu 0.082 tissue EC2 PABPC1 chr8:101721709 T/A Benign Tyr408Phe 0.084 tissue EC2 PIK3R1 chr5:67589138 G/A Damaging Gly376Arg 0.437 tissue EC2 SMC1A chrX:53440058 C/G Benign Val216Leu 0.047 tissue EC2 PTPRC chr1:198718573 T/G Damaging His989Gln 0.179 tissue EC5 FKBP9 chr7:33044951 C/G Damaging His620Gln 0.031 tissue EC5 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.055 tissue EC5 CTNNB1 chr3:41266107 T/G Damaging Ile35Ser 0.294 tissue EC5 TET1 chr10:70432681 C/T Damaging Pro1568Leu 0.069 tissue EC5 RANBP2 chr2:109371421 G/A Benign Asp755Asn 0.104 tissue EC5 BRD4 chr19:15379770 C/G Benign Gln123His 0.111 tissue EC5 PDE4DIP chr1:144906426 T/G Damaging Ile948Leu 0.073 tissue EC5 PDE4DIP chr1:144863438 G/T Damaging Gln2125Lys 0.185 tissue EC5 ESR1 chr6:152419922 T/A Damaging Tyr537Asn 0.271 tissue EC5 USP6 chr17:5036205 A/C Benign Lys66Gln 0.09 tissue EC5 USP6 chr17:5036214 C/T Benign Arg69Trp 0.097 tissue EC5 USP6 chr17:5036823 T/C Benign Leu121Ser 0.117 tissue EC5 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.049 tissue EC5 KMT2C chr7:151970859 C/A Damaging Gly315Cys 0.043 tissue EC5 SMO chr7:128845997 T/G Benign Asn309Lys 0.072 tissue EC5 BCOR chrX:39921444 T/C Damaging Asn1459Ser 0.272 tissue EC9 PTEN chr10:89624305 T/A Damaging Tyr27Asn 0.311 tissue EC9 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.052 tissue EC9 CTNNB1 chr3:41266097 G/T Damaging Asp32Tyr 0.277 tissue EC9 MDM4 chr1:204507412 C/A Benign His163Asn 0.055 tissue EC9 PAFAH1B2 chr11:117042462 A/G Benign Gln179Arg 0.079 tissue EC9 PDE4DIP chr1:144856955 C/T Damaging Gly2313Asp 0.058 tissue EC9 BCORL1 chrX:129155009 G/T N.A. Arg1164Met 0.286 tissue EC9 USP6 chr17:5036823 T/C Benign Leu121Ser 0.176 tissue EC9 USP6 chr17:5036834 G/A Benign Gly125Arg 0.176 tissue EC9 USP6 chr17:5036838 G/A Benign Arg126Lys 0.192 tissue EC9 USP6 chr17:5036843 C/A Benign Gln128Lys 0.192 tissue EC9 KMT2C chr7:151970859 C/A Damaging Gly315Cys 0.046 tissue EC9 ATP2B3 chrX:152823732 G/A Damaging Val866Met 0.063 tissue EC9 SMO chr7:128850258 T/G Damaging Cys507Trp 0.071 tissue EC9 PABPC1 chr8:101721692 G/A Damaging Pro414Ser 0.04 tissue EC9 SMC1A chrX:53448878 C/A Damaging Val31Leu 0.038 tissue EC9 BCOR chrX:39921444 T/C Damaging Asn1459Ser 0.371 tissue EC1 FKBP9 chr7:33014363 A/G Benign Asn172Ser 0.056 tissue EC1 PIK3CA chr3:178916726 G/A Damaging Arg38His 0.344 tissue EC1 ARHGEF10 chr8:1882056 C/T Damaging Ala1082Val 0.06 tissue EC1 GATA3 chr10:8097689 C/A Damaging Pro24Gln 0.053 tissue EC1 AKAP9 chr7:91732115 G/A Benign Val3773Ile 0.372 tissue EC1 PTEN chr10:89692905 G/A Damaging Arg130Gln 0.366 tissue EC1 IL7R chr5:35873634 C/A Damaging Pro197Gln 0.042 tissue EC1 SH3GL1 chr19:4363385 G/A Benign Ala237Val 0.058 tissue EC1 MTOR chr1:11264698 G/T Damaging Ser1288Arg 0.292 tissue EC1 PPP2R1A chr19:52714556 G/A Damaging Arg105Gln 0.338 tissue EC1 SMAD4 chr18:48591862 C/A Damaging Pro342His 0.321 tissue EC1 D.C.C. chr18:50961517 G/A Benign Arg1056His 0.374 tissue EC1 NCOA2 chr8:71078921 C/T Benign Val204Ile 0.059 tissue EC1 NCOA1 chr2:24930309 T/A Benign Val657Asp 0.456 tissue EC1 PRDM16 chr1:3328253 C/A Damaging Leu498Met 0.295 tissue EC1 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.089 tissue EC1 ALK chr2:29450509 C/T Benign Glu949Lys 0.278 tissue EC1 ALK chr2:30142886 G/A Damaging Arg214Cys 0.348 tissue EC1 APOBEC3B chr22:39381947 C/T Benign Ala102Val 0.078 tissue EC1 CTNNB1 chr3:41275290 C/T Damaging Arg486Cys 0.04 tissue EC1 TSC2 chr16:2138118 G/A Damaging Arg1713His 0.367 tissue EC1 ARID1B chr6:157406007 G/A Damaging Arg737Gln 0.314 tissue EC1 RECQL4 chr8:145741892 G/C N.A. 0.307 tissue EC1 RECQL4 chr8:145737136 G/A N.A. 0.353 tissue EC1 ARHGEF10L chr1:17952490 G/A Damaging Gly453Arg 0.079 tissue EC1 TCF3 chr19:1622053 C/A Benign Met223Ile 0.041 tissue EC1 TCF3 chr19:1612385 C/T Benign Arg545Gln 0.319 tissue EC1 CCDC6 chr10:61666044 C/A Damaging Gly47Trp 0.355 tissue EC1 CSMD3 chr8:114326902 C/T Benign Arg100Gln 0.358 tissue EC1 FLT4 chr5:180030323 G/A Benign Arg1321Trp 0.443 tissue EC1 POLD1 chr19:50919734 C/T Damaging Arg968Cys 0.29 tissue EC1 TET1 chr10:70412316 G/T Damaging Gly1476Trp 0.062 tissue EC1 RANBP2 chr2:109382877 T/G Damaging Phe1961Cys 0.255 tissue EC1 RANBP2 chr2:109383318 T/C Benign Leu2108Ser 0.04 tissue EC1 ERCC4 chr16:14038663 C/T Benign Ala663Val 0.293 tissue EC1 MSH6 chr2:48028177 A/C Benign Ile1019Leu 0.07 tissue EC1 SPECC1 chr17:20013776 C/A Damaging Pro62Thr 0.256 tissue EC1 HIP1 chr7:75183817 G/T Benign Leu658Ile 0.051 tissue EC1 AXIN1 chr16:396731 T/C Benign Ile99Val 0.122 tissue EC1 MED12 chrX:70342972 T/A Benign Ser505Thr 0.335 tissue EC1 DCAF12L2 chrX:125298773 C/T Damaging Ala379Thr 0.283 tissue EC1 PRKCB chr16:24185859 C/T Benign Ala451Val 0.239 tissue EC1 NOTCH2 chr1:120458550 A/C Benign Asn2265Lys 0.044 tissue EC1 ACKR3 chr2:237489668 C/T Benign Thr187Met 0.388 tissue EC1 CNTRL chr9:123850693 T/G Benign Met30Arg 0.084 tissue EC1 BCLAF1 chr6:136599201 C/G Damaging Gly273Ala 0.146 tissue EC1 BCLAF1 chr6:136599459 G/A Benign Pro187Leu 0.216 tissue EC1 BRCA2 chr13:32914817 G/A Benign Val2109Ile 0.423 tissue EC1 NF1 chr17:29653063 G/T Damaging Arg1687Ser 0.037 tissue EC1 TRIM27 chr6:28872418 G/A Damaging Thr324Met 0.284 tissue EC1 PER1 chr17:8047056 G/T Benign Pro867His 0.046 tissue EC1 RUNX1 chr21:36259267 T/C Damaging Asp75Gly 0.065 tissue EC1 MYO5A chr15:52680064 C/T Damaging Val572Ile 0.214 tissue EC1 SMARCA4 chr19:11144089 G/A Benign Val1288Met 0.405}

^{tissue EC1 LZTR1 chr22:21347168 G/A Damaging Arg412His 0.061 tissue EC1 LZTR1 chr22:21341825 G/A Damaging Arg118His 0.327 tissue EC1 RNF213 chr17:78320342 T/C Benign Val2785Ala 0.046 tissue EC1 AFF3 chr2:100170901 G/A Damaging Pro1169Leu 0.045 tissue EC1 AFF3 chr2:100210409 C/T Benign Ala597Thr 0.455 tissue EC1 AFF1 chr4:87968591 C/T Damaging Arg302Trp 0.098 tissue EC1 CHEK2 chr22:29130471 G/T Damaging Pro80His 0.298 tissue EC1 PAX5 chr9:37020789 C/A Damaging Gly19Val 0.049 tissue EC1 PAX5 chr9:37020768 A/C Damaging Val26Gly 0.236 tissue EC1 MB21D2 chr3:192516548 C/T Damaging Cys368Tyr 0.316 tissue EC1 TP53 chr17:7577538 C/T Damaging Arg248Gln 0.372 tissue EC1 NFE2L2 chr2:178096054 G/A Benign Pro426Leu 0.274 tissue EC1 BCR chr22:23656786 C/G Damaging Ala1204Gly 0.093 tissue EC1 STAT6 chr12:57493609 C/T Damaging Arg562His 0.361 tissue EC1 STAT6 chr12:57500551 G/A Damaging Arg135Trp 0.313 tissue EC1 USP6 chr17:5036834 G/A Benign Gly125Arg 0.082 tissue EC1 USP6 chr17:5036838 G/A Benign Arg126Lys 0.081 tissue EC1 USP6 chr17:5036843 C/A Benign Gln128Lys 0.078 tissue EC1 USP6 chr17:5072276 C/T Benign Ser1148Leu 0.5 tissue EC1 KCNJ5 chr11:128781217 G/C Benign Val17Leu 0.28 tissue EC1 GNAS chr20:57428403 A/G Damaging Gln28Arg 0.286 tissue EC1 GNAS chr20:57484607 C/T Damaging Arg874Cys 0.273 tissue EC1 COL1A1 chr17:48266329 G/A Damaging Arg994Cys 0.329 tissue EC1 NAB2 chr12:57484963 C/T Damaging Arg47Trp 0.33 tissue EC1 PLAG1 chr8:57079790 T/G Damaging His172Pro 0.05 tissue EC1 KMT2C chr7:151935850 C/T Damaging Gly865Asp 0.07 tissue EC1 PRDM2 chr1:14108836 C/T Damaging Arg1516Trp 0.238 tissue EC1 KMT2D chr12:49427714 T/G Benign Met3592Leu 0.084 tissue EC1 HLF chr17:53345382 G/T Benign Arg129Leu 0.279 tissue EC1 BCL6 chr3:187447511 G/A Damaging Arg228Trp 0.36 tissue EC1 PRF1 chr10:72358783 G/A Damaging Arg232Cys 0.301 tissue EC1 PMS1 chr2:190719322 A/C Benign Ser442Arg 0.395 tissue EC1 ATP2B3 chrX:152814194 C/T Damaging Thr407Met 0.277 tissue EC1 FAT3 chr11:92087842 C/T Damaging Ala855Val 0.224 tissue EC1 FAT3 chr11:92495256 G/A Damaging Gly1302Arg 0.253 tissue EC1 TAF15 chr17:34151088 G/A Benign Arg164His 0.432 tissue EC1 FAT1 chr4:187538302 C/A Benign Val2980Leu 0.581 tissue EC1 FAT1 chr4:187541858 C/T Benign Gly1963Asp 0.343 tissue EC1 FAT1 chr4:187557308 A/G Damaging Ser1352Pro 0.352 tissue EC1 FAT1 chr4:187627981 C/T Damaging Val1001Met 0.077 tissue EC1 FAT1 chr4:187629979 T/G Damaging Thr335Pro 0.047 tissue EC1 PTPRD chr9:8501057 G/A Damaging Pro609Ser 0.254 tissue EC1 SMC1A chrX:53409466 A/C Damaging Asp1082Glu 0.126 tissue EC1 SMC1A chrX:53407986 C/T Benign Val1154Ile 0.369 tissue EC1 NACA chr12:57112549 C/T Benign Arg922Gln 0.258 tissue EC1 FAT4 chr4:126373044 G/A Benign Gly3625Ser 0.328 tissue EC1 FAT4 chr4:126241504 C/A Damaging Pro1313His 0.09 tissue EC1 RNF43 chr17:56435372 G/C Benign Pro589Ala 0.25 tissue EC1 FAM47C chrX:37027640 G/A Benign Arg386His 0.334 tissue EC1 RFWD3 chr16:74694873 G/A Benign Arg159Trp 0.365 tissue EC1 FOXR1 chr11:118851213 T/C Damaging Phe209Leu 0.342 tissue EC1 EPHA3 chr3:89391155 T/G Damaging Phe407Leu 0.062 tissue EC1 POT1 chr7:124482867 T/G Damaging His386Pro 0.092 tissue EC1 ABL1 chr9:133738258 C/T Benign Arg239Cys 0.31 tissue EC1 NCOR2 chr12:124831354 C/T Damaging Arg1379His 0.268 tissue EC1 NCOR1 chr17:16062109 G/A Damaging Arg233Cys 0.28 tissue EC1 ELL chr19:18561449 G/T Benign Gln435Lys 0.054 tissue EC1 ELL chr19:18561475 C/T Benign Gly426Asp 0.32 tissue EC1 ELL chr19:18576248 A/G Damaging Val148Ala 0.37 tissue EC1 BCOR chrX:39923667 T/G Benign Ser1142Arg 0.062 tissue EC1 CIC chr19:42778303 G/A N.A. 0.055 tissue EC1 ACVR1 chr2:158595058 G/A Damaging Pro430Leu 0.304 tissue EC1 ACVR1 chr2:158630626 C/T Damaging Arg206His 0.076 tissue EC1 BCL11A chr2:60679778 G/A Damaging Arg777Cys 0.337 tissue EC1 BCL11B chr14:99724144 C/T Benign Glu31Lys 0.403 tissue EC1 LATS2 chr13:21562462 G/T Benign Ala486Asp 0.255 tissue EC1 TLX1 chr10:102891767 G/A Benign Val157Met 0.219 tissue EC1 CREB3L2 chr7:137600663 C/T Benign Val139Ile 0.056 tissue EC1 SDHA chr5:224529 G/A Damaging Ala69Thr 0.343 tissue EC1 SDHA chr5:236678 G/A Damaging Ala466Thr 0.036 tissue EC8 FKBP9 chr7:33044951 C/G Damaging His620Gln 0.032 tissue EC8 CBLB chr3:105404191 T/G Benign His725Pro 0.083 tissue EC8 AKAP9 chr7:91632395 C/A Damaging Ser1067Tyr 0.464 tissue EC8 SETBP1 chr18:42532072 A/C Benign Ile923Leu 0.084 tissue EC8 RGPD3 chr2:107029579 T/G Damaging Ser1743Arg 0.162 tissue EC8 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.035 tissue EC8 SIX2 chr2:45233332 T/G Benign Asn285His 0.04 tissue EC8 PDGFRB chr5:149503907 A/C Damaging Ser643Arg 0.033 tissue EC8 LARP4B chr10:909789 A/C Benign His108Gln 0.047 tissue EC8 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.07 tissue EC8 PICALM chr11:85742634 A/C Damaging Asn50Lys 0.085 tissue EC8 RUNX1 chr21:36164610 T/C Damaging Glu422Gly 0.12 tissue EC8 MAML2 chr11:96074720 C/T Benign Ala114Thr 0.058 tissue EC8 THRAP3 chr1:36762331 G/A Damaging Glu755Lys 0.088 tissue EC8 USP6 chr17:5036823 T/C Benign Leu121Ser 0.076 tissue EC8 BCL9L chr11:118769546 T/G Benign Met1360Leu 0.113 tissue EC8 KMT2C chr7:151962148 C/G Benign Glu387Gln 0.078 tissue EC8 KMT2C chr7:151945225 T/C Damaging Glu765Gly 0.035 tissue EC8 KMT2C chr7:151962168 C/A Damaging Arg380Leu 0.067 tissue EC8 KMT2C chr7:151962265 C/T Damaging Asp348Asn 0.067 tissue EC8 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.071 tissue EC8 KMT2C chr7:151962294 G/A Benign Ser338Leu 0.034 tissue EC8 KMT2C chr7:151970859 C/T Damaging Gly315Ser 0.049 tissue EC8 KMT2D chr12:49425065 T/G Benign Ser4475Arg 0.094 tissue EC8 PRF1 chr10:72357954 A/C Benign Val508Gly 0.036 tissue EC8 SMO chr7:128845046 T/G Damaging Asn180Lys 0.07 tissue EC8 PREX2 chr8:68981347 T/G Benign Asn473Lys 0.083 tissue EC8 ABL2 chr1:179077557 T/G Benign Ile949Leu 0.041 tissue EC8 ELF3 chr1:201980279 T/G Damaging Cys5Trp 0.103 tissue EC8 TMPRSS2 chr21:42840424 T/G Damaging Ile442Leu 0.045 tissue EC4 FKBP9 chr7:33014363 A/G Benign Asn172Ser 0.058 tissue EC4 GATA2 chr3:128204926 C/T Benign Gly172Asp 0.031 tissue EC4 CUX1 chr7:101891852 G/A Benign Ala1361Thr 0.328 tissue EC4 POLQ chr3:121260261 G/A Damaging Arg272Trp 0.469 tissue EC4 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.058 tissue EC4 CBLC chr19:45281364 C/A Benign Ala59Asp 0.458 tissue EC4 ERC1 chr12:1289726 G/T Damaging Gln586His 0.12}

^{tissue EC4 FIP1L1 chr4:54280840 G/A Benign Val292Ile 0.475 tissue EC4 MYCN chr2:16080800 G/C N.A. 0.085 tissue EC4 NSD1 chr5:176639004 G/A Benign Glu1202Lys 0.402 tissue EC4 ATM chr11:108139302 C/T Benign Thr935Met 0.431 tissue EC4 ZFHX3 chr16:72991734 C/T Damaging Gly771Arg 0.561 tissue EC4 T.F.G. chr3:100432666 G/A Damaging Gly46Glu 0.096 tissue EC4 ERCC2 chr19:45871974 T/C Benign Asn92Asp 0.384 tissue EC4 MSH6 chr2:48027016 A/G Damaging Lys632Glu 0.045 tissue EC4 PRKCB chr16:23847510 C/T Benign Ala5Val 0.511 tissue EC4 LMNA chr1:156105701 A/C Benign Lys316Gln 0.091 tissue EC4 CNTRL chr9:123886324 C/T Benign Thr589Met 0.312 tissue EC4 PTCH1 chr9:98220396 C/T Benign Gly1023Ser 0.467 tissue EC4 NUP214 chr9:134073269 C/T Damaging Pro1442Leu 0.44 tissue EC4 PER1 chr17:8050696 C/T Damaging Val501Ile 0.396 tissue EC4 PTPN13 chr4:87701620 G/A Benign Gly1991Asp 0.428 tissue EC4 PDE4DIP chr1:145021150 T/C Damaging Asp84Gly 0.108 tissue EC4 AFF3 chr2:100210570 A/G Benign Leu543Pro 0.396 tissue EC4 TRRAP chr7:98573836 C/T Damaging Thr2628Met 0.147 tissue EC4 DDR2 chr1:162725021 C/T Damaging Arg165Trp 0.48 tissue EC4 NFE2L2 chr2:178096304 C/A Damaging Asp343Tyr 0.419 tissue EC4 CTNND1 chr11:57564191 A/G Damaging Tyr228Cys 0.507 tissue EC4 BCR chr22:23656786 C/G Damaging Ala1204Gly 0.064 tissue EC4 USP6 chr17:5036249 G/T Benign Met80Ile 0.068 tissue EC4 COL1A1 chr17:48276678 C/G Damaging Gly127Ala 0.125 tissue EC4 CDH17 chr8:95143148 T/C Benign Asn747Ser 0.749 tissue EC4 NAB2 chr12:57486861 C/T N.A. His387Tyr 0.486 tissue EC4 ITGAV chr2:187511536 G/A Benign Arg428Gln 0.482 tissue EC4 KMT2C chr7:151962168 C/A Damaging Arg380Leu 0.048 tissue EC4 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.051 tissue EC4 KMT2C chr7:151970859 C/T Damaging Gly315Ser 0.046 tissue EC4 FAT3 chr11:92533711 C/T Benign Ala2511Val 0.478 tissue EC4 HLA-A chr6:29912345 A/T Benign Ile322Phe 0.27 tissue EC4 SMC1A chrX:53407978 A/C Damaging Asp1156Glu 0.039 tissue EC4 TP63 chr3:189612269 G/A Benign Arg674His 0.474 tissue EC4 DROSHA chr5:31493373 C/G Damaging Asp595His 0.453 tissue EC4 CLTCL1 chr22:19188887 C/T Damaging Ala1240Thr 0.197 tissue EC4 PTPRK chr6:128319906 T/G Damaging Met906Leu 0.108 tissue EC4 SDHA chr5:236676 G/A Damaging Arg465Gln 0.032 tissue EC4 SDHA chr5:236678 G/A Damaging Ala466Thr 0.033 tissue EC3 FKBP9 chr7:33014363 A/G Benign Asn172Ser 0.052 tissue EC3 PIK3CA chr3:178936095 A/C Damaging Gln546Pro 0.131 tissue EC3 PIK3CA chr3:178952084 C/T Benign His1047Tyr 0.237 tissue EC3 GATA3 chr10:8097728 A/C Benign Asp37Ala 0.324 tissue EC3 MAX chr14:65544747 C/T Damaging Arg60Gln 0.303 tissue EC3 CCND2 chr12:4388002 T/C Damaging Ile163Thr 0.332 tissue EC3 AKAP9 chr7:91736657 T/C Benign Tyr3827His 0.337 tissue EC3 TGFBR2 chr3:30691844 G/T Benign Ala141Ser 0.067 tissue EC3 SGK1 chr6:134492286 T/C Damaging Met400Val 0.083 tissue EC3 EIF4A2 chr3:186507044 G/A Damaging Ala405Thr 0.276 tissue EC3 GMPS chr3:155611424 T/C Benign Phe49Leu 0.075 tissue EC3 REL chr2:61144031 T/G Benign Asn138Lys 0.159 tissue EC3 TSC1 chr9:135771951 C/T Benign Ala1056Thr 0.101 tissue EC3 PBRM1 chr3:52651319 T/C Damaging Met593Val 0.368 tissue EC3 MYOD1 chr11:17742894 G/A Benign Ala268Thr 0.387 tissue EC3 FIP1L1 chr4:54319215 G/T Damaging Asp472Tyr 0.051 tissue EC3 KIAA1549 chr7:138602271 C/T Benign Glu701Lys 0.134 tissue EC3 FBLN2 chr3:13679166 C/T Damaging Ala1148Val 0.102 tissue EC3 SIX2 chr2:45233332 T/G Benign Asn285His 0.05 tissue EC3 SIX2 chr2:45235838 C/T Benign Val138Met 0.368 tissue EC3 EXT1 chr8:119123018 A/G Benign Ser90Pro 0.032 tissue EC3 ARID1A chr1:27100880 A/G Benign Met1388Val 0.336 tissue EC3 FUBP1 chr1:78444640 C/A Benign Gly17Cys 0.04 tissue EC3 ARHGEF10L chr1:17958883 G/A Damaging Arg551His 0.331 tissue EC3 TCF3 chr19:1625638 T/C Benign Thr95Ala 0.288 tissue EC3 ZFHX3 chr16:72821467 T/C Benign Ser3570Gly 0.086 tissue EC3 ZFHX3 chr16:72831399 G/C Benign Gln1728Glu 0.363 tissue EC3 FBXW7 chr4:153332900 A/G Damaging Leu19Pro 0.327 tissue EC3 TET2 chr4:106164914 G/A Damaging Arg1282His 0.364 tissue EC3 FOXL2 chr3:138664820 C/T Benign Ala249Thr 0.49 tissue EC3 RANBP2 chr2:109384346 C/T Damaging Pro2451Ser 0.347 tissue EC3 HOXA9 chr7:27205008 A/C Benign Asp23Glu 0.049 tissue EC3 SPECC1 chr17:20108176 G/T Damaging Asp272Tyr 0.042 tissue EC3 CHST11 chr12:105150838 G/A Damaging Asp106Asn 0.314 tissue EC3 NOTCH1 chr9:139412290 T/C Damaging Asp452Gly 0.321 tissue EC3 PICALM chr11:85692947 T/C Damaging Asp539Gly 0.432 tissue EC3 SND1 chr7:127447556 C/T Damaging Arg391Cys 0.242 tissue EC3 MAP3K1 chr5:56177773 T/G Benign Cys916Gly 0.074 tissue EC3 BCLAF1 chr6:136599436 G/T Damaging Pro195Thr 0.062 tissue EC3 NUP214 chr9:134073296 C/T Benign Ser1451Leu 0.299 tissue EC3 NUP214 chr9:134073967 A/G Damaging Thr1675Ala 0.313 tissue EC3 RUNX1 chr21:36164605 A/C Damaging Ser424Ala 0.063 tissue EC3 HIF1A chr14:62188253 A/G Benign Lys109Glu 0.2 tissue EC3 SKI chr1:2238188 C/A Benign Ala724Glu 0.099 tissue EC3 DAXX chr6:33287620 C/T Benign Asp493Asn 0.056 tissue EC3 NTRK1 chr1:156834151 T/A Damaging Ile73Asn 0.378 tissue EC3 BCORL1 chrX:129147745 G/A N.A. Val333Ile 0.377 tissue EC3 STAT6 chr12:57493667 T/C Benign Ser543Gly 0.263 tissue EC3 SALL4 chr20:50401031 C/T Damaging Gly979Ser 0.305 tissue EC3 GNAS chr20:57429164 G/A Benign Gly282Ser 0.298 tissue EC3 GNAS chr20:57429691 G/T N.A. Ala457Ala 0.119 tissue EC3 GNAS chr20:57470723 A/G Benign Asn709Asp 0.279 tissue EC3 CDH11 chr16:64982522 G/A Benign Thr688Ile 0.107 tissue EC3 CDH11 chr16:65016102 C/T Damaging Val368Met 0.314 tissue EC3 KMT2C chr7:151945228 G/A Benign Ser764Phe 0.042 tissue EC3 KMT2C chr7:151962265 C/T Damaging Asp348Asn 0.039 tissue EC3 KMT2C chr7:151962290 C/G Benign Lys339Asn 0.047 tissue EC3 KMT2C chr7:151962294 G/A Benign Ser338Leu 0.052 tissue EC3 KMT2D chr12:49427714 T/G Benign Met3592Leu 0.128 tissue EC3 FLI1 chr11:128677120 A/G Benign Gln256Arg 0.25 tissue EC3 FLI1 chr11:128628148 C/T Benign Pro53Ser 0.328 tissue EC3 STAT5B chr17:40371762 G/A Damaging Arg217Cys 0.288 tissue EC3 ACSL6 chr5:131326641 C/T Benign Arg97Gln 0.336 tissue EC3 FAT3 chr11:92086633 G/T Damaging Gly452Val 0.234 tissue EC3 FAT3 chr11:92087094 G/A Damaging Asp606Asn 0.313 tissue EC3 KDM5A chr12:459872 T/A Damaging Glu408Val 0.359 tissue EC3 DNM2 chr19:10935790 C/T Damaging Arg651Trp 0.289 tissue EC3 CHD4 chr12:6700879 C/T Damaging Arg1068His 0.27}

^{tissue EC3 NBEA chr13:35770297 A/G Damaging Asn1742Asp 0.285 tissue EC3 FAM47C chrX:37027361 A/C Benign His293Pro 0.049 tissue EC3 FAM47C chrX:37028333 A/C Benign His617Pro 0.037 tissue EC3 FAM47C chrX:37028648 G/A Benign Arg722His 0.346 tissue EC3 HOXD11 chr2:176973662 G/A Damaging Arg270His 0.371 tissue EC3 IKZF1 chr7:50467747 C/T Damaging Arg328Cys 0.319 tissue EC3 NCOR2 chr12:124856982 G/A Benign Pro798Leu 0.297 tissue EC3 ELL chr19:18562379 A/C Benign Ser317Ala 0.052 tissue EC3 DICER1 chr14:95569720 G/A Benign Ala1338Val 0.329 tissue EC3 LRP1B chr2:141762945 G/C Benign Ala821Gly 0.363 tissue EC3 LRP1B chr2:141291668 G/A Damaging Arg2562Cys 0.234 tissue EC3 PTPRB chr12:70929822 A/G Damaging Cys2022Arg 0.291 tissue EC3 DNMT3A chr2:25467478 T/C Damaging Tyr533Cys 0.306 tissue EC3 PTPRK chr6:128319906 T/G Damaging Met906Leu 0.078 tissue EC3 GRIN2A chr16:9857080 T/C Benign Thr1441Ala 0.323 tissue EC3 PTPRC chr1:198713220 A/G Damaging Tyr912Cys 0.385 tissue EC7 PRDM1 chr6:106553683 A/C Benign Ile550Leu 0.119 tissue EC7 RBM15 chr1:110883113 T/G Benign Asp362Glu 0.045 tissue EC7 SIX2 chr2:45233332 T/G Benign Asn285His 0.061 tissue EC7 TPR chr1:186344032 A/C Benign His43Gln 0.036 tissue EC7 ZFHX3 chr16:72845484 T/G Benign Ile1286Leu 0.095 tissue EC7 LARP4B chr10:888908 T/G Damaging Ser204Arg 0.15 tissue EC7 EP300 chr22:41556673 T/G Benign Asn1206Lys 0.077 tissue EC7 SHTN1 chr10:118687354 G/T Damaging Pro354Gln 0.041 tissue EC7 PBX1 chr1:164781344 C/T Benign His319Tyr 0.256 tissue EC7 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.107 tissue EC7 BRCA1 chr17:41245918 G/T Damaging Gln544Lys 0.111 tissue EC7 TCF7L2 chr10:114925408 T/A Benign Ser513Thr 0.051 tissue EC7 TRRAP chr7:98569512 C/A Damaging Leu2588Met 0.107 tissue EC7 BCR chr22:23656786 C/G Damaging Ala1204Gly 0.06 tissue EC7 SF3B1 chr2:198288641 T/G Benign Gln29Pro 0.057 tissue EC7 KMT2C chr7:151945225 T/C Damaging Glu765Gly 0.057 tissue EC7 KMT2C chr7:151962168 C/A Damaging Arg380Leu 0.057 tissue EC7 KMT2C chr7:151970859 C/T Damaging Gly315Ser 0.049 tissue EC7 SPOP chr17:47696719 C/G Damaging Asp77His 0.774 tissue EC7 AKT3 chr1:243828161 C/A Damaging Arg66Leu 0.07 tissue EC7 KRAS chr12:25398284 C/G Damaging Gly12Ala 0.444 tissue EC7 KDM6A chrX:44966777 G/A Damaging Cys1341Tyr 0.159 tissue EC7 PML chr15:74337108 T/G Damaging Val803Gly 0.178 tissue EC7 ELL chr19:18555603 T/G Benign Ile609Leu 0.106 tissue EC7 SDHA chr5:236678 G/A Damaging Ala466Thr 0.031 tissue EC6 LIFR chr5:38482133 A/G Benign Ile953Thr 0.342 tissue EC6 PIK3CA chr3:178916726 G/A Damaging Arg38His 0.1 tissue EC6 CBLB chr3:105404191 T/G Benign His725Pro 0.103 tissue EC6 SH3GL1 chr19:4362346 C/A Benign Arg297Leu 0.051 tissue EC6 SETBP1 chr18:42532072 A/C Benign Ile923Leu 0.109 tissue EC6 FLNA chrX:153585889 T/G Damaging Ile1620Leu 0.049 tissue EC6 RET chr10:43615650 A/G Benign Gln910Arg 0.083 tissue EC6 COL2A1 chr12:48392212 G/C Benign Gln99Glu 0.136 tissue EC6 PRDM16 chr1:3328749 C/T Benign Ala663Val 0.131 tissue EC6 RGPD3 chr2:107041612 A/C Benign Ser937Arg 0.073 tissue EC6 VAV1 chr19:6833957 T/G Benign Asn590Lys 0.116 tissue EC6 CDK12 chr17:37682548 A/C Benign Met1247Leu 0.166 tissue EC6 KLF6 chr10:3824115 C/T Benign Glu132Lys 0.05 tissue EC6 CLIP1 chr12:122758654 T/C Benign Lys1341Arg 0.13 tissue EC6 ANK1 chr8:41550626 G/A Damaging Ala1209Val 0.165 tissue EC6 KIAA1549 chr7:138603907 A/C Benign Asp155Glu 0.071 tissue EC6 ARAF chrX:47426708 C/T Damaging Thr318Met 0.099 tissue EC6 TSC2 chr16:2110731 A/C Damaging Ile346Leu 0.04 tissue EC6 ELK4 chr1:205589676 T/C Benign Ile256Met 0.092 tissue EC6 TCF3 chr19:1611726 T/C Damaging Asn653Asp 0.085 tissue EC6 TCF3 chr19:1620977 C/A Benign Gln310His 0.138 tissue EC6 NSD1 chr5:176707683 C/T Damaging Arg1914Cys 0.132 tissue EC6 ZFHX3 chr16:72984598 T/G Damaging Lys996Gln 0.071 tissue EC6 FLT4 chr5:180047694 A/C Damaging Met774Arg 0.065 tissue EC6 CSF1R chr5:149440478 T/C Damaging His639Arg 0.051 tissue EC6 FANCA chr16:89865583 A/C Benign Val295Gly 0.054 tissue EC6 TET2 chr4:106156369 A/G Benign Ser445Gly 0.065 tissue EC6 IRS4 chrX:107979139 G/A Damaging Arg146Cys 0.145 tissue EC6 TNFRSF14 chr1:2491291 T/C Damaging Ser112Pro 0.137 tissue EC6 LYL1 chr19:13210142 C/A Damaging Glu278Asp 0.302 tissue EC6 MED12 chrX:70338669 C/T Damaging Pro22Leu 0.274 tissue EC6 CHST11 chr12:105150763 C/T Damaging Arg81Trp 0.234 tissue EC6 NOTCH1 chr9:139390918 C/T Benign Ala2425Thr 0.097 tissue EC6 NOTCH2 chr1:120458550 A/C Benign Asn2265Lys 0.05 tissue EC6 NOTCH2 chr1:120548047 T/G Damaging His107Pro 0.138 tissue EC6 ACKR3 chr2:237489743 T/G Damaging Met212Arg 0.037 tissue EC6 KAT6B chr10:76735336 C/T Benign Thr414Ile 0.047 tissue EC6 KAT6B chr10:76789020 G/A Benign Asp1480Asn 0.107 tissue EC6 NF1 chr17:29677257 T/G Damaging Ser2460Ala 0.158 tissue EC6 FGFR2 chr10:123310914 C/T Damaging Ala172Thr 0.117 tissue EC6 NIN chr14:51214736 T/G Damaging Lys1680Gln 0.048 tissue EC6 KIF5B chr10:32337433 T/G Damaging Gln58Pro 0.06 tissue EC6 TCF7L2 chr10:114925408 T/A Benign Ser513Thr 0.044 tissue EC6 TCF7L2 chr10:114925418 T/A Benign Leu516Gln 0.038 tissue EC6 KAT7 chr17:47882770 G/A Damaging Cys209Tyr 0.102 tissue EC6 SMARCA4 chr19:11123782 C/A Damaging Pro875His 0.141 tissue EC6 SMARCA4 chr19:11134251 C/T Damaging Arg1037Trp 0.072 tissue EC6 RNF213 chr17:78280189 G/A Benign Arg832His 0.123 tissue EC6 TRRAP chr7:98534893 T/G Damaging Met1409Arg 0.055 tissue EC6 TRRAP chr7:98553911 G/T Damaging Arg2020Met 0.054 tissue EC6 TRRAP chr7:98509724 G/A Damaging Arg696His 0.093 tissue EC6 ESR1 chr6:152419920 T/C Damaging Leu536Pro 0.143 tissue EC6 TBX3 chr12:115112509 C/T Benign Ala411Thr 0.114 tissue EC6 SF3B1 chr2:198266611 C/T Damaging Gly742Asp 0.13 tissue EC6 GNAS chr20:57429164 G/A Benign Gly282Ser 0.195 tissue EC6 BIRC6 chr2:32733295 C/T Benign Leu3317Phe 0.057 tissue EC6 BIRC6 chr2:32689787 G/A Benign Val1718Ile 0.052 tissue EC6 NRG1 chr8:31497514 G/A Benign Arg5His 0.083 tissue EC6 NT5C2 chr10:104934666 G/A Benign Ala17Val 0.069 tissue EC6 KMT2C chr7:151846222 A/T Benign Leu4321Met 0.21 tissue EC6 KMT2C chr7:151874643 T/G Benign Gln2632Pro 0.056 tissue EC6 KMT2C chr7:151962168 C/A Damaging Arg380Leu 0.048 tissue EC6 KMT2C chr7:151962265 C/T Damaging Asp348Asn 0.039 tissue EC6 KMT2A chr11:118371737 G/A Damaging Arg2065His 0.082 tissue EC6 KMT2D chr12:49416531 C/T Damaging Glu5394Lys 0.127 tissue EC6 KMT2D chr12:49443773 T/G Benign Ile1200Leu 0.035 tissue EC6 KMT2D chr12:49445979 G/A Benign Pro496Leu 0.15 tissue EC6 BCL2 chr18:60985815 C/T Benign Glu29Lys 0.125 tissue EC6 SH2B3 chr12:111884639 T/G Damaging Leu272Arg 0.328 tissue EC6 SRGAP3 chr3:9066993 G/A Benign Pro544Ser 0.338 tissue EC6 STAT5B chr17:40368040 C/T Damaging Ala489Thr 0.088 tissue EC6 ROBO2 chr3:77617566 C/T Damaging Thr651Met 0.103 tissue EC6 CLTC chr17:57743854 T/A Damaging Ile599Asn 0.067 tissue EC6 EED chr11:85979507 T/G Benign Ile290Met 0.31 tissue EC6 FAT1 chr4:187630350 T/G Damaging Asp211Ala 0.049 tissue EC6 PIK3R1 chr5:67588131 G/T Damaging Gly321Cys 0.053 tissue EC6 PIK3R1 chr5:67591091 C/A Benign Arg562Ser 0.077 tissue EC6 PIK3R1 chr5:67591106 A/G Damaging Lys567Glu 0.143 tissue EC6 FAT4 chr4:126241549 T/G Benign Met1328Arg 0.12 tissue EC6 RNF43 chr17:56448298 G/T Damaging Arg117Ser 0.101 tissue EC6 ETV1 chr7:13935606 C/T Damaging Arg454His 0.102 tissue EC6 TNFAIP3 chr6:138200392 A/G Benign Thr604Ala 0.1 tissue EC6 AR chrX:66941805 A/C Benign Ile817Leu 0.137 tissue EC6 NCOR2 chr12:124819118 T/G Damaging Ser2160Arg 0.057 tissue EC6 DROSHA chr5:31410867 G/A Damaging Ala1218Val 0.045 tissue EC6 KDR chr4:55962435 T/G Damaging Asn897His 0.098 tissue EC6 LATS2 chr13:21555712 C/A Damaging Arg853Met 0.151 tissue EC6 LATS2 chr13:21619864 C/T Damaging Arg101Gln 0.077 tissue EC6 ELF4 chrX:129201444 G/A Benign Ser415Leu 0.039 tissue EC6 LRP1B chr2:141072619 A/C Damaging Asn4230Lys 0.174 tissue EC6 TNC chr9:117819482 C/T Damaging Gly1510Glu 0.083 tissue EC6 CLTCL1 chr22:19196590 G/T Damaging Ala1095Glu 0.047 tissue EC6 RAC1 chr7:6438326 C/T Damaging Arg87Trp 0.127 tissue EC6 KAT6A chr8:41801276 G/A Damaging Arg740Cys 0.043 tissue EC6 PTPRC chr1:198718573 T/G Damaging His989Gln 0.228 * UCSC GRCh37/hg19
** Protein function was predicted by at least two of the three methods (PolyPhen-2, PROVEAN, and SHIFT).}

* UCSC GRCh37/hg19

** Protein function was predicted by at least two of the three methods (PolyPhen-2, PROVEAN, and SHIFT).

Immunohistochemical analysis results

Immunohistochemistry for P53 was performed on all 10 EC tissues, and 3 EC tissues showed abnormal P53 expression levels (EC1, EC4, and EC7) (Table 2). EC1 showed overexpression of P53, and EC4 showed a wild-type pattern with “high” focal expression on a “low” wild type background. EC7 showed complete absence (Figures 3A, 3C and 3D). In particular, EC4 harbored TP53 mutations in peritoneal fluid and plasma ctDNA but not tissues, showing tumor heterogeneity (Tables 2 and 5).

Copy number variation assay results

We identified a total of 650 copy number variants (CNAs) (254 gains, 396 losses) in tissue, plasma, and peritoneal fluid samples from 10 EC patients (Table 7). In addition, 52 repeatedly mutated CNA regions were identified in tissue, 46 repeatedly mutated CNA regions in plasma, and 27 repeatedly mutated CNA regions in peritoneal fluid. Losses (tissue, plasma, and peritoneal fluid) at 4p15.32 and gains (tissue and peritoneal fluid) at 12p13.31 occurred most repeatedly in EC (Figures 4A-F and Table 4). Regarding cancer-related genes, POLQ and PREX2 in gain regions and CASP8 and SF3B1 in loss regions were identified in all samples including tissue, plasma, and peritoneal fluid (Fig. 4a–f).

Copy number variations identified in 24 endometrial cancer genomes through WES Sample Type SampleID Genomic Position* Event
** Copy Number Length
(bp) Log2 Ratio Number of Genes Cancer-related Genes*** tissue EC6 chr2:196544754-203379766 CN Loss One 6835012 -0.445172 69 SF3B1, CASP8 tissue EC6 chr2:234182273-238287776 CN Gain 3 4105503 0.325335 86 ACKR3 tissue EC6 chr4:3891710-4199126 CN Loss 0 307416 -2.34393 3 tissue EC6 chr4:16188042-17586839 CN Loss One 1398797 -1.77334 6 tissue EC6 chr4:119414616-119561978 CN Loss One 147362 -1.59992 3 tissue EC6 chr4:120275183-120425786 CN Loss One 150603 -1.97513 6 tissue EC6 chr7:44034670-44084648 CN Loss 0 49978 -2.37547 7 tissue EC6 chr9:39073805-46843811 CN Loss One 7770006 -1.50088 17 tissue EC6 chr10:18112016-18129807 CN Loss 0 17791 -26.8335 One tissue EC6 chr12:9453768-9596181 CN Gain 6 142413 1.5686 2 tissue EC6 chr12:9660014-9717937 CN Loss 0 57923 -26.3716 2 tissue EC6 chr14:20201457-20404331 CN Gain 6 202874 1.67986 7 tissue EC6 chr14:92406252-93407429 CN Loss One 1001177 -0.839614 12 TRIP11, GOLGA5 tissue EC6 chr14:105409215-105418727 CN Gain 5 9512 1.37045 One tissue EC6 chr15:23097113-23610325 CN Loss 0 513212 -2.53753 9 tissue EC6 chr15:28630207-29043494 CN Loss 0 413287 -2.31235 7 tissue EC6 chr15:30375993-30906808 CN Loss 0 530815 -2.10341 12 tissue EC6 chr15:32460405-32889958 CN Loss 0 429553 -3.22632 9 tissue EC6 chr17:18331601-18456672 CN Loss 0 125071 -19.4287 6 tissue EC6 chr20:29623057-29978338 CN Gain 4 355281 1.08887 8 tissue EC6 chr21:9865856-28338827 CN Gain 3 18472971 0.337896 58 tissue EC6 chr22:42522518-42526797 CN Loss 0 4279 -13.7345 2 tissue EC6 chrY:5605542-21868530 CN Loss 0 16262988 -11.164 7 tissue EC2 chr2:196544754-202207200 CN Loss One 5662446 -0.493498 47 SF3B1, CASP8 tissue EC2 chr4:16188042-17579357 CN Loss One 1391315 -1.99131 6 tissue EC2 chr7:44034670-44084648 CN Loss 0 49978 -2.26199 7 tissue EC2 chr8:69023125-71015987 CN Gain 5 1992862 1.37585 9 PREX2 tissue EC2 chr10:18087499-18129807 CN Loss 0 42308 -27.2892 3 tissue EC2 chr12:9458682-9586751 CN Gain 9 128069 2.20009 2 tissue EC2 chr12:40876187-40884792 CN Gain 6 8605 1.67723 One tissue EC2 chr12:49496720-49724278 CN Loss One 227558 -1.10182 9 tissue EC2 chr12:96992377-97137716 CN Loss One 145339 -1.72925 One tissue EC2 chr14:92624008-93407429 CN Loss One 783421 -1.00712 7 GOLGA5 tissue EC2 chr14:105409215-105416426 CN Gain 6 7211 1.54134 One tissue EC2 chr15:78232198-78575865 CN Gain 8 343667 1.91268 10 tissue EC2 chr15:81647957-82545216 CN Gain 9 897259 2.17209 5 tissue EC2 chr15:83544113-84324800 CN Gain 8 780687 1.93477 10 tissue EC2 chr15:84908031-85112939 CN Loss 0 204908 -2.80795 6 tissue EC2 chr17:20370722-20459515 CN Loss 0 88793 -2.42174 3 tissue EC2 chr19:49113973-49561202 CN Loss One 447229 -0.960355 43 BAX tissue EC2 chr19:55720559-56024501 CN Loss One 303942 -0.683447 30 tissue EC2 chr20:29623057-29977072 CN Gain 4 354015 0.97629 8 tissue EC2 chr21:9865856-28338827 CN Gain 3 18472971 0.371241 58 tissue EC2 chrY:5605542-21868530 CN Loss 0 16262988 -9.83282 7 tissue EC10 chr2:196544754-204239734 CN Loss One 7694980 -0.450863 76 SF3B1, CASP8 tissue EC10 chr2:234343343-238428654 CN Gain 3 4085311 0.355449 83 ACKR3 tissue EC10 chr3:9547542-9747565 CN Loss One 200023 -1.40276 3 tissue EC10 chr4:9461326-9471683 CN Loss 0 10357 -27.8289 One tissue EC10 chr4:16188042-17586839 CN Loss One 1398797 -1.8237 6 tissue EC10 chr5:180376275-180429863 CN Loss 0 53588 -27.0755 3 tissue EC10 chr7:31377-7136136 CN Loss One 7104759 -0.418616 109 CARD11, PMS2, RAC1 tissue EC10 chr7:44034670-44097850 CN Loss 0 63180 -2.20837 9 tissue EC10 chr7:55588652-57529664 CN Loss One 1941012 -0.561058 21 ZNF479 tissue EC10 chr8:11985842-12003959 CN Loss 0 18117 -26.3968 7 tissue EC10 chr8:47752736-69023295 CN Gain 3 21270559 0.344501 96 PREX2, SOX17, PLAG1, CHCHD7, TCEA1 tissue EC10 chr8:69027979-71015987 CN Gain 7 1988008 1.76358 9 PREX2 tissue EC10 chr8:71025798-146279543 CN Gain 3 75253745 0.342207 502 NCOA2, RSPO2, EXT1, CDH17, RAD21, PABPC1, FAM135B, EIF3E, CSMD3, RUNX1T1, NBN, CNBD1, RECQL4, NDRG1, MYC, UBR5, COX6C, HEY1 tissue EC10 chr9:127232778-130027324 CN Gain 4 2794546 1.07465 28 PPP6C tissue EC10 chr10:15831209-17949694 CN Gain 3 2118485 0.350681 16 tissue EC10 chr10:18087499-18129807 CN Loss 0 42308 -22.6948 3 tissue EC10 chr11:1018185-1026455 CN Gain 19 8270 3.25588 One tissue EC10 chr12:38600783-46321689 CN Gain 3 7720906 0.406287 32 ARID2 tissue EC10 chr12:97023809-97137362 CN Loss One 113553 -1.97729 One tissue EC10 chr14:92406252-93407429 CN Loss One 1001177 -0.872742 12 TRIP11, GOLGA5 tissue EC10 chr17:6004-1554302 CN Loss One 1548298 -0.587645 33 YWHAE tissue EC10 chr17:20370722-20459515 CN Loss 0 88793 -3.08403 3 tissue EC10 chr17:44388533-44594744 CN Loss 0 206211 -21.8683 6 tissue EC10 chr17:59968858-60351511 CN Loss One 382653 -1.16467 4 tissue EC10 chr21:9865856-28338827 CN Gain 3 18472971 0.387302 58 tissue EC10 chr22:21062274-21414861 CN Gain 3 352587 0.459895 16 LZTR1 tissue EC10 chr22:21481091-21797151 CN Loss 0 316060 -2.50831 11 tissue EC10 chr22:25005895-25054685 CN Loss 0 48790 -2.02098 5 tissue EC10 chrX:100808474-101096784 CN Gain 10 288310 2.32765 6 tissue EC10 chrX:108867890-109695098 CN Gain 6 827208 1.58767 11 tissue EC10 chrY:5605542-21868530 CN Loss 0 16262988 -10.0931 7 tissue EC7 chr1:12942022-16809924 CN Loss One 3867902 -0.489894 79 SPEN, PRDM2, CASP9 tissue EC7 chr1:16862368-17198555 CN Gain 4 336187 0.963452 9 tissue EC7 chr1:17248473-17715444 CN Loss One 466971 -0.661238 9 SDHB tissue EC7 chr1:17718495-17961104 CN Loss 0 242609 -2.46496 3 ARHGEF10L tissue EC7 chr1:17961368-36023463 CN Loss One 18062095 -0.479668 335 SFPQ, ARID1A, ID3, ARHGEF10L, PAX7, MDS2, LCK tissue EC7 chr2:241396784-241570302 CN Gain 4 173518 1.00931 6 tissue EC7 chr2:242002102-243061217 CN Gain 3 1059115 0.689725 29 tissue EC7 chr3:239351-90283749 CN Loss One 90044398 -0.522847 763 FOXP1, FHIT, EPHA3, SRGAP3, CTNNB1, VHL, CCR4, FANCD2, MITF, FBLN2, RAF1, CACNA1D, MLH1, MYD88, TGFBR2, NCKIPSD, XPC, PPARG, RHOA, SETD2, ROBO2, PBRM1, BAP1 tissue EC7 chr3:121206742-121228602 CN Gain 10 21860 2.29109 One POLQ tissue EC7 chr3:138456542-145912262 CN Gain 3 7455720 0.583215 40 ATR, PIK3CB, FOXL2 tissue EC7 chr3:145912905-146172159 CN Gain 14 259254 2.8341 3 tissue EC7 chr3:146173061-186761050 CN Gain 3 40587989 0.501815 301 MLF1, ETV5, TBL1XR1, WWTR1, PIK3CA, EIF4A2, MECOM, MAP3K13, SOX2, IGF2BP2, GMPS tissue EC7 chr3:186768974-197904036 CN Gain 4 11135062 0.841434 135 TP63, MUC4, TFRC, MB21D2, LPP, BCL6 tissue EC7 chr4:53239-31144461 CN Loss One 31091222 -0.439842 215 SLC34A2, NSD2, FGFR3 tissue EC7 chr4:66233066-190981540 CN Loss One 124748474 -0.569625 655 FAT4, CASP3, PTPN13, TET2, AFF1, FAT1, IL2, RAP1GDS1, LEF1, FBXW7 tissue EC7 chr5:49694954-180687851 CN Loss One 130992897 -0.550082 1393 CD74, PDGFRB, AFF4, RAD17, ITK, CSF1R, MAP3K1, ACSL6, IL6ST, NSD1, ARHGAP26, PIK3R1, PWWP2A, EBF1, APC, FGFR4, TLX3, NPM1, FLT4 tissue EC7 chr8:163376-43212050 CN Loss One 43048674 -0.654729 370 ARHGEF10, WRN, PCM1, IKBKB, ANK1, HOOK3, NRG1, NSD3, LEPROTL1, KAT6A, FGFR1 tissue EC7 chr8:69023125-71015987 CN Gain 6 1992862 1.47559 9 PREX2 tissue EC7 chr8:109260724-146279543 CN Gain 5 37018819 1.17554 287 RECQL4, EXT1, RAD21, EIF3E, CSMD3, NDRG1, MYC, FAM135B tissue EC7 chr9:65505340-70999528 CN Loss One 5494188 -1.37273 36 tissue EC7 chr9:71002369-127232008 CN Loss One 56229639 -0.661753 458 GNAQ, OMD, SYK, NR4A3, XPA, TAL2, WNK2, KLF4, FANCC, TNC, CNTRL, PTCH1 tissue EC7 chr9:127232778-130027324 CN Gain 3 2794546 0.673246 28 PPP6C

tissue EC7 chr9:130053402-133304109 CN Loss One 3250707 -0.594134 105 FNBP1, SET tissue EC7 chr11:86848-51516243 CN Loss One 51429395 -0.421377 609 WT1, MYOD1, NUP98, CARS, HRAS, FANCF, CREB3L1, LMO1, DDB2, LMO2, EXT2 tissue EC7 chr11:55029631-134856681 CN Gain 3 79827050 0.329015 1229 NUMA1, FOXR1, ATM, BIRC3, MEN1, FEN1, CTNND1, EED, MALAT1, BCL9L, SDHAF2, MAML2, ZBTB16, DDX10, KMT2A, ARHGEF12, FLI1, PAFAH1B2, KCNJ5, POU2AF1, CLP1, CBL, FAT3, CCND1, DDX6, SDHD, PICALM tissue EC7 chr12:86466-3043732 CN Gain 3 2957266 0.611159 45 ERC1, KDM5A tissue EC7 chr12:9458682-9582281 CN Gain 11 123599 2.49317 2 tissue EC7 chr12:19670973-34182659 CN Gain 3 14511686 0.782731 87 PPFIBP1, ETNK1, KRAS tissue EC7 chr12:93277580-133811188 CN Loss One 40533608 -0.5191 449 CHST11, POLE, USP44, PTPN11, ZCCHC8, ALDH2, SETD1B, TBX3, CLIP1, HNF1A, SH2B3, NCOR2, BCL7A tissue EC7 chr13:21237313-46541895 CN Loss One 25304582 -0.657328 189 BRCA2, CDX2, FOXO1, LATS2, NBEA, LHFPL6, FLT3 tissue EC7 chr14:50050346-78374512 CN Loss One 28324166 -0.657034 336 NIN, KTN1, MAX, SIX1, HIF1A, RAD51B, GPHN tissue EC7 chr14:85994962-92403562 CN Loss One 6408600 -0.573944 35 tissue EC7 chr14:92406252-93407429 CN Loss One 1001177 -1.34323 12 TRIP11, GOLGA5 tissue EC7 chr14:93408103-105409021 CN Loss One 12000918 -0.445026 282 HSP90AA1, TCL1A, AKT1, DICER1, BCL11B tissue EC7 chr14:105409215-105418727 CN Gain 4 9512 0.954239 One tissue EC7 chr15:78232198-78575865 CN Gain 8 343667 1.99305 10 tissue EC7 chr15:81647957-82545216 CN Gain 9 897259 2.14869 5 tissue EC7 chr15:82554021-83533094 CN Loss One 979073 -0.416661 22 tissue EC7 chr15:83544113-84324800 CN Gain 7 780687 1.90369 10 tissue EC7 chr15:84908031-85112939 CN Loss 0 204908 -2.58897 6 tissue EC7 chr15:85382922-85467362 CN Gain 10 84440 2.29997 2 tissue EC7 chr16:50060200-70161391 CN Loss One 20101191 -0.50216 238 CDH11, HERPUD1, CBFB, CYLD, CDH1, CTCF tissue EC7 chr16:70162612-71061774 CN Gain 3 899162 0.478697 23 tissue EC7 chr17:6004-649799 CN Loss One 643795 -0.546535 11 tissue EC7 chr17:18046777-21858319 CN Loss One 3811542 -0.703807 73 SPECC1 tissue EC7 chr17:25620838-28659235 CN Loss One 3038397 -0.624715 86 tissue EC7 chr17:36351799-36385063 CN Gain 12 33264 2.6252 One tissue EC7 chr17:47375967-62758903 CN Gain 3 15382936 0.531907 221 PPM1D, SPOP, MSI2, RNF43, KAT7, DDX5, CLTC, COL1A1, HLF, CD79B, BRIP1 tissue EC7 chr17:62865204-62893380 CN Loss 0 28176 -2.73709 One tissue EC7 chr18:47396-3874786 CN Loss One 3827390 -0.545769 39 tissue EC7 chr19:107361-8654449 CN Loss One 8547088 -0.582967 334 TCF3, CD209, VAV1, STK11, FSTL3, MLLT1, MAP2K2, GNA11, SH3GL1 tissue EC7 chr19:9868565-11169665 CN Loss One 1301100 -0.48384 73 KEAP1, SMARCA4, DNM2 tissue EC7 chr19:35843101-49113365 CN Loss One 13270264 -0.501445 488 CIC, CBLC, ERCC2, AKT2, BCL3, CD79A tissue EC7 chr19:49113973-49561202 CN Loss One 447229 -1.44417 43 BAX tissue EC7 chr19:49561202-55888444 CN Loss One 6327242 -0.578978 372 PPP2R1A, ZNF331, TFPT, BCL2L12, POLD1, KLK2, CNOT3 tissue EC7 chr20:15843294-26094607 CN Gain 3 10251313 0.405922 89 CRNKL1 tissue EC7 chr20:34025349-61981528 CN Loss One 27956179 -0.453666 389 SRC, NFATC2, PTPRT, GNAS, SDC4, TOP1, SALL4, PLCG1, SS18L1, MAFB tissue EC7 chr21:9865856-28338827 CN Gain 3 18472971 0.385604 58 tissue EC7 chr22:25120863-34426332 CN Gain 3 9305469 0.328652 143 ZNRF3, MN1, NF2, PATZ1, CHEK2, EWSR1 tissue EC7 chrY:5605542-21868530 CN Loss 0 16262988 -10.972 7 tissue EC4 chr1:145298217-150941113 CN Loss One 5642896 -0.419976 222 BCL9, SETDB1, ARNT tissue EC4 chr1:152086334-152330158 CN Gain 5 243824 1.38292 8 tissue EC4 chr1:154901524-155003943 CN Loss 0 102419 -2.01654 15 tissue EC4 chr2:196544754-202207200 CN Loss One 5662446 -0.527894 47 SF3B1, CASP8 tissue EC4 chr2:234182273-238287776 CN Gain 3 4105503 0.33477 86 ACKR3 tissue EC4 chr4:3891710-4199126 CN Loss 0 307416 -2.34409 3 tissue EC4 chr4:16188042-17586839 CN Loss One 1398797 -1.79073 6 tissue EC4 chr4:119414384-119606769 CN Loss One 192385 -1.52951 4 tissue EC4 chr4:120314348-120420021 CN Loss 0 105673 -2.19476 5 tissue EC4 chr4:177162588-178169554 CN Gain 8 1006966 1.90867 4 tissue EC4 chr7:31377-44032660 CN Gain 3 44001283 0.380197 352 ETV1, MACC1, SFRP4, RAC1, CARD11, HOXA13, JAZF1, HOXA11, HNRNPA2B1, PMS2, FKBP9, HOXA9 tissue EC4 chr7:44034670-44084648 CN Loss One 49978 -1.88574 7 tissue EC4 chr7:44089741-57529664 CN Gain 3 13439923 0.489665 95 ZNF479, EGFR, IKZF1 tissue EC4 chr7:62708550-158937144 CN Gain 3 96228594 0.459481 960 KMT2C, CREB3L2, FAM131B, MNX1, ELN, SND1, MET, SBDS, EZH2, KIAA1549, AKAP9, TRRAP, SMO, CUX1, CNTNAP2, POT1, CDK6, TRIM24, BRAF, HIP1, GRM3 tissue EC4 chr8:163376-6914130 CN Gain 4 6750754 0.871251 35 ARHGEF10 tissue EC4 chr8:6985470-8175809 CN Loss One 1190339 -0.682823 28 tissue EC4 chr8:8175809-43212050 CN Gain 4 35036241 0.891991 310 WRN, PCM1, IKBKB, ANK1, HOOK3, NRG1, NSD3, LEPROTL1, KAT6A, FGFR1 tissue EC4 chr8:47752736-146279543 CN Gain 4 98526807 0.964386 604 RECQL4, CDH17, PABPC1, CSMD3, RUNX1T1, NDRG1, NCOA2, PREX2, CHCHD7, EIF3E, SOX17, NBN, MYC, PLAG1, FAM135B, EXT1, RAD21, TCEA1, UBR5, HEY1, RSPO2, COX6C, CNBD1 tissue EC4 chr10:18087499-18129807 CN Loss 0 42308 -27.4146 3 tissue EC4 chr12:8372448-8568397 CN Loss 0 195949 -2.2129 5 tissue EC4 chr12:9453768-9580323 CN Gain 10 126555 2.30056 2 tissue EC4 chr12:40876187-40884792 CN Gain 6 8605 1.60343 One tissue EC4 chr12:49496720-49723274 CN Loss One 226554 -1.17399 9 tissue EC4 chr12:96992377-97137362 CN Loss One 144985 -1.8062 One tissue EC4 chr17:20370722-20448480 CN Loss 0 77758 -3.19231 3 tissue EC4 chr20:62518810-62577123 CN Gain 9 58313 2.19324 14 tissue EC4 chr21:9865856-28338827 CN Gain 3 18472971 0.362202 58 tissue EC4 chrY:5605542-21868530 CN Loss 0 16262988 -11.0097 7 tissue EC9 chr1:142542802-249231246 CN Gain 3 106688444 0.578924 1513 AKT3, FH, ELF3, ABL2, CDC73, TPM3, NTRK1, RGS7, H3F3A, PTPRC, S100A7, FCRL4, SETDB1, MUC1, FCGR2B, SLC45A3, MLLT11, TPR, LMNA, MDM4, PBX1, ARNT, DDR2, PRCC, BCL9, ELK4, PRRX1, SDHC, PDE4DIP tissue EC9 chr4:3891710-4199126 CN Loss 0 307416 -2.34076 3 tissue EC9 chr4:16188042-17586839 CN Loss One 1398797 -1.93065 6 tissue EC9 chr5:140385-45695927 CN Gain 3 45555542 0.324378 200 IL7R, CDH10, DROSHA, CTNND2, SDHA, TERT, LIFR tissue EC9 chr14:19110208-20182013 CN Loss One 1071805 -0.618846 18 tissue EC9 chr14:20201457-20404331 CN Gain 6 202874 1.56062 7 tissue EC9 chr21:9865856-28338827 CN Gain 3 18472971 0.341295 58 tissue EC9 chrY:5605542-21868530 CN Loss 0 16262988 -8.56179 7 tissue EC5 chr1:142542802-249231246 CN Gain 3 106688444 0.58397 1513 AKT3, FH, ELF3, ABL2, CDC73, TPM3, NTRK1, RGS7, H3F3A, PTPRC, S100A7, FCRL4, SETDB1, MUC1, FCGR2B, SLC45A3, MLLT11, TPR, LMNA, MDM4, PBX1, ARNT, DDR2, PRCC, BCL9, ELK4, PRRX1, SDHC, PDE4DIP tissue EC5 chr2:196544754-203379766 CN Loss One 6835012 -0.449013 69 SF3B1, CASP8 tissue EC5 chr2:234182273-237103650 CN Gain 3 2921377 0.387662 81 tissue EC5 chr3:9547542-9747565 CN Loss One 200023 -1.28636 3 tissue EC5 chr4:16188042-17586839 CN Loss One 1398797 -1.89723 6 tissue EC5 chr8:69023125-71015987 CN Gain 6 1992862 1.51754 9 PREX2 tissue EC5 chr9:127232778-130027324 CN Gain 4 2794546 1.16356 28 PPP6C tissue EC5 chr11:1016787-1026455 CN Gain 13 9668 2.73347 One tissue EC5 chr11:1264073-1270820 CN Loss One 6747 -1.69262 2 tissue EC5 chr12:9453768-9580323 CN Gain 11 126555 2.4093 2 tissue EC5 chr14:92406252-93407429 CN Loss One 1001177 -0.772337 12 TRIP11, GOLGA5 tissue EC5 chr15:20170005-20482100 CN Gain 9 312095 2.14261 One tissue EC5 chr15:22156764-22567047 CN Gain 12 410283 2.57449 15 tissue EC5 chr15:22706286-22833476 CN Loss 0 127190 -3.49189 4 tissue EC5 chr15:23105925-23610325 CN Loss 0 504400 -2.36048 9 tissue EC5 chr15:28630207-28957534 CN Loss 0 327327 -2.37646 5 tissue EC5 chr15:30375993-30437814 CN Loss 0 61821 -3.10861 3

tissue EC5 chr15:30702369-30906808 CN Loss 0 204439 -2.35324 6 tissue EC5 chr15:32684980-32889958 CN Loss 0 204978 -2.8689 7 tissue EC5 chr16:16418832-16463534 CN Loss 0 44702 -19.803 6 tissue EC5 chr17:18302589-18511289 CN Loss One 208700 -1.94318 9 tissue EC5 chr17:20370722-20459515 CN Loss 0 88793 -2.55794 3 tissue EC5 chr19:8656622-9806860 CN Gain 3 1150238 0.465301 29 MUC16 tissue EC5 chr19:49113973-49561421 CN Loss One 447448 -1.01737 43 BAX tissue EC5 chr19:55720559-56024501 CN Loss One 303942 -0.641552 30 tissue EC5 chr21:9865856-28338827 CN Gain 3 18472971 0.372307 58 tissue EC5 chrY:5605542-21868530 CN Loss 0 16262988 -8.69558 7 tissue EC8 chr3:121206742-121228602 CN Gain 9 21860 2.13688 One POLQ tissue EC8 chr3:145912905-146172159 CN Gain 11 259254 2.40483 3 tissue EC8 chr4:3891710-4190777 CN Loss 0 299067 -3.00676 3 tissue EC8 chr4:16188042-17579357 CN Loss One 1391315 -1.94661 6 tissue EC8 chr10:46194965-46733004 CN Loss 0 538039 -2.93384 4 tissue EC8 chr10:51769751-52445877 CN Loss One 676126 -1.59793 6 tissue EC8 chr10:88987990-89127187 CN Loss 0 139197 -2.97675 3 NUTM2D tissue EC8 chr10:112044561-112544696 CN Gain 5 500135 1.33674 5 tissue EC8 chr12:9453768-9596181 CN Gain 7 142413 1.71028 2 tissue EC8 chr12:9660014-9717937 CN Loss 0 57923 -26.7745 2 tissue EC8 chr14:92406252-93407429 CN Loss One 1001177 -0.833988 12 TRIP11, GOLGA5 tissue EC8 chr14:105409215-105418727 CN Gain 5 9512 1.45108 One tissue EC8 chr15:20170005-20482100 CN Gain 5 312095 1.42216 One tissue EC8 chr15:20488789-20777830 CN Loss 0 289041 -2.20894 5 tissue EC8 chr15:20777830-22567047 CN Gain 4 1789217 1.11829 26 tissue EC8 chr15:22706286-22833476 CN Loss 0 127190 -3.15311 4 tissue EC8 chr15:23255275-23610325 CN Loss 0 355050 -2.36461 7 tissue EC8 chr15:28630207-28957534 CN Loss 0 327327 -2.17091 5 tissue EC8 chr15:30375993-30906808 CN Loss 0 530815 -2.02566 12 tissue EC8 chr15:32684980-32889958 CN Loss 0 204978 -2.99785 7 tissue EC8 chr15:78232198-78575865 CN Gain 8 343667 1.92907 10 tissue EC8 chr15:81647957-82545216 CN Gain 9 897259 2.18112 5 tissue EC8 chr15:82554021-83533094 CN Loss One 979073 -0.459042 22 tissue EC8 chr15:83544113-84324800 CN Gain 8 780687 1.92984 10 tissue EC8 chr15:84908031-85112939 CN Loss 0 204908 -2.74883 6 tissue EC8 chr15:85382922-85467362 CN Gain 9 84440 2.2407 2 tissue EC8 chr17:18302589-18511289 CN Loss One 208700 -1.88157 9 tissue EC8 chr17:20370722-20448480 CN Loss 0 77758 -2.29633 3 tissue EC8 chr17:44388533-44626151 CN Loss One 237618 -1.87554 9 tissue EC8 chr17:60142489-60350076 CN Loss 0 207587 -2.0406 3 tissue EC8 chr19:49113973-49561202 CN Loss One 447229 -0.988558 43 BAX tissue EC8 chr19:55720559-56024501 CN Loss One 303942 -0.733841 30 tissue EC8 chr20:29623057-29977072 CN Gain 4 354015 1.07678 8 tissue EC8 chr21:9865856-28338827 CN Gain 3 18472971 0.387511 58 tissue EC8 chr22:21481091-21797151 CN Loss 0 316060 -2.52602 11 tissue EC8 chr22:25005895-25054685 CN Loss 0 48790 -2.05472 5 tissue EC8 chrY:5605542-21868530 CN Loss 0 16262988 -7.19293 7 tissue EC1 chr1:145293045-150941113 CN Loss One 5648068 -0.423998 226 BCL9, SETDB1, ARNT tissue EC1 chr1:152279576-152329901 CN Gain 7 50325 1.78879 5 tissue EC1 chr1:154901524-155003943 CN Loss One 102419 -1.99769 15 tissue EC1 chr2:16080381-18112238 CN Loss One 2031857 -1.09135 10 MYCN tissue EC1 chr2:87073730-88082387 CN Loss One 1008657 -1.49022 11 tissue EC1 chr2:114205185-114386361 CN Loss 0 181176 -2.21991 8 tissue EC1 chr2:137639710-138400159 CN Gain 8 760449 2.0177 One tissue EC1 chr2:160006904-160086506 CN Gain 6 79602 1.61622 3 tissue EC1 chr2:196544754-202207200 CN Loss One 5662446 -0.522963 47 SF3B1, CASP8 tissue EC1 chr3:121206742-121228602 CN Gain 9 21860 2.22774 One POLQ tissue EC1 chr3:145912905-146172159 CN Gain 10 259254 2.2883 3 tissue EC1 chr4:3891710-4190777 CN Loss 0 299067 -2.4649 3 tissue EC1 chr4:16188042-17579357 CN Loss 0 1391315 -2.01365 6 tissue EC1 chr5:68902885-70404969 CN Loss 0 1502084 -4.00942 19 tissue EC1 chr8:11990185-12003959 CN Loss 0 13774 -20.8567 5 tissue EC1 chr9:12709-118152 CN Loss 0 105443 -2.10313 3 tissue EC1 chr9:34835825-35669756 CN Loss One 833931 -0.538095 24 FANCG tissue EC1 chr9:39073805-46843811 CN Loss 0 7770006 -2.12728 17 tissue EC1 chr10:18112016-18122837 CN Loss 0 10821 -27.185 One tissue EC1 chr12:8372448-8568397 CN Loss 0 195949 -2.1858 5 tissue EC1 chr12:9453768-9586751 CN Gain 7 132983 1.86596 2 tissue EC1 chr12:40876491-40884792 CN Gain 7 8301 1.76092 One tissue EC1 chr12:49496720-49723274 CN Loss One 226554 -1.18677 9 tissue EC1 chr12:97023809-97137362 CN Loss One 113553 -1.93306 One tissue EC1 chr14:20201457-20404833 CN Gain 13 203376 2.66641 7 tissue EC1 chr16:16414976-16463534 CN Loss 0 48558 -3.5839 6 tissue EC1 chr17:20370722-20448480 CN Loss 0 77758 -2.65872 3 tissue EC1 chr19:49113973-49561202 CN Loss One 447229 -0.96167 43 BAX tissue EC1 chr20:62518810-62577123 CN Gain 9 58313 2.18803 14 tissue EC1 chrY:5605542-21868530 CN Loss 0 16262988 -10.8547 7 tissue EC3 chr1:145293045-150676814 CN Loss One 5383769 -0.44058 221 BCL9 tissue EC3 chr1:152086334-152330158 CN Gain 5 243824 1.20385 8 tissue EC3 chr1:154901524-155003943 CN Loss One 102419 -1.97052 15 tissue EC3 chr2:196544754-202207200 CN Loss One 5662446 -0.51451 47 SF3B1, CASP8 tissue EC3 chr2:241815279-241930738 CN Loss One 115459 -1.07686 5 tissue EC3 chr4:3891710-4199126 CN Loss 0 307416 -2.19945 3 tissue EC3 chr4:16188042-17579357 CN Loss One 1391315 -1.97819 6 tissue EC3 chr7:6820875-6844625 CN Loss 0 23750 -26.9804 3 tissue EC3 chr7:44034670-44084648 CN Loss 0 49978 -2.41148 7 tissue EC3 chr11:1016787-1026455 CN Gain 13 9668 2.7326 One tissue EC3 chr11:1264073-1270820 CN Loss 0 6747 -2.43146 2

tissue EC3 chr12:8372448-8568397 CN Loss 0 195949 -2.07953 5 tissue EC3 chr12:9453768-9580323 CN Gain 9 126555 2.17441 2 tissue EC3 chr14:92624008-93407429 CN Loss One 783421 -0.983611 7 GOLGA5 tissue EC3 chr14:105409215-105418727 CN Gain 5 9512 1.37434 One tissue EC3 chr16:70428938-70503182 CN Gain 12 74244 2.57119 2 tissue EC3 chr16:74410934-74446273 CN Loss 0 35339 -2.04406 3 tissue EC3 chr16:75238561-75263368 CN Loss 0 24807 -3.08731 3 tissue EC3 chr17:16635843-16844069 CN Loss One 208226 -1.71343 9 tissue EC3 chr17:20370722-20448480 CN Loss 0 77758 -2.9261 3 tissue EC3 chr17:40948014-40998180 CN Gain 5 50166 1.44849 10 tissue EC3 chr17:60315347-60350076 CN Loss 0 34729 -2.56423 2 tissue EC3 chr17:62864561-62893380 CN Loss 0 28819 -2.82863 One tissue EC3 chr20:62518810-62577123 CN Gain 9 58313 2.23458 14 tissue EC3 chrY:5605542-21868530 CN Loss 0 16262988 -11.0689 7 plasma EC6 chr2:196544754-202207200 CN Loss One 5662446 -0.517161 47 SF3B1, CASP8 plasma EC6 chr2:234429649-238288029 CN Gain 3 3858380 0.396789 79 ACKR3 plasma EC6 chr3:9547542-9747565 CN Loss One 200023 -1.28076 3 plasma EC6 chr3:121206742-121228602 CN Gain 9 21860 2.23402 One POLQ plasma EC6 chr4:16188042-17579357 CN Loss 0 1391315 -2.00054 6 plasma EC6 chr7:44034670-44097850 CN Loss 0 63180 -2.05268 9 plasma EC6 chr8:69023125-71015987 CN Gain 5 1992862 1.45567 9 PREX2 plasma EC6 chr9:12709-178980 CN Loss One 166271 -1.26893 4 plasma EC6 chr9:35065190-35669756 CN Loss One 604566 -0.572875 20 FANCG plasma EC6 chr9:39073805-46843811 CN Loss One 7770006 -1.33106 17 plasma EC6 chr10:18112016-18129807 CN Loss 0 17791 -27.0354 One plasma EC6 chr12:9660014-9716895 CN Loss 0 56881 -26.4877 2 plasma EC6 chr12:49496720-49723274 CN Loss One 226554 -1.32218 9 plasma EC6 chr12:96992377-97137362 CN Loss One 144985 -1.69641 One plasma EC6 chr14:20201457-20404833 CN Gain 6 203376 1.50953 7 plasma EC6 chr14:92624008-93407429 CN Loss One 783421 -0.986138 7 GOLGA5 plasma EC6 chr14:105409215-105418727 CN Gain 6 9512 1.63904 One plasma EC6 chr15:75550886-75630891 CN Loss 0 80005 -3.28646 4 plasma EC6 chr15:78232198-78588062 CN Gain 7 355864 1.86583 10 plasma EC6 chr15:83544113-84324800 CN Gain 8 780687 2.00094 10 plasma EC6 chr15:84908031-85112939 CN Loss 0 204908 -3.03405 6 plasma EC6 chr15:85382922-85467362 CN Gain 11 84440 2.41906 2 plasma EC6 chr15:102295237-102303107 CN Loss 0 7870 -2.31456 One plasma EC6 chr15:102303107-102416666 CN Gain 3 113559 0.37871 4 plasma EC6 chr15:102416666-102518006 CN Loss 0 101340 -2.41804 11 plasma EC6 chr17:18331601-18456672 CN Loss 0 125071 -20.3403 6 plasma EC6 chr20:62518810-62577123 CN Gain 9 58313 2.18314 14 plasma EC6 chr21:9865856-28338827 CN Gain 3 18472971 0.33397 58 plasma EC6 chr22:42522518-42526797 CN Loss 0 4279 -15.4634 2 plasma EC6 chrX:100808474-101096784 CN Gain 10 288310 2.28871 6 plasma EC6 chrY:5605542-21868530 CN Loss 0 16262988 -8.56199 7 plasma EC7 chr1:16973502-17087621 CN Gain 8 114119 2.04242 6 plasma EC7 chr1:17718495-17961104 CN Loss One 242609 -1.90633 3 ARHGEF10L plasma EC7 chr2:196544754-202207200 CN Loss One 5662446 -0.505302 47 SF3B1, CASP8 plasma EC7 chr2:234429649-238288029 CN Gain 3 3858380 0.396882 79 ACKR3 plasma EC7 chr3:9547542-9747565 CN Loss One 200023 -1.32135 3 plasma EC7 chr3:121206742-121228602 CN Gain 9 21860 2.24442 One POLQ plasma EC7 chr3:145912905-146167184 CN Gain 12 254279 2.54139 3 plasma EC7 chr4:3891710-4190777 CN Loss 0 299067 -2.22992 3 plasma EC7 chr4:9461326-9471683 CN Loss 0 10357 -27.4558 One plasma EC7 chr4:16188042-17586839 CN Loss One 1398797 -1.77673 6 plasma EC7 chr8:69023125-71015987 CN Gain 5 1992862 1.4352 9 PREX2 plasma EC7 chr12:9453768-9580323 CN Gain 8 126555 2.06979 2 plasma EC7 chr14:92624008-93171120 CN Loss One 547112 -1.57927 4 plasma EC7 chr14:105409215-105418727 CN Gain 6 9512 1.56907 One plasma EC7 chr15:75550886-75630891 CN Loss 0 80005 -2.67426 4 plasma EC7 chr15:78232198-78588062 CN Gain 7 355864 1.83731 10 plasma EC7 chr15:81647957-82545216 CN Gain 9 897259 2.18079 5 plasma EC7 chr15:83544113-84324800 CN Gain 8 780687 1.9942 10 plasma EC7 chr15:84908031-85112939 CN Loss 0 204908 -2.46659 6 plasma EC7 chr15:85382922-85467362 CN Gain 11 84440 2.4084 2 plasma EC7 chr17:6004-1554648 CN Loss One 1548644 -0.495527 33 YWHAE plasma EC7 chr19:8654736-9806860 CN Gain 3 1152124 0.4607 29 MUC16 plasma EC7 chr20:29623057-30070254 CN Gain 3 447197 0.798072 12 plasma EC7 chr21:9865856-28338827 CN Gain 3 18472971 0.343261 58 plasma EC7 chrY:5605542-21868530 CN Loss 0 16262988 -10.852 7 plasma EC5 chr11:1016787-1027240 CN Gain 11 10453 2.40063 One plasma EC5 chr11:1264073-1270820 CN Loss 0 6747 -2.00793 2 plasma EC5 chr15:75550886-75630891 CN Loss 0 80005 -2.65523 4 plasma EC5 chr15:78232198-78588062 CN Gain 7 355864 1.86414 10 plasma EC5 chr15:81647957-82545216 CN Gain 9 897259 2.16619 5 plasma EC5 chr15:83544113-84324800 CN Gain 8 780687 1.97904 10 plasma EC5 chr15:84908031-85112939 CN Loss 0 204908 -2.6309 6 plasma EC5 chr15:102295763-102303107 CN Loss 0 7344 -2.39833 One plasma EC5 chr15:102462723-102518006 CN Loss 0 55283 -3.134 10 plasma EC5 chr17:6004-1564826 CN Loss One 1558822 -0.444955 33 YWHAE plasma EC5 chr17:18302589-18511289 CN Loss One 208700 -1.62981 9 plasma EC5 chr17:19999997-21858319 CN Loss One 1858322 -0.431377 24 SPECC1 plasma EC5 chr19:49122131-49561202 CN Loss One 439071 -1.00869 42 BAX plasma EC5 chr20:62518810-62577123 CN Gain 8 58313 2.04936 14 plasma EC5 chr21:31691926-31874276 CN Gain 7 182350 1.70303 14 plasma EC5 chrX:2699993-57935914 CN Loss One 55235921 -0.618906 434 SMC1A, ZRSR2, DDX3X, TFE3, SSX1, FAM47C, EIF1AX, SSX4, RBM10, KDM6A, BCOR, ARAF, KDM5C, WAS, GATA1 plasma EC5 chrX:62519275-154774973 CN Loss One 92255698 -0.472916 671 IRS4, ZMYM3, GPC3, FLNA, DCAF12L2, NONO, AMER1, STAG2, MTCP1, MSN, MED12, AR, RPL10, FOXO4, PHF6, ATRX, ATP2B3, SEPT6, BCORL1, ELF4, BTK plasma EC5 chrY:5605542-21868530 CN Loss One 16262988 -0.522535 7 plasma EC10 chr2:196544754-202207200 CN Loss One 5662446 -0.490213 47 SF3B1, CASP8 plasma EC10 chr2:234429649-237103650 CN Gain 3 2674001 0.495001 74 plasma EC10 chr3:9547542-9747565 CN Loss One 200023 -1.30168 3

plasma EC10 chr3:14801278-15071914 CN Gain 4 270636 1.04125 3 plasma EC10 chr4:9461326-9471683 CN Loss 0 10357 -27.7635 One plasma EC10 chr4:16188042-17586839 CN Loss One 1398797 -1.85467 6 plasma EC10 chr5:180376275-180429863 CN Loss 0 53588 -21.7011 3 plasma EC10 chr6:102516194-105306516 CN Loss One 2790322 -1.46161 2 plasma EC10 chr7:44034670-44097850 CN Loss 0 63180 -2.08188 9 plasma EC10 chr8:11986329-12003959 CN Loss 0 17630 -25.339 7 plasma EC10 chr8:27905036-30014019 CN Loss One 2108983 -0.570464 20 LEPROTL1 plasma EC10 chr8:69023125-71015987 CN Gain 5 1992862 1.44083 9 PREX2 plasma EC10 chr9:12709-178980 CN Loss One 166271 -1.6736 4 plasma EC10 chr9:39073805-39178383 CN Loss One 104578 -1.26085 One plasma EC10 chr9:39358092-46843811 CN Loss One 7485719 -1.86361 16 plasma EC10 chr9:127232778-130027324 CN Gain 5 2794546 1.21977 28 PPP6C plasma EC10 chr10:18087499-18129807 CN Loss 0 42308 -26.582 3 plasma EC10 chr11:1016787-1027240 CN Gain 11 10453 2.501 One plasma EC10 chr11:1264073-1270820 CN Loss 0 6747 -2.00799 2 plasma EC10 chr12:49496720-49723274 CN Loss One 226554 -1.30944 9 plasma EC10 chr12:96992377-97137362 CN Loss One 144985 -1.72152 One plasma EC10 chr14:92624008-93172930 CN Loss One 548922 -1.50384 4 plasma EC10 chr17:20370722-20459515 CN Loss 0 88793 -2.65829 3 plasma EC10 chr17:44388533-44592710 CN Loss 0 204177 -21.5273 6 plasma EC10 chr19:107361-182790 CN Loss 0 75429 -2.64825 2 plasma EC10 chr19:8619172-8654906 CN Loss One 35734 -1.45983 2 plasma EC10 chr19:8656622-9806860 CN Gain 3 1150238 0.433738 29 MUC16 plasma EC10 chr20:62518810-62577123 CN Gain 8 58313 2.01835 14 plasma EC10 chr21:9865856-28338827 CN Gain 3 18472971 0.337398 58 plasma EC10 chr21:31691926-31874276 CN Gain 6 182350 1.53245 14 plasma EC10 chr22:21064928-21414861 CN Gain 3 349933 0.586099 16 LZTR1 plasma EC10 chr22:21481091-21797151 CN Loss 0 316060 -2.28231 11 plasma EC10 chr22:21799212-22661978 CN Loss One 862766 -0.4556 20 MAPK1 plasma EC10 chr22:22673092-22973461 CN Gain 3 300369 0.519985 8 plasma EC10 chr22:22975980-22994790 CN Loss 0 18810 -2.46617 3 plasma EC10 chr22:24627347-24717783 CN Loss One 90436 -1.67872 5 plasma EC10 chr22:25005895-25054685 CN Loss One 48790 -1.79342 5 plasma EC10 chrX:100808474-101096784 CN Gain 10 288310 2.33564 6 plasma EC10 chrY:5605542-21868530 CN Loss 0 16262988 -9.87747 7 plasma EC9 chr3:9547542-9747565 CN Loss One 200023 -1.23935 3 plasma EC9 chr4:16188042-17586839 CN Loss One 1398797 -1.82018 6 plasma EC9 chr6:38840628-38890998 CN Gain 6 50370 1.49501 3 plasma EC9 chr8:6985470-8098567 CN Loss One 1113097 -1.66938 27 plasma EC9 chr11:1016787-1026455 CN Gain 12 9668 2.6211 One plasma EC9 chr11:1264073-1270820 CN Loss One 6747 -1.76876 2 plasma EC9 chr12:9453768-9580323 CN Gain 8 126555 1.95457 2 plasma EC9 chr12:49496720-49723274 CN Loss One 226554 -1.21355 9 plasma EC9 chr12:97023809-97137362 CN Loss One 113553 -1.88907 One plasma EC9 chr14:19110208-20182013 CN Loss One 1071805 -0.74221 18 plasma EC9 chr14:20201457-20404331 CN Gain 5 202874 1.42425 7 plasma EC9 chr17:6004-1564826 CN Loss One 1558822 -0.441101 33 YWHAE plasma EC9 chr19:107361-156956 CN Loss 0 49595 -3.0605 2 plasma EC9 chr19:8619172-8654449 CN Loss One 35277 -1.55148 2 plasma EC9 chr19:8654736-9806860 CN Gain 3 1152124 0.437776 29 MUC16 plasma EC9 chr21:9865856-28338827 CN Gain 3 18472971 0.323302 58 plasma EC9 chr21:31661650-31874276 CN Gain 6 212626 1.53125 15 plasma EC9 chrY:5605542-21868530 CN Loss 0 16262988 -11.1496 7 plasma EC4 chr1:145293045-150941113 CN Loss One 5648068 -0.472121 226 BCL9, SETDB1, ARNT plasma EC4 chr1:152086334-152329901 CN Gain 5 243567 1.37036 8 plasma EC4 chr1:154901524-155003943 CN Loss 0 102419 -2.15754 15 plasma EC4 chr1:228155066-228167899 CN Loss 0 12833 -3.16515 2 plasma EC4 chr1:243211090-243220748 CN Loss 0 9658 -3.35703 2 plasma EC4 chr2:196544754-202207200 CN Loss One 5662446 -0.513779 47 SF3B1, CASP8 plasma EC4 chr2:234296768-238288029 CN Gain 3 3991261 0.364954 80 ACKR3 plasma EC4 chr3:9547542-9747565 CN Loss One 200023 -1.34215 3 plasma EC4 chr4:16188042-17586839 CN Loss One 1398797 -1.86137 6 plasma EC4 chr4:119414384-119606769 CN Loss One 192385 -1.52552 4 plasma EC4 chr7:44034670-44084648 CN Loss 0 49978 -2.7184 7 plasma EC4 chr8:6985470-8175809 CN Loss One 1190339 -1.64197 28 plasma EC4 chr8:69023125-71015987 CN Gain 6 1992862 1.4968 9 PREX2 plasma EC4 chr10:18087499-18129807 CN Loss 0 42308 -27.0601 3 plasma EC4 chr12:8375140-8568397 CN Loss 0 193257 -2.5823 5 plasma EC4 chr12:9453768-9580323 CN Gain 9 126555 2.20553 2 plasma EC4 chr12:40876187-40907334 CN Gain 5 31147 1.40989 One plasma EC4 chr12:49496720-49723274 CN Loss One 226554 -1.36721 9 plasma EC4 chr12:96992377-97137362 CN Loss One 144985 -1.6511 One plasma EC4 chr14:92624008-93171120 CN Loss One 547112 -1.45551 4 plasma EC4 chr14:105409215-105418727 CN Gain 6 9512 1.6427 One plasma EC4 chr20:62518810-62577123 CN Gain 9 58313 2.17776 14 plasma EC4 chr21:9865856-28338827 CN Gain 3 18472971 0.331704 58 plasma EC4 chrX:100808474-101096659 CN Gain 10 288185 2.3043 6 plasma EC4 chrY:5605542-21868530 CN Loss 0 16262988 -9.67814 7 plasma EC1 chr8:6985470-8175809 CN Loss 0 1190339 -2.0305 28 plasma EC1 chr8:11986673-12003959 CN Loss 0 17286 -19.0569 7 plasma EC1 chr10:18112016-18122837 CN Loss 0 10821 -27.0905 One plasma EC1 chr16:16414976-16463534 CN Loss 0 48558 -3.24997 6 plasma EC1 chr19:42910158-43702367 CN Gain 4 792209 0.913433 23 plasma EC1 chr19:48892820-49113365 CN Loss One 220545 -0.421696 10 plasma EC1 chr19:49113973-49561202 CN Loss One 447229 -1.12216 43 BAX plasma EC1 chr19:49561202-50826374 CN Loss One 1265172 -0.41773 95 BCL2L12

plasma EC1 chr19:55720559-56171784 CN Loss One 451225 -0.634725 42 plasma EC1 chrY:5605542-21868530 CN Loss 0 16262988 -8.23129 7 plasma EC2 chr1:13448382-13718871 CN Loss 0 270489 -3.2661 16 plasma EC2 chr1:17718495-17946123 CN Loss 0 227628 -2.05356 3 ARHGEF10L plasma EC2 chr1:18661429-18962940 CN Gain 7 301511 1.83854 3 PAX7 plasma EC2 chr2:196756347-202207200 CN Loss One 5450853 -0.553412 46 SF3B1, CASP8 plasma EC2 chr2:234429649-238287776 CN Gain 3 3858127 0.442231 79 ACKR3 plasma EC2 chr4:16188042-17586839 CN Loss One 1398797 -1.90981 6 plasma EC2 chr8:6985470-8098567 CN Loss 0 1113097 -2.21163 27 plasma EC2 chr8:69023125-71015987 CN Gain 5 1992862 1.4175 9 PREX2 plasma EC2 chr8:86554982-86574231 CN Loss 0 19249 -2.898 2 plasma EC2 chr9:12709-178980 CN Loss One 166271 -1.77325 4 plasma EC2 chr9:35065190-35749453 CN Loss One 684263 -0.541333 32 FANCG plasma EC2 chr9:39073805-46843811 CN Loss 0 7770006 -2.14928 17 plasma EC2 chr10:18087499-18129807 CN Loss 0 42308 -26.9594 3 plasma EC2 chr12:49496720-49723274 CN Loss One 226554 -1.40962 9 plasma EC2 chr12:52681019-53447252 CN Gain 3 766233 0.348862 34 plasma EC2 chr12:96992377-97137362 CN Loss One 144985 -1.71164 One plasma EC2 chr14:92624008-93398993 CN Loss One 774985 -1.0011 6 GOLGA5 plasma EC2 chr14:105409215-105416426 CN Gain 6 7211 1.6958 One plasma EC2 chr15:75550886-75630891 CN Loss 0 80005 -2.99535 4 plasma EC2 chr15:78232198-78588062 CN Gain 7 355864 1.90649 10 plasma EC2 chr15:81647957-82545216 CN Gain 9 897259 2.15753 5 plasma EC2 chr15:83544113-84324800 CN Gain 8 780687 2.04237 10 plasma EC2 chr15:84908031-85112939 CN Loss 0 204908 -2.8303 6 plasma EC2 chr15:85382922-85467362 CN Gain 11 84440 2.51103 2 plasma EC2 chr19:42914753-43990568 CN Gain 3 1075815 0.772092 26 plasma EC2 chr19:49122131-49561202 CN Loss One 439071 -1.17587 42 BAX plasma EC2 chr20:29623057-30070254 CN Gain 4 447197 0.814332 12 plasma EC2 chrY:5605542-21868530 CN Loss 0 16262988 -11.1841 7 plasma EC3 chr1:145293045-150676814 CN Loss One 5383769 -0.504491 221 BCL9 plasma EC3 chr1:152280232-152329901 CN Gain 5 49669 1.2939 5 plasma EC3 chr1:154901524-155004224 CN Loss One 102700 -1.96381 15 plasma EC3 chr2:196544754-202207200 CN Loss One 5662446 -0.486219 47 SF3B1, CASP8 plasma EC3 chr3:9547542-9747565 CN Loss One 200023 -1.29287 3 plasma EC3 chr4:16188042-17586839 CN Loss One 1398797 -1.88521 6 plasma EC3 chr7:6820875-6844625 CN Loss 0 23750 -26.8904 3 plasma EC3 chr7:44034670-44097850 CN Loss One 63180 -1.98127 9 plasma EC3 chr8:69023125-71015987 CN Gain 5 1992862 1.34722 9 PREX2 plasma EC3 chr11:1016787-1027240 CN Gain 11 10453 2.46417 One plasma EC3 chr11:1264073-1270820 CN Loss 0 6747 -2.36351 2 plasma EC3 chr12:657202-668614 CN Gain 7 11412 1.89767 One plasma EC3 chr12:9453768-9580323 CN Gain 8 126555 1.91653 2 plasma EC3 chr14:92624008-93393055 CN Loss One 769047 -0.999031 6 GOLGA5 plasma EC3 chr14:105409215-105418727 CN Gain 5 9512 1.33633 One plasma EC3 chr17:20370722-20448480 CN Loss 0 77758 -2.24267 3 plasma EC3 chr20:29623057-30070254 CN Gain 4 447197 0.83503 12 plasma EC3 chr21:9865856-28338827 CN Gain 3 18472971 0.347411 58 plasma EC3 chrX:100808474-101096659 CN Gain 10 288185 2.38295 6 plasma EC3 chrX:109387883-109695098 CN Gain 8 307215 2.07133 5 plasma EC3 chrY:5605542-21868530 CN Loss 0 16262988 -9.42611 7 plasma EC8 chr3:121206742-121228602 CN Gain 10 21860 2.25192 One POLQ plasma EC8 chr3:145912905-146167184 CN Gain 13 254279 2.673 3 plasma EC8 chr4:16188042-17579357 CN Loss 0 1391315 -2.01849 6 plasma EC8 chr8:69023125-71015987 CN Gain 6 1992862 1.49215 9 PREX2 plasma EC8 chr12:9660014-9717937 CN Loss 0 57923 -25.6483 2 plasma EC8 chr14:92624008-93407429 CN Loss One 783421 -0.997715 7 GOLGA5 plasma EC8 chr14:105409215-105418727 CN Gain 6 9512 1.59227 One plasma EC8 chr15:78232198-78588062 CN Gain 7 355864 1.88466 10 plasma EC8 chr15:81648781-82545216 CN Gain 9 896435 2.21341 5 plasma EC8 chr15:83544113-84324800 CN Gain 8 780687 1.98266 10 plasma EC8 chr15:84908031-85112939 CN Loss 0 204908 -2.80629 6 plasma EC8 chr17:18315246-18511289 CN Loss 0 196043 -2.15296 8 plasma EC8 chr19:42910158-43990568 CN Gain 3 1080410 0.786092 29 plasma EC8 chr19:49113973-49561202 CN Loss One 447229 -1.09489 43 BAX plasma EC8 chr22:21481091-21797151 CN Loss 0 316060 -2.65664 11 plasma EC8 chr22:25005895-25054685 CN Loss One 48790 -1.95887 5 plasma EC8 chrY:5605542-21868530 CN Loss 0 16262988 -10.8883 7 peritoneal fluid EC3 chr1:13448112-13718871 CN Loss 0 270759 -2.93908 16 peritoneal fluid EC3 chr1:16862368-17087621 CN Gain 5 225253 1.23922 9 peritoneal fluid EC3 chr1:17718495-17961104 CN Loss 0 242609 -2.10125 3 ARHGEF10L peritoneal fluid EC3 chr1:142542802-145293544 CN Gain 3 2750742 0.344142 46 PDE4DIP peritoneal fluid EC3 chr1:152086334-152329901 CN Gain 5 243567 1.18169 8 peritoneal fluid EC3 chr1:154917896-155003943 CN Loss 0 86047 -2.12132 14 peritoneal fluid EC3 chr2:196544754-202207200 CN Loss One 5662446 -0.47489 47 SF3B1, CASP8 peritoneal fluid EC3 chr3:9547542-9747565 CN Loss One 200023 -1.2599 3 peritoneal fluid EC3 chr3:121206742-121228602 CN Gain 9 21860 2.21832 One POLQ peritoneal fluid EC3 chr3:145912905-146167184 CN Gain 12 254279 2.55657 3 peritoneal fluid EC3 chr4:16188042-17524618 CN Loss One 1336576 -1.98478 5 peritoneal fluid EC3 chr4:57839321-57871972 CN Gain 8 32651 1.93325 2 peritoneal fluid EC3 chr4:120327169-120425786 CN Loss 0 98617 -2.02096 5 peritoneal fluid EC3 chr4:177116488-178169554 CN Gain 6 1053066 1.6899 5 peritoneal fluid EC3 chr9:65505340-70919133 CN Loss One 5413793 -1.07236 35 peritoneal fluid EC3 chr9:127232778-130027324 CN Gain 5 2794546 1.18677 28 PPP6C peritoneal fluid EC3 chr11:1016787-1026455 CN Gain 12 9668 2.59892 One peritoneal fluid EC3 chr11:1264073-1270820 CN Loss 0 6747 -2.48118 2 peritoneal fluid EC3 chr11:62288169-62300576 CN Gain 5 12407 1.35471 One peritoneal fluid EC3 chr11:62300576-64682052 CN Loss One 2381476 -0.474763 139 MEN1 peritoneal fluid EC3 chr11:89532890-89730470 CN Loss 0 197580 -2.0271 6 peritoneal fluid EC3 chr12:9453768-9580323 CN Gain 9 126555 2.17894 2

peritoneal fluid EC3 chr14:19110208-19671606 CN Loss One 561398 -1.70671 11 peritoneal fluid EC3 chr14:92406252-93407429 CN Loss One 1001177 -0.788576 12 TRIP11, GOLGA5 peritoneal fluid EC3 chr14:105409215-105418727 CN Gain 5 9512 1.37816 One peritoneal fluid EC3 chr15:74181324-76254331 CN Loss One 2073007 -0.502977 58 PML peritoneal fluid EC3 chr15:78290437-78575865 CN Gain 8 285428 2.04909 7 peritoneal fluid EC3 chr15:81647957-82545216 CN Gain 9 897259 2.14637 5 peritoneal fluid EC3 chr15:82554021-83533094 CN Loss One 979073 -0.436622 22 peritoneal fluid EC3 chr15:83544113-84324800 CN Gain 8 780687 2.00451 10 peritoneal fluid EC3 chr15:84908031-85112939 CN Loss 0 204908 -2.30596 6 peritoneal fluid EC3 chr15:85382922-85467362 CN Gain 10 84440 2.25912 2 peritoneal fluid EC3 chr16:16329675-16425914 CN Loss 0 96239 -7.36178 6 peritoneal fluid EC3 chr17:6004-1554648 CN Loss One 1548644 -0.451248 33 YWHAE peritoneal fluid EC3 chr17:20370722-20448480 CN Loss 0 77758 -2.44155 3 peritoneal fluid EC3 chr17:62865204-62893380 CN Loss 0 28176 -2.58508 One peritoneal fluid EC3 chr20:62518810-62577123 CN Gain 8 58313 2.0762 14 peritoneal fluid EC3 chr21:9865856-28338827 CN Gain 3 18472971 0.352071 58 peritoneal fluid EC3 chrX:100808474-101096659 CN Gain 10 288185 2.33789 6 peritoneal fluid EC3 chrY:5605542-21868530 CN Loss 0 16262988 -8.25687 7 peritoneal fluid EC2 chr2:196544754-202259640 CN Loss One 5714886 -0.432443 48 SF3B1, CASP8 peritoneal fluid EC2 chr2:234182273-238288029 CN Gain 3 4105756 0.410174 86 ACKR3 peritoneal fluid EC2 chr3:9547542-9747565 CN Loss One 200023 -1.34485 3 peritoneal fluid EC2 chr4:16188042-17586839 CN Loss One 1398797 -1.7033 6 peritoneal fluid EC2 chr6:151669450-151674868 CN Loss One 5418 -1.85477 One peritoneal fluid EC2 chr8:69023125-71015987 CN Gain 5 1992862 1.44525 9 PREX2 peritoneal fluid EC2 chr10:18087499-18129807 CN Loss 0 42308 -23.972 3 peritoneal fluid EC2 chr12:9458682-9582281 CN Gain 11 123599 2.39394 2 peritoneal fluid EC2 chr12:38600783-46322634 CN Gain 3 7721851 0.42184 32 ARID2 peritoneal fluid EC2 chr12:49496720-49724663 CN Loss One 227943 -1.25015 9 peritoneal fluid EC2 chr12:96992377-97137716 CN Loss One 145339 -1.62284 One peritoneal fluid EC2 chr14:20201457-20471033 CN Gain 5 269576 1.33138 9 peritoneal fluid EC2 chr14:92406252-93407429 CN Loss One 1001177 -0.85023 12 TRIP11, GOLGA5 peritoneal fluid EC2 chr14:105409215-105416426 CN Gain 6 7211 1.67559 One peritoneal fluid EC2 chr15:78232198-78575865 CN Gain 7 343667 1.84068 10 peritoneal fluid EC2 chr15:81647957-82545216 CN Gain 9 897259 2.15853 5 peritoneal fluid EC2 chr15:83544113-84324800 CN Gain 8 780687 1.98562 10 peritoneal fluid EC2 chr15:84908031-85112939 CN Loss 0 204908 -2.53565 6 peritoneal fluid EC2 chr16:75238561-75263368 CN Loss 0 24807 -3.10578 3 peritoneal fluid EC2 chr16:87925440-88069111 CN Gain 13 143671 2.72014 2 peritoneal fluid EC2 chr17:6004-1554302 CN Loss One 1548298 -0.532119 33 YWHAE peritoneal fluid EC2 chr19:48892820-50826374 CN Loss One 1933554 -0.642891 146 BAX, BCL2L12 peritoneal fluid EC2 chr19:55720559-55888444 CN Loss One 167885 -1.07176 19 peritoneal fluid EC2 chr21:9865856-28338827 CN Gain 3 18472971 0.417995 58 peritoneal fluid EC2 chrY:5605542-21868530 CN Loss 0 16262988 -10.9163 7 peritoneal fluid EC4 chr2:196544754-202216258 CN Loss One 5671504 -0.460343 47 SF3B1, CASP8 peritoneal fluid EC4 chr2:234182273-238288029 CN Gain 3 4105756 0.36397 86 ACKR3 peritoneal fluid EC4 chr4:16188042-17586839 CN Loss One 1398797 -1.77123 6 peritoneal fluid EC4 chr7:44034670-44099315 CN Loss One 64645 -1.85229 9 peritoneal fluid EC4 chr8:7074091-8175809 CN Loss One 1101718 -1.26731 28 peritoneal fluid EC4 chr8:47752736-69021918 CN Gain 3 21269182 0.339065 96 PREX2, SOX17, PLAG1, CHCHD7, TCEA1 peritoneal fluid EC4 chr8:69023125-71015987 CN Gain 7 1992862 1.77677 9 PREX2 peritoneal fluid EC4 chr10:18087499-18129807 CN Loss 0 42308 -27.2104 3 peritoneal fluid EC4 chr12:8372448-8568397 CN Loss 0 195949 -2.23513 5 peritoneal fluid EC4 chr12:9453768-9580323 CN Gain 9 126555 2.17435 2 peritoneal fluid EC4 chr12:38600783-40876187 CN Gain 3 2275404 0.368355 11 peritoneal fluid EC4 chr12:40876187-40907334 CN Gain 6 31147 1.51649 One peritoneal fluid EC4 chr12:49496720-49723274 CN Loss One 226554 -1.221 9 peritoneal fluid EC4 chr12:96992377-97137362 CN Loss One 144985 -1.58049 One peritoneal fluid EC4 chr14:19110208-20182013 CN Loss One 1071805 -0.601829 18 peritoneal fluid EC4 chr14:20201457-20471033 CN Gain 5 269576 1.22644 9 peritoneal fluid EC4 chr17:20370722-20448480 CN Loss 0 77758 -2.95969 3 peritoneal fluid EC4 chr21:9865856-28338827 CN Gain 3 18472971 0.373803 58 peritoneal fluid EC4 chrX:62519275-154774973 CN Gain 3 92255698 0.323967 671 IRS4, ZMYM3, GPC3, FLNA, DCAF12L2, NONO, AMER1, STAG2, MTCP1, MSN, MED12, AR, RPL10, FOXO4, PHF6, ATRX, ATP2B3, SEPT6, BCORL1, ELF4, BTK peritoneal fluid EC4 chrY:5605542-21868530 CN Loss 0 16262988 -9.66893 7 peritoneal fluid EC1 chr1:142542802-145290534 CN Gain 3 2747732 0.340225 41 PDE4DIP peritoneal fluid EC1 chr1:152192601-152329901 CN Gain 7 137300 1.85139 6 peritoneal fluid EC1 chr1:154901524-155003943 CN Loss 0 102419 -2.11605 15 peritoneal fluid EC1 chr2:16080381-18112238 CN Loss One 2031857 -1.01935 10 MYCN peritoneal fluid EC1 chr2:87073730-88053262 CN Loss One 979532 -1.31603 11 peritoneal fluid EC1 chr2:100986794-101638448 CN Gain 5 651654 1.25621 11 peritoneal fluid EC1 chr2:114257319-114386361 CN Loss 0 129042 -2.4926 7 peritoneal fluid EC1 chr2:137639710-138400159 CN Gain 9 760449 2.17945 One peritoneal fluid EC1 chr2:160006904-160043483 CN Gain 10 36579 2.3458 3 peritoneal fluid EC1 chr2:196544754-202216258 CN Loss One 5671504 -0.484471 47 SF3B1, CASP8 peritoneal fluid EC1 chr2:234182273-238288029 CN Gain 3 4105756 0.350373 86 ACKR3 peritoneal fluid EC1 chr3:121206742-121228602 CN Gain 9 21860 2.17587 One POLQ peritoneal fluid EC1 chr3:145912905-146172159 CN Gain 10 259254 2.31302 3 peritoneal fluid EC1 chr4:16188042-17586839 CN Loss One 1398797 -1.73472 6 peritoneal fluid EC1 chr6:151669765-151674868 CN Loss One 5103 -1.71553 One peritoneal fluid EC1 chr8:6985470-8175809 CN Loss One 1190339 -1.86301 28 peritoneal fluid EC1 chr8:11986329-12003564 CN Loss 0 17235 -21.3586 7 peritoneal fluid EC1 chr8:69023125-71015987 CN Gain 6 1992862 1.51399 9 PREX2 peritoneal fluid EC1 chr9:12709-118152 CN Loss 0 105443 -2.20467 3 peritoneal fluid EC1 chr9:34835825-35669756 CN Loss One 833931 -0.538035 24 FANCG peritoneal fluid EC1 chr9:39073805-46843811 CN Loss One 7770006 -1.73314 17 peritoneal fluid EC1 chr10:46194965-46733004 CN Loss One 538039 -1.91515 4 peritoneal fluid EC1 chr10:51769495-52445877 CN Loss One 676382 -1.53982 6 peritoneal fluid EC1 chr10:88987990-89127187 CN Loss 0 139197 -2.96602 3 NUTM2D peritoneal fluid EC1 chr11:55370955-55419365 CN Loss 0 48410 -21.6522 3 peritoneal fluid EC1 chr12:9453768-9583258 CN Gain 8 129490 2.08647 2 peritoneal fluid EC1 chr12:40876187-40884792 CN Gain 9 8605 2.19745 One peritoneal fluid EC1 chr12:49496720-49723274 CN Loss One 226554 -1.1327 9 peritoneal fluid EC1 chr12:97023809-97137362 CN Loss One 113553 -1.83373 One peritoneal fluid EC1 chr14:19110208-20182013 CN Gain 3 1071805 0.363243 18 peritoneal fluid EC1 chr14:20201457-20404833 CN Gain 13 203376 2.74403 7 peritoneal fluid EC1 chr15:20170005-20482100 CN Gain 3 312095 0.711278 One peritoneal fluid EC1 chr15:20488789-22074801 CN Loss One 1586012 -1.30265 15 peritoneal fluid EC1 chr15:22156764-22567047 CN Gain 4 410283 0.817618 15 peritoneal fluid EC1 chr15:22706286-22743598 CN Loss 0 37312 -3.65773 3 peritoneal fluid EC1 chr15:23255275-23610325 CN Loss 0 355050 -2.69415 7 peritoneal fluid EC1 chr15:28630207-28947614 CN Loss 0 317407 -6.14241 5 peritoneal fluid EC1 chr16:16414976-16463534 CN Loss 0 48558 -3.27587 6 peritoneal fluid EC1 chr17:6004-1554302 CN Loss One 1548298 -0.4453 33 YWHAE peritoneal fluid EC1 chr19:49113973-49561202 CN Loss One 447229 -1.02429 43 BAX peritoneal fluid EC1 chr19:55574535-56113811 CN Loss One 539276 -0.545363 43 peritoneal fluid EC1 chr20:62518810-62577123 CN Gain 9 58313 2.18748 14 peritoneal fluid EC1 chrY:5605542-21868530 CN Loss 0 16262988 -9.45966 7 * UCSC GRCh37/hg19
** CN Gain (copy number gain, 3~7 copies), CN Loss (copy number loss, 0~1 copies)
*** Cancer-related genes are extracted from Cancer Gene Census (http://cancer.sanger.ac.uk/census) and genes previously reported in Endometrial Cancers.

In particular, copy number variation regions of PREX2 and SOX17 were identified in three DNA sources of the EC4 patient, and recurrence of the disease was confirmed 15 months later (tissue: copy number acquisition at 8q11.1-8q24.3, plasma: 8q13. Copy number gain at 2-8q13.3, peritoneal fluid: copy number gain at 8q11.1-8q13.2 and 8q13.2-8q13.3) (Figures 7A and 7B). Common copy number loss regions of 2p24.3-2p24.2 and 2q32.3-2q33.1 in MYCN, SF3B1, and CASP8 were identified in both tissue and peritoneal fluid samples from EC1 patients (Figure 7c). Additionally, the copy number variation profile of EC7 patients was largely consistent with previously identified copy number variation in EC-related genes such as CDH1, CTNNB1, KRAS, MYC, and PIK3CA (Figure 7D). Two major clusters were identified through copy number variation (CNA) hierarchical clustering of tumor gDNA samples (Figure 8a). Most endometrioid ECs in TCGA showed CN low, and the cluster of EC7 was similar to high copy number cluster 4 in TCGA. Of the 24 tumor gDNA and ctDNA samples analyzed, 23 were identified as CN low and all patients were classified as endometrioid endometrial cancer (Table 2).

MSI analysis result

The present inventors identified microsatellite instability (MSI) status in all EC genomes, which makes a critical contribution to EC diagnosis and treatment. MSI status was confirmed from tumor gDNA and peritoneal fluid ctDNA from 75% of samples. The Microsatellite Stable (MSS) state of EC2 and the MSI state of EC1 and EC4 were confirmed (Figure 1c). Similarly, we determined MSS status in paired tumor gDNA and plasma ctDNA samples from five EC patients (Figure 1C).

As a result, among the four molecular groups, the MSI status of tumor gDNA and peritoneal fluid ctDNA was consistent in EC1 and EC4 patients (Figure 8b).

Mutation signature analysis results

We analyzed mutational signatures of somatic mutations in peritoneal fluid ctDNA, plasma ctDNA, and tumor gDNA samples using the NMF algorithm. We found that the C > T transition, which is frequently found in human tumors exhibiting TP53 and oxidative DNA damage effects, was enriched in all three DNA sources. Mutation signatures SBS1, SBS5, and SBS15 from the COSMIC data base were consistently confirmed to have a cosine similarity of more than 0.9 in all three DNA sources (Figure 5a-c). All three SBS mutation signatures are frequently found in uterine or cervical cancer, and SBS15 is associated with defective DNA mismatch repair. SBS15 is one of the mutational signatures in the hypermutation (MSI) subtype of TCGA EC. SBS1 affects endogenous mutational processes in most cancers. Aging-related SBS1 was the most frequently detected signature associated with EC in TCGA, especially in the copy-number-low and copy-number-high groups. In particular, we identified mutational signatures ID7 and ID2 in tissue gDNA and peritoneal fluid ctDNA (cosine similarity of 0.91 and 0.90, respectively), which were shown to be associated with DNA mismatch repair deficiency in cancer (Fig. 5d, e).

Relationship between peritoneal fluid positive for endometrial cancer and genetic characteristics

According to NCCN guidelines, peritoneal/ascitic fluid cytology is included in the surgical principles, but cytology alone has no impact on FIGO staging (https://www.nccn.org, accessed September 20, 2021). . Peritoneal fluid was collected from 10 EC patients, and whole-exome sequencing (WES) was performed on 4 samples (EC1, EC2, EC3, and EC4).

As a result, EC1 and EC3 samples showed negative cytology results, while EC2 and EC4 showed positive cytology results (Tables 1 and 2). As the number of patients with EC was only four, no statistically significant difference was observed in the number of mutations in patients presenting with negative (EC1 and EC3) and positive (EC2 and EC4) cytology. However, we found that patients with negative cytology had tissue (EC1: n = 2894, EC3: n = 2077 and EC2: n = 722, EC4 = 1472) and peritoneal fluid (EC1: n = 4044, EC3: n = 2169). , EC2: n = 1040, EC4 = 2911), the data confirmed that the total number of mutations was higher than in patients with positive cytology. Additionally, patients with negative peritoneal fluid (EC1 and EC3) had two frameshift deletions (p.K250fs and p.P20fs), one missense mutation (p.R248Q), and one mutation in TP53 and MSI. It was confirmed that it has several important genetic characteristics such as frameshift insertion (p. S37fs). EC1 and EC3 had matching TP53 mutations in tissue and peritoneal fluid, and EC1 exhibited MSI-H status in both tissue and peritoneal fluid. Additionally, the patient with positive peritoneal fluid (EC4) exhibited significant genetic features such as TP53 mutation and MSI-H status.

Claims (26)

A biomarker detected in ctDNA extracted from plasma and/or peritoneal fluid,
The biomarker is one or more selected from the group consisting of TP53, PTEN, KRAS, PIK3CA, POLE, ARID1A, CTNNB1, KMT2C, PRKAR1A, NOTCH2, USP6, SDHA, POLQ, PREX2, CASP8, SF3B1, SOX17, MYCN, CDH1 and MYC. A biomarker for predicting, diagnosing or monitoring recurrence of endometrial cancer.
According to paragraph 1,
The biomarker is TP53, which is characterized in that endometrial cancer is positive or relapsed when one or more mutations selected from the group consisting of the following are detected in TP53:
(a) frameshift mutation (p.P20fs, p.S37fs, p.C3fs, or p.K250fs);
(b) nonsense mutation (p.R174X); and
(c) Missense mutation (p.R248Q or p.R181C).
According to paragraph 1,
The biomarker is PTEN, which is characterized in that endometrial cancer is positive or relapsed when a missense mutation (p.R130Q and/or p.Y27N) is detected in PTEN.
According to paragraph 1,
The biomarker is KRAS, which is characterized in that endometrial cancer is positive or relapsed when a missense mutation (p.G13D and/or p.G12A) is detected in KRAS.
According to paragraph 1,
The biomarker is PIK3CA, and when one or more missense mutations selected from the group consisting of p.R38H, p.Q546P, p.H1047Y and p.R38C are detected in PIK3CA, endometrial cancer is positive or relapsed. A biomarker, characterized in that.
According to paragraph 1,
The biomarker is POLE, which is characterized in that endometrial cancer is positive or relapsed when one or more mutations selected from the group consisting of the following are detected in POLE:
(a) frameshift mutation (p.V1446fs); and
(b) Missense mutation (p.A465V or p.R2165H).
According to paragraph 1,
The biomarker is ARID1A, which is characterized in that endometrial cancer is positive or relapsed when one or more mutations selected from the group consisting of the following are detected in ARID1A:
(a) In frame mutation (p.1326_1327del)
(b) frameshift mutations (p.S2179fs, p.M793fs, p.D2260fs, p.P1467fs, p.P1897fs, p.V132fs, p.P2139fs, p.A1517fs, p.G1848fs, p.P549fs, p.Y1324fs, or p.Y222fs);
(c) nonsense mutation (p.R2158X, p.Y1012X, p.R1276X, or p.Q537X); and
(d) Missense mutation (M1388V or p.T1649I). According to paragraph 1,
The biomarker is CTNNB1, and endometrial cancer is detected in CTNNB1 when one or more missense mutations selected from the group consisting of p.D32Y, p.R486C, p.D32N, p.H737Q, and p.I35S are detected. A biomarker, characterized in that it is benign or recurrent.
According to paragraph 1,
The biomarker is KMT2C, which is characterized in that endometrial cancer is positive or relapsed when one or more mutations selected from the group consisting of the following are detected in KMT2C:
(a) frameshift mutation (p.K2797fs);
(b) nonsense mutation (p.Q755X); and
(c) Missense mutations (p.A3366T, p.R380L, p.G315S, p.R284Q, p.S764F, p.D348N, p.K339N, p.S338L, p.E765G, p.G315C, p.G865D, p.E387Q, p.L4264M, p.Q2632P, p.S349N, p.A3222V, p.T820I, or p.K3620N).
According to paragraph 1,
The biomarker is PRKAR1A, which is characterized in that endometrial cancer is positive or relapsed when a nonsense mutation (p.X338E) is detected in PRKAR1A.
According to paragraph 1,
The biomarker is NOTCH2, and when one or more missense mutations selected from the group consisting of p.N2265K, p.H107P, p.I2310L and p.H1390L are detected in NOTCH2, endometrial cancer is positive or relapsed. A biomarker, characterized in that.
According to paragraph 1,
The biomarker is USP6, which is characterized in that endometrial cancer is positive or relapsed when one or more mutations selected from the group consisting of the following are detected in USP6:
(a) In frame mutation (c.201_202GT);
(b) Frameshift mutation (p.R1249fs); and
(c) missense mutation (p.M80I, p.K66Q, p.R69W, p.L121S, p.G125R, p.R126K, p.Q128K, or p.S1148L).
According to paragraph 1,
The biomarker is SDHA, which is characterized in that endometrial cancer is positive or relapsed when one or more mutations selected from the group consisting of the following are detected in SDHA:
(a) Frameshift mutation (p.T567fs); and
(b) missense mutation (p.A69T, A466T, p.R465Q, p.V446A, p.A449V, p.S456L, p.C467S, or p.A454T).
According to paragraph 1,
The biomarker is POLQ, which is characterized in that endometrial cancer is positive or relapsed when one or more mutations selected from the group consisting of the following are detected in the POLQ:
(a) Frameshift mutation (p.L1430fs); and
(b) Missense mutation (p.R137W or p.R2347H).
According to paragraph 1,
The biomarker is PREX2, which is characterized in that endometrial cancer is positive or relapsed when a missense mutation (p.N473K) is detected in PREX2.
According to paragraph 1,
The biomarker is CASP8, which is characterized in that endometrial cancer is positive or relapsed when a nonsense mutation (p.Y319X) and/or a missense mutation (p.A326V) is detected in CASP8. Biomarker.
According to paragraph 1,
The biomarker is SF3B1, which is characterized in that endometrial cancer is positive or relapsed when one or more mutations selected from the group consisting of the following are detected in SF3B1:
(a) Frameshift mutation (p.M378fs);
(b) In frame mutation (p.S377delinsTPC); and
(c) Missense mutation (p.Q29P, p.G742D, or p.R387W).
According to paragraph 1,
The biomarker is MYCN, which is characterized in that endometrial cancer is positive or relapsed when one or more mutations selected from the group consisting of the following are detected in MYCN:
(a) Frameshift mutation (p.H29fs);
(b) In frame mutation (p.H29delinsHPPPP); and
(c) Missense mutation (p.R31P, p.G159D, p.G34R, or p.G37R).
According to paragraph 1,
The biomarker is MYC, a biomarker characterized in that endometrial cancer is positive or relapsed when an in frame mutation (p.70_74del and/or p.41_41del) is detected in MYC.
According to paragraph 1,
The biomarker is one or more selected from the group consisting of POLQ, PREX2, and SOX17, and when copy number gain is detected in the biomarker, endometrial cancer is positive or relapsed.
According to paragraph 1,
The biomarker is one or more selected from the group consisting of MYCN, SF3B1, and CASP8, and when copy number loss is detected in the biomarker, endometrial cancer is positive or relapsed.
A composition for predicting, diagnosing, or monitoring recurrence of endometrial cancer, comprising a substance capable of detecting the biomarker of any one of claims 1 to 21.
According to clause 22,
A composition capable of detecting the biomarker, characterized in that the composition is a probe or primer.
A kit for diagnosing or monitoring recurrence of endometrial cancer comprising the composition of claim 22.
How to provide information to predict, diagnose or monitor recurrence of endometrial cancer, including the following steps:
(a) extracting gDNA from tissue isolated from a biological sample of a diagnostic target, ctDNA from peritoneal fluid, and/or ctDNA from plasma;
(b) TP53, PTEN, KRAS, PIK3CA, POLE, ARID1A, CTNNB1, KMT2C, PRKAR1A, NOTCH2, USP6, SDHA, POLQ, PREX2, CASP8, SF3B1, SOX17, MYCN, CDH1 and Detecting mutations in one or more genes selected from the group consisting of MYC; and
(c) Determining endometrial cancer when a mutation in the gene is detected.
According to clause 25,
The method, wherein the biological sample is one or more selected from the group consisting of tumor tissue, blood, and peritoneal cell fluid.