KR20240017865A - Assay for quantitative assessment of mRNA capping efficiency - Google Patents

Abstract

The present invention provides a method for quantifying capping efficiency in a sample from an in vitro transcription reaction mixture comprising a plurality of mRNA transcripts, wherein the mRNA transcript is coupled to an oligonucleotide complementary to the sequence of nucleotides in the 5' untranslated region of the mRNA transcript. between the oligonucleotide and the sequence of nucleotides of the mRNA transcript to release the first five, six, or seven nucleotides of the mRNA transcript using nuclease (e.g., RNAse H) digestion. It is characterized by the step of forming an mRNA:DNA hybrid.

Description

Assay for quantitative assessment of mRNA capping efficiency

Cross-reference to related applications

This application claims the benefit of priority to U.S. Provisional Application No. 63/197,106, filed June 4, 2021, the disclosure of which is incorporated herein.

Incorporation by reference of sequence listing

Reference is made herein to the Sequence Listing (submitted electronically in the text file name MRT-2241WO-Sequence Listing). The text file was created on June 1, 2022, and the file size is 13,515 bytes. The entire contents of the Sequence Listing are incorporated herein by reference.

Messenger RNA (“mRNA”) therapy is becoming an increasingly important approach to treating a variety of diseases. mRNA therapy requires effective delivery of mRNA to the patient and efficient production of the protein encoded by the mRNA within the patient's body.

The mRNA used in therapy is typically produced by in vitro transcription (IVT). Although only mRNAs with a methylated 5' cap structure are translated efficiently in vivo , the mechanism for generating capped mRNAs by IVT is incomplete. Therefore, accurate characterization of capping efficiency is particularly important for determining the quality of mRNA for therapeutic applications.

The IVT process may involve cap analogs being added co-transcriptionally. Alternatively, after the IVT reaction is complete, the 5' cap structure can be added enzymatically post-transcriptionally.

During co-transcriptional capping, an anti-reversal cap analog (ARCA) is included in the IVT reaction mixture. The resulting mRNA transcript contains a methylated Cap 0 structure, which must be further methylated to form the Cap 1 structure. The Cap 1 structure is typically required for efficient translation of capped mRNA in vivo . Methylation can be performed by including 2'-O-methyltransferase in the IVT reaction mixture. The mRNA sample from the IVT reaction mixture subjected to co-transcriptional capping consists of mRNA transcripts containing Cap 0 or Cap 1 at the 5' end of the first nucleotide of the nucleotide sequence, and/or mRNA transcripts lacking the cap structure. It can be included. The mRNA transcripts without the 5' cap structure and with cap 0 and cap 1 structures, respectively, are shown in Figure 1. If ARCA cap analogs are used, the cap 0 and cap 1 structures may additionally include methylation of m ⁷ G on either the 2' or 3' OH group of the ribose ring.

Enzymatic post-transcriptional capping involves three synthetic steps. In the first step, guanylyltransferase adds guanine (cap G) to the 5' end of in vitro transcribed mRNA, using GTP as a substrate. In the second step, guanine methyltransferase adds a methyl group to form the cap 0 structure. In the third step, 2'-O-methyltransferase adds a second methyl group to form the Cap 1 structure. This process is depicted in Figure 2. The mRNA sample from the IVT reaction mixture subjected to enzymatic post-transcriptional capping consists of mRNA transcripts containing one of a number of different cap structures at the 5' end of the first nucleotide of the nucleotide sequence, and/or lacking a cap structure. May contain mRNA transcripts.

Methods for measuring capping efficiency are known in the art. For example, one method involves including [α ^-32 P]GTP in the IVT reaction mixture, where G is the first nucleotide in the nucleotide sequence of the mRNA transcript. After RNase T2 digestion, uncapped mRNA releases p3G[ ^32P ], and its abundance relative to capped mRNA, e.g. ^m7 Gp3G[ ^32P ], can be determined by analytical methods such as anion exchange chromatography. there is. However, radiolabeling the sample prohibits the use of the mRNA sample in the IVT reaction mixture for many downstream applications, so radiolabeling methods are typically run in parallel as separate control reactions. These simultaneous but separate samples not only increase the number of samples that must be processed, but are also inherently variable due to intra-operator error and subtle changes in reaction conditions.

Radiolabel-free methods for measuring capping efficiency are also known. One such method is described in WO 2017/098468. This involves using an oligonucleotide probe complementary to the 5' end of the mRNA. The probe contains a tag that allows binding to the substrate so that the substrate can be used to enrich RNase H cleaved 5' ends from the pool of synthesized mRNA molecules. However, reagents (e.g., magnetic beads) required for the concentration step add to the cost of the assay. Concentration is also accompanied by an inherent reduction in yield, reducing the sample-efficiency of the analysis.

Therefore, there is a need for a cost-effective, sample-efficient, and time-efficient method to quantify capping efficiency in mRNA samples from IVT reaction mixtures.

The present invention provides an improved method for accurately and quantitatively determining the capping efficiency of mRNA transcripts synthesized by in vitro transcription (IVT). In particular, the present invention relates to an improved method for quantifying the capping efficiency of mRNA transcripts directly from an mRNA preparation sample (e.g., from an IVT reaction mixture), without pretreatment of the mRNA preparation sample. Best of all, the mRNA capping efficiency method provided herein combines mRNA:DNA hybridization reaction, nuclease digestion, and MS and LC-MS (mass spectrometry/liquid chromatography-mass spectrometry) quantification into a one-step analysis within a single reaction vessel. do. The improved method is a reliable, fast, and efficient quantitative approach to assess mRNA capping efficiency. The present invention is particularly useful for quality control during mRNA manufacturing and characterization of mRNA as an active pharmaceutical ingredient (API) in a final therapeutic product. Quantification of capping efficiency can also be automated with the one-step simplicity of using a single reaction vessel.

The invention is based, in part, on the highly efficient and precise enzymatic release of the first five, six or seven 5' nucleotides of an mRNA transcript. These are oligonucleotides and the second to fifth 5' nucleotides of the mRNA transcript, respectively, to guide nuclease (e.g., RNAseH) activity such that the first five, six, or seven 5' nucleotides of the mRNA are released from the remaining mRNA transcript. This is achieved using oligonucleotides that form an mRNA:DNA hybrid between the th nucleotide, the third to sixth nucleotide, or the fourth to seventh nucleotide. This is depicted in Figure 3, where the first five 5' nucleotides of the mRNA are separated between the oligonucleotide and the second to fifth nucleotides to guide nuclease (e.g. RNAseH) activity to release them from the remaining mRNA transcript. The use of oligonucleotides to form mRNA:DNA hybrids is illustrated. By analyzing only the first five, six, or seven 5' nucleotides in the nucleotide sequence of an mRNA transcript, the present invention allows the mRNA transcript synthesized by IVT (e.g., in contrast to an incompletely methylated Cap 0 structure). It provides a highly sensitive method for determining whether Cap 1 contains a structure.

In particular, the present invention provides a method for quantifying mRNA capping efficiency in an mRNA sample from an IVT reaction mixture, comprising: (a) providing an mRNA sample, wherein the mRNA sample contains a plurality of mRNA transcripts comprising a nucleotide sequence; , wherein the first portion of the mRNA transcript comprises a Cap 1 structure at the 5' end of the first nucleotide of the nucleotide sequence; (b) Contacting the mRNA sample with an oligonucleotide complementary to the mRNA transcript, the oligonucleotide and (i) the second to fifth nucleotides, (ii) the third to sixth nucleotides of the nucleotide sequence of the mRNA transcript. or (iii) forming an mRNA:DNA hybrid between the fourth to seventh nucleotides ; (c) contacting the sample obtained in step (b) with a nuclease (e.g., RNase H) to separate (i) the first five 5' nucleotides of the mRNA, (ii) the first six nucleotides, or (iii) ) releasing each of the first seven nucleotides; and (d) analyzing the sample obtained in step (c) to determine the first portion of the mRNA transcript comprising the Cap 1 structure in the mRNA sample, wherein steps (a) to (c) are the same. A method is provided wherein the reaction proceeds sequentially with each other in a reaction vessel. The method of the present invention is a reliable, fast, and efficient quantitative approach to assess mRNA capping efficiency. The present invention is particularly useful for quality control during mRNA manufacturing and characterization of mRNA as an active pharmaceutical ingredient (API) in a final therapeutic product.

In some embodiments, the invention provides a method of quantifying mRNA capping efficiency in an mRNA sample from an IVT reaction mixture, comprising: (a) providing an mRNA sample, wherein the mRNA sample comprises a nucleotide sequence of a plurality of mRNA transcripts; wherein the first portion of the mRNA transcript comprises a Cap 1 structure at the 5' end of the first nucleotide of the nucleotide sequence; (b) contacting the mRNA sample with an oligonucleotide complementary to the mRNA transcript, forming an mRNA:DNA hybrid between the oligonucleotide and the second to fifth nucleotides of the nucleotide sequence of the mRNA transcript; (c) contacting the sample obtained in step (b) with a nuclease (e.g., RNase H) to release the first five 5' nucleotides of the mRNA; and (d) analyzing the sample obtained in step (c) to determine the first portion of the mRNA transcript comprising the Cap 1 structure in the mRNA sample, wherein steps (a) to (c) are the same. A method is provided wherein the reaction proceeds sequentially with each other in a reaction vessel.

In some embodiments, the invention provides a method of quantifying mRNA capping efficiency in an mRNA sample from an IVT reaction mixture, comprising: (a) providing an mRNA sample, wherein the mRNA sample comprises a nucleotide sequence of a plurality of mRNA transcripts; wherein the first portion of the mRNA transcript comprises a Cap 1 structure at the 5' end of the first nucleotide of the nucleotide sequence; (b) contacting the mRNA sample with an oligonucleotide complementary to the mRNA transcript, forming an mRNA:DNA hybrid between the oligonucleotide and the third to sixth nucleotides of the nucleotide sequence of the mRNA transcript; (c) contacting the sample obtained in step (b) with a nuclease (e.g., RNase H) to release the first six 5' nucleotides of the mRNA; and (d) analyzing the sample obtained in step (c) to determine the first portion of the mRNA transcript comprising the Cap 1 structure in the mRNA sample, wherein steps (a) to (c) are the same. Provided is a method in which reactions proceed sequentially with each other in a reaction vessel.

In some embodiments, the invention provides a method of quantifying mRNA capping efficiency in an mRNA sample from an IVT reaction mixture, comprising: (a) providing an mRNA sample, wherein the mRNA sample comprises a nucleotide sequence of a plurality of mRNA transcripts; wherein the first portion of the mRNA transcript comprises a Cap 1 structure at the 5' end of the first nucleotide of the nucleotide sequence; (b) contacting the mRNA sample with an oligonucleotide complementary to the mRNA transcript, forming an mRNA:DNA hybrid between the oligonucleotide and the fourth to seventh nucleotides of the nucleotide sequence of the mRNA transcript; (c) contacting the sample obtained in step (b) with RNase H to release the first 7' nucleotides of the mRNA; and (d) analyzing the sample obtained in step (c) to determine the first portion of the mRNA transcript comprising the Cap 1 structure in the mRNA sample, wherein steps (a) to (c) are the same. A method is provided in which the reactions proceed sequentially in a reaction vessel.

In some embodiments, steps (b) through (d) are performed by an automated system.

In some embodiments, the analysis can further determine the methylation status of the cap. In some embodiments, the method according to the invention further comprises determining the relative abundance of cap structures comprising different methylation states. In some embodiments, the methods of the invention can be used to determine the portion of the mRNA transcript that contains a cap G structure. In some embodiments, the methods of the invention can be used to determine the portion of an mRNA transcript that is capped with cap 0. In some embodiments, the method according to the invention may be used to determine the portion of the mRNA transcript comprising a Cap 0 or Cap G structure further comprising methylation of m ⁷ G in the 2' or 3' OH group of the ribose ring. You can.

In some embodiments, the cap is added enzymatically after transcription. In some embodiments, the cap is co-transcriptionally added to the mRNA.

Oligonucleotides suitable for use in step (b) are typically about 10 to 25 (e.g., 14 to 21) nucleotides in length. It includes a DNA nucleotide flanked on one or both sides by one or more RNA nucleotides (e.g., 1, 2, 3, 4, 5 or more RNA nucleotides). In some embodiments, suitable oligonucleotides are 16 nucleotides in length. In certain embodiments, suitable oligonucleotides contain four DNA nucleotides flanked on one or both sides by one or more RNA nucleotides (e.g., 1, 2, 3, 4, 5 or more RNA nucleotides).

In some embodiments, suitable oligonucleotides oligonucleotides are represented by the formula: 5'-[R] _n [D] ₄ [R] ₁ -3', wherein each R is an RNA nucleotide and each D is DNA nucleotides (where n is 10 to 20), the oligonucleotide has a GC content of about 40% to about 60%, and the mRNA:DNA hybrid has a melting temperature of about 50°C to about 60°C. In some embodiments, the melt temperature is between 52°C and 58°C. In some embodiments, n is 11 to 15. In certain embodiments, each RNA nucleotide comprises 2'-O-methyl ribose. In certain embodiments, the oligonucleotide is represented by the formula: 5'-[R] ₁₁ [D] ₄ [R] _1-3 ', where each R is an RNA nucleotide and each D is a DNA nucleotide. ).

Exemplary oligonucleotides found to be particularly suitable for use in the present invention have the following sequence: 5'-mUmCmCmAmGmGmCmGmAmUmCTGTCmC-3' [SEQ ID NO: 1], where mU represents uridine with 2'-O-methyl ribose ; mC represents cytidine with 2'-O-methyl ribose; mA represents adenine with 2'-O-methyl ribose; mG represents guanidine with 2'-O-methyl ribose; T represents stands for oxythymidine; G stands for deoxyguanidine; C stands for deoxycytidine). This oligonucleotide can be used with mRNA containing the following 5' untranslated region (5' UTR): GGACAGAUCGCCUGGA GACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG [SEQ ID NO: 2]. Oligonucleotide binding sites in the 5' UTR are indicated in bold. Upon contact with an mRNA transcript comprising the 5' UTR of SEQ ID NO:2, an mRNA:DNA hybrid is formed between the oligonucleotide and the second to fifth nucleotides of the nucleotide sequence of the mRNA transcript. Upon contact of the mRNA:DNA hybrid with RNase H, the first five 5' nucleotides (and cap nucleotides, if present) are released from the mRNA transcript.

In some embodiments, the method requires input of no more than 100 pmol of in vitro transcribed mRNA in the mRNA sample provided in step (a) of the method.

In some embodiments, the method requires a total analysis volume of 100 μl or less.

In some embodiments, steps (b) through (c) of the method are performed within 90 minutes.

In some embodiments, no purification step is required between steps (a) through (d) of the method.

In some embodiments, step (d) of the method comprises HPLC, optionally UHPLC. In some embodiments, step (d) of the method includes mass spectrometry. In some embodiments, step (d) of the method comprises liquid chromatography-mass spectrometry (LC-MS).

In some embodiments, the sample provided in step (a) includes a second portion of the mRNA transcript that includes a cap 0 structure. In some embodiments, the sample provided in step (a) includes a third portion of the mRNA transcript that includes a cap G structure. In some embodiments, the sample provided in step (a) includes a fourth portion of the mRNA transcript that does not include a cap structure.

In some embodiments, the first portion of the mRNA transcript comprising the Cap 1 structure is at least 90% of the IVT reaction mixture to be further processed. In some embodiments, the second portion of the mRNA transcript comprising the cap 0 structure is no more than 10% of the IVT reaction mixture to be further processed. In some embodiments, the third portion of the mRNA transcript comprising the cap G structure is no more than 10% of the IVT reaction mixture to be further processed. In some embodiments, the fourth portion of the mRNA transcript that does not contain a cap structure is no more than 10% of the IVT reaction mixture to be further processed. In some embodiments, the further processing includes purification and/or encapsulation of mRNA transcripts from the IVT reaction mixture. In some embodiments, further processing includes using the mRNA transcript to prepare a therapeutic composition.

In some embodiments, the invention relates to a method of making therapeutic mRNA, the method comprising: (i) synthesizing the therapeutic mRNA using an in vitro transcription (IVT) reaction mixture; (ii) analyzing the mRNA sample from the IVT reaction mixture using a method for quantifying mRNA capping efficiency according to the invention; and (iii) further processing the mRNA when the first portion of the mRNA transcript comprises a Cap 1 structure of the mRNA. In some embodiments, further processing includes purification of the therapeutic mRNA synthesized in step (i). Additionally, or alternatively, further processing may include formulating the therapeutic mRNA synthesized in step (i). Formulation may include encapsulating the mRNA in lipid nanoparticles.

Among other things, the present invention further provides compositions and kits for performing the methods of the invention described herein. In some embodiments, the present invention provides a kit for quantifying mRNA capping efficiency, comprising one or more of the following: (1) to the sequence of the 5' untranslated region of the mRNA transcript in the sample for which capping efficiency is quantified; Complementary suitable oligonucleotides; (2) one or more reagents for annealing between DNA and RNA; (3) RNAse H; (4) one or more reagents (e.g., a chromatography column) to perform the analysis and (5) one or more control samples.

In some embodiments, the oligonucleotide may form an mRNA:DNA hybrid between the oligonucleotide and the second to fifth nucleotides of the mRNA transcript, wherein each control sample (i) contains 5' cap structures; a sequence of nucleotides, and (ii) a sequence of five nucleotides, in defined ratios to provide reference, either lacking a cap structure or containing a cap structure that is different from the cap structure of (i). For example, a control sample may contain a 9:1 ratio of (i) a sequence of 5 nucleotides containing the 5' cap 1 structure, and (ii) a sequence of 5 nucleotides lacking the cap structure. Control samples are adapted according to oligonucleotides capable of forming an mRNA:DNA hybrid between the 3rd to 6th nucleotides, or the 4th to 7th nucleotides, respectively, of the nucleotide sequence of the oligonucleotide and the mRNA transcript, i.e., they are respectively It contains a sequence of 6 or 7 nucleotides.

In some embodiments, one or more control samples according to (5) are used in a calibration step as part of the analysis according to step (d) of the method of the invention. In some embodiments, one or more control samples are run in parallel with the analysis of the sample obtained according to step (c) of the method. In some embodiments, the control sample may be such that the sample obtained according to step (c) of the method may be spiked with one or more control samples for simultaneous measurement of the sample obtained according to step (c) of the method and the one or more control samples. modified, for example deuterated, or radiolabelled.

In some embodiments, the control sample according to (5) contains a sequence of 5, 6, or 7 nucleotides, as appropriate, 60 to 100% of which are cap 1 structures, e.g., 70 to 98% cap. 1, or 80 to 95% Cap 1, or 90% Cap 1. In some embodiments, the control sample according to (5) contains a sequence of 5, 6, or 7 nucleotides, as appropriate, 1 to 30% of which are cap G structures, e.g., 2 to 20% cap. G, or 3 to 15% Cap G, or 10% Cap G. In some embodiments, the control sample according to (5) contains a sequence of 5, 6, or 7 nucleotides, as appropriate, 1 to 30% of which are cap 0 structures, e.g., 2 to 20% cap. 0, or 3 to 15% Cap 0, or 10% Cap 0. In some embodiments, the control sample according to (5) contains a sequence of 5, 6, or 7 nucleotides, as appropriate, 1 to 30% of which do not comprise a cap structure, for example 2 to 30%. 20% lack cap structure, or 3 to 15% lack cap structure, or 10% lack cap structure.

In some embodiments, the present invention provides a method of quantifying mRNA capping efficiency in an mRNA preparation sample, comprising: (a) contacting the mRNA preparation sample with an oligonucleotide complementary to the mRNA transcript, wherein the oligonucleotide and the nucleotide sequence of the mRNA transcript are forming an mRNA:DNA hybrid between the second to fifth nucleotides, the third to sixth nucleotides, or the fourth to seventh nucleotides; (b) contacting the sample obtained in step (b) with a nuclease (e.g., RNase H) to separate (i) the first five 5' nucleotides of the mRNA, (ii) the first six nucleotides, or (iii) ) releasing each of the first seven nucleotides; and (c) analyzing the released nucleotides in the sample to determine the relative amounts of mRNA transcripts comprising the Cap 1 structure in the mRNA sample, wherein steps (a) to (c) are performed relative to each other in the same reaction vessel. Provides a method that progresses continuously.

In some embodiments, the invention provides compositions comprising purified in vitro synthesized mRNA molecules comprising a Cap 1 structure. In some embodiments, the compositions of the invention comprise at least 80% of the mRNA molecules comprising a Cap 1 structure. In some embodiments, the compositions of the invention comprise at least 90% of the mRNA molecules comprising a Cap 1 structure. In some embodiments, the compositions of the invention comprise at least 95% of the mRNA molecules comprising a Cap 1 structure. In some embodiments, the compositions of the invention comprise greater than 95% mRNA molecules comprising a Cap 1 structure.

Other features, objects, and advantages of the present invention will become apparent from the following detailed description. However, although the detailed description shows embodiments of the present invention, it should be understood that it is provided by way of example only and not limiting the present invention. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art upon reading the detailed description.

The drawings are for illustrative purposes only and are not limiting in any way.
Figure 1 schematically shows an mRNA transcript without a 5' cap structure (A), an mRNA transcript with cap 0 (B), and an mRNA transcript with a cap 1 structure (C). Cap 0 and Cap 1 structures may additionally include methylation of m ⁷ G on either the 2' or 3''OH group of the ribose ring (not shown).
Figure 2 schematically shows the enzymatic capping process.
Figure 3 shows an oligonucleotide forming an mRNA:DNA hybrid between the oligonucleotide and the second to fifth nucleotides of the mRNA transcript to guide RNAse H activity such that the first five 5' nucleotides of the mRNA are released from the remaining mRNA transcript. It outlines how it can be used. The dashed portions of the oligonucleotides represent DNA nucleotides; The sides of the solid line represent RNA nucleotides.
Figure 4 shows an exemplary method for analyzing the 5' cap structure of a sample of in vitro transcribed mRNA transcripts. Figure 4A shows mRNA transcripts with hybridized oligonucleotides; Oligonucleotide DNA nucleotides are indicated by letters, and RNA nucleotides are indicated by solid lines. Arrows indicate RNase H cleavage sites. Figures 4b and 4c show UHPLC chromatograms of cleaved nucleotides due to RNase H digestion.

Justice

To more easily understand the present invention, certain terms are first defined. Additional definitions of the following terms and other terms are set forth throughout this specification.

About: As used in this application, the terms “about” and “approximately” are used with equivalent meaning. Any number used in this application, with about/approximately, or without about/approximately, is meant to encompass any normal variation as understood by a person skilled in the relevant art. Typically, the term “approximately” or “about” refers to a range of values that are within 10% (e.g., within 5%) of a stated reference value, or more typically 1%.

Affinity: As known in the art, “affinity” is a measure of the firmness with which a particular ligand binds (e.g., non-covalently binds) its partner and/or the rate or frequency with which it dissociates from its partner. am. As is known in the art, any of a variety of techniques may be utilized to determine affinity. In many embodiments, affinity represents a measure of specific binding.

Annealing or Hybridization : As used herein, the terms “annealing,” “hybridization,” and grammatical equivalents refer to the term “annealing” between nucleotide sequences that are sufficiently complementary to form a complex through Watson-Crick base pairing or non-canonical base pairing. Refers to the formation of a complex (also called a duplex or hybrid). It will be appreciated that the annealing or hybridization sequence need not have perfect complementarity to provide a stable hybrid. In many situations, stable hybrids are formed where less than about 10% of the bases are mismatched. Accordingly, as used herein, the term "complementary" generally refers to a specific condition where there is at least about 90% homology (e.g., at least about 95% homology, at least about 98% homology, or at least about 99% homology). refers to a nucleic acid molecule that forms a stable duplex with its complement. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences with at least the desired level of complementarity hybridize reliably, while sequences with lower complementarity do not hybridize. For examples of hybridization conditions and parameters, see, e.g., Sambrook et al., " Molecular Cloning: A Laboratory Manual" , 1989, Second Edition, Cold Spring Harbor Press: Plainview, NY and Ausubel, " Current Protocols in Molecular Biology" , 1994, John Wiley & Sons: Secaucus, NJ]. Complementarity between two nucleic acid molecules is called “complete,” “whole,” or “complete” if all the nucleic acid bases match; otherwise, it is called “partial.”

Cap 1: As used herein, an mRNA transcript comprising a Cap 1 structure refers to a cap structure in which the N7 amine of the guanine cap is methylated and the first nucleotide of the nucleotide sequence of the mRNA transcript is methylated both at the 2'OH of the ribose. refers to an RNA transcript containing The mRNA transcript containing the Cap 1 structure may contain additional modifications. For example, the 2' or 3' OH group of the cap ribose may be methylated. As another example, the 2'OH of the second nucleotide of the nucleotide sequence of the mRNA transcript may be methylated.

Cap 0: As used herein, an mRNA transcript comprising a cap 0 structure is a cap structure in which the N7 amine of the guanine cap is methylated but the first nucleotide of the nucleotide sequence of the mRNA transcript is unmethylated at the 2'OH of the ribose. refers to an mRNA transcript containing The mRNA transcript containing the cap 0 structure may contain additional modifications. For example, the 2' or 3' OH group of the cap ribose may be methylated.

Chromatography: As used herein, the term “chromatography” refers to a technique for separating mixtures. Typically, the mixture is dissolved in a fluid called a “mobile phase”, which transports the mixture through a structure that holds another substance called the “stationary phase”. Column chromatography is a separation technique in which the fixed bed is located within a tube, that is, a column.

Control: As used herein, the term “control” has the art-understood meaning of a standard against which results are compared. Typically, controls are used to increase the integrity of an experiment by isolating variables in order to draw conclusions about them. In some embodiments, a control is a reaction or assay performed simultaneously with the test reaction or assay to provide a comparison group. In an experiment, a “test” ( i.e. , the variable being tested) is applied. In the second experiment, the “control group” in which the variable is tested does not apply. In some embodiments, the control is a historical control (i.e., a previously performed test or assay, or previously known quantity or result). In some embodiments, the control is or includes printed or stored records. The control may be a positive control or a negative control.

Kit: As used herein, the term “kit” refers to any delivery system for delivering a substance. These delivery systems involve transporting various diagnostic or therapeutic reagents (e.g., oligonucleotides, antibodies, enzymes, etc. in appropriate containers) and/or support materials (e.g., buffers, assays, etc.) from one location to another. may include systems for storing, transporting, or delivering instructions). For example, a kit includes one or more enclosures (e.g., boxes) containing relevant reaction reagents and/or support materials. As used herein, the term “fragmented kit” refers to a delivery system comprising two or more separate containers, each containing a subportion of the components of the overall kit. Containers may be delivered together or separately to the intended recipient. For example, the first vessel may contain enzymes for use in the assay, and the second vessel may contain oligonucleotides. The term “fragmented kit” is intended to include, but is not limited to, kits containing analyte specific reagents (ASR) regulated under section 520(e) of the Federal Food, Drug, and Cosmetic Act. In fact, any delivery system comprising two or more separate containers each containing a subportion of a complete kit component is encompassed by the term “fragmented kit”. In contrast, a “combined kit” refers to a delivery system containing all components in a single container (e.g., a single box containing each desired component). The term “kit” includes both fragmented and combined kits.

Nucleoside : The term "nucleoside" or "nucleobase", as used herein, refers to the anomeric carbon of a carbohydrate (the 1'-carbon atom of the carbohydrate) and the nucleobase through an N-glycosidic bond. Carbohydrates, such as adenine ("A"), guanine ("G"), cytosine ("C"), and uracil linked to D-ribose (in RNA) or 2'-deoxy-D-ribose (in DNA) (“U”), thymine (“T”) and their analogs. When the nucleobase is a purine, for example A or G, the ribose sugar is generally attached to the N9-position of the heterocyclic ring of the purine. If the nucleobase is a pyrimidine, for example C, T or U, the sugar is generally attached to the N1-position of the heterocyclic ring. Carbohydrates may be substituted or unsubstituted. Substituted ribose sugars have one or more of the carbon atoms, for example the 2'-carbon atom, with one or more identical or different Cl, F, --R, --OR, --NR ₂ or halogen groups, wherein each R independently H, C ₁ -C ₆ alkyl or C ₅ -C ₁₄ aryl). Examples of ribose include ribose, 2'-deoxyribose, 2',3'-dideoxyribose, 2'-haloribose, 2'-fluororibose, 2'-chlororibose, and 2'-alkylibose, for example For example, 2'-O-methyl, 4'-alpha-anomeric nucleotide, 1'-alpha-anomeric nucleotide (Asseline et al., Nucl. Acids Res., 19:4067-74 [1991]), 2'-4'- and 3'-4'-linked and other "locked" or "LNA," bicyclic sugar modifications (WO 98/22489; WO 98/39352; WO 99/14226).

Nucleotide: As used herein, the term “nucleotide” refers to a nucleoside, either as a monomeric unit or in phosphorylated form (phosphate ester of a nucleoside) within a polynucleotide polymer. "Nucleotide 5'-triphosphate" refers to a nucleotide having a triphosphate ester group at the 5' position, sometimes designated "NTP", or "dNTP" and "ddNTP" to specifically point out structural features of the ribose sugar. Triphosphate ester groups can include sulfur substitution on various oxygen moieties, such as alpha-thio-nucleotide 5'-triphosphate. Nucleotides may exist in mono-, di-, or tri-phosphorylated forms. The carbon atoms of the ribose present in the nucleotide are designated with a prime letter (') to distinguish them from the base's backbone number. For a review of polynucleotide and nucleic acid chemistry, see Shabarova, Z. and Bogdanov, A. Advanced Organic Chemistry of Nucleic Acids, VCH, New York, 1994.

Nucleic acid : The terms “nucleic acid,” “nucleic acid molecule,” “polynucleotide,” or “oligonucleotide” may be used interchangeably herein. They refer to polymers of nucleotide monomers or analogs thereof, such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) and combinations thereof. Nucleotides may be genomic, synthetic, or semisynthetic in origin. Unless otherwise specified, the terms include nucleic acid-like structures with synthetic backbones as well as amplification products. As those skilled in the art will appreciate, the length (i.e., the number of nucleotides contained) of these polymers can often vary widely depending on the intended function or use. Polynucleotides may be linear, branched linear or circular molecules. Polynucleotides are also associated with counterions such as H ⁺ , NH ₄ ⁺ , trialkylammonium, Mg ⁺ , Na ^{+ ,} etc. The polynucleotide may be composed entirely of deoxyribonucleotides, entirely ribonucleotides, or chimeric mixtures thereof. Polynucleotides may be composed of internucleotide nucleobases and sugar analogs.

Oligonucleotide : In some embodiments, the term “oligonucleotide” refers to an oligonucleotide of about 5 to about 150 nucleotides, e.g., from about 10 to about 100 nucleotides, from about 15 to about 75 nucleotides, or from about 15 to about 50 nucleotides. It is used herein to refer to a polynucleotide comprising. In the context of the present invention, oligonucleotides typically comprise about 10 to 25 nucleotides (eg, 14 to 21 nucleotides). Throughout the specification, whenever an oligonucleotide is represented by a series of letters (e.g., selected from the four base letters: A, C, G, and T, which represent adenosine, cytidine, guanosine, and thymidine, respectively) , nucleotides are displayed in 5' to 3' order from left to right. “Polynucleotide sequence” refers to the sequence of nucleotide monomers following a polymer. Unless otherwise specified, whenever a polynucleotide sequence appears, it will be understood that the nucleotides are in a left to right 5' to 3' orientation.

Nucleotide analogs : Nucleic acids, polynucleotides and oligonucleotides may be composed of standard nucleotide bases or may be substituted with nucleotide isotype analogs, including but not limited to iso-C and iso-G bases, which are more or less acceptable than standard bases. It can hybridize readily and will hybridize preferentially to the complementary isoform analog base. Many of these isoform bases are described, for example, in Benner et al., (1987) Cold Spring Harb. Symp. Quant. Biol. 52, 53-63]. Analogues of naturally occurring nucleotide monomers include, for example, 7-deazaadenine, 7-deazaguanine, 7-deaza-8-azaguanine, 7-deaza-8-azaadenine, 7-methylguanine, inosine, Nebularine, nitropyrrole (Bergstrom, J. Amer. Chem. Soc., 117:1201-1209 [1995]), nitroindole, 2-aminopurine, 2-amino-6-chloropurine, 2,6-dia. Minopurine, hypoxanthine, pseudouridine, pseudocytosine, pseudoisocytosine, 5-propynylcytosine, isocytosine, isoguanine (Seela, U.S. Patent No. 6,147,199), 7-deazaguanine (Seela, U.S. Patent No. No. 5,990,303), 2-azapurine (Seela, WO 01/16149), 2-thiopyrimidine, 6-thioguanine, 4-thiothymine, 4-thiouracil, 0-6-methylguanine, N-6- Methyladenine, O-4-methylthymine, 5,6-dihydrothymine, 5,6-dihydrouracil, 4-methylindole, pyrazolo[3,4-D]pyrimidine, "PPG" (Meyer, USA) Patent Nos. 6,143,877 and 6,127,121; Gall, WO 01/38584), and ethenoadenine (Fasman (1989) in Practical Handbook of Biochemistry and Molecular Biology, pp. 385-394, CRC Press, Boca Raton, Fla. ) is included.

5'end/3' end : As used herein in relation to a nucleic acid molecule, the terms "3'end" and "3'end" refer to the end of the nucleic acid containing a free hydroxyl group attached to the 3' carbon of the terminal pentose sugar. refers to As used herein with reference to a nucleic acid molecule, the terms "5'end" and "5'end" refer to the end of the nucleic acid molecule containing a free hydroxyl or phosphate group attached to the 5' carbon of the terminal pentose sugar. When referring to nucleotide numbers in mRNA transcripts, unless otherwise specified, cap nucleotides are not counted. For example, the first 5' nucleotide is the 5'-most nucleotide containing a free hydroxyl or phosphate group attached to the 5' carbon of the terminal pentose in an uncapped mRNA transcript, or the 5'-most nucleotide of the terminal pentose in a capped mRNA transcript. Refers to the 5'-most nucleotide that contains a cap structure attached to the 5' carbon.

Specific details for carrying out the invention

The present invention provides an improved method for quantifying capping efficiency in mRNA samples from in vitro transcription (IVT) reaction mixtures to determine the portion of the mRNA transcript that contains the Cap 1 structure.

The method is based on enzymatically releasing the first 5, 6 or 7 nucleotides of the nucleotide sequence of the mRNA transcript. The first 5, 6, or 7 nucleotides released are contacted by contacting the mRNA sample with an oligonucleotide complementary to the mRNA transcript, producing the oligonucleotide and (i) the second to fifth nucleotides, (ii) the third to sixth nucleotides, respectively, or (iii) forming an mRNA:DNA hybrid between the fourth to seventh nucleotides and contacting the sample with a nuclease (e.g., RNase H). The sample is analyzed to determine the portion of the mRNA transcript that contains the Cap 1 structure of the mRNA sample.

mRNA transcripts containing a Cap 1 structure at the 5' end of the first nucleotide of the nucleotide sequence are efficiently translated. In contrast, mRNA transcripts containing the Cap G or Cap 0 cap structures, or mRNA transcripts lacking the cap structure, are not translated as efficiently as mRNA transcripts containing Cap 1. Whether capping of mRNA is performed co-transcriptionally or enzymatically post-transcriptionally, at least a portion of the mRNA transcript will not contain a Cap 1 structure. Therefore, it is important to determine the capping efficiency of mRNA samples from the IVT reaction mixture prior to downstream use. For example, an mRNA sample from an IVT reaction mixture may also include an mRNA transcript comprising a cap 0 structure. In some embodiments, the mRNA sample from the IVT reaction mixture also includes a portion of the mRNA transcript that includes a cap G structure. In some embodiments, the mRNA sample from the IVT reaction mixture also includes a portion of the mRNA transcript that does not include a cap structure.

Accordingly, in some embodiments, the methods of the invention determine the relative abundance of an mRNA transcript comprising Cap 1 relative to an mRNA transcript comprising a different cap (e.g., Cap 0 or Cap G). In some embodiments, the analysis can determine the relative abundance of mRNA transcripts containing cap 0 structures. In some embodiments, the analysis can determine the relative abundance of mRNA transcripts containing cap G structures. In some embodiments, the analysis can determine the relative abundance of mRNA transcripts lacking a cap structure.

We have found that enzymatic release of the first five 5' nucleotides of an mRNA transcript is particularly useful in determining the relative abundance of mRNA transcripts containing Cap 1 relative to mRNA transcripts containing Cap 0 or Cap G. did. This is achieved, as shown in Figure 3, using oligonucleotides that form an mRNA:DNA hybrid between the oligonucleotide and the second to fifth nucleotides of the mRNA transcript, with the first five 5' nucleotides of the mRNA interacting with the rest of the mRNA. Guides nuclease (e.g., RNAse H) activity to be released from the transcript. By analyzing only the first five 5' nucleotides in the nucleotide sequence of an mRNA transcript, we can determine whether the mRNA transcript synthesized by IVT contains a Cap 1 structure (e.g., as opposed to an incompletely methylated Cap 0 structure). could provide a very sensitive way to determine whether

In certain embodiments, the methods of the invention determine the methylation profile of mRNA transcripts in an mRNA sample from an IVT reaction mixture.

The method of the present invention rapidly, reliably and efficiently determines capping efficiency and ensures that the majority of mRNA transcripts in the mRNA sample from the IVT reaction mixture contain a Cap 1 structure, e.g., for vaccination with mRNA encoding the antigen. , or to analyze whether the mRNA-encoded protein is suitable for efficient expression in the context of a therapeutic application, such as the treatment of protein deficiencies, where the mRNA may be used to produce functional deficiencies or functional deficiencies in the protein due, for example, to genetic mutations. Due to its absence, it encodes a protein deficiency in the subject.

mRNA capping

Typically, eukaryotic mRNAs have a "cap" structure at the 5'-end, which plays an important role in translation. For example, the cap plays a central role in mRNA metabolism and is required to varying degrees for processing and maturation of RNA transcripts in the nucleus, mRNA movement from the nucleus to the cytoplasm, mRNA stability, and efficient translation of mRNA into protein. The 5' cap structure is involved in protein synthesis initiation and mRNA processing and in vivo stability of eukaryotic and eukaryotic viral mRNAs (e.g., Shatkin, AJ, Cell, 9: 645-653 (1976); Furuichi , et al., Nature, 266: 235 (1977)]; [Federation of Experimental Biologists Society Letter 96: 1-11 (1978)]; [Sonenberg, N., Prog. Nuc. Acid Res Mol Biol, 35: 173 -207 (1988)]. Components of the machinery required for translation initiation of mRNA include specific cap-binding proteins (see, e.g., Shatkin, AJ, Cell, 40: 223-24 (1985); Sonenberg, N., Prog. Nuc. Acid Res Mol Biol, 35: 173-207 (1988)]. The cap of the mRNA is recognized by the translation initiation factor eIF4E (Gingras, et al., Ann. Rev. Biochem. 68: 913-963 (1999); Rhoads, RE, J. Biol. Chem. 274: 30337-3040 (1999)]. The 5' cap structure also provides resistance to 5'-exonuclease activity, the absence of which causes rapid degradation of the mRNA (see, e.g., Ross, J., Mol. Biol. Med. 5 : 1-14 (1988)]; see [Green, MR et al., Cell, 32: 681-694 (1983)]. Because primary transcripts of many eukaryotic and eukaryotic viral genes require processing to remove intervening sequences (introns) within the coding regions of these transcripts, the benefit of the cap also extends to stabilization of these pre-mRNAs. .

Capped RNA has been reported to be translated more efficiently than uncapped transcripts in various in vitro translation systems such as rabbit reticulocyte lysate or wheat germ translation systems (see, e.g., Shimotohno, K., et al ., Proc. Natl. Acad. Sci. USA, 74: 2734-2738 (1977)]; [Paterson and Rosenberg, Nature, 279: 692 (1979)]. This effect is also believed to be due, in part, to protecting the RNA from exoribonucleases and other factors that may be present in the in vitro translation system.

cap 1

The naturally-occurring cap structure comprises 7-methyl guanosine linked to the 5'-terminus of the first nucleotide in the nucleotide sequence of the mRNA transcript via a triphosphate bridge, where m ⁷ G(5')ppp(5')N , N is any nucleoside). In vivo , the cap is added enzymatically. The cap is added to the nucleus and is catalyzed by the enzyme guanylyl transferase. Addition of a cap to the 5' end of RNA occurs immediately after transcription begins. The cap nucleoside is in the reverse orientation of all other nucleotides, i.e. m ⁷ G(5')ppp(5')Np. The cap structure containing the N7 methyl guanosine and lacking 2'O methylation of the ribose of the first nucleotide in the nucleotide sequence of the mRNA transcript is known as cap 0. 2'O methylation of the ribose of the first nucleotide in the nucleotide sequence of the mRNA transcript leads to m ⁷ G(5')ppp(5')Nm, cap 1. This 2'O methylation is important for differentiation between 'self' and 'non-self' RNA and therefore for increasing translation efficiency of mRNA transcripts (see, e.g. Sikorski., et al., NUC [ACID RES, 48: 4 (2020)]. One of the reported mechanisms for the increased translation efficiency of mRNA transcripts containing Cap 1 is that ribose 2′-O methylation of the first nucleotide of the nucleotide sequence induces the inhibition of the translation inhibitor, IFIT1 (IFN-bearing tetratricopeptide repeat-1). It prevents recognition of mRNA transcripts by inducing proteins (Abbas., et al., PNAS, 114: 11 (2017), Habjan., et al., PLoS PATHOG, 9: 10 (2013)] reference).

Production of capped mRNA

Transcription of RNA generally begins with a nucleoside triphosphate (usually a purine, A or G). In vitro transcription typically involves a phage RNA polymerase, such as T7, T3 or SP6, a DNA template containing the phage polymerase promoter, nucleotides (ATP, GTP, CTP and UTP) and a buffer containing magnesium salts.

Co-transcriptional capping

Co-transcriptional capping can be performed using a preformed dinucleotide of the form m ⁷ G(5')ppp(5')G (“m ⁷ GpppG”) as a transcription initiator. Excess cap (e.g., m ⁷ GpppG) to GTP (4:1) increases the likelihood that each transcript will have a 5' cap. Changing this ratio can affect the balance between achieving high transcription yields and minimizing the portion of the mRNA transcript that lacks the cap structure. Kits for this type of IVT mRNA capping are commercially available, including the mMESSAGE mMACHINE® kit (Invitrogen). These kits typically produce 80% capped RNA versus 20% uncapped RNA, but because GTP is required for transcript elongation, the total RNA yield is lower as GTP concentration becomes rate limiting. A disadvantage of using m ⁷ G(5')ppp(5')G, a pseudosymmetric dinucleotide, is that the 3'-OH of the G or m ⁷ G portion tends to serve as an initiating nucleophile for transcription elongation. That is, the presence of 3'-OH on both the m ⁷ G and G moieties results in up to half of the mRNAs having their caps incorporated in an inappropriate orientation. This synthesizes two isomeric RNAs in the form m ⁷ G(5')pppG(pN) _n and G(5')pppm ⁷ G(pN) n at approximately the same ratio depending on the ionic conditions of the transcription reaction. Modification of isomeric forms can negatively affect in vitro translation and is undesirable for homogeneous therapeutic products.

To prevent this anti-reversal cap orientation, a common form of synthetic dinucleotide cap used in in vitro translation experiments is the anti-reversal cap analog ("ARCA"), which typically has the 2' or 3' OH group replaced by -OCH ₃ . It is a substituted, modified cap analog. Chemical modification of m ⁷ G on the 2' or 3' OH group of the ribose ring results in the cap being incorporated only in the forward direction, even though the 2' OH group does not participate in the phosphodiester bond (Jemielity, J. et al ., " Novel 'anti-reverse' cap analogs with superior translational properties" , RNA, 9: 1108-1122 (2003)]. Selective procedures for methylation of guanosine in N7 and 3' O-methylation and 5' diphosphate synthesis have been established (Kore, A. and Parmar, G. Nucleosides, Nucleotides, and Nucleic Acids, 25: 337-340 , (2006)] and [Kore, AR, et al. Nucleosides, Nucleotides, and Nucleic Acids 25(3): 307-14, (2006)]). Kits for capping IVT mRNA using ARCA caps are commercially available, including the mMESSAGE mMACHINE® T7 ULTRA kit (Invitrogen). These kits typically recommend a cap analog to GTP ratio of 4:1. Reducing the ratio of cap analogs to GTP typically increases the yield of the transcription reaction but reduces the fraction of mRNA transcripts containing the cap structure.

Capping after transfer

mRNA can also be capped post-transcriptionally in a three-step enzymatic process, outlined in Figure 2. In the first step, guanylyltransferase uses GTP as a substrate to add guanine to the 5' end of the first nucleotide of the nucleotide sequence of the mRNA transcript, forming the cap G structure. In the second step, N7 methyltransferase adds a methyl group to the N7 of the cap guanine to form the cap 0 structure. In the third step, 2'-O-methyltransferase adds a methyl group to the 2' OH of the ribose of the first nucleotide of the nucleotide sequence in the mRNA transcript, forming the Cap 1 structure.

How to quantify mRNA capping efficiency

In some embodiments, the invention provides a method of quantifying mRNA capping efficiency in an mRNA sample from an IVT reaction mixture, comprising: (a) providing an mRNA sample, wherein the mRNA sample comprises a nucleotide sequence of a plurality of mRNA transcripts; wherein the first portion of the mRNA transcript comprises a Cap 1 structure at the 5' end of the first nucleotide of the nucleotide sequence; (b) contacting the mRNA sample with an oligonucleotide complementary to the mRNA transcript, forming an mRNA:DNA hybrid between the oligonucleotide and the second to fifth nucleotides of the nucleotide sequence of the mRNA transcript; (c) contacting the sample obtained in step (b) with a nuclease (e.g., RNase H) to release the first five 5' nucleotides of the mRNA; and (d) analyzing the sample obtained in step (c) to determine the first portion of the mRNA transcript comprising the Cap 1 structure in the mRNA sample, wherein steps (a) to (c) are carried out in the same reaction vessel. Provides a method including steps that proceed sequentially with each other.

In some embodiments, the invention provides a method of quantifying mRNA capping efficiency in an mRNA sample from an IVT reaction mixture, comprising: (a) providing an mRNA sample, wherein the mRNA sample comprises a nucleotide sequence of a plurality of mRNA transcripts; wherein the first portion of the mRNA transcript comprises a Cap 1 structure at the 5' end of the first nucleotide of the nucleotide sequence; (b) contacting the mRNA sample with an oligonucleotide complementary to the mRNA transcript, forming an mRNA:DNA hybrid between the oligonucleotide and the third to sixth nucleotides of the nucleotide sequence of the mRNA transcript; (c) contacting the sample obtained in step (b) with a nuclease (e.g., RNase H) to release the first six 5' nucleotides of the mRNA; and (d) analyzing the sample obtained in step (c) to determine the first portion of the mRNA transcript comprising the Cap 1 structure in the mRNA sample, wherein steps (a) to (c) are carried out in the same reaction vessel. Provides a method including steps that proceed sequentially with each other.

In some embodiments, the invention provides a method of quantifying mRNA capping efficiency in an mRNA sample from an IVT reaction mixture, comprising: (a) providing an mRNA sample, wherein the mRNA sample comprises a nucleotide sequence of a plurality of mRNA transcripts; wherein the first portion of the mRNA transcript comprises a Cap 1 structure at the 5' end of the first nucleotide of the nucleotide sequence; (b) contacting the mRNA sample with an oligonucleotide complementary to the mRNA transcript, forming an mRNA:DNA hybrid between the oligonucleotide and the fourth to seventh nucleotides of the nucleotide sequence of the mRNA transcript; (c) contacting the sample obtained in step (b) with a nuclease (e.g., RNase H) to release the first 7' 5' nucleotides of the mRNA; and (d) analyzing the sample obtained in step (c) to determine the first portion of the mRNA transcript comprising the Cap 1 structure in the mRNA sample, wherein steps (a) to (c) are carried out in the same reaction vessel. Provides a method including steps that proceed sequentially with each other.

One advantage of the method according to the invention is that small amounts of mRNA sample from the IVT reaction mixture are required. This is also because additional steps are required between steps (a) to (d). For example, the process of the present invention does not require that a purification step be performed after any of steps (a) to (c), and step (d) proceeds immediately after step (c) without any intermediate steps. Similarly, the process of the present invention does not require an additional digestion step to be performed after any of steps (a) to (c), and step (d) proceeds immediately after step (c) without any intermediate steps. Likewise, the method of the present invention does not require an enrichment step of the released first 5, 6 or 7 5' nucleotides of the mRNA transcript to be performed after step (c), if applicable, and step (d) is an intermediate step. Proceeds immediately after step (c) without.

mRNA influx

Because there are no additional steps of purification, digestion or concentration, the methods disclosed herein have high sample efficiency. Accordingly, in some embodiments, the method comprises 30 to 110 pmol or less of IVT mRNA in a given mRNA sample, e.g., 30 to 100 pmol, 30 to 90 pmol, 30 to 80 pmol, 30 to 70 pmol, 30 Requires an input of 60 pmol or 30 to 50 pmol of IVT mRNA. For example, in some embodiments, the method requires input of 100 pmol or less of IVT mRNA in a given mRNA sample. In Example 1, it was demonstrated that the method requires input of less than 55 pmol of IVT mRNA in a given mRNA sample. Among other advantages, the low amount of input mRNA required by the disclosed method increases the amount of mRNA remaining in the IVT reaction mixture for downstream uses, such as use in formulating therapeutic compositions.

Assay volume

A further advantage of the method according to the invention is that it requires a small total analysis volume. Accordingly, in some embodiments, the method is a total assay of 50 to 120 μl or less, such as 50 to 110 μl, 50 to 100 μl, 50 to 90 μl, 50 to 80 μl, 50 to 70 μl, or 50 to 60 μl. Requires volume. For example, in some embodiments the method requires a total analysis volume of 100 μl or less. In Example 1, it was found that a volume of 52 μl worked well. There are many advantages to using smaller reaction volumes, including cost savings, ease of scalability, and ease of transferability of the process to automated systems.

oligonucleotide

Oligonucleotides for use in the methods of the present invention may be located between (i) the second to fifth nucleotides, (ii) the third to sixth nucleotides, or (iii) the fourth to seventh nucleotides of the nucleotide sequence of the oligonucleotide and the mRNA transcript. Forms an mRNA:DNA Hybrid In certain embodiments, oligonucleotides for use in the methods of the invention have a nucleotide sequence between the oligonucleotide and the second to fifth nucleotides of the nucleotide sequence of the mRNA transcript, as schematically shown in Figure 3. can form an mRNA:DNA hybrid. Therefore, an oligonucleotide contains at least 4 DNA base pairs.

Oligonucleotides for use in the methods of the present invention are designed so as not to form mRNA:DNA hybrids with off-target sites. Specific annealing of oligonucleotides is such that nuclease (e.g., RNase H) cleavage is directed to one site, i.e., the first five 5' nucleotides, the first six 5' nucleotides, or the first seven 5' nucleotides, as appropriate. Allow the oligonucleotide to be released. For example, a single RNase H digestion step releasing only the first five 5' nucleotides provides a low molecular weight mRNA sequence sample suitable for high resolution analysis, particularly determining the methylation status of the cap nucleotide.

Because the methods disclosed herein require one cleavage event to occur at the 5' end of the mRNA transcript, the remainder of the mRNA transcript remains intact and, equal to its length, including the length of the 3' tail, It can be used to gather additional information about other aspects of . Accordingly, in some embodiments, an mRNA sample used in a capping efficiency method as disclosed may be used in another method to analyze other aspects of the mRNA transcript, such as the length of the transcript or the length of the 3' tail. there is.

Non-specific annealing of oligonucleotides may result in a more complex mixture of released mRNA transcript nucleotides and result in loss of resolution during the analysis step. Therefore, to minimize this loss of resolution, for example, through the use of an initial digestion step to shorten the mRNA transcript, through the use of a purification step to remove unwanted released mRNA transcript nucleotides, or by simplifying the mRNA transcript. Additional steps, such as reducing off-target hybridization of oligonucleotides, may be necessary. In contrast, the present invention achieves high resolution without requiring an initial simplified digestion step, purification step and/or transfer to a new reaction vessel.

In some embodiments, oligonucleotides for use in the invention have the structure 5'-[R] _n [D] ₄ [R] ₁ -3', wherein each R is an RNA nucleotide and each D is a DNA nucleotide. nucleotides, and the subscript numbers indicate the number of each nucleotide. n can be adjusted to provide oligonucleotides with suitable melting temperature (T _m ) and GC content (GC%). For example, a T _m of about 50°C to about 60°C, more typically 52°C to 58°C, may be particularly desirable for the mRNA:DNA hybrid formed between the oligonucleotide and the mRNA transcript. A GC% of about 40% to about 60% is typically suitable. n may be 10 to 20. More typically, n is 11 to 15.

The inventors have found that oligonucleotides with the following structure are particularly useful: 5'-[R] ₁₁ [D] ₄ [R] ₁ -3' (where R is an RNA nucleotide, D is a DNA nucleotide, and Subscript numbers indicate their respective numbers).

Oligonucleotides with methylated RNA nucleotides can form more stable duplexes with the target mRNA. Additionally, oligonucleotides with methylated RNA nucleotides can be easily distinguished from the mRNA fragments of the sample during subsequent analysis steps. Accordingly, in a typical embodiment, each RNA nucleotide of an oligonucleotide for use in the methods of the invention is methylated, for example, each RNA nucleotide may comprise a 2'-O-methyl ribose.

Those skilled in the art will recognize that different 5' UTR sequences require the use of different oligonucleotide sequences, and thus the methods of the present invention combine the oligonucleotide and nucleotide sequences of the mRNA transcript (i.e., cap nucleotides), respectively. is specifically adapted to bind to the 5'UTR or mRNA transcript, such that an mRNA:DNA hybrid is formed between the second to fifth nucleotides, the third to sixth nucleotides, or the fourth to seventh nucleotides (not counting). It is expected that it can be used with any oligonucleotide.

For example, in some embodiments, an exemplary 5' UTR includes the following sequence: GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG [SEQ ID NO: 2]. In some embodiments, the 5' UTR comprises the following sequence: AGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG [SEQ ID NO: 3]. In some embodiments, the 5' UTR comprises the following sequence: GAGAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC [SEQ ID NO: 4]. In some embodiments, the 5' UTR comprises the following sequence: GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC [SEQ ID NO: 5]. In some embodiments, the 5' UTR comprises the following sequence: GGAGAAAGCUUACC [SEQ ID NO: 6]. In some embodiments, the 5' UTR comprises the following sequence: GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC [SEQ ID NO: 7]. In some embodiments, the 5' UTR comprises the following sequence: AGGGUCAAGAUUAGAGAACGGUCGUAGCAUUAUCGGAGGUUCUGCCACC [SEQ ID NO: 8]. In some embodiments, the 5' UTR comprises the following sequence: GGGUCAAGAUUAGAGAACGGUCGUAGCAUUAUCGGAGGUUCUGCCACC [SEQ ID NO: 9].

In some embodiments, the 5' UTR comprises a sequence selected from SEQ ID NO: 1 to 1363, SEQ ID NO: 1395, SEQ ID NO: 1421, and SEQ ID NO: 1422 of WO2013/143700. In some embodiments, the 5' UTR comprises sequences selected from SEQ ID NOs: 25-30 and SEQ ID NOs: 319-382 of WO2016/107877. In some embodiments, the 5' UTR comprises a sequence selected from SEQ ID NOs: 1 to 151 of WO2017/036580. In some embodiments, the 5' UTR comprises a sequence selected from SEQ ID NOs: 4276 to 4282 of WO2014/164253.

Exemplary Oligonucleotides

Exemplary oligonucleotides suitable for use in the methods of the invention include: 5'-UCCAGGCGAUC TGTC C-3' (SEQ ID NO: 10), 5'-UUCUCUCUUAU TTCC C-3' (SEQ ID NO: 11), 5 '-CUUUUCUCUCUUAU TTCC C-3' (SEQ ID NO: 12), 5'-CAGAAGAAUAC TAGT U-3' (SEQ ID NO: 13), 5'-GGACCAGAAGAAUAC TAGT U-3' (SEQ ID NO: 14), 5'-CGUUCUCUAAUCUUG ACCC U -3' (SEQ ID NO: 15), 5'-CUCUAAUCUUG ACCC U-3' (SEQ ID NO: 16), 5'-CCGUUCUCUAAUCUU GACC C-3' (SEQ ID NO: 17), and 5'-CUCUAAUCUU GACC C-3' ( SEQ ID NO: 18). The underlined nucleotides are DNA. The remaining nucleotides are RNA. In a typical embodiment, the RNA nucleotides are methylated, for example, they may contain 2'-O-methyl ribose.

An exemplary oligonucleotide found to be particularly suitable for use in the present invention has the following sequence: 5'-mUmCmCmAmGmGmCmGmAmUmCTGTCmC-3' [SEQ ID NO: 1]. This oligonucleotide can be used with mRNA containing the following 5' untranslated region (5' UTR): GGACAGAUCGCCUGGA GACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG [SEQ ID NO: 2]. Oligonucleotide binding sites in the 5' UTR are indicated in bold.

Another exemplary oligonucleotide for use in the present invention has the following sequence: 5'-mUmUmCmUmCmUmCmUmUmAmUTTCCmC-3' [SEQ ID NO: 19]. This oligonucleotide can be used with mRNA containing the following 5' untranslated region (5' UTR): GGGAAAUAAGAGAGAA AAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC [SEQ ID NO: 7] and GGGAAAUAAGAGAGAA AAGAAGAGUAAGAAGAAAUAUAAGAGCCACC [SEQ ID NO: 5]. Oligonucleotide binding sites in the 5' UTR are indicated in bold.

Another exemplary oligonucleotide for use in the present invention has the following sequence: 5'-mCmUmUmUmUmCmUmCmUmCmUmUmUmAmUTTCCmC-3' [SEQ ID NO: 20]. This oligonucleotide can be used with mRNA containing the following 5' untranslated region (5' UTR): GGGAAAUAAGAGAGAAAAG AAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC [SEQ ID NO: 7] and GGGAAAUAAGAGAGAAAAG AAGAGUAAGAAGAAAUAUAAGAGCCACC [SEQ ID NO: 5]. Oligonucleotide binding sites in the 5' UTR are indicated in bold.

Another exemplary oligonucleotide for use in the present invention has the following sequence: 5'-mCmAmGmAmAmGmAmAmUmAmCTAGTmU-3' [SEQ ID NO: 21]. This oligonucleotide can be used with mRNA containing the following 5' untranslated region (5' UTR): AACUAGUAUUCUUCUG GUCCCCACAGACUCAGAGAGAACCCGCCACC [SEQ ID NO: 22]. Oligonucleotide binding sites in the 5' UTR are indicated in bold.

Another exemplary oligonucleotide for use in the present invention has the following sequence: 5'-mGmGmAmCmCmAmGmAmAmGmAmAmUmAmCTAGTmU-3' [SEQ ID NO: 23]. This oligonucleotide can be used with mRNA containing the following 5' untranslated region (5' UTR): AACUAGUAUUCUUCUGGUCC CCACAGACUCAGAGAGAACCCGCCACC [SEQ ID NO: 22]. Oligonucleotide binding sites in the 5' UTR are indicated in bold.

Another exemplary oligonucleotide for use in the present invention has the following sequence: 5'-mCmGmUmUmCmUmCmUmAmAmUmCmUmUmGACCCmU-3' [SEQ ID NO: 24]. This oligonucleotide can be used with mRNA containing the following 5' untranslated region (5' UTR): AGGGUCAAGAUUAGAGAACG GUCGUAGCAUUAUCGGAGGUUCUGCCACC [SEQ ID NO: 8]. Oligonucleotide binding sites in the 5' UTR are indicated in bold.

Another exemplary oligonucleotide for use in the present invention has the following sequence: 5'-mCmUmCmUmAmAmUmCmUmUmGACCCmU-3' [SEQ ID NO: 25]. This oligonucleotide can be used with mRNA containing the following 5' untranslated region (5' UTR): AGGGUCAAGAUUAGAG AACGGUCGUAGCAUUAUCGGAGGUUCUGCCACC [SEQ ID NO: 8]. Oligonucleotide binding sites in the 5' UTR are indicated in bold.

Another exemplary oligonucleotide for use in the present invention has the following sequence: 5'-mCmCmGmUmUmCmUmCmUmAmAmUmCmUmUGACCmC-3' [SEQ ID NO: 26]. This oligonucleotide can be used with mRNA containing the following 5' untranslated region (5' UTR): GGGUCAAGAUUAGAGAACGG UCGUAGCAUUAUCGGAGGUUCUGCCACC [SEQ ID NO: 9]. Oligonucleotide binding sites in the 5' UTR are indicated in bold.

Another exemplary oligonucleotide for use in the present invention has the following sequence: 5'-mCmUmCmUmAmAmUmCmUmUGACCmC-3' [SEQ ID NO: 27]. This oligonucleotide can be used with mRNA containing the following 5' untranslated region (5' UTR): GGGUCAAGAUUAGAG AACGGUCGUAGCAUUAUCGGAGGUUCUGCCACC [SEQ ID NO: 9]. Oligonucleotide binding sites in the 5' UTR are indicated in bold.

In the oligonucleotide sequence, mU represents uridine with 2'-O-methyl ribose; mC represents cytidine with 2'-O-methyl ribose; mA represents adenine with 2'-O-methyl ribose; mG represents guanidine with 2'-O-methyl ribose; A represents deoxyadenin; T represents deoxythymidine; G represents deoxyguanidine, and C represents deoxycytidine.

nuclease

According to the present invention, a nuclease capable of catalyzing cleavage of RNA and/or DNA strands in an RNA:DNA hybrid substrate can be used to cleave the first nuclease from the untranslated region of the mRNA molecule in an mRNA sample; Such nucleases are non-sequence specific. In some embodiments, more than one nuclease is used to quantify single capping efficiency.

In some embodiments, a suitable nuclease is RNase H or any enzyme with RNase H-like enzymatic activity. In some embodiments, a suitable nuclease is RNase S1 or any enzyme with RNase S1-like enzymatic activity. In another embodiment, suitable nucleases are selected from Benzonase®, nuclease P1, phosphodiester, RNase A and RNase T1. In some embodiments, multiple nucleases; For example, RNase H and S1 nucleases are used.

In one embodiment, the nuclease is RNase H.

RNase H

RNases H form a ubiquitous family of enzymes that are divided into two distinct phylogenetic subtypes, Type 1 and Type 2, either of which may be used in certain embodiments of the invention. RNases H are united by their common ability to bind single-stranded (ss) RNA that has hybridized to a single strand of complementary DNA and then degrade the RNA portion of the RNA:DNA hybrid. RNases H are involved in DNA replication, recombination, and repair, but their physiological roles are not fully understood. In vitro , the enzyme also binds to double-stranded (ds) DNA, ssDNA, ssRNA, and dsRNA, although with lower affinity than to RNA:DNA hybrids. Due to the ubiquity of the enzyme, there are several sequences for RNase H known in the literature, each with somewhat different amino acid sequences. Like US Patent No. 5,500,370, US Patent No. 5,268,289 discloses thermostable RNase H. U.S. Patent No. 6,376,661 discloses human RNase H and compositions and uses thereof. US Patent No. 6,001,652 discloses human type 2 RNase H. U.S. Patent No. 6,071,734 discloses RNase H from HBV polymerase. All of these RNase Hs can be used in one or more embodiments of the invention.

Analysis run time

Another advantage of the process according to the invention is that the reaction step takes a short time to complete. Accordingly, in some embodiments, an mRNA sample is contacted with an oligonucleotide to release the first 5, 6, or 7 nucleotides of the nucleotide sequence of the mRNA transcript and the sample is incubated with a nuclease (e.g., RNase H ) takes less than 90 minutes to complete the contacting step. In some embodiments, the steps are performed within 40 - 100 minutes, 45 - 90 minutes, 50 - 80 minutes, 55 - 70 minutes, or 60 - 70 minutes.

As described in Example 1, an mRNA sample is contacted with an oligonucleotide to release the first 5, 6, or 7 nucleotides of the nucleotide sequence of the mRNA transcript and the sample is incubated with a nuclease (e.g., RNase H ) is carried out within 60 minutes. Accordingly, in certain embodiments of the invention, contacting the mRNA sample with the oligonucleotide and then contacting the sample with a nuclease (e.g., RNase H) takes no more than 60 minutes, or less than 65 minutes to complete. in need.

automation

One advantage of the method according to the invention is that the steps of contacting an mRNA sample with an oligonucleotide complementary to the mRNA transcript, contacting the sample with a nuclease (e.g., RNase H), and analyzing the sample for cap 1 The advantage is that the step of determining the portion of the mRNA transcript containing the structure can be performed in an automated system. Automation can further improve the time efficiency of the methods disclosed herein. Automation also has the advantage of scaling up the method for determining capping efficiency disclosed herein. In some embodiments, automation includes the use of an automated liquid handling system. In certain embodiments, the automated liquid handling system processes approximately 100 samples at a time. For example, in certain embodiments, the automated liquid handling system is configured for use with multi-well plates (e.g., 96-well plates). Commercially available liquid handling systems include Microlab VANTAGE 1.3, Microlab STAR, Microlab NIMBUS96, or Microlab Prep (all Hamilton). Similar systems are also available from Tecan (e.g., Tecan Fluent or Freedom EVO liquid handling platforms). Other automated liquid handling devices will be known to those skilled in the art.

Chromatographic separation

Nuclease treated (e.g., RNase H-treated) samples are analyzed to determine the portion of the mRNA transcript that contains the Cap 1 structure of the mRNA sample. In a typical embodiment, the invention utilizes chromatography to obtain nucleotides corresponding to the first 5, 6 or 7 nucleotides of the nucleotide sequence of an mRNA transcript comprising Cap 1, Cap 0 and/or Cap G. A nucleotide corresponding to the first 5, 6, or 7 nucleotides of the nucleotide sequence of an mRNA transcript, and/or a nucleotide corresponding to the first 5, 6, or 7 nucleotides of the nucleotide sequence of an mRNA transcript lacking a cap structure Separate nucleotides.

In some embodiments, an mRNA sample comprising the first 5, 6, or 7 nucleotides of the nucleotide sequence of the mRNA transcript may be subjected to thin layer chromatography (“TLC”).

In certain embodiments, analysis according to step (d) includes analyzing the sample obtained in step (c) by high performance liquid chromatography (HPLC). The term “HPLC,” as used herein, also relates to ultra-high performance liquid chromatography (UHPLC).

In a particular embodiment, the method according to the invention uses UHPLC for the analysis performed in step (d). UHPLC typically uses columns packed with particles smaller than 2 μm (e.g., 1.7 μm). UHPLC systems typically use pressures greater than 6000 psi (e.g., up to 15,000 psi), resulting in faster speeds and higher flow rates. Combined with small particle sizes, UHPLC offers superior resolution and sensitivity compared to conventional HPLC systems (see, e.g., Swartz, M.E., "Ultra Performance Liquid Chromatography (UPLC): an introduction", Separation Science Redefined (2005) ).

HPLC can involve a variety of sample separation methods depending on the column used. For example, in some embodiments, a suitable chromatography column is selected from the group consisting of an anion exchange column, cation exchange column, reversed phase HPLC column, hydrophobic interaction column, size exclusion column, or combinations thereof. In certain embodiments, a reversed phase HPLC column is used, such as a reversed phase UHPLC column. In certain embodiments, analysis according to step (d) includes analyzing the sample obtained in step (c) on a C18 reversed phase UHPLC column. The inventors have found the C18 2.1 x 100 mm column to be particularly useful. In some embodiments, it may be desirable to heat the sample (e.g., to about 50° C.) or to apply the sample to a heated chromatography column.

As known to those skilled in the art, ion exchangers ( e.g. anion exchangers and/or cation exchangers) can be based on a variety of materials with respect to the matrix and attached charged groups. For example, the following matrices can be used, in which the mentioned materials can be more or less crosslinked: agarose-based matrices (e.g. Sepharose™ CL-6B, Sepharose™ Fast Flow and Sepharose™ High Performance), cellulose-based matrices (e.g. DEAE Sephacel®), dextran-based matrices (such as SEPHADEX®), silica-based matrices and synthetic polymer-based matrices.

Ion exchange resins can be prepared according to known methods. Typically, an equilibration buffer that causes the resin to bind its counter ions can be passed through the ion exchange resin prior to loading the sample onto the resin. Conveniently, the equilibration buffer can be the same as the loading buffer, but this is not required. In one embodiment, the ion exchange resin can be regenerated with regeneration buffer after elution of the sample, so that the column can be reused. Generally, the salt concentration and/or pH of the regeneration buffer is such that substantially all contaminants and all remaining sample are eluted from the ion exchange resin. Typically, the regeneration buffer has a very high salt concentration to elute contaminants and nucleotides from the ion exchange resin.

In some embodiments, the sample obtained in step (c) is subjected to anion exchange chromatography for analysis according to step (d). High-resolution analysis of nucleotides can be performed as described in Ausser, WA, et al., "High-resolution analysis and purification of synthetic oligonucleotides with strong anion-exchange HPLC", Biotechniques, 19: 136-139 (1995). For anion exchange resins, the charged groups covalently attached to the matrix can be, for example, diethylaminoethyl (DEAE), quaternary aminoethyl (QAE), and/or quaternary ammonium (Q). In some embodiments, the anion exchange resin used is a Q Sepharose column. Anion exchange chromatography is performed, for example, by Q Sepharose™ Fast Flow, Q Sepharose™ High Performance, Q Sepharose™ XL, Capto™ Q, DEAE, TOYOPEARL Gigacap® Q, Fractogel® TMAE (trimethylaminoethyl, quaternary ammonia resin), Eshmuno™ Q, Nuvia™ Q, or UNOsphere™ Q. Other anion exchangers include quaternary amine resins or “Q-resins” ( e.g. Capto ^TM -Q, Q-Sepharose ^® , QAE Sephadex ^® ); diethylaminoethane resins ( e.g., DEAE-Trisacryl ^® , DEAE Sepharose ^® , benzoylated naphthoylated DEAE, diethylaminoethyl Sephacel ^® ); Amberjet ^® resin; Amberlyst ^® resin; Amberlite ^® resin ( e.g., Amberlite ^® IRA-67, Amberlite ^® strong base, Amberlite ^® weak base), cholestyramine resin, ProPac ^® resin (e.g., ProPac ^® SAX-10, ProPac ^® WAX-10, ProPac ^® WCX-10); TSK-GEL ^® resin ( e.g., TSKgel DEAE-NPR; TSKgel DEAE-5PW); and Acclaim ^® resin.

Typical mobile phases for anion exchange chromatography include polar solutions such as water, acetonitrile, organic alcohols such as methanol, ethanol and isopropanol, or solutions containing 2-(N-morpholino)-ethanesulfonic acid (MES). do. Accordingly, in certain embodiments, the mobile phase is about 0%, 1%, 2%, 4%, 6%, 8%, 10%, 12%, 14%, 16%, 18%, 20%, 25%, 30%. %, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100% polar solution. . In certain embodiments, the mobile phase is at about 1% to about 100%, about 5% to about 95%, about 10% to about 90%, about 20% to about 80%, about 30% to about 30% at any point during the separation process. and about 70% polar solution, or about 40% to about 60% polar solution.

Typically, uncapped mRNA is adsorbed to a fixed positive charge on a strong anion exchange column, and a gradient of increasing ionic strength using a mobile phase at a predetermined flow rate is proportional to the strength of ionic interaction with the positively charged column. The capped species (cap with positive charge) is eluted from the column. More negatively charged (more acidic) mRNA nucleotides lacking a cap structure elute later than less negatively charged (less acidic) capped species.

In some embodiments, the analysis according to step (d) involves subjecting the same obtained in step (c) to cation exchange chromatography, such as sulfopropyl (SP) cation exchange chromatography. Other cation chromatography membranes or resins may be used, such as MUSTANG™ S membrane, S- Sepharose™ resin, or Blue Sepharose™ resin.

In some embodiments, the analysis according to step (d) includes subjecting the same obtained in step (c) to hydrophobic interaction chromatography (HIC). Hydrophobic interaction chromatography exploits the attractive force of a given molecule toward a polar or non-polar environment, and in the case of nucleic acids, this tendency is governed by the hydrophobicity or hydrophilicity of the nucleotide and modifications thereto. Accordingly, nucleic acids are classified according to their varying degrees of attraction to a hydrophobic matrix, an inert support typically having an alkyl linker arm with a chain length of 2 to 18 carbons. The stationary phase comprises small non-polar groups (butyl, octyl, or phenyl) attached to a hydrophilic polymer backbone ( e.g., cross-linked Sepharose™, dextran, or agarose). In some embodiments, hydrophobic interaction chromatography includes phenyl chromatography. In another embodiment, hydrophobic interaction chromatography includes butyl chromatography or octyl chromatography.

In some embodiments, the analysis according to step (d) includes subjecting the same obtained in step (c) to reverse phase-HPLC. Reverse-phase HPLC includes a non-polar stationary phase and a moderately polar mobile phase. In some embodiments, the stationary phase is silica treated, for example, with RMe ₂ SiCl, where R is a straight chain alkyl group, such as C ₁₈ H ₃₇ or C ₈ H ₁₇ . Therefore, for molecules that are more non-polar in nature, the retention time is longer so that polar molecules can be more easily eluted. Adding a polar solvent to the mobile phase increases the retention time, and adding a large amount of hydrophobic solvent decreases the retention time. Other parameters that can be changed include mobile phase flow rate and temperature. The nature of a particular RNA molecule as an analyte can play an important role in its retention properties. In general, analytes with more nonpolar functional groups (e.g., methyl groups) have longer retention times because they increase the hydrophobicity of the molecule. Protocols for high resolution of RNA species using reversed-phase-HPLC that can be adapted for use in embodiments of the invention are known in the art (e.g., U.S. Pat. No. 8,383,340; Gilar, M., “Analysis and purification of synthetic oligonucleotides by reversed-phase high-performance liquid chromatography with photodiode array and mass spectrometry detection", Anal. Biochem., 298: 196-206 (2001). In some embodiments, triethylammonium acetate (TEAA) buffer is used with UV detection for isolation and characterization of the first 5, 6, or 7 nucleotides of the nucleotide sequence of an mRNA transcript, including the cap.

In some embodiments, the analysis according to step (d) of the method utilizes a combination of one or more chromatographic separation methods disclosed herein. For example, certain embodiments of the invention may utilize reversed-phase ion pair chromatography, whereby separation is based on the hydrophobicity and number of anions associated with the molecule. The matrix may be silica-based (e.g., Murray et al., Anal. Biochem., 218:177-184 (1994)). Non-porous, inert polymeric resins may be used in certain embodiments (see, e.g., Huber, C.G., “High-resolution liquid chromatography of oligonucleotides on nonporous alkylated styrene-divinylbenzene copolymers”, Anal. Biochem., 212: 351- 358 (1993)).

In certain embodiments, analysis according to step (d) may include chromatography (e.g., HPLC, especially UHPLC) coupled to mass spectrometry (“MS”). Suitable LC-MS methods are known in the art. These methods typically use aqueous triethylamine-hexafluoroisopropanol (TEA HFIP) buffer, which is compatible with MS detection (Apffel, A., et al., "New procedure for the use of HPLC-ESI MS for the analysis of nucleotides and oligonucleotides", J. Chromatogr. A, 777: 3-21 (1997)). For example, the optimized TEA-HFIP mobile phase can be used for LC-MS separation and characterization of the first 5, 6, or 7 nucleotides of the nucleotide sequence of an mRNA transcript, including the cap. In a specific embodiment, the aqueous buffer includes 100 mM HFIP at pH 8.3 and 8.6 mM TEA. In a specific embodiment, a mobile phase comprising an aqueous solution of 100 mM HFIP/8.6 mM TEA, pH 8.3, combined with up to 50% methanol is used in the process according to the invention. Alternatively, triethylammonium bicarbonate mobile phase can be used for oligonucleotide separation by adding acetonitrile to the eluate after the column. Ion pair buffers can be selected to provide the best MS detection sensitivity. In certain embodiments, analysis according to step (d) may include chromatography (e.g., HPLC) coupled to tandem mass spectrometry (LC-MS/MS). The inventors have found that ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UHPLC/Q-TOF-MS) is a particularly suitable method for analysis according to step (d) of the present invention. Accordingly, in a particular embodiment, the method according to the invention performs the analysis of step (d) using ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UHPLC/Q-TOF-MS).

In some embodiments, analysis of a sample by MS or LC-MS according to step (d) comprises analysis over a scan range of 200 to 6000 m/z, or 250 to 5000 m/z, or 300 to 4000 m/z. Includes. In certain embodiments, analysis of a sample by MS or LC-MS according to step (d) includes analysis over a scan range of 400 to 3200 m/z.

Methylation profile

In certain embodiments, the mRNA transcript comprising the cap structure is characterized by a methylation profile. In some embodiments, “methylation profile” refers to a set of values corresponding to the amount of the first 5, 6, or 7 nucleotides of the nucleotide sequence of an mRNA transcript eluted from a chromatography column at a time after addition to the mobile phase column. do. As described above, the retention time of the methylated cap and penultimate nucleotide, which are more non-polar in nature, is increased compared to the more easily eluted polar molecules. Accordingly, in some embodiments, the retention time of the first 5, 6, or 7 nucleotides released in step (c) of the method of the invention is determined by the polarity of the mobile phase used during the chromatographic analysis step performed in step (d). It can be increased by adding solvent. In some embodiments, the retention time of the first 5, 6 or 7 nucleotides released in step (c) of the method of the invention is determined by adding a hydrophobic solvent to the mobile phase used during the chromatographic analysis step performed in step (d). It can be reduced by adding

peak analysis

In some embodiments, analysis according to step (d) of the methods disclosed herein includes automated integration of the area of each peak in the chromatogram. For example, data can be expressed as an area percentage value, which represents the percentage of the integrated peak area of a particular species relative to the total integrated peak area of the entire chromatogram.

In some embodiments, analysis according to step (d) of the methods disclosed herein includes comparison of individual peaks in the chromatogram(s) following HPLC analysis. In certain embodiments, analysis according to step (d) of the methods disclosed herein includes comparison of the total ion number of each peak of the chromatogram(s) following mass spectrometry analysis (e.g., LC-MS).

In some embodiments, the portion of the first 5, 6, or 7 nucleotides of the nucleotide sequence of the mRNA transcript comprising the Cap 1 structure comprises another cap structure (e.g., Cap 0 or Cap G), or It is determined for the portion of the first 5, 6, or 7 nucleotides of the nucleotide sequence of the mRNA transcript that lacks the cap structure.

In certain embodiments, the portion of the first five nucleotides of the nucleotide sequence of the mRNA transcript comprising the cap 1 structure comprises another cap structure (e.g., cap 0 or cap G), or the mRNA lacks the cap structure. It is determined for the first five nucleotides of the nucleotide sequence of the transcript.

control sample

In some embodiments, the analysis according to step (d) of the method of the invention is performed with reference to one or more control samples. For example, in some embodiments, the analysis according to step (d) of the method of the present invention may be performed using synthesized nucleotides corresponding to the first 5, 6 or 7 nucleotides, respectively, of the nucleotide sequence of the mRNA in the mRNA sample according to the invention. This is performed with reference to an uncapped control sample containing oligonucleotides.

In other embodiments, suitable control samples include (i) a sequence of 5, 6, or 7 nucleotides, as appropriate, comprising a 5' cap structure, and (ii) 5, 6, or 7 nucleotides, as appropriate, lacking the cap structure. , or a sequence of 7 nucleotides in a defined ratio (e.g., 9:1) to provide a reference. For example, if an oligonucleotide is designed for enzymatic release of the first five 5' nucleotides of an mRNA transcript, the control sample contains (i) a sequence of five nucleotides containing the 5' Cap 1 structure, and (ii) ) may contain sequences of five nucleotides lacking the cap structure in defined ratios to provide a reference. In certain embodiments, the control sample contains a 9:1 ratio of (i) a sequence of 5 nucleotides comprising the 5' cap 1 structure, and (ii) a sequence of 5 nucleotides lacking the cap structure.

In some embodiments, one or more control samples are used in the calibration step as part of the analysis according to step (d) of the method of the invention. In some embodiments, control samples are used to monitor instrument calibration by measuring the elution time and/or peak intensity of the control sample. In some embodiments, a control sample comprising synthesized oligonucleotides corresponding to the first 5, 6, or 7 nucleotides, respectively, of the nucleotide sequence of the mRNA is analyzed according to step (d) of the method of the invention to perform machine calibration. Monitor.

In some embodiments, one or more control samples are run in parallel with the analysis of the sample obtained according to step (c) to provide a reference chromatogram. In some embodiments, the control sample is modified such that the sample obtained according to step (c) can be spiked with one or more control samples for simultaneous measurement of the sample obtained according to step (c) and one or more control samples, For example, it may be deuterated or radiolabeled.

between the first five nucleotides of the nucleotide sequence of a cap-containing mRNA transcript and the first five nucleotides of the nucleotide sequence of a non-cap-containing mRNA transcript, as well as between the different cap structures (e.g., cap-0, cap-G, and cap-G). 1), the use of control samples is not necessarily necessary, given the high resolution achieved by the method of the present invention, which can be easily distinguished between Accordingly, in certain embodiments of the invention, no control sample is used in step (d) to analyze the sample obtained in step (c) of the method of the invention.

Further processing of mRNA transcripts

In some embodiments, the method of the invention is incorporated into a manufacturing process and the results of step (d) are used to determine whether the IVT reaction mixture from which the mRNA sample was taken is processed further.

“Further processed” means that the reaction mixture is moved to the next step in a given manufacturing process. For example, further processing may include purification, for example, to remove certain components of the IVT reaction mixture. Additional processing may also include formulating the mRNA transcript, for example, by encapsulating it in lipid nanoparticles. For example, further processing may include using the IVT reaction mixture in the preparation of therapeutic compositions.

In certain embodiments, further processing may include addition of a 3' poly(A) tail. In some embodiments, a 3' poly(A) tail of approximately 200 nucleotides in length (as determined by gel electrophoresis) is incorporated through the addition of ATP with PolyA polymerase. In some embodiments, the poly(A) tail is approximately 100 to 250 nucleotides in length. In some embodiments, the poly(A) tail is about 50 to 300 nucleotides in length. In some embodiments, the mRNA transcript in the IVT reaction mixture includes 5' and 3' untranslated regions.

In some embodiments, further processing includes additional quality control steps. For example, the IVT reaction mixture can be used as a source for additional mRNA samples that can be analyzed with respect to other aspects of the mRNA transcript, such as the length of the mRNA transcript. Additional processing may include determining the purity of the mRNA sample.

Typically, IVT reaction mixtures determined to contain an amount of mRNA transcript containing Cap 1 structures exceeding a threshold value are considered for further processing. In some embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 80% of the samples for the IVT reaction mixture to be further processed. In some embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 85% of the samples for the IVT reaction mixture to be further processed. In some embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 90% of the samples for the IVT reaction mixture to be further processed. In some embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 91% of the samples for the IVT reaction mixture to be further processed. In some embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 92% of the samples for the IVT reaction mixture to be further processed. In some embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 93% of the samples for the IVT reaction mixture to be further processed. In some embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 94% of the samples for the IVT reaction mixture to be further processed. In certain embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 95% of the samples for the IVT reaction mixture to be further processed. In some embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 96% of the samples for the IVT reaction mixture to be further processed. In some embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 97% of the samples for the IVT reaction mixture to be further processed. In some embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 98% of the samples for the IVT reaction mixture to be further processed. In some embodiments, the mRNA transcripts comprising the Cap 1 structure are at least 99% of the samples for the IVT reaction mixture to be further processed.

Therefore, an IVT reaction mixture determined to contain an amount of mRNA transcript containing a cap structure other than Cap 1 is considered to be processed further only if the non-Cap 1 cap structure is present below the threshold value. In some embodiments, mRNA transcripts comprising a cap 0 structure are no more than 20% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap 0 structure are no more than 15% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap 0 structure are no more than 10% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap 0 structure are no more than 9% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap 0 structure are no more than 8% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap 0 structure are no more than 7% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap 0 structure are no more than 6% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap 0 structure are no more than 5% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap 0 structure are no more than 4% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap 0 structure are no more than 3% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap 0 structure are no more than 2% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap 0 structure represent 1% or less of the sample for the IVT reaction mixture to be further processed.

In some embodiments, mRNA transcripts containing a cap G structure are no more than 20% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts containing a cap G structure are no more than 15% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts containing a cap G structure are no more than 10% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap G structure are no more than 9% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap G structure are no more than 8% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap G structure are no more than 7% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap G structure are no more than 6% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap G structure represent no more than 5% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap G structure are no more than 4% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap G structure are no more than 3% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap G structure are no more than 2% of the samples for the IVT reaction mixture to be further processed. In some embodiments, mRNA transcripts comprising a cap G structure represent 1% or less of the sample for the IVT reaction mixture to be further processed.

Generally, an IVT reaction mixture determined to contain an amount of uncapped mRNA transcript is considered to be processed further only if the amount is below the threshold value. In certain embodiments, uncapped mRNA transcripts are no more than 20% of the samples for the ITV reaction mixture to be further processed. In certain embodiments, uncapped mRNA transcripts are no more than 15% of the samples for the ITV reaction mixture to be further processed. In certain embodiments, uncapped mRNA transcripts are no more than 10% of the samples for the ITV reaction mixture to be further processed. In certain embodiments, uncapped mRNA transcripts are no more than 9% of the samples for the ITV reaction mixture to be further processed. In certain embodiments, uncapped mRNA transcripts are no more than 8% of the sample for the ITV reaction mixture to be further processed. In certain embodiments, uncapped mRNA transcripts are no more than 7% of the samples for the ITV reaction mixture to be further processed. In certain embodiments, uncapped mRNA transcripts are no more than 6% of the sample for the ITV reaction mixture to be further processed. In certain embodiments, uncapped mRNA transcripts are no more than 5% of the sample for the ITV reaction mixture to be further processed. In certain embodiments, uncapped mRNA transcripts are no more than 4% of the sample for the ITV reaction mixture to be further processed. In certain embodiments, uncapped mRNA transcripts are no more than 3% of the sample for the ITV reaction mixture to be further processed. In certain embodiments, uncapped mRNA transcripts are no more than 2% of the sample for the ITV reaction mixture to be further processed. In certain embodiments, uncapped mRNA transcripts are less than 1% of the sample for the ITV reaction mixture to be further processed.

IVT reaction mixtures determined to contain less than 90% of the mRNA transcripts containing Cap 1 will not be processed further, but mRNA samples or IVT reaction mixtures may be used to determine, for example, the cause of insufficient production of Cap 1. It can be used for other purposes such as:

kit

The present invention further provides kits containing various reagents and materials useful for carrying out the inventive method according to the present invention. The quantitative procedures described herein can be performed in a diagnostic laboratory, experimental laboratory, or commercial laboratory. The present invention provides a kit that can be used in these various environments.

To detect/quantitate mRNA capping efficiency, the kit specifically anneals adjacent to the mRNA cap of the target mRNA transcript, at the second to fifth and third to sixth nucleotides of the nucleotide sequence of the oligonucleotide and mRNA transcript, respectively. , or an oligonucleotide as disclosed herein that forms an mRNA:DNA hybrid between the fourth to seventh nucleotides. The kit also includes a nuclease to produce the first 5, 6, or 7 nucleotides, respectively, of the nucleotide sequence of the mRNA transcript; That is, it may contain RNase H. The kit may further include instructions for using the kit according to the methods of the present invention.

In some embodiments, kits of the invention may further include control samples to serve as reference points. For example, a control sample included in a kit may include an mRNA sample containing at least 90% of the mRNA transcripts containing a Cap 1 structure. In certain embodiments, the control sample included in the kit comprises 5, 6, or 7 ribonucleotides, as appropriate, wherein at least 90% of the ribonucleotides comprise a Cap 1 structure.

In some embodiments, materials and reagents for quantifying mRNA capping efficiency in mRNA samples by enzymatic manipulation and chromatographic separation can be assembled together in a kit. For example, such a kit may include a reagent for separating the first 5, 6 or 7 nucleotides of the nucleotide sequence of an mRNA transcript containing a cap structure on the column, a chromatographic column, and a kit according to the method of the present invention. May include instructions for use.

composition

The invention also provides purified mRNA compositions comprising in vitro synthesized mRNA comprising a Cap 1 structure. In some embodiments, the mRNA composition comprises at least 80% of the mRNA molecules comprising a Cap 1 structure. In some embodiments, the mRNA composition comprises at least 85% of the mRNA molecules comprising a Cap 1 structure. In some embodiments, the mRNA composition comprises at least 90% of the mRNA molecules comprising a Cap 1 structure. In some embodiments, the mRNA composition comprises at least 95% of the mRNA molecules comprising a Cap 1 structure. In some embodiments, the mRNA composition comprises at least 96% of the mRNA molecules comprising a Cap 1 structure. In some embodiments, the mRNA composition comprises at least 97% of the mRNA molecules comprising a Cap 1 structure. In some embodiments, the mRNA composition comprises at least 98% of the mRNA molecules comprising a Cap 1 structure. In some embodiments, the mRNA composition comprises at least 99% of the mRNA molecules comprising a Cap 1 structure. mRNA molecules containing the Cap 1 structure are prepared according to the capping efficiency assay described herein. In some embodiments, the percentage of mRNA molecules comprising the Cap 1 structure is determined by the capping efficiency assay of the present invention.

In some embodiments, the mRNA composition is encapsulated in lipid nanoparticles. In some embodiments, the mRNA composition is formulated for in vivo delivery.

Example

Example 1: Analysis of capping efficiency

This example demonstrates a method to quantify capping efficiency in mRNA samples from two different in vitro transcription (IVT) reaction mixtures, referred to as “Sample 1” and “Sample 2.”

As shown in Figure 3, oligonucleotides were designed and synthesized to be complementary to the mRNA transcript to form an mRNA:DNA hybrid between the oligonucleotide and the second to fifth nucleotides of the nucleotide sequence of the mRNA transcript. The mRNA transcript contained the following 5' untranslated region (5' UTR): GGACAGAUCGCCUGGA GACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG [SEQ ID NO: 2].

The sequence of the oligonucleotide is as follows: 5'-mUmCmCmAmGmGmCmGmAmUmC TGTC mC-3' (SEQ ID NO: 1) where mU represents uridine with 2'-O-methyl ribose and mC is 2'-O-methyl represents cytidine with ribose; mA represents adenine with 2'-O-methyl ribose; mG represents guanidine with 2'-O-methyl ribose; T represents deoxythymidine; G represents represents oxyguanidine, C represents deoxycytidine, and underlined text represents DNA nucleotides).

Sample 1 and Sample 2 were processed as two separate reactions as follows. 55 pmol of mRNA samples containing mRNA transcripts were contacted with oligonucleotides in a total initial assay volume of 22 μl and incubated for 10 minutes at 75°C and then for 10 minutes at room temperature. The mRNA samples were then contacted with RNase H in the same reaction vessel to obtain a total final assay volume of 52 μl. The reaction proceeded at 37°C for 40 minutes. RNase H cleaves the mRNA at the region of the DNA:RNA hybrid, releasing the first five 5' nucleotides of the nucleotide sequence of the mRNA transcript.

Without any purification, RNase H-digested mRNA samples were loaded onto a UHPLC-QTOF system (Agilent) with an InfinityLab C18 2.1 The parts of the carcass were determined. Using a flow rate of 0.5 ml/min, perform a 1 to 16% gradient from mobile phase A (100 mM HFIP, 8.6 mM trimethylamine, pH 8.3) to mobile phase B (100% methanol) over 10 min, followed by 50% for 1.5 min. Mobile phase B was performed. The eluate was analyzed directly by QTOF spectroscopy using 13 L/min 350°C dry gas flow, 10 psi nebulizer pressure, and capillary voltage of 3750 V. Analysis was performed in negative ion mode over the following scan range 400 to 3200 m/z.

The resulting chromatograms for Sample 1 and Sample 2 are shown in Figures 4B and 4C, respectively. As shown in Figure 4B, the chromatogram for sample 1 showed four identifiable peaks. These could be designated as uncapped nucleotides and nucleotides with cap 0, cap G, and cap 1 as indicated. Sample 1 was not processed further because the portion of the mRNA transcript containing the Cap 1 structure was less than 90%. As shown in Figure 4C, the chromatogram for Sample 2 showed a major peak corresponding to Cap 1. The relative abundance of Cap 1 relative to uncapped nucleotides was determined through automated integration of relevant chromatographic peaks. The fraction of mRNA transcripts containing cap 1 structures was determined to be 95%, so sample 2 was taken for further processing.

SEQUENCE LISTING <110> Translate Bio, Inc. <120> Assay for quantitative assessment of mRNA capping efficiency <130> MRT-2241WO <140>PCT/USxx/xxxxxx <141> 2022-06-03 <150> 63/197106 <151> 2021-06-04 <160> 27 <170> PatentIn version 3.5 <210> 1 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <220> <221> modified_base <222> (1)..(1) <223>um <220> <221> modified_base <222> (2)..(2) <223>cm <220> <221> modified_base <222> (3)..(3) <223>cm <220> <221> modified_base <222> (4)..(4) <223> a.m. <220> <221> modified_base <222> (5)..(5) <223>gm <220> <221> modified_base <222> (6)..(6) <223>gm <220> <221> modified_base <222> (7)..(7) <223>cm <220> <221> modified_base <222> (8)..(8) <223>gm <220> <221> modified_base <222> (9)..(9) <223> a.m. <220> <221> modified_base <222> (10)..(10) <223>um <220> <221> modified_base <222> (11)..(11) <223>cm <220> <221> modified_base <222> (16)..(16) <223>cm <400> 1 uccaggcgau ctgtcc 16 <210> 2 <211> 140 <212> RNA <213> Artificial Sequence <220> <223> 5'-UTR <400> 2 ggacagaucg ccuggagacg ccauccacgc uguuuugacc uccauagaag acaccgggac 60 cgauccagcc uccgcggccg ggaacggugc auuggaacgc ggauuccccg ugccaagagu 120 gacucaccgu ccuugacacg 140 <210> 3 <211> 140 <212> RNA <213> Artificial Sequence <220> <223> 5'-UTR <400> 3 agacagaucg ccuggagacg ccauccacgc uguuuugacc uccauagaag acaccgggac 60 cgauccagcc uccgcggccg ggaacggugc auuggaacgc ggauuccccg ugccaagagu 120 gacucaccgu ccuugacacg 140 <210> 4 <211> 54 <212> RNA <213> Artificial Sequence <220> <223> 5'-UTR <400> 4 gagaauaaac uaguauucuu cuggucccca cagacucaga gagaacccgc cacc 54 <210> 5 <211> 47 <212> RNA <213> Artificial Sequence <220> <223> 5'-UTR <400> 5 gggaaauaag agagaaaaga agaguaagaa gaaaauauaag agccacc 47 <210> 6 <211> 14 <212> RNA <213> Artificial Sequence <220> <223> 5'-UTR <400> 6 ggagaaagcu uacc 14 <210> 7 <211> 57 <212> RNA <213> Artificial Sequence <220> <223> 5'-UTR <400> 7 gggaaauaag agagaaaaga agaguaagaa gaaaauuaag accccggcgc cgccacc 57 <210> 8 <211> 49 <212> RNA <213> Artificial Sequence <220> <223> 5'-UTR <400> 8 agggucaaga uuagagaacg gucguagcau uaucggaggu ucugccacc 49 <210> 9 <211> 48 <212> RNA <213> Artificial Sequence <220> <223> 5'-UTR <400> 9 gggucaagau uagagaacgg ucguagcauu aucggagguu cugccacc 48 <210> 10 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <400> 10 uccaggcgau ctgtcc 16 <210> 11 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <400> 11 uucucucuua uttccc 16 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <400> 12 cuuuucucuc uuauttccc 19 <210> 13 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <400> 13 cagaagaaua ctagtu 16 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <400> 14 ggaccagaag aauactagtu 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <400> 15 cguucucuaa ucuugacccu 20 <210> 16 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <400> 16 cucuaaucuu gacccu 16 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <400> 17 ccguucucua aucuugaccc 20 <210> 18 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <400> 18 cucuaaucuu gaccc 15 <210> 19 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <220> <221> modified_base <222> (1)..(1) <223>um <220> <221> modified_base <222> (2)..(2) <223>um <220> <221> modified_base <222> (3)..(3) <223>cm <220> <221> modified_base <222> (4)..(4) <223>um <220> <221> modified_base <222> (5)..(5) <223>cm <220> <221> modified_base <222> (6)..(6) <223>um <220> <221> modified_base <222> (7)..(7) <223>cm <220> <221> modified_base <222> (8)..(8) <223>um <220> <221> modified_base <222> (9)..(9) <223>um <220> <221> modified_base <222> (10)..(10) <223> a.m. <220> <221> modified_base <222> (11)..(11) <223>um <220> <221> modified_base <222> (16)..(16) <223>cm <400> 19 uucucucuua uttccc 16 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <220> <221> modified_base <222> (1)..(1) <223>cm <220> <221> modified_base <222> (2)..(2) <223>um <220> <221> modified_base <222> (3)..(3) <223>um <220> <221> modified_base <222> (4)..(4) <223>um <220> <221> modified_base <222> (5)..(5) <223>um <220> <221> modified_base <222> (6)..(6) <223>cm <220> <221> modified_base <222> (7)..(7) <223>um <220> <221> modified_base <222> (8)..(8) <223>cm <220> <221> modified_base <222> (9)..(9) <223>um <220> <221> modified_base <222> (10)..(10) <223>cm <220> <221> modified_base <222> (11)..(11) <223>um <220> <221> modified_base <222> (12)..(12) <223>um <220> <221> modified_base <222> (13)..(13) <223> a.m. <220> <221> modified_base <222> (14)..(14) <223>um <220> <221> modified_base <222> (19)..(19) <223>cm <400> 20 cuuuucucuc uuauttccc 19 <210> 21 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <220> <221> modified_base <222> (1)..(1) <223>cm <220> <221> modified_base <222> (2)..(2) <223> a.m. <220> <221> modified_base <222> (3)..(3) <223>gm <220> <221> modified_base <222> (4)..(4) <223> a.m. <220> <221> modified_base <222> (5)..(5) <223> a.m. <220> <221> modified_base <222> (6)..(6) <223>gm <220> <221> modified_base <222> (7)..(7) <223> a.m. <220> <221> modified_base <222> (8)..(8) <223> a.m. <220> <221> modified_base <222> (9)..(9) <223>um <220> <221> modified_base <222> (10)..(10) <223> a.m. <220> <221> modified_base <222> (11)..(11) <223>cm <220> <221> modified_base <222> (16)..(16) <223>um <400> 21 cagaagaaua ctagtu 16 <210> 22 <211> 47 <212> RNA <213> Artificial Sequence <220> <223> 5'-UTR <400> 22 aacuaguauu cuucuggucc ccacagacuc agagagaacc cgccacc 47 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <220> <221> modified_base <222> (1)..(1) <223>gm <220> <221> modified_base <222> (2)..(2) <223>gm <220> <221> modified_base <222> (3)..(3) <223> a.m. <220> <221> modified_base <222> (4)..(4) <223>cm <220> <221> modified_base <222> (5)..(5) <223>cm <220> <221> modified_base <222> (6)..(6) <223> a.m. <220> <221> modified_base <222> (7)..(7) <223>gm <220> <221> modified_base <222> (8)..(8) <223> a.m. <220> <221> modified_base <222> (9)..(9) <223> a.m. <220> <221> modified_base <222> (10)..(10) <223>gm <220> <221> modified_base <222> (11)..(11) <223> a.m. <220> <221> modified_base <222> (12)..(12) <223> a.m. <220> <221> modified_base <222> (13)..(13) <223>um <220> <221> modified_base <222> (14)..(14) <223> a.m. <220> <221> modified_base <222> (15)..(15) <223>cm <220> <221> modified_base <222> (20)..(20) <223>um <400> 23 ggaccagaag aauactagtu 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <220> <221> modified_base <222> (1)..(1) <223>cm <220> <221> modified_base <222> (2)..(2) <223>gm <220> <221> modified_base <222> (3)..(3) <223>um <220> <221> modified_base <222> (4)..(4) <223>um <220> <221> modified_base <222> (5)..(5) <223>cm <220> <221> modified_base <222> (6)..(6) <223>um <220> <221> modified_base <222> (7)..(7) <223>cm <220> <221> modified_base <222> (8)..(8) <223>um <220> <221> modified_base <222> (9)..(9) <223> a.m. <220> <221> modified_base <222> (10)..(10) <223> a.m. <220> <221> modified_base <222> (11)..(11) <223>um <220> <221> modified_base <222> (12)..(12) <223>cm <220> <221> modified_base <222> (13)..(13) <223>um <220> <221> modified_base <222> (14)..(14) <223>um <220> <221> modified_base <222> (15)..(15) <223>gm <220> <221> modified_base <222> (20)..(20) <223>um <400> 24 cguucucuaa ucuugacccu 20 <210> 25 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <220> <221> modified_base <222> (1)..(1) <223>cm <220> <221> modified_base <222> (2)..(2) <223>um <220> <221> modified_base <222> (3)..(3) <223>cm <220> <221> modified_base <222> (4)..(4) <223>um <220> <221> modified_base <222> (5)..(5) <223> a.m. <220> <221> modified_base <222> (6)..(6) <223> a.m. <220> <221> modified_base <222> (7)..(7) <223>um <220> <221> modified_base <222> (8)..(8) <223>cm <220> <221> modified_base <222> (9)..(9) <223>um <220> <221> modified_base <222> (10)..(10) <223>um <220> <221> modified_base <222> (11)..(11) <223>gm <220> <221> modified_base <222> (16)..(16) <223>um <400> 25 cucuaaucuu gacccu 16 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <220> <221> modified_base <222> (1)..(1) <223>cm <220> <221> modified_base <222> (2)..(2) <223>cm <220> <221> modified_base <222> (3)..(3) <223>gm <220> <221> modified_base <222> (4)..(4) <223>um <220> <221> modified_base <222> (5)..(5) <223>um <220> <221> modified_base <222> (6)..(6) <223>cm <220> <221> modified_base <222> (7)..(7) <223>um <220> <221> modified_base <222> (8)..(8) <223>cm <220> <221> modified_base <222> (9)..(9) <223>um <220> <221> modified_base <222> (10)..(10) <223> a.m. <220> <221> modified_base <222> (11)..(11) <223> a.m. <220> <221> modified_base <222> (12)..(12) <223>um <220> <221> modified_base <222> (13)..(13) <223>cm <220> <221> modified_base <222> (14)..(14) <223>um <220> <221> modified_base <222> (15)..(15) <223>um <220> <221> modified_base <222> (20)..(20) <223>cm <400> 26 ccguucucua aucuugaccc 20 <210> 27 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide containing DNA and RNA nucleotides <220> <221> modified_base <222> (1)..(1) <223>cm <220> <221> modified_base <222> (2)..(2) <223>um <220> <221> modified_base <222> (3)..(3) <223>cm <220> <221> modified_base <222> (4)..(4) <223>um <220> <221> modified_base <222> (5)..(5) <223> a.m. <220> <221> modified_base <222> (6)..(6) <223> a.m. <220> <221> modified_base <222> (7)..(7) <223>um <220> <221> modified_base <222> (8)..(8) <223>cm <220> <221> modified_base <222> (9)..(9) <223>um <220> <221> modified_base <222> (10)..(10) <223>um <220> <221> modified_base <222> (15)..(15) <223>cm <400> 27 cucuaaucuu gaccc 15

Claims (25)

A method for quantifying capping efficiency in an mRNA sample from an in vitro transcription (IVT) reaction mixture, comprising:
(a) providing an mRNA sample, wherein the mRNA sample contains a plurality of mRNA transcripts comprising a nucleotide sequence with or without a cap, and wherein the first portion of the mRNA transcript is 5 of the first nucleotide of the nucleotide sequence. 'comprising a cap 1 structure at the end;
(b) contacting the mRNA sample with an oligonucleotide complementary to the mRNA transcript, such that the oligonucleotide and the nucleotide sequence of the mRNA transcript contain (i) the second to fifth nucleotides, (ii) the third to sixth nucleotides, or (iii) forming an mRNA:DNA hybrid between the fourth to seventh nucleotides;
(c) contacting the sample obtained in step (b) with RNase H to alter each of (i) the first 5 nucleotides, (ii) the first 6 nucleotides, or (iii) the first 7 nucleotides of the nucleotide sequence of the mRNA transcript. releasing; and
(d) analyzing the sample obtained in step (c) to determine the first portion of the mRNA transcript comprising the Cap 1 structure in the mRNA sample.
Including,
Steps (a) to (c) proceed sequentially with each other in the same analytical vessel. According to paragraph 1,
Steps (b) to (d) are performed by an automated system. According to claim 1 or 2,
The method of claim 1, wherein the analysis can further determine the methylation status of the cap. According to any one of claims 1 to 3,
The method of claim 1, wherein the cap was added enzymatically after transcription. According to any one of claims 1 to 3,
The method of claim 1, wherein the cap was co-transcriptionally added to the mRNA. According to any one of claims 1 to 5,
The oligonucleotide is represented by the formula:
5'-[R] _n [D] ₄ [R] ₁ -3'
(wherein each R is an RNA nucleotide and each D is a DNA nucleotide, where n is 10 to 20),
The method of claim 1, wherein the oligonucleotide has a GC content of about 40% to about 60%, and the mRNA:DNA hybrid has a melting temperature of about 50°C to about 60°C. According to clause 6,
An oligonucleotide, wherein each RNA nucleotide contains 2'-O-methyl ribose. According to any one of claims 1 to 7,
A method that requires input of no more than 100 pmol of in vitro transcribed mRNA in the mRNA sample provided in step (a). According to any one of claims 1 to 8,
Method, requiring a total analysis volume of less than 100 μl. According to any one of claims 1 to 9,
Steps (b) to (c) are performed within 90 minutes. According to any one of claims 1 to 10,
A method, wherein the analysis of step (d) comprises HPLC to isolate the first 5, 6 or 7 nucleotides of the nucleotide sequence of the mRNA transcript released in step (c) to determine the presence or absence of a cap. According to clause 11,
HPLC is UHPLC, method. According to claim 11 or 12,
The analysis in step (d) further includes mass spectrometry (MS) to identify the first 5, 6, or 7 nucleotides of the nucleotide sequence of the mRNA transcript released in step (c), including the Cap 1 structure. Including, method. According to clause 12,
The method of claim 1, wherein the analysis in step (d) comprises liquid chromatography-mass spectrometry (LC-MS). According to claim 13 or 14,
The method of claim 1, wherein analyzing the sample by MS or LC-MS according to step (d) comprises analysis over a scan range of 200 to 6000 m/z. According to any one of claims 1 to 15,
The method of claim 1, wherein the mRNA sample provided in step (a) comprises a second portion of the mRNA transcript that includes a cap 0 structure. According to any one of claims 1 to 16,
The method of claim 1, wherein the mRNA sample provided in step (a) comprises a third portion of the mRNA transcript that includes a cap G structure. According to any one of claims 1 to 17,
The method of claim 1, wherein the first portion of the mRNA transcript comprising the Cap 1 structure is at least 90% of the IVT reaction mixture to be further processed. According to any one of claims 1 to 18,
The method of claim 1, wherein the second portion of the mRNA transcript comprising the cap 0 structure is no more than 10% of the IVT reaction mixture to be further processed. According to any one of claims 1 to 19,
The third portion of the mRNA transcript comprising the cap G structure is no more than 10% of the IVT reaction mixture to be further processed. According to any one of claims 18 to 20,
The method of claim 1, wherein the further processing comprises purification and/or encapsulation of mRNA transcripts from the IVT reaction mixture. A method for producing therapeutic mRNA, said method comprising:
(i) synthesizing therapeutic mRNA using an in vitro transcription (IVT) reaction mixture;
(ii) analyzing the mRNA sample from the in vitro transcription (IVT) reaction mixture using the method of any one of claims 1 to 15; and
(iii) further processing the mRNA if the first portion of the mRNA transcript contains at least 90% of the Cap 1 structure of the mRNA.
Method, including. According to clause 22,
Wherein further processing includes purification of the therapeutic mRNA synthesized in step (i). According to claim 22 or 23,
The method of claim 1, wherein further processing comprises formulating the therapeutic mRNA synthesized in step (i). According to clause 24,
The method of claim 1, wherein formulating comprises encapsulating the mRNA in lipid nanoparticles.