KR20240017849A - Flow cell and method of manufacturing the same - Google Patents

Abstract

In one example of a method of making a flow cell, a photosensitive material is deposited on a resin layer comprising depressions separated by gap regions, wherein the depressions are over a first resin portion having a first thickness, and the gap regions are over a first resin portion having a first thickness. It is on a second resin portion having a second greater thickness. By irradiating a predetermined dose of ultraviolet light based on the first thickness and the second thickness through the resin layer, the photosensitive material over the depression is exposed to ultraviolet light, and the second resin portion absorbs the ultraviolet light, resulting in altered photosensitivity. The material is confined in a first predetermined area above the resin layer. The modified photosensitive material is used to create a functionalized layer in a first predefined area or in a second predefined area over the resin layer.

Description

Flow cell and method of manufacturing the same

Cross-reference to related applications

This application claims the benefit of U.S. Provisional Application No. 63/195,126, filed May 31, 2021, the contents of which are hereby incorporated by reference in their entirety.

Reference in Sequence Listing

The sequence listing submitted herein via EFS Web is incorporated herein by reference in its entirety. The file name is ILI220BPCT_IP-2152-PCT2_Sequence_Listing_ST25.txt, the file size is 3,059 bytes, and the file creation date is May 19, 2022.

Some available platforms for sequencing nucleic acids use a sequencing-by-synthesis approach. With this approach, a nascent strand is synthesized and the addition of each monomer (e.g., nucleotide) to the growing strand is detected optically and/or electronically. Because the template strand drives the synthesis of the nascent strand, the sequence of the template DNA can be deduced from the series of nucleotide monomers added to the growing strand during synthesis. In some examples, sequential paired-end sequencing may be used, in which the forward strand is sequenced and removed, and then the reverse strand is constructed and sequenced. In another example, simultaneous paired-end sequencing can be used, where the forward and reverse strands are sequenced simultaneously.

Features of examples of the disclosure will become apparent by reference to the following detailed description and drawings, where like reference numerals correspond to similar, if not identical, elements. For the sake of brevity, reference numbers or features having previously described functions may or may not be described with respect to the other drawings in which they appear.
1A is a top view of an exemplary flow cell;
1B-1E are enlarged and partial cutaway views of different examples of flow channels of a flow cell;
2A-2D are schematic diagrams of different examples of primer sets used in some examples of flow cells disclosed herein;
3A-3F are schematic diagrams that together illustrate an example of a method of using a sputtered or thermally evaporated metal film to create a mask used to pattern an example of a flow cell structure including depressions;
4A-4G are schematic diagrams that together illustrate other examples of methods for using sputtered or thermally evaporated metal films to create masks used to pattern other examples of flow cell structures including depressions;
5A-5E are schematic diagrams that together illustrate another example of how to use a sputtered or thermally evaporated metal film to create a mask used to pattern another example of a flow cell structure including depressions; ;
6A-6E are schematic diagrams that together illustrate another example of how to use a sputtered or thermally evaporated metal film to create a mask used to pattern another example of a flow cell structure including depressions; ;
Figure 7 is a schematic diagram of a transparent substrate including an example of a multi-depth depression;
8A-8N together illustrate two examples of how to use sputtered or thermally evaporated metal films to create a mask used to pattern an example of a flow cell structure containing multi-depth depressions. It is a schematic diagram;
9A-9I are schematic diagrams that together illustrate other examples of how to use sputtered or thermally evaporated metal films to create masks used to pattern other examples of flow cell structures containing multi-depth depressions. ego;
10A-10H together illustrate another example of how to use a sputtered or thermally evaporated metal film to create a mask used to pattern another example of a flow cell structure containing multi-depth depressions. It is a schematic diagram;
11A-11H together illustrate another example of how to use a sputtered or thermally evaporated metal film to create a mask used to pattern another example of a flow cell structure containing multi-depth depressions. It is a schematic diagram;
Figures 12A-12F are schematic diagrams that together illustrate an example of how to use varying the thickness of a resin layer to pattern an example of a flow cell structure including depressions;
Figure 13 is a schematic diagram of a resin layer containing an example of a multi-depth depression;
Figures 14A-14J are schematic diagrams illustrating together two examples of how to use varying the thickness of a resin layer to pattern an example of a flow cell structure including multi-depth depressions;
Figures 15A-15H are schematic diagrams that together illustrate another example of how to use varying the thickness of a resin layer to pattern another example of a flow cell structure comprising multi-depth depressions;
Figures 16A-16I are schematic diagrams that together illustrate another example of how to use varying the thickness of a resin layer to pattern an example of a flow cell structure including multi-depth depressions;
Figures 17A-17J are schematic diagrams that together illustrate another example of how to use varying the thickness of a resin layer to pattern an example of a flow cell structure comprising subsets of depressions with different depths;
18A and 18B are scanning electron microscopy (SEM) and confocal microscopy images (reproduced in black and white) of an aluminum film sputtered on a flow cell, respectively;
Figures 19A and 19B are partial enlarged views of the scanning electron micrograph of Figure 18A, illustrating the bottom of the depression and part of the interstitial region;
Figure 20 is an SEM image of a top view of a flow cell surface similar to that shown in Figure 4E, where a metal film is used to create an insoluble negative photoresist in the depressions rather than the interstitial regions;
Figure 21 is a confocal microscopy image of a flow cell surface similar to that shown in Figure 4g, where a metal film was used to create the functionalization layer in the depressions rather than the interstitial regions;
22A, 22B, and 22C show the gap regions after developing the negative photoresist with 22a) 260 mJ/cm ² backside exposure, 22b) 90 mJ/cm ² backside exposure, and 22c) 30 mJ/cm ² backside exposure. This is a planar SEM image of a flow cell containing a resin layer with a thickness of 500 nm at the top and 150 nm at the depressions.

Examples of flow cells disclosed herein can be used for sequencing, examples of which include sequential paired-end nucleic acid sequencing or simultaneous paired-end nucleic acid sequencing.

For sequential paired-end sequencing, primer sets are deposited within each depression of the flow cell and/or onto each functionalized layer pad. The primers in the primer set contain orthogonal cleavage (linearization) chemical structures that cause the forward strand to be generated, sequenced, and then removed, and then the reverse strand to be generated, sequenced, and then removed. In these examples, orthogonal cleavage chemistries can be implemented through different cleavage sites attached to different primers in the set. Several example methods for creating such flow cells are described.

For simultaneous paired-end sequencing, different sets of primers are attached to different regions within each depression of the flow cell and/or on each functionalized layer pad. In these examples, primer sets can be controlled such that their cleavage (linearization) chemistries are orthogonal in different regions. In these examples, orthogonal cleavage chemistries may be implemented through the same cleavage site attached to different sets of different primers, or through different cleavage sites attached to different sets of different primers. This allows clusters of forward strands to be generated in one region and clusters of reverse strands to be generated in another region. In one example, the regions are directly adjacent to each other. In another example, the arbitrary space between regions is small enough that the clustering can span two regions. In any of these examples, the forward and reverse strands are spatially separated to separate the fluorescence signal from the two reads while allowing simultaneous base calling of each read. Several example methods for creating such flow cells are described.

Justice

Terms used herein should be understood to have their ordinary meaning in the relevant technical field, unless otherwise specified. Some terms used herein and their meanings are explained below.

The singular forms (“a”, “an” and “the”) include plural referents unless the context clearly dictates otherwise.

The terms comprising, including, containing and the various forms of these terms are synonymous with each other and have an equally broad meaning.

The terms top, bottom, bottom, top, on, etc. are used herein to describe the flow cell and/or various components of the flow cell. It should be understood that these directional terms are not intended to imply a specific orientation, but rather are used to designate the relative orientation between components. The use of directional terms should not be construed as limiting the examples disclosed herein to any particular orientation(s).

Terms such as first, second, etc. do not refer to a specific orientation or order, but are used to distinguish one component from another.

Ranges provided herein are to be understood to include the stated range and any values or subranges within the stated range as if such values or subranges were explicitly stated. For example, the range from about 400 nm to about 1 μm (1000 nm) includes individual values such as about 708 nm, about 945.5 nm, etc., as well as the explicitly stated limits of about 400 nm to about 1 μm, and about 425 nm. It should be interpreted to include subranges such as from about 825 nm to about 550 nm to about 940 nm. Additionally, when “about” and/or “substantially” are used to describe a value, it is meant to include slight differences (up to +/-10%) from the indicated value.

"Acrylamide monomer" has the structure It is a monomer having a or a monomer containing an acrylamide group. Examples of monomers containing acrylamide groups include azido acetamido pentyl acrylamide: and N-isopropylacrylamide: Includes. Other acrylamide monomers may be used.

As used herein, the term “activation” refers to the process of generating reactive groups on the surface of a base support or in the outermost layer of a multilayer structure. Activation can be achieved using silanization or plasma ashing. Although the figure does not depict a separate silanized layer or -OH group from plasma ashing, activation creates a silanized layer or -OH group at the surface of the activated support or layer, thereby covalently attaching the functionalized layer to the underlying support or layer. It should be understood as attaching to.

As used herein, an aldehyde is an organic compound containing a functional group with the structure -CHO, where the carbon atom contains a hydrogen and a carbonyl center (i.e., carbon double bonded to oxygen) that is also bonded to an R group, such as an alkyl or other side chain. . The general structure of an aldehyde is am.

As used herein, “alkyl” refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., does not contain double or triple bonds). Alkyl groups can have 1 to 20 carbon atoms. Exemplary alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. As an example, the designation “C1 to 4 alkyl” indicates that 1 to 4 carbon atoms are present in the alkyl chain, i.e., the alkyl chain can be methyl, ethyl, propyl, iso-propyl, n-butyl, isobutyl, sec-butyl. , and t-butyl.

As used herein, “alkenyl” refers to a straight or branched hydrocarbon chain containing one or more double bonds. Alkenyl groups can have 2 to 20 carbon atoms. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

As used herein, “alkyne” or “alkynyl” refers to a straight or branched hydrocarbon chain containing one or more triple bonds. Alkynyl groups can have 2 to 20 carbon atoms.

As used herein, “aryl” refers to an aromatic ring or ring system containing only carbon in the ring backbone (i.e., two or more fused rings that share two adjacent carbon atoms). When aryl is a ring system, all rings in the system are aromatic. Aryl groups can have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

As defined herein, an “amine” or “amino” functional group refers to the group -NR _a R _b where R _a and R _b are each independently hydrogen (e.g. ), C1 to 6 alkyl, C2 to 6 alkenyl, C2 to 6 alkynyl, C3 to 7 carbocyclyl, C6 to 10 aryl, 5 to 10 membered heteroaryl, and 5 to 10 membered heterocyclyl. do.

As used herein, the term “attached” refers to the state of two being joined, fastened, glued, connected or bound to each other, directly or indirectly. For example, the nucleic acid can be attached to the functionalized polymer by covalent or non-covalent bonds. Covalent bonds are characterized by sharing pairs of electrons between atoms. Noncovalent bonds are physical bonds that do not involve sharing of electron pairs and may include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

The “azide” or “azido” functional group refers to -N ₃ .

As used herein, “bonding region” refers to, for example, a spacer layer, a lid, another patterned structure, etc., or a combination thereof (e.g., a spacer layer and a lid, or a spacer layer and another patterned structure). Refers to an area of a patterned structure that can be bonded to another material. The bond formed in the bonding region may be a chemical bond (as described above) or a mechanical bond (eg, using a fastener, etc.).

As used herein, “carbocyclyl” refers to a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When the carbocyclyl is a ring system, two or more rings may be joined together in a fused, cross-linked, or spiro-linked form. Carbocyclyl can have any degree of saturation, provided that at least one ring of the ring system is non-aromatic. Thus, carbocyclyl includes cycloalkyl, cycloalkenyl, and cycloalkynyl. Carbocyclyl groups can have 3 to 20 carbon atoms. Examples of carbocyclyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4. ]Includes nonanil.

As used herein, the term “carboxylic acid” or “carboxyl” refers to -COOH.

As used herein, “cycloalkylene” refers to a fully saturated carbocyclyl ring or ring system that is attached to the remainder of the molecule through two points of attachment.

As used herein, “cycloalkenyl” or “cycloalkene” refers to a carbocyclyl ring or ring system having at least one double bond, wherein the rings of the ring system are not aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also, as used herein, “heterocycloalkenyl” or “heterocycloalkene” refers to a carbocyclyl ring or ring system having at least one heteroatom in the ring backbone, having at least one double bond, wherein the ring system The ring of is not aromatic.

As used herein, “cycloalkynyl” or “cycloalkyne” refers to a carbocyclyl ring or ring system having at least one triple bond, wherein none of the rings of the ring system are aromatic. One example is cyclooctyne. Another example is bicyclononine. Also, as used herein, “heterocycloalkynyl” or “heterocycloalkyne” refers to a carbocyclyl ring or ring system having at least one heteroatom in the ring backbone and having at least one triple bond, wherein the ring The rings of the system are not aromatic.

As used herein, the term “deposition” refers to any suitable application technique, which may be manual or automatic, and in some cases results in modification of surface properties. Generally, deposition can be performed using deposition techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating. through coating), aerosol printing, screen printing, micro contact printing, inkjet printing, etc.

As used herein, the term "recess" means a discrete recess in one layer of the base support or multilayer stack having a surface opening that is at least partially surrounded by interstitial region(s) of one layer of the base support or multilayer stack. Refers to a feature. The depressions may have any of a variety of shapes in the opening of the surface, including, for example, circular, oval, square, polygonal, stellate (with any number of vertices), etc. The cross section of the depression orthogonal to the surface may be curved, square, polygonal, hyperbolic, conical, prismatic, etc. By way of example, the depression may be a well or two interconnected wells. The depressions may also have more complex structures such as ridges, step features, etc.

The term "each", when used in connection with a set of items, is intended to identify individual items within the set, but does not necessarily refer to all items within the set. Exceptions may occur if explicit disclosure or context clearly dictates otherwise.

As used herein, the term “epoxy” (also referred to as a glycidyl or oxirane group) refers to or refers to

As used herein, the term “flow cell” refers to a vessel having a flow channel in which a reaction can be performed, an inlet for delivering reagent(s) to the flow channel, and an outlet for removing the reagent(s) from the flow channel. I want to mean it. In some examples, the flow cell accommodates detection of a reaction occurring in the flow cell. For example, a flow cell can include one or more transparent surfaces that allow optical detection of arrays, optically labeled molecules, etc.

As used herein, a “flow channel” or “channel” may be a defined area between two coupled components that can selectively receive a liquid sample. In some examples, a flow channel may be defined between two patterned structures and thus may be in fluid communication with the surface chemistry of the patterned structures. In another example, a flow channel may be defined between the patterned structure and the lead, and thus may be in fluid communication with the surface chemistry of the patterned structure.

As used herein, “functionalization layer” or “functionalization layer pad” refers to a gel material applied over at least a portion of a flow cell substrate. The gel material contains functional group(s) that can be attached to the primer(s). The functionalization layer can be located within a portion of the depression defined in the substrate. The functionalized layer pad sits on a substantially flat substrate surface and thus appears as a protrusion. The term "functionalized layer" also refers to a gel material applied over all or part of a substrate and exposed to further processing to define the functionalized layer in a portion of a depression or to define a pad of the functionalized layer on a substantially flat substrate surface. refers to

As used herein, “heteroaryl” refers to an aromatic ring or ring system (i.e., an aromatic ring or ring system containing one or more heteroatoms in the ring backbone, i.e., elements other than carbon, including but not limited to nitrogen, oxygen, and sulfur) (i.e., two adjacent atoms) refers to two or more fused rings that share . When heteroaryl is a ring system, all rings in the system are aromatic. Heteroaryl groups can have 5 to 18 ring members.

As used herein, “heterocyclyl” refers to a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. Heterocyclyls can be joined together in fused, cross-linked or spiro-linked forms. Heterocyclyl can have any degree of saturation, provided that at least one ring of the ring system is non-aromatic. In a ring system, the heteroatom(s) may be present in a non-aromatic ring or an aromatic ring. Heterocyclyl groups can have from 3 to 20 ring members (i.e., the number of atoms that make up the ring skeleton, including carbon atoms and heteroatoms). In some examples, the heteroatom(s) is O, N, or S.

As used herein, the term “hydrazine” or “hydrazinyl” refers to the group -NHNH ₂ .

기를 지칭하며, 상기 식에서 본원에 정의된 바와 같은 R_a 및 R_b는 각각 독립적으로 수소, C1 내지 6 알킬, C2 내지 6 알케닐, C2 내지 6 알키닐, C3 내지 7 카르보시클릴, C6 내지 10 아릴, 5원 내지 10원 헤테로아릴, 및 5원 내지 10원 헤테로시클릴로부터 선택된다.As used herein, the term “hydrazone” or “hydrazonyl” refers to

refers to a group in which R _a and R _b as defined herein are each independently hydrogen, C1 to 6 alkyl, C2 to 6 alkenyl, C2 to 6 alkynyl, C3 to 7 carbocyclyl, C6 to 10 is selected from aryl, 5- to 10-membered heteroaryl, and 5- to 10-membered heterocyclyl.

As used herein, “hydroxy” or “hydroxyl” refers to the group -OH.

As used herein, the term “interstitial region” refers to, for example, a depression or region of the base support or layers of a multilayer stack that separates the functionalized layer pads. For example, a gap region may separate one depression in the array from another depression in the array. The two depressions separated from each other may be distinct, i.e. lacking physical contact with each other. In many instances, the interstitial region is continuous, whereas the depressions or pads are discrete, such as in the case of a plurality of depressions or pads defined on an otherwise continuous surface. In other examples, the gap regions and features are separate, such as in the case of a plurality of depressions in the form of trenches separated by each gap region. The separation provided by the gap region may be partial separation or complete separation. The interstitial regions may have a different surface material than the surface material of the depressions. For example, the depressions may have polymer and primer set(s) therein, and the interstitial regions may not have polymer and primer set(s).

As used herein, the term “photosensitive material” refers to a photoresist or other ultraviolet light-curable resin.

As used herein, “negative photoresist” refers to a photosensitive material whose portions exposed to light of a particular wavelength(s) become insoluble in a developer. In this example, the insoluble negative photoresist has a solubility of less than 5% in the developer. With negative photoresists, light exposure changes the chemical structure so that the exposed portions of the material become less soluble in the developer (than the unexposed portions). Although not soluble in the developer, an insoluble negative photoresist may be at least 99% soluble in a remover that is different from the developer. The remover may be, for example, a solvent or solvent mixture used in the lift-off process.

In contrast to an insoluble negative photoresist, any portion of the negative photoresist that is not exposed to light is at least 95% soluble in the developer. In some examples, the portion of the negative photoresist that is not exposed to light is at least 98% soluble in the developer, such as 99%, 99.5%, 100% soluble.

As used herein, "nitrile oxide" refers to the group "R _a C≡N ⁺ O ^- ", wherein R _a is defined herein. Examples of nitrile oxide preparations include in situ from aldoxime by treatment with chloramide-T or through the action of a base on imidoyl chloride [RC(Cl)=NOH] or from the reaction between hydroxylamine and aldehyde. Includes creation.

As used herein, “nitrone” means group, wherein R ¹ , R ² , and R ³ may be any of the R _a and R _b groups defined herein, except that R ³ is not hydrogen (H).

As used herein, “nucleotide” includes a nitrogen-containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are the monomeric units of nucleic acid sequences. In RNA, the sugar is ribose, and in DNA, the sugar is deoxyribose, a sugar lacking the hydroxyl group present at the 2' position of the ribose. The nitrogen-containing heterocyclic base (i.e., nucleobase) can be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G), and modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), and modified derivatives or analogs thereof. The C-1 atom of deoxyribose is bonded to N-1 of pyrimidine or N-9 of purine. Nucleic acid analogs may be those in which any of the phosphate backbones, sugars, or nucleobases have been altered. Examples of nucleic acid analogs include, for example, universal base or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNAs).

In some examples, the term “on” can mean that one component or material is positioned directly on another component or material. When one touches directly on top of the other, the two touch each other. In Figure 1E, the resin layer 18, 18' is applied over the base support 17, 17' such that it is in direct contact on the base support 17, 17'.

In another example, the term “on” can mean that one component or material is positioned indirectly on another component or material. “Indirectly on” means that a gap or additional component or material may be positioned between two components or materials. In Figure 1e, the functionalized layers 24, 26 are positioned on the base supports 17, 17' so that the two are in indirect contact. Resin layers 18 and 18' are located between them.

“Patterned resin” refers to any polymer that can have defined depressions therein. In some examples disclosed herein, the patterned resin may have portions that absorb ultraviolet light and other portions that transmit ultraviolet light, in part depending on its thickness. Specific examples of resins and techniques for patterning resins will be further described below.

“Patterned structure” refers to a single layer base support, or a multilayer stack having a layer having a surface chemical structure located, for example in depressions, otherwise on the support or layer surface. The surface chemistry may include functionalization layers and primers (e.g., used for library template capture and amplification). In some examples, layers of a single layer base support or multilayer stack have been exposed to a patterning technique (e.g., etching, lithography, etc.) to create a pattern for the surface chemistry. However, the term “patterned structure” is not intended to imply that such patterning techniques should be used to create the pattern. For example, the base support can be a substantially flat surface with a pattern of functionalized layers thereon. Patterned structures can be created via any of the methods disclosed herein.

As used herein, the term “polyhedral oligomeric silsesquioxane” refers to a chemical composition that is a hybrid intermediate between silica (SiO ₂ ) and silicon (R ₂ SiO) (eg, RSiO _1.5 ). Examples of polyhedral oligomeric silsesquioxanes are described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-778]. In one example, the composition is an organosilicon compound having the formula [RSiO _3/2 ] _n , where the R groups can be the same or different. Exemplary R groups for POSS include epoxy, azide/azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate, and/or methacrylate, or further, for example, alkyl , aryl, alkoxy, and/or haloalkyl groups.

As used herein, “positive photoresist” refers to a photosensitive material whose portions exposed to light of a specific wavelength(s) become soluble in a developer. In this example, any portion of the positive photoresist exposed to light is at least 95% soluble in the developer. In some examples, the portion of positive photoresist exposed to light is at least 98% soluble in the developer, such as 99%, 99.5%, 100% soluble. With positive photoresists, light exposure changes the chemical structure, making the exposed portions of the material more soluble in the developer (than the unexposed portions).

In contrast to soluble positive photoresist, any portion of positive photoresist that is not exposed to light is insoluble (less than 5% soluble) in the developer. Although not soluble in the developer, an insoluble positive photoresist may be at least 99% soluble in a remover that is different from the developer. In some examples, the insoluble positive photoresist is at least 98% soluble in the remover, such as 99%, 99.5%, 100% soluble. The remover may be a solvent or solvent mixture used in the lift off process.

As used herein, “primer” is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers, referred to herein as amplification primers, serve as starting points for template amplification and cluster generation. Other primers, referred to herein as sequencing primers, serve as starting points for DNA synthesis. The 5' end of the primer may be modified to allow a coupling reaction with a functional group of the polymer. Primer length can be any number of bases long and can include a variety of non-natural nucleotides. In one example, sequencing primers are short strands ranging from 10 to 60 bases, or 20 to 40 bases.

As used herein, “spacer layer” refers to a material that joins two components together. In some examples, the spacer layer may be a radiation-absorbing material that aids in bonding, or may be in contact with a radiation-absorbing material that aids in bonding.

The term “substrate” refers to a single layer base support or multilayer structure onto which the surface chemistry is introduced. In an example of using a metal film for patterning, a multilayer structure or a single layer base support can be used to pattern a photoresist and be transparent to ultraviolet light used for nucleic acid sequencing. In an example of how to change the thickness of a resin layer for patterning, the resin layer (which may be one layer in a multilayer structure or a single layer base support) transmits ultraviolet light in thinner portions and ultraviolet light in thicker portions. Can absorb light. When a resin layer is used in a multilayer structure, the other layer(s) of the multilayer structure are used to pattern the photoresist and can transmit ultraviolet light used for nucleic acid sequencing.

The term “tantalum pentoxide” refers to an inorganic compound having the formula Ta ₂ O ₅ . These compounds are transparent with a transmittance ranging from about 0.25 (25%) to 1 (100%) for wavelengths ranging from about 0.35 μm (350 nm) to at least 1.8 μm (1800 nm). The “tantalum pentoxide base support” or “tantalum pentoxide layer” may comprise, consist essentially of, or consist of Ta ₂ O ₅ . In instances where it is desirable for the tantalum pentoxide base support or the tantalum pentoxide layer to be transparent to electromagnetic energy having any of these wavelengths, the base support or layer may consist of Ta ₂ O ₅ or Ta ₂ O ₅ and the base support. or it may comprise or consist essentially of other components that will not interfere with the desired transmittance of the layer.

The “thiol” functional group refers to -SH.

As used herein, the terms “tetrazine” and “tetrazinyl” refer to a 6-membered heteroaryl group containing 4 nitrogen atoms. Tetrazine may be optionally substituted.

As used herein, “tetrazole” refers to a 5-membered heterocyclic group containing 4 nitrogen atoms. Tetrazoles may be optionally substituted.

The term “transparent” refers to a material, for example in the form of a base support or layer, that is capable of transmitting certain wavelengths or ranges of wavelengths. For example, the material may be transparent to the wavelength(s) used to chemically change the photoresist to positive or negative. Transparency can be quantified using transmittance, i.e., the ratio of light energy incident on the body to light energy transmitted through the body. The transmittance of a transparent base support or transparent layer will depend on the thickness of the base support or layer, the wavelength of light, and the dose of light to which it is exposed. In embodiments disclosed herein, the transmittance of the transparent base support or transparent layer may range from 0.25 (25%) to 1 (100%). The material of the base support or layer may be a pure material, a material with some impurities, or a mixture of materials, as long as the resulting base support or layer can have the desired transmittance. Additionally, depending on the transmittance of the base support or layer, the light exposure time and/or output of the light source can be adjusted to achieve the desired effect (e.g., creating a soluble or insoluble photoresist). It can be increased or decreased to deliver an appropriate dose of light energy.

flow cell

An example of a flow cell for sequential paired-end sequencing generally includes a patterned structure, comprising: a substrate; a functionalized layer on at least a portion of the substrate; and a primer set comprising two different primers attached to the functionalization layer. An example of a flow cell for simultaneous paired-end sequencing generally includes a patterned structure, comprising: a substrate; two functionalized layers on at least a portion of the substrate; and different sets of primers attached to the two functionalization layers.

An example of flow cell 10 is shown in top view in FIG. 1A. Flow cell 10 may include two patterned structures bonded to each other or one patterned structure bonded to a lead. There is a flow channel 12 between the two patterned structures or one patterned structure and the lead. The example shown in FIG. 1A includes eight flow channels 12. Although eight flow channels 12 are shown, any number of flow channels 12 may be included in the flow cell 10 (e.g., a single flow channel 12, four flow channels 12). ), etc.) must be understood. Each flow channel 12 may be isolated from the other flow channels 12 so that fluid introduced into the flow channel 12 does not flow into the adjacent flow channel(s) 12. Some examples of fluids introduced into flow channel 12 may include reaction components (e.g., DNA samples, polymerases, sequencing primers, nucleotides, etc.), washing solutions, deblocking agents, etc.

Each flow cell 12 is in fluid communication with an inlet and an outlet (not shown). The inlet and outlet of each flow channel 12 may be located at opposite ends of the flow cell. The inlet and outlet of each flow channel 12 may alternatively be located anywhere along the length and depth of the flow channel 12 to enable desired fluid flow.

The inlet allows fluid to flow into the flow channel 12, and the outlet allows fluid to be extracted from the flow channel 12. Each inlet and outlet is fluidly connected to a fluid control system (including, for example, reservoirs, pumps, valves, waste containers, etc.) that controls fluid introduction and discharge.

Flow channel 12 is defined at least partially by a patterned structure. The patterned structure may be a single layer base support 14 or 14' (as shown in Figures 1B, 1C, and 1D), or a multilayer structure 16, 16' (as shown in Figure 1E). It may include a substrate such as.

In an example of a method using a metal film (see reference number 48 in Figure 1D) for patterning, the single layer base support 14 is exposed to the light (e.g., ultraviolet light) used to pattern the photoresist and nucleic acid sequencing. It can be any material that can transmit light (eg, ultraviolet light and visible light) used in. In these specific examples, suitable materials include siloxanes, glasses, modified or functionalized glasses, plastics (acrylic, polystyrene, copolymers of styrene and other materials, polyethylene terephthalate (PET), polycarbonates, cyclic olefin copolymers). (COC), including some polyamides), silica or silicon oxide (e.g., SiO ₂ ), fused silica, silica-based materials, silicon nitride (Si ₃ N ₄ ), inorganic glasses, resins, etc. Examples of resins capable of transmitting UV light include inorganic oxides such as tantalum pentoxide (e.g. Ta ₂ O ₅ ) or other tantalum oxide(s) (TaO _x ), aluminum oxide (e.g. Al ₂ O ₃ ), silicon oxide (e.g. SiO ₂ ), hafnium oxide (e.g. HfO ₂ ), indium tin oxide, titanium dioxide, etc. or polymeric resins such as polyhedral oligomeric silsesquioxane based Resins (e.g., POSS® from Hybrid Plastics), non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxies), acrylic resins, acrylate resins , methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof. In some examples, the resin used has a UV transmission (at the given UV dose employed), which ranges from about 0.5 to about 1, such as from about 0.75 to about 1, from about 0.9 to about 0.99. The thickness of the resin used with the metal film can be adjusted so that the overall resin exhibits the desired UV transmission for the UV dose used. In some cases, the resin thickness is 150 nm or less.

In an example of a method using a metal film for patterning, the multilayer structure 16 may include a base support 17 and a resin layer 18 on the base support 17. In this example, any material for the single layer base support 14 may be used as the base support 17, and any resin for the single layer base support 14 may be used for the resin layer 18. .

In an example of a method of varying the thickness of a resin layer for patterning, the single layer base support 14' can be any resin material whose UV absorbance when exposed to a particular UV light dose can be varied by adjusting the thickness. . Any of the previously listed resins can be used as long as the thicker portions absorb the UV light when the resin is exposed to a given dose of UV light and the thinner portions transmit the desired amount of UV light for patterning. . In one example, a polyhedral oligomeric silsesquioxane-based resin having a thicker portion of about 500 nm and a thinner portion of about 150 nm is exposed to a dose ranging from about 30 mJ/cm ² to about 60 mJ/cm ² In this case, UV light will be effectively absorbed and transmitted respectively. Different thicknesses can be used and the UV dose can be adjusted accordingly to achieve the desired absorption in thicker regions and transmission in thinner regions.

In an example of how to vary the resin layer thickness for patterning, the multilayer structure 16' can include a base support 17' and a resin layer 18' on the base support 17' (FIG. 1E). . In this example, any material described herein suitable for use as a single layer base support 14 can be used as the base support 17', and any material described herein suitable for use as a single layer base support 14' can be used as a single layer base support 14'. Any of the resins described may be used for the resin layer 18'. In this example, the thick and thin portions of the resin layer 18' are adjusted to achieve the desired absorption and transmission.

The correlation between UV dose, UV absorption constant, and resin layer thickness can be expressed as:

In the above equation, D ₀ is the UV dose required to pattern the resin layer, D is the actual UV dose that must be applied to the resin, k is the absorption constant, and d is the thickness of the thinner portion of the resin. Therefore, the actual UV dose (D) can be expressed as:

In one example, the single layer base support 14' or resin layer 18' is negative photoresist NR9-1000P (from Futurrex), with D ₀ = 19 mJ/cm ² at 0.9 μm thickness, and the UV of the photoresist. The absorption constant (k) is 3x10 ⁴ cm ^-1 , the thickness of the thinner part of the photoresist is 150 nm, and D is about 30 mJ/cm ² .

In some examples described herein, the single layer base support 14, 14' or resin layer 18, 18' is patterned with depressions 20, 20'.

Some exemplary materials (e.g., inorganic oxides) may optionally be applied via vapor deposition, aerosol printing, or inkjet printing, and depressions 20, 20' may be formed during these processes. Other exemplary materials, such as polymeric resins, may be patterned after application to form depressions 20, 20'. For example, polymeric resins use suitable techniques such as chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, and microcontact printing. So you can calm down. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, etc.

The single layer base support 14, 14' or base support 17, 17' is a circular sheet, panel having a diameter in the range of about 2 mm to about 300 mm, for example in the range of about 200 mm to about 300 mm. , wafers, dies, etc., or may be rectangular sheets, panels, wafers, dies, etc., with a maximum dimension of up to about 10 feet (about 3 meters). As an example, the die may have a depth ranging from about 0.1 mm to about 10 mm. Although exemplary dimensions have been provided, it should be understood that the single layer base supports 14, 14' or base supports 17, 17' may have any suitable dimensions.

In one example, flow channel 12 has a substantially rectangular configuration (eg, with curved ends as shown in Figure 1A). The length and depth of the flow channel 12 are such that a portion of the single layer base support 14, 14' or a resin layer 18, 18' of a multi-layer structure 16, 16' surrounds and leads the flow channel 12. (not shown) or may be selected for use in attachment to other patterned structures.

The depth of the flow channel 12 can be as shallow as the monolayer thickness when microcontact, aerosol, or inkjet printing is used to deposit a separate material defining the walls of the flow channel 12. In other examples, the depth of flow channel 12 may be greater than about 1 μm, about 10 μm, about 50 μm, about 100 μm. In one example, the depth may range from about 10 μm to about 100 μm. In another example, the depth may range from about 10 μm to about 30 μm. In another example, the depth is about 5 μm or less. It should be understood that the depth of flow channel 12 may be greater, less, or in between than the values specified above.

1B, 1C, 1D, and 1E show examples of structures within flow channel 12. As shown in Figure 1B, the structure includes depressions 20 of equal depth separated by gap regions 22. In this example, a functionalization layer 24 is formed in each depression 20. As shown in Figure 1c, the structure comprises depressions 20 of different depths D ₁ , D ₂ separated by gap regions 22 . In this example, functionalization layers 24, 26 are formed in different depressions 20. A functionalized layer pad 28 is also formed on the surface of the single layer base support 14'. As shown in Figure 1D, the structure includes a plurality of functionalized layer pads 28 separated by gap regions 22' across a substantially flat surface on a single layer base support 14. As shown in Figure 1E, the structure consists of a multi-depth depression 20' separated by a gap region 22 and a functionalized layer 24 formed on different surfaces of the multi-depth depression 20'. , 26). In another example, resinous material protrusions may be formed in depressions 20 and functionalization layer 24 may be formed over these resinous material protrusions. An example of this is shown in Figure 6e.

A number of different layouts of functionalized layer pad 28 and depressions 20, 20' can be envisioned, including regular, repeating, and irregular patterns. In one example, the functionalized layer pads 28 and/or depressions 20, 20' are arranged in a hexagonal grid for close packing and improved density. Other layouts may include, for example, a straight (rectangular) layout, a triangular layout, etc. In some examples, the layout or pattern may be in an x-y format of rows and columns. In some other examples, the layout or pattern may be a repeating arrangement of functionalized layer pads 28 and/or depressions 20, 20' and interstitial regions 22, 22'. In another example, the layout or pattern may be a random arrangement of functionalized layer pads 28 and/or depressions 20, 20' and interstitial regions 22, 22'.

The layout or pattern may be characterized in terms of the density (number) of defined areas of functionalized layer pads 28 and/or depressions 20, 20'. For example, the functionalized layer pad 28 and/or depressions 20, 20' may be present at a density of approximately 2 million per mm ² . Densities are, for example, about 100/mm ² , about 1,000/mm ² , about 100,000/mm ² , about 1 million/mm ² , about 2 million/mm ² , about 5 million/mm ² , about 10 million/mm ² , can be adjusted to different densities including about 50 million/mm ² or more, or less. It should be further understood that the density may be between one of the lower values and one of the upper values selected from the range above, or that other densities (outside the range presented) may be used. By way of example, a high density array may be characterized as having functionalized layer pads 28 and/or depressions 20, 20' separated by less than about 100 nm, and a medium density array may be characterized by having functionalized layer pads 28 and/or depressions 20, 20' separated by less than about 100 nm. may be characterized as having functionalized layer pads 30 and/or depressions 20, 20' separated by 1 μm, with the low density array having functionalized layer pads 28 separated by greater than about 1 μm. ) and/or may be characterized by having recesses (20, 20').

The layout or pattern of the functionalized layer pad 28 and/or depressions 20, 20' may also or alternatively be adjusted to an average pitch, or the functionalized layer pad 28 and/or depressions 20, 20'. the distance from the center of an adjacent set of functionalized layer pads 28 and/or depressions 20, 20' (center-to-center spacing) or functionalized layer pads 28 and/or depressions 20, 20') to the left edge of an adjacent set of functionalized layer pads 28 and/or depressions 20, 20' (edge-to-edge spacing). The pattern may be regular, in which case the coefficient of variation around the average pitch may be small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In any case, the average pitch may be, for example, about 50 nm, about 0.15 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm or more, or less. The average pitch for a particular pattern may be between one of the lower values and one of the upper values selected from the above range. In one example, depressions 20 have a pitch (center-to-center) of approximately 1.5 μm. Although exemplary average pitch values have been provided, it should be understood that other average pitch values may be used.

The size of each depression 20, 20 may be characterized by its volume, opening area, depth, and/or diameter or length and depth. For example, the volume may range from about 1× ^10-3 μm ³ to about 100 μm ³ , such as about 1× ^10-2 μm ³ , about 0.1 μm ³ , about 1 μm ³ , about 10 μm ³ , or It may be more or less than that. For other examples, the opening area ranges from about 1× ^10-3 μm ² to about 100 μm ² , for example about 1× ^10-2 μm ² , about 0.1 μm ² , about 1 μm ² , or at least about 10 μm ^{2 .} , or more, or less. For another example, the depth may range from about 0.1 μm to about 100 μm, for example about 0.5 μm, about 1 μm, about 10 μm, or more, or less. For other examples, the depth may range from about 0.1 μm to about 100 μm, for example about 0.5 μm, about 1 μm, about 10 μm, or more, or less. For another example, the diameter or length and depth may each range from about 0.1 μm to about 100 μm, for example about 0.5 μm, about 1 μm, about 10 μm, or more, or less.

The size of each functionalized layer pad 28 may be characterized by its top surface area, height, and/or diameter or length and depth. In one example, the top surface area ranges from about 1× ^10-3 μm ² to about 100 μm ² , for example about 1× ^10-2 μm ² , about 0.1 μm ² , about 1 μm ² , at least about 10 μm ² , or more, or less. For another example, the height may range from about 0.1 μm to about 100 μm, for example about 0.5 μm, about 1 μm, about 10 μm, or more, or less. For another example, the diameter or length and depth may each range from about 0.1 μm to about 100 μm, for example about 0.5 μm, about 1 μm, about 10 μm, or more, or less.

Each of the structures also includes a functionalized layer (24, 26) and/or a functionalized layer pad (28). In each example, functionalization layer 24, 26 or functionalization layer pad 28 represents a region with a set of primers attached thereto. Some examples of primer sets (29) (Figures 1B, 1C, and 1D) include two different primers (31, 33) used for sequential paired-end sequencing. Other examples include different primer sets (30, 32) used in simultaneous paired-end sequencing (Figure 1e).

In some examples disclosed herein, the functionalized layer 24, 26 and/or the functionalized layer pad 28 are chemically identical and primer sets 29 or 30, 32 can be prepared using any of the techniques disclosed herein. may be secured to the desired layer 24, 26, and/or pad 28. In other examples disclosed herein, the functionalized layer 24, 26 and/or functionalized layer pad 28 are chemically different. (e.g., each primer set 29 or 30, 32 includes a different functional group for attachment), and primer sets 29 or 30, 32 are used in each layer (e.g., 29 or 30, 32) using any of the techniques disclosed herein. 24, 26) and/or pad 28. In other examples disclosed herein, the material applied to form functionalized layer 24, 26 or functionalized layer pad 28 is pre-grafted. Each may have a set of primers 29 or 30, 32, and thus the immobilization chemistry of the functionalization layer 24, 26 or the functionalization layer pad 28 may be the same or different.

In some examples, the functionalized layers 24, 26 or the functionalized layer pad 28 are any gel material that can swell when liquid is absorbed and shrink when the liquid is removed, for example, by drying. It can be. In one example, the gel material is a polymeric hydrogel. In one example, the polymeric hydrogel includes an acrylamide copolymer. Some examples of acrylamide copolymers are represented by the structural formula (I):

In the above equation:

R ^A is azido, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted selected from the group consisting of tetrazoles, optionally substituted tetrazines, nitrile oxides, nitrones, sulfates and thiols;

R ^B is H or optionally substituted alkyl;

R ^C , R ^D and R ^E are each independently selected from the group consisting of H and optionally substituted alkyl;

Each -(CH ₂ ) _p - may be optionally substituted;

p is an integer ranging from 1 to 50;

n is an integer ranging from 1 to 50,000;

m is an integer ranging from 1 to 100,000.

One specific example of an acrylamide copolymer represented by structural formula (I) is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, PAZAM.

Those skilled in the art will recognize that the arrangement of repeated "n" and "m" features in structural formula (I) is representative, and that the monomeric subunits can be arranged in any order in the polymer structure (e.g., random, block, patterned, or combinations thereof). You will know that it can exist.

The molecular weight of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa, or from about 10 kDa to about 1000 kDa, or in certain instances, about 312 kDa.

In some examples, the acrylamide copolymer is a linear polymer. In some other examples, the acrylamide copolymer is a weakly crosslinked polymer.

In another example, the gel material may be a variant of structural formula (I). In one example, the acrylamide unit is N,N-dimethylacrylamide ( ) can be replaced with. In this example, the acrylamide unit of structural formula (I) is may be substituted with, wherein R ^D , R ^E and R ^F are each H or C1 to C6 alkyl, and R ^G and R ^H are each C1 to C6 alkyl (instead of H as in the case of acrylamide). In this example, q can be an integer ranging from 1 to 100,000. In another example, in addition to acrylamide units, N,N-dimethylacrylamide may be used. In this example, structural formula (I) contains, in addition to the repeating "n" and "m" features may include, wherein R ^D , R ^E and R ^F are each H or C1 to C6 alkyl, and R ^G and R ^H are each C1 to C6 alkyl. In this example, q can be an integer ranging from 1 to 100,000.

As another example of a polymeric hydrogel, the repeating "n" feature of structure (I) can be replaced with a monomer comprising a heterocyclic azido group having structure (II):

In the above formula, R ¹ is H or C1 to C6 alkyl; R ₂ is H or C1 to C6 alkyl; L is a linker comprising a linear chain having 2 to 20 atoms selected from the group consisting of carbon, oxygen and nitrogen and 10 optional substituents on carbon and any nitrogen atom in the chain; E is a linear chain comprising 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen, and optional substituents on carbon and any nitrogen atoms in the chain; A is an N substituted amide with H or C1 to C4 alkyl attached to N; Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 carbon containing ring members that exist as single cyclic structures or fused structures. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl. As another example, the gel material may include repeating units of each of the following structural formulas (III) and (IV):

and

wherein R ^1a , R ^2a , R ^1b and R ^2b are each independently selected from hydrogen, optionally substituted alkyl, or optionally substituted phenyl; R ^3a and R ^3b are each independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl or optionally substituted C7 to C14 aralkyl; Each of L ¹ and L ² is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

In another example, an acrylamide copolymer is formed using nitroxide mediated polymerization, such that at least some of the copolymer chains have alkoxyamine end groups. In a copolymer chain, the term "alkoxyamine end group" refers to the dormant species -ONR ₁ R ₂ , where each R ₁ and R ₂ may be the same or different and independently represent linear or branched alkyl, or It may be a ring structure, and the oxygen atom is attached to the remainder of the copolymer chain. In some instances, an alkoxyamine may also be introduced into some of the repeating acrylamide monomers, for example at position R ^A in structural formula (I). As such, in one example, structural formula (I) includes an alkoxyamine end group; In another example, structural formula (I) includes an alkoxyamine end group and an alkoxyamine group in at least some of the side chains.

Other molecules, e.g., primer set(s) 29, or 30, 32, may be added to the functionalized layer 24, 26 and/or functionalized layer pad 28, as long as they can be functionalized with the desired chemical. It should be understood that it can be used to form . Some examples of suitable materials for functionalized layers 24, 26 and/or functionalized layer pad 28 include functionalized silanes, such as norbornene silanes, azido silanes, alkyne functionalized silanes, amine functionalized silanes. silanes, maleimide silanes, or any other silanes each having a functional group capable of attaching the desired chemical substance. Further examples of materials suitable for the functionalization layer 24, 26 and/or the functionalization layer pad 28 include those having a colloidal structure, such as agarose; or polymeric mesh structures such as gelatin; or crosslinked polymer structures, such as polyacrylamide polymers and copolymers, silane-free acrylamides (SFA) or azidolyzed versions of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid, or from acrylic acid containing vinyl groups, or from monomers that form a [2+2] photoglycary addition reaction. Another example of suitable materials for the functionalized layer 24, 26 and/or the functionalized layer pad 28 includes mixed copolymers of acrylamide and acrylate. A variety of polymer structures containing acrylic monomers (e.g., acrylamides, acrylates, etc.), such as branched polymers, including dendrimers (e.g., multi-arm or star polymers), star-shaped or star-block polymers, etc. Polymers can be used in the examples disclosed herein. For example, monomers (eg, acrylamide, acrylamide containing catalyst, etc.) can be incorporated randomly or in blocks into the branches (arms) of the dendrimer.

The gel material for the functionalized layer 24, 26 and/or the functionalized layer pad 28 can be prepared by any suitable copolymerization process, such as nitroxide mediated polymerization (NMP), reversible addition-fragmentation chain transfer (RAFT) polymerization, etc. It can be formed using

Attachment of the functionalized layer 24, 26 and/or the functionalized layer pad 28 to the underlying base support 14, 14' or resin layer 18, 18' may be via covalent bonds. In some cases, the underlying base support 14, 14' or resin layer 18, 18' may be activated first, for example through silanization or plasma ashing. Covalent bonding helps maintain the primer set(s) 29 or 30, 32 in the desired region over the life of the flow cell 10 during various uses.

Each of the structures also includes a primer set(s) 29 or 30, 32 attached to the respective functionalization layer 24, 26 and/or pad 28.

Primer set (29) includes two different primers (31, 33) used for sequential paired-end sequencing. By way of example, primer set 29 may include the P5 and P7 primers, P15 and P7 primers, or any combination of the PA primers, PB primers, PC primers, and PD primers set forth herein. By way of example, primer set 29 may be any combination of any two PA, PB, PC and PD primers, or one PA primer and one PB, PC or primer PD, or one PB primer and one PC. or any combination of primers PD, or any combination of one PC primer and one primer PD.

Examples of P5 and P7 primers can be found on the surface of commercial flow cells sold by Illumina Inc. for sequencing, such as HiSeq™, HiSeqX™, MiSeq™, MiSeqDX™, MiNISeq™, NextSeq™, NextSeqDX™, NovaSeq™, Used in iSEQ ^™ , Genome Analyzer™, and other instrument platforms. The P5 primers (denoted cleavable primers) are:

P5: 5' → 3'

AATGATACGGCGACCACCGAGAUCTACAC (SEQ ID NO: 1)

The P7 primer (denoted cleavable primer) may be any of the following:

P7 #1: 5' → 3'

CAAGCAGAAGACGGCATACGAnAT (SEQ ID NO: 2)

P7 #2: 5' → 3'

CAAGCAGAAGACGGCATACnAGAT (SEQ ID NO: 3)

where “n” is 8-oxoguanine or uracil in the respective sequence.

The P15 primers (denoted cleavable primers) are:

P15: 5' → 3'

AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 4)

where “n” is allyl-T.

Other primers mentioned above (PA-PD, denoted as non-cleavable primer) include:

PA 5' → 3'

GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ ID NO: 5)

cPA (PA') 5' → 3'

CTCAACGGATTAACGAAGCGTTCGGACGTGCCAGC (SEQ ID NO: 6)

PB 5' → 3'

CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ ID NO: 7)

cPB (PB') 5' → 3'

AGTTCATATCCACCGAAGCGCCATGGCAGACGACG (SEQ ID NO: 8)

PC 5' → 3'

ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ ID NO: 9)

cPC (PC') 5' → 3'

AGTTGCGGATTCGACGCGTTGATATTAGCGGCCGT (SEQ ID NO: 10)

PD 5' → 3'

GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ ID NO: 11)

cPD (PD') 5' → 3'

GCTGCATCGAATAGTCCGGCTAACGTAACGCGGC (SEQ ID NO: 12)

Although not indicated in the example sequence of PA-PD, it should be understood that any of these primers may contain cleavage sites such as uracil, 8-oxoguanine, allyl-T, etc., at any point in the strand. Furthermore, P5, P7, and P15 primers can be rendered non-cleavable by removing cleavage sites (e.g., uracil, 8-oxoguanine, allyl-T, etc.) from the strand.

Each of the primers disclosed herein may also include a polyT sequence at the 5' end of the primer sequence. In some examples, the polyT region includes between 2 T bases and 20 T bases. As specific examples, a polyT region may contain 3, 4, 5, 6, 7, or 10 T bases.

The 5' end of each primer may include a linker (e.g., 46, 46' described with reference to FIGS. 2B and 2D). Any linker comprising a terminal alkyne group or other suitable terminal functional group that can be attached to a surface functional group of the functionalized layer 24, 26 and/or the functionalized layer pad 28 may be used. In one example, the primer is hexynyl terminated.

Primer sets 30, 32 are related in that one set includes a first non-cleavable primer and a second cleavable primer, and the other set includes a first cleavable primer and a second non-cleavable primer. . These primer sets (30, 32) allow a single template strand to be amplified and clustered across both primer sets (30, 32) and also allow for the cleavage groups present in opposing primers of the set (30, 32) to separate adjacent functionalized layers. (24, 26) (e.g., as shown in Figure 1 e), allowing forward and reverse strands to be generated. Examples of such primer sets 30, 32 will be discussed with reference to FIGS. 2A-2D.

2A-2D show different configurations of primer sets 30A, 32A, 30B, 32B, 30C, 32C, and 30D, 32D attached to functionalization layers 24, 26.

Each of the first primer sets (30A, 30B, 30C, and 30D) includes a first non-cleavable primer (34 or 34') and a second cleavable primer (36 or 36'); Each of the second primer sets (32A, 32B, 32C, and 32D) includes a first cleavable primer (38 or 38') and a second non-cleavable primer (40 or 40').

The first non-cleavable primer (34 or 34') and the second cleavable primer (36 or 36') are an oligonucleotide pair, for example the first non-cleavable primer (34 or 34') is a forward amplification primer. , the cleavable second primer (36 or 36') is a reverse amplification primer, or the cleavable second primer (36 or 36') is a forward amplification primer, and the non-cleavable first primer (34 or 34') is a reverse amplification primer. It's a primer. In each example of the first primer set (30A, 30B, 30C, and 30D), the second cleavable primer (36 or 36') includes a cleavage site (42), while the first non-cleavable primer (34) or 34') does not include the cleavage site 42.

The first cleavable primer (38 or 38') and the second non-cleavable primer (40 or 40') are also an oligonucleotide pair, for example the first cleavable primer (38 or 38') is a forward amplification primer and , the non-cleavable second primer (40 or 40') is a reverse amplification primer, or the second non-cleavable primer (40 or 40') is a forward amplification primer, and the first cleavable primer (38 or 38') is a reverse amplification primer. It is an amplification primer. In each example of the second primer set (32A, 32B, 32C, and 32D), the first cleavable primer (38 or 38') includes a cleavage site (42' or 44), while the second non-cleavable primer (38 or 38') includes a cleavage site (42' or 44). Primer (40 or 40') does not include the cleavage site (42' or 44).

a non-cleavable first primer (34 or 34') of the first primer set (30A, 30B, 30C, and 30D) and a cleavable first primer (38) of the second primer set (32A, 32B, 32C, and 32D) or 38') is the same, except that the cleavable first primer (38 or 38') comprises a cleavage site (42' or 44) integrated into the nucleotide sequence or a linker (46') attached to the nucleotide sequence. It will be understood that both have nucleotide sequences (eg, both are forward amplification primers). Similarly, the second cleavable primer (36 or 36') of the first primer set (30A, 30B, 30C, and 30D) and the second non-cleavable primer (32A, 32B, 32C, and 32D) of the second primer set (32A, 32B, 32C, and 32D) Primer 40 or 40' has the same nucleotide sequence, except that the second cleavable primer 36 or 36' comprises a cleavage site 42 integrated into the nucleotide sequence or a linker 46 attached to the nucleotide sequence. sequence (e.g., both are reverse amplification primers).

It should be understood that if the first primer (34 and 38 or 34' and 38') is a forward amplification primer, the second primer (36 and 40 or 36' and 40') is a reverse primer, and vice versa.

Non-cleavable primers (34, 40 or 34', 40') are the P5 and P7 primers (each lacking a cleavage site) or any combination of the PA, PD, PC, PD primers (e.g., PA and PB or It can be any primer having a universal sequence for capture and/or amplification purposes, such as PA and PD, etc.). In some examples, the P5 and P7 primers are non-cleavable primers (34, 40 or 34', 40') because they do not contain the cleavage site (42, 42', 44). It should be understood that any suitable universal sequence may be used as the non-cleavable primer (34, 40 or 34', 40').

Examples of cleavable primers (36, 38 or 36', 38') refer to the respective nucleic acid sequences (e.g., Figures 2A and 2C) or cleavable primers (36, 38 or 36', 38'), respectively. P5 and P7 primers or other universal sequences with respective cleavage sites (42, 42', 44) incorporated into linkers (46', 46) (FIGS. 2B and 2D) that attach to functionalization layers (24, 26). Includes primers (e.g., PA, PB, PC, PD primers with cleavage sites). Examples of suitable cleavage sites 42, 42', 44 include enzymatically cleavable nucleobases or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., between nucleobases), as described herein. do.

Each primer set (30A and 32A or 30B and 32B or 30C and 32C or 30D and 32D) is attached to each functionalization layer (24, 26). As described herein, the functionalization layers 24, 26 comprise different functional groups that can selectively react with the respective primers 34, 36 or 34', 36' or 38, 40 or 38', 40'. Alternatively, they may contain identical functional groups and each primer (34, 36 or 34', 36' or 38, 40 or 38', 40') may be attached sequentially as described in some methods.

Although not shown in Figures 2A-2D, one or both of the primer sets (30A, 30B, 30C, 30D or 32A, 32B, 32C or 32D) may also include PX primers to capture the library template seeding molecules. It must be understood. As an example, PX may be included in primer set (30A, 30B, 30C, 30D) but not in primer set (32A, 32B, 32C or 32D). As another example, PX may be included in primer set (30A, 30B, 30C, 30D) and primer set (32A, 32B, 32C or 32D). The density of PX motifs should be relatively low to minimize polyclonality within each depression (20, 20').

PX capture primers may be:

PX 5' → 3'

AGGAGGAGGAGGAGGAGGAGGAGG (SEQ ID NO: 13)

cPX (PX') 5' → 3'

CCTCCTCCTCCTCCTCCTCCTCCT (SEQ ID NO: 14)

2A-2D show different configurations of primer sets 30A, 32A, 30B, 32B, 30C, 32C, and 30D, 32D attached to functionalization layers 24, 26. More specifically, Figures 2A-2D show different configurations of primers (34, 36 or 34', 36' and 38, 40 or 38', 40') that can be used.

In the example shown in Figure 2A, primers 34, 36 and 38, 40 of primer sets 30A and 32A are attached directly to the functionalization layer 24, 26, for example without linkers 46, 46'. . The functionalized layer 24 has surface functional groups capable of anchoring terminal groups at the 5' ends of the primers 34 and 36. Similarly, functionalization layer 26 has surface functional groups capable of anchoring terminal groups at the 5' ends of primers 38, 40. The immobilization chemical structure between the functionalized layer 24 and the primers 34, 36 and the immobilization chemical structure between the functionalized layer 26 and the primers 38, 40 are such that primers 34, 36 or 38, 40 are preferred. It can be different to selectively attach to the functionalization layers 24, 26. Alternatively, primers 34, 36 or 38, 40 may be pre-grafted or applied sequentially via some of the methods disclosed herein.

Additionally, in the example shown in Figure 2A, the cleavage sites 42 and 42' of each of the cleavable primers 36 and 38 are incorporated into the sequence of the primers. In this example, the same type of cleavage site 42, 42' is used for the cleavable primers 36, 38 of each primer set 30A, 32A. As an example, the cleavage site (42, 42') is a uracil base and the cleavable primers (36, 38) are P5U (SEQ ID NO: 1) and P7U (SEQ ID NO: 2 or 3). Uracil bases or other cleavage sites can also be incorporated into any of the PA, PB, PC, and PD primers to create cleavable primers (36, 38). In this example, the non-cleavable primer (34) of the oligonucleotide pair (34, 36) may be P7 (SEQ ID NO: 2 or 3 without n), and the non-cleavable primer (40) of the oligonucleotide pair (38, 40) may be P5 (SEQ ID NO: 1 without U). Accordingly, in this example, first primer set 30A includes P7, P5U and second primer set 32A includes P5, P7U. Primer sets 30A, 32A have opposite linearization chemistries, such that after amplification, cluster generation, and linearization, a forward template strand is formed on one functionalization layer 24, and a forward template strand is formed on the other functionalization layer 26. Allows reverse strands to form.

In the example shown in Figure 2B, primers 34', 36' and 38', 40' of primer sets 30B and 32B are coupled to the functionalized layers 24, 26, for example via linkers 46, 46'. ) is attached to. The functionalization layers 24 and 26 include respective functional groups, and the ends of each linker 46 and 46' can be covalently attached to the respective functional groups. As such, the functionalized layer 24 may have surface functional groups capable of anchoring the linker 46 to the 5' ends of the primers 34' and 36'. Similarly, functionalization layer 24 may have surface functionalities capable of anchoring linker 46' to the 5' ends of primers 38' and 40'. The immobilization chemistry for the functionalization layer 24 and the linker 46 and the immobilization chemistry for the functionalization layer 26 and the linker 46' are such that the primers 34, 36 or 38, 40 are the preferred functionalizations. The layers 24 and 26 may be different to allow selective attachment. Alternatively, primers 34, 36 or 38, 40 may be pre-grafted or applied sequentially via some of the methods disclosed herein.

Examples of suitable linkers 46, 46' include nucleic acid linkers (e.g., up to 10 nucleotides) or non-nucleic acid linkers such as polyethylene glycol chains, alkyl groups or carbon chains, aliphatic linkers with vicinal diols, peptide linkers, etc. may include. An example of a nucleic acid linker is a polyT spacer, but other nucleotides may also be used. In one example, the spacer is a 6T to 10T spacer. The following are some examples of nucleotides containing non-nucleic acid linkers with terminal alkyne groups (where B is the nucleobase and “oligo” is the primer):

In the example shown in Figure 2B, primers 34', 38' have the same sequence (e.g., P5 ) has. Primer 34' is non-cleavable, while primer 38' contains a cleavage site 42' incorporated into linker 46'. Also in this example, primers 36', 40' have identical sequences (e.g., P7) except for the cleavage site 42 and the presence or absence of the same or different linkers 46, 46'. Primer 40' is non-cleavable, and primer 36' contains a cleavage site 42 incorporated into linker 46. The same type of cleavage site (42, 42') is used in the linker (46, 46') of each of the cleavable primers (36', 38'). As an example, the cleavage site (42, 42') may be a uracil base incorporated into the nucleic acid linker (46, 46'). Primer sets 30B, 32B have opposite linearization chemistries, such that after amplification, cluster generation and linearization, a forward template strand is formed on one functionalized layer 24 and on the other functionalized layer 26. Allows reverse strands to form.

The example shown in Figure 2C is the example shown in Figure 2A, except that different types of cleavage sites 42, 44 are used for the cleavable primers 36, 38 of each primer set 30C, 32C. Similar to By way of example, two different enzymatic cleavage sites may be used, two different chemical cleavage sites may be used, or one enzymatic cleavage site and one chemical cleavage site may be used. Examples of different cleavage sites 42, 44 that can be used for each cleavable primer 36, 38 include any combination of the following: vicinal diol, uracil, allyl ether, disulfide, restriction enzyme site, and 8 -Oxoguanine.

The example shown in Figure 2D is in the linkers 46, 46' where different types of cleavage sites 42, 44 are attached to the cleavable primers 36', 38' of each primer set (30D, 32D). It is similar to the example shown in Figure 2b except that it is used. Examples of different cleavage sites 42, 44 that can be used in each linker 46, 46' attached to cleavable primers 36', 38' include any combination of the following: vicinal diol, uracil , allyl ether, disulfide, restriction enzyme site, and 8-oxoguanine.

In any example using primer set 29 or primer set 30, 32, primers 31, 33, or 34 are added to functionalized layer(s) 24, 26 and/or functionalized layer pad 28. , 36 and 38, 40 or 34', 36' and 38', 40') are attached to the template of the primers (31, 33 or 34, 36 and 38, 40 or 34', 36' and 38', 40'). -The specific moiety is free to anneal to its cognate template and frees the 3' hydroxyl group for primer extension.

Different methods can be used to create the flow cell structures disclosed herein. Various methods will now be explained.

Method for manufacturing flow cell structures with metal films

Some examples of the methods disclosed herein use a sputtered or thermally evaporated metal film to create a mask used to pattern a photosensitive material, which in turn can be used to form a functionalized layer(s) 24, 26 and/or a pad. It is used to pattern (28). This method generally involves sputtering or thermally evaporating a metallic material onto a transparent substrate comprising depressions 20, 20' separated by gap regions 22, thereby forming the depressions with a first thickness over gap regions 22. forming a metal film having a second thickness over (20, 20'), wherein the second thickness is less than or equal to about 30 nm and is at least 10 nm thinner than the first thickness; Depositing a photosensitive material onto the metal film; using a metal film to develop the photosensitive material through a transparent substrate (e.g., 14, 16) to define the modified photosensitive material in a first predetermined area on the functionalized layer transparent substrate; and using the modified photosensitive material to create a functionalized layer pad (24, 26) or a functionalized layer pad (28) in a first predetermined area or a second predetermined area on the transparent substrate.

In this exemplary method, the transparent substrate is either a single layer base support 14 or a multilayer structure 16 as described herein. Both of these structures (14, 16) can be used to pattern photosensitive materials and transmit light for use in nucleic acid sequencing. While a multi-layer structure 16 may be used, the series of figures (Figures 3-11) illustrate the resin layer 18 but do not show the underlying base support 17.

The series of views of FIGS. 3A-3F through 6A-6E show a resin layer 18 of a single layer base support 14 or a multilayer structure 16 with depressions 20 defined therein. The depressions 20 may be etched, imprinted, or otherwise defined into the single layer base support 14 or resin layer 18 using any suitable technique. In one example, nanoimprint lithography is used. In this example, the walking stamp is pressed into the single layer base support 14 or resin layer 18 while the material is in a soft state, thereby imprinting the walking stamp features into the single layer base support 14 or resin layer 18. Create. The single layer base support 14 or resin layer 18 can then be cured in situ with the walking stamp.

Curing can be accomplished by exposure to actinic radiation, such as visible radiation or ultraviolet (UV) radiation, if a radiation-curable resin material is used, or by exposure to heat if a thermosetting resin material is used. Curing may promote polymerization and/or crosslinking. As an example, curing can include multiple steps, including soft bake (e.g., to remove any liquid carrier that may be used to deposit the resin) and hard bake. Softbaking can occur at low temperatures ranging from about 50°C to about 150°C. The duration of the hard bake may last from about 5 seconds to about 10 minutes at a temperature ranging from about 100°C to about 300°C. Examples of devices that can be used for soft baking and/or hard baking include hot plates, ovens, etc.

After curing, the walking stamp is released. This creates topographical features (e.g., depressions 20) in the single layer base support 14 or resin layer 18.

In the series of Figures 3A to 3F to 6A to 6E, a metal material is sputter coated or thermally evaporated on the surface of the single layer base support 14 or the resin layer 18. During sputtering, metallic material is deposited at a specific angle (e.g., 45° or 60°) relative to the surface. This creates a shadow effect in the depression 20 where little or no metallic material is deposited in the area of the depression 20 across the incoming metallic material. Accordingly, the transparent substrate (e.g., single layer base support 14 or multilayer structure 16) is rotated via sputtering to introduce metallic material into these region(s) of depression 20. Because metal material continues to be deposited into gap areas 22 as the substrate rotates, this method deposits more metal material into gap areas 22 and deposits more metal into depressions 20, at least in part due to the shadow effect. Deposits less material. Pressure may be adjusted during sputtering. Low pressure (about 5 mTorr or less) increases the directionality of sputtering to maximize the shadow effect. A similar effect can be achieved with thermal evaporation (eg, using low pressure), and thus this technique can be used instead of sputtering to create metal film 48. Accordingly, as a result of sputtering or thermal evaporation, a metal film ₄₈ (e.g., Figure _3a , Figures 4a, 5a, and 6a) are generated. Sputtering or thermal evaporation is controlled such that the second thickness T ₂ is about 30 nm or less and is at least 10 nm thinner than the first thickness T ₁ . The second thickness T ₂ allows UV light to transmit through the metal film 48 in the thin portion, while the first thickness T ₁ blocks UV light from penetrating the metal film 48 in the thick portion. Suffice.

As mentioned, the second thickness T ₂ is about 30 nm or less and is at least 10 nm thinner than the first thickness T ₁ . In some examples, the second T ₂ is 20 nm or less (which provides desirable UV transmission). As such, in some cases, T ₂ ≤ 20 ≤ T ₁ - 10 nm. In one example, the first thickness T ₁ is about 30 nm and the second thickness T ₂ is at least 10 nm thinner (eg, 20 nm or less (eg, 8.5 nm, 15 nm, etc.)). As another example, T ₁ = 40 nm and T ₂ = 30 nm; T ₁ = 15 nm and T ₂ = 5 nm; T ₁ = 20 nm and T ₂ = 10 nm; T ₁ = 25 nm and T ₂ = 15 nm.

The metal material used to form metal film 48 may be titanium, chromium, aluminum, gold, or copper. In some examples, the metallic material can be at least substantially pure (less than 99% pure). In another example, molecules or compounds of the listed elements are such that the metal film 48 is i) opaque (having a transmittance of less than 0.25 or not transparent) to the light energy used to alter the photosensitive material in thick regions, and ii) In thin areas, photosensitive materials may be used as long as they are transparent (having a transmittance greater than 0.25) to the light energy used to modify them. For example, any of the listed metal oxides (e.g., aluminum oxide, zinc oxide, titanium dioxide, etc.) may be used alone or in combination with the listed metals. As a result of sputtering or thermal evaporation, metal films 48 with various thicknesses T ₁ , T ₂ are formed on a single layer base support 14 or a resin layer as shown in FIGS. 3A, 4A, 5A and 6A respectively. (18) Located above.

In the method of Figures 3A-3F, photosensitive material 50 is positive photoresist 52; Positive photoresist 52 is deposited in direct contact with metal film 48; Using the metal film 48 to develop the photosensitive material 50 involves exposing the positive photoresist 52 to light through the transparent substrates 14, 16, thereby forming a positive photoresist 52 over the depressions 20. A portion of the photoresist 52 is soluble, and a portion of the positive photoresist 52 over the gap region 22 defines an insoluble positive photoresist 52'; The insoluble positive photoresist 52' is a modified photosensitive material 50'; The interstitial region 22 is the first predetermined region 54 (see Figure 3C in which the modified photosensitive material 50' is formed); The depression 20 is the second predefined region 56 (see Figure 3e where the functionalized layer 24 is formed).

As shown in Figure 3B, positive photoresist 52 is deposited on metal film 48. Any deposition technique described herein may be used.

Examples of suitable positive photoresists 52 include the MICROPOSIT® S1800 series or AZ® 1500 series, both available from Kayaku Advanced Materials, Inc. Another example of a suitable positive photoresist is SPR™-220 (from DuPont). When a positive photoresist 52 is used, selective exposure to light of a particular wavelength forms soluble regions (e.g., it is at least 95% soluble in a developer), and the soluble regions are removed using a developer. . Portions of the positive photoresist 52 that are not exposed to light will become insoluble in the developer. Examples of suitable developers for positive photoresist 52 include alkaline aqueous solutions, such as diluted sodium hydroxide, diluted potassium hydroxide, or an aqueous solution of metal-free organic TMAH (tetramethylammonium hydroxide).

In this example, developing photosensitive material 50 (e.g., positive photoresist 52) using metal film 48 allows light (e.g., ultraviolet light) to pass through transparent substrates 14, 16. ) involves exposing the positive photoresist 52 to . The thicker metal film 48 (having a thickness T ₁ ) allows at least 75% of the light transmitted through the transparent substrates 14, 16 to pass through the thicker metal film 48, a positive photoresist positioned in line with T ₁ . Blocks it from reaching (52). As such, these portions become insoluble portions 50', 52' as shown in Figure 3C. In contrast, UV light may be transmitted through the thinner metal film 48 (having a thickness T ₂ ), thereby rendering the portion of positive photoresist 52 over the depressions 20 soluble. The soluble portion is removed, for example by a developer, exposing the thinner metal film 48, T ₂ , present in the depression 20 . The resulting structure is shown in Figure 3c.

Modified photosensitive material 50' (e.g., insoluble positive photoresist 52') is then used to create functionalization layer 24 in second predetermined region 56. This includes etching the metal film 48 from the depression 20 (Figure 3d); Depositing a functionalized layer (24) over the insoluble positive photoresist (52') and depressions (20) (FIG. 3E); and removing the insoluble positive photoresist 52' and metal film 48 (FIG. 3F).

Dry etching of metal film 48 from depression 20 may involve reactive ion etching with BCl ₃ + Cl ₂ . The dry etching process can be stopped if the surface of support 14 or resin layer 18 is exposed. This process exposes a second predetermined area 56 where the functionalization layer 24 will be formed. Removal of metal film 48 from depression 20 is shown in Figure 3D. Wet etching of the metal film 48 from the depressions 20 may also be used. Wet etching of the aluminum metal film 48 can be performed using acidic or basic conditions, wet etching of the copper metal film 48 can be performed using FeCl ₃ or iodine and iodide solutions, gold Wet etching of the metal film 48 may be performed using iodine and iodide solution, and wet etching of the titanium metal film 48 may be performed using H ₂ O ₂ . In this example, support 14 or resin layer 18 acts as an etch stop for the etching process.

If the base support 14 or resin layer 18 does not include surface groups covalently attached to the functionalization layer 24, the base support 14 or resin layer 18 may first be silanized or It can be activated through plasma ashing. If the base support 14 or the resin layer 18 includes surface groups covalently attached to the functionalization layer 24, the activation process is not performed.

A functionalized layer 24 is then deposited over the insoluble positive photoresist 52' and depressions 20. Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. The functionalized layer 24 is covalently attached to the base support 14 or the resin layer 18 in the depressions 20 . The deposited functionalized layer 24 is shown in Figure 3E.

The insoluble positive photoresist 52' and metal film 48 may then be removed from gap region 22. The insoluble positive photoresist 52' can be removed using a remover such as dimethyl sulfoxide (DMSO) using sonication, or acetone, or propylene glycol monomethyl ether acetate, or based on N-methyl-2-pyrrolidone (NMP). It can be lifted off using a stripper. The lift off process removes i) at least 99% of the insoluble positive photoresist 52' and ii) the functionalization layer 24 positioned thereon. Metal film 48 can also be lifted off using a stripper suitable for the particular metal. As an example, the aluminum metal film 48 can be removed using a suitable base such as potassium hydroxide (KOH) or sodium hydroxide (NaOH), and the copper metal film 48 can be removed using FeCl ₃ or a mixture of iodine and iodide. It can be removed using . After each of these removal processes, the functionalized layer 24 of the depression 20 remains intact, at least in part because it is covalently attached to the base support 14 or the resin layer 18.

Although not shown, this method also includes attaching primer set 29 to functionalization layer 24. In some examples, primers 31, 33 (not shown in FIGS. 3A-3F) may be pre-grafted into functionalization layer 24. In this example, no additional primer grafting is performed.

In another example, primers 31 and 33 are not pre-grafted into functionalized layer 24. In this example, primers 31 and 33 may be grafted after functionalization layer 24 is applied (e.g., in Figure 3E or Figure 3F).

When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique. By way of example, grafting can be accomplished by flow through deposition (e.g., using temporarily bound leads), dunk coating, spray coating, puddle dispensing, or other suitable methods. Each of these exemplary techniques may use a primer solution or mixture that may include primer(s) 31, 33, water, buffer, and catalyst. With any grafting method, primers 31, 33 are attached to the reactive groups of functionalization layer 24 and have no affinity for interstitial regions 22 (when exposed, as shown in Figure 3f). ).

Although a single depression 20 and functionalized layer 24 are shown in Figure 3F, the method described with reference to Figures 3A-3F can be performed to form a depression across the surface of base support 14 or resin layer 18. , can create an array of functionalized depressions separated by interstitial regions 22 .

4A-4G, photosensitive material 50 is negative photoresist 60; Negative photoresist 60 is deposited in direct contact with functionalization layer 24 (see Figure 4d); Using metal film 48 to develop photosensitive material 50 involves exposing negative photoresist 60 to light through transparent substrate 14 or 16, thereby forming a negative overlying depression 20. The portion of photoresist 60 defines an insoluble negative photoresist 60', and the portion of negative photoresist 60 above gap region 22 is soluble; The insoluble negative photoresist 60' is a modified photosensitive material 50'; The depression 20 is a first predetermined area 54 (see Figure 4E in which the modified photosensitive material 50' is formed); The depression 20 is (also) a second predefined area 56 (see FIG. 4F in which the modified photosensitive material 50' and the functionalization layer 24 are formed).

In this exemplary method, as shown in FIGS. 4B and 4C, prior to depositing photosensitive material 50 over metal film 48, the method deposits protective layer 58 in direct contact with metal film 48. ordering step; and depositing the functionalized layer (24) in direct contact with the protective layer (58).

The protective layer 58 has high resistance to degradation by chemicals used in nucleic acid sequencing (thereby preventing exposure of the underlying metal film 48) and also provides good adhesion to the functionalization layer 24. It can be any inorganic material that has or can be activated to have. In one example, protective layer 58 is an inorganic material that includes surface groups for attachment to functionalization layer 24. One example of such a protective layer 58 is silicon dioxide. In another example, the protective layer 58 is an inorganic material that does not contain surface groups for attachment to the functionalization layer 24, and the method activates the protective layer 58 by silinization or plasma ashing, thereby forming the functionalized layer 24. It further includes introducing surface groups to attach to the chemical layer 24. For example, protective layer 58 may be Ta ₂ O _{5 ,} which may be silanized to create surface groups for reacting with functionalization layer 24 ; or a polyhedral oligomeric silsesquioxane-based resin that can be plasma ashed or silanized to create surface groups that react with the functionalization layer 24. Protective layer 58 may be deposited using any suitable technique and coats metal film 48 as shown in FIG. 4B.

A functionalized layer 24 is then deposited over protective layer 58. Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. Functionalization layer 24 is covalently attached (due to intrinsic or generated surface groups) to protective layer 58. The deposited functionalized layer 24 is shown in Figure 4C.

As shown in Figure 4D, negative photoresist 60 is deposited on functionalization layer 24. Any deposition technique described herein may be used.

Examples of suitable negative photoresists 60 include the NR® series photoresists (available from Futurrex). Other suitable negative photoresists 54 include the SU-8 series and KMPR® series (both available from Kayaku Advanced Materials, Inc.) or the UVN™ series (available from DuPont). When a negative photoresist 60 is used, it is selectively exposed to light of a specific wavelength to form an insoluble negative photoresist 60', which is then exposed to a developer to form a soluble portion (e.g., exposed to light of a specific wavelength) to form an insoluble negative photoresist 60'. (parts that are not used) are removed. Examples of suitable developers for negative photoresist 60 include alkaline aqueous solutions, such as diluted sodium hydroxide, diluted potassium hydroxide, or an aqueous solution of metal-free organic TMAH (tetramethylammonium hydroxide).

In this example, developing photosensitive material 50 (e.g., negative photoresist 60) using metal film 48 involves exposing light (e.g., ultraviolet light) through transparent substrates 14, 16. ) involves exposing the negative photoresist 60 to . The thicker metal film 48 (having a thickness T ₁ ) allows at least 75% of the light transmitted through the transparent substrates 14, 16 to pass through the thicker metal film 48, a negative photoresist positioned in line with T ₁ . Blocks it from reaching (60). As such, these parts become fusible. The soluble portion is removed, for example using a developer, exposing the functionalized layer 24 over the interstitial region 22. In contrast, UV light may be transmitted through a thinner metal film 48 (having a thickness T ₂ ), such that the portion of negative photoresist 60 overlying depressions 20 becomes insoluble. The resulting structure is shown in Figure 4e.

Modified photosensitive material 50' (e.g., insoluble negative photoresist 60') is then used to create functionalization layer 24 in first predetermined region 54. This includes dry etching the functionalization layer 24, protective layer 58, and metal film 48 from the gap region 22; and removing the insoluble negative photoresist 60'.

The dry etch or ashing process used to remove functionalization layer 24 and protective layer 58 from gap region 22 may be performed with a plasma such as 100% O ₂ plasma, air plasma, argon plasma, etc. This process may also be used to remove metal film 48. Alternatively, the dry etch process used to remove metal film 48 from gap region 22 may be a reactive ion etch with BCl ₃ + Cl ₂ .

Removal of the insoluble negative photoresist 60' may then be performed to expose the functionalized layer 24 in the depressions 20. The insoluble negative photoresist 60' is insoluble in the developer, but is soluble (at least 99% soluble) in the remover. Suitable strippers may include those in dimethyl sulfoxide (DMSO) or acetone using sonication, or using N-methyl-2-pyrrolidone (NMP) based strippers.

Although not shown, this method also includes attaching primer set 29 to functionalization layer 24. In some examples, primers 31, 33 (not shown in FIGS. 4A-4G) may be pre-grafted into functionalization layer 24. In this example, no additional primer grafting is performed.

In another example, primers 31 and 33 are not pre-grafted into functionalized layer 24. In this example, primers 31 and 33 may be grafted after functionalization layer 24 is applied or re-exposed (e.g., in Figure 4C or Figure 4G).

When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique. By way of example, grafting can be accomplished by flow through deposition (e.g., using temporarily bound leads), dunk coating, spray coating, puddle dispensing, or other suitable methods. Each of these exemplary techniques may use a primer solution or mixture that may include primer(s) 31, 33, water, buffer, and catalyst. When grafting is performed after removing the insoluble negative photoresist 60', the primers 31, 33 are attached to the reactive groups of the functionalized layer 24 in the depressions 20 and are attached to the gap regions 22. There is no affinity.

Although a single depression 20 and functionalized layer 24 are shown in Figure 4G, the method described with reference to Figures 4A-4G can be performed to form a depression across the surface of base support 14 or resin layer 18. , can create an array of functionalized depressions separated by interstitial regions 22 .

5A-5E, prior to depositing the photosensitive material 50 on the metal film 48, the method further includes depositing a transparent resin 62 in direct contact with the metal film 48. Any example of the material described herein for resin layer 18 may be used as transparent resin 62 and may be deposited at a thickness such that light (used to pattern photosensitive material 50) is transmitted therethrough. there is.

Clear resin 62 may be deposited using any suitable technique disclosed herein. For some deposition techniques, the resin may be mixed in a liquid carrier such as propylene glycol monomethyl ether acetate (PGMEA), toluene, dimethyl sulfoxide (DMSO), tetrahydrofuran (THF), etc. The transparent resin 62 may be spin on or deposited and then cured. Curing can be accomplished by exposure to actinic radiation, such as visible radiation or ultraviolet (UV) radiation, if a radiation-curable resin material is used, or by exposure to heat if a thermosetting resin material is used.

Clear resin 62 can be activated using silanization or plasma ashing to create surface groups that can react with functionalization layer 24.

After the transparent resin 62 is created, the photosensitive material 50 is deposited and patterned. In this example, photosensitive material 50 is positive photoresist 52; Positive photoresist 52 is deposited in direct contact with transparent resin 62 (Figure 5b); Using the metal film 48 to develop the photosensitive material 50 involves exposing the positive photoresist 52 to light through a transparent substrate 14 or 18, thereby forming a positive photoresist 52 over the depressions 20. A portion of the photoresist 52 is soluble, and a portion of the positive photoresist 52 over the gap region 22 defines an insoluble positive photoresist 52'; The insoluble positive photoresist 52' is a modified photosensitive material 50'; The portion of the transparent resin 62 above the gap region 22 is the first predetermined region 54 (see FIG. 5C where the modified photosensitive material 50' is formed); The portion of the transparent resin 62 above the depression 20 is the second predefined region 56 (see FIG. 5D where the functionalized layer 24 is formed).

In this example, developing photosensitive material 50 (e.g., positive photoresist 52) using metal film 48 allows light (e.g., ultraviolet light) to pass through transparent substrates 14, 16. ) involves exposing the positive photoresist 52 to . The thicker metal film 48 (having a thickness T ₁ ) allows at least 75% of the light transmitted through the transparent substrates 14, 16 to pass through the thicker metal film 48, a positive photoresist positioned in line with T ₁ . Blocks it from reaching (52). As such, these portions become insoluble portions 50', 52' as shown in Figure 5c. In contrast, UV light may be transmitted through the thinner metal film 48 (having a thickness T ₂ ), thereby rendering the portion of positive photoresist 52 over the depressions 20 soluble. The soluble portion is removed, for example using a developer, exposing portions of the transparent resin 62. This portion is the second predetermined area 56. The resulting structure is shown in Figure 5c.

In this exemplary method, the modified photosensitive material 50' is modified to create a functionalized layer (in this example, which is the functionalized layer pad 28 (see FIG. 5E)) in the second predetermined region 56. The use may include depositing a functionalization layer (24) over an insoluble positive photoresist (52') and over a second predefined region (56); and removing the insoluble positive photoresist 52'.

The functionalization layer 24 is deposited over the insoluble positive photoresist 52' and a second predefined area 56, which in this example is an exposed portion of the transparent resin 62. Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. Functionalization layer 24 is covalently attached to transparent resin 62. The deposited functionalized layer 24 is shown in Figure 5D.

Thereafter, the insoluble positive photoresist 52' may be removed. The insoluble positive photoresist 52' can be removed using a remover such as dimethyl sulfoxide (DMSO) using sonication, or acetone, or propylene glycol monomethyl ether acetate, or based on N-methyl-2-pyrrolidone (NMP). It can be lifted off using a stripper. The lift off process removes i) at least 99% of the insoluble positive photoresist 52' and ii) the functionalization layer 24 positioned thereon. After photoresist removal, functionalized layer pads 28 are formed, separated by gap regions 22' (of transparent resin 62).

Although not shown, this method also includes attaching primer set 29 to functionalized layer pad 28. In some examples, primers 31, 33 (not shown in FIGS. 5A-5E) may be pre-grafted to functionalized layer 24, which may then be pre-grafted to functionalized layer pad 28. . In this example, no additional primer grafting is performed.

In another example, primers 31 and 33 are not pre-grafted into functionalized layer 24. In this example, primers 31, 33 are applied after functionalization layer 24 is applied (e.g., in Figure 5D) or after functionalization layer pad 28 is formed (e.g., in Figure 5E). Can be grafted.

When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique. By way of example, grafting can be accomplished by flow through deposition (e.g., using temporarily bound leads), dunk coating, spray coating, puddle dispensing, or other suitable methods. Each of these exemplary techniques may use a primer solution or mixture that may include primer(s) 31, 33, water, buffer, and catalyst. When the primers 31, 33 are attached to the functionalized layer pad 28 (FIG. 5E), the primers 31, 33 are attached to the reactive groups of the functionalized layer pad 28 and in the gap region 22'. has no affinity for

Although a single functionalized layer pad 28 is shown in Figure 5E, the method described with reference to Figures 5A-5E can be performed to form interstitial regions 22 across the surface of the base support 14 or resin layer 18. It should be understood that one may create an array of functionalized layer pads 28 (see, e.g., FIG. 1D ) separated by

The method shown in FIGS. 6A-6E uses the example of a protective layer 58' and a photocurable resin 64. In this example, photocurable resin 64 is photosensitive material 50.

6B and 6C, prior to depositing the photosensitive material 50 on the metal film 48, the method further includes depositing a protective layer 58' in direct contact with the metal film 48. do. In this example, the protective layer 58' has high resistance to degradation by chemicals used in nucleic acid sequencing (thereby preventing exposure of the underlying metal film 48) and also the functionalization layer 24. It has poor adhesion to. Examples of protective layers 58' include tantalum pentoxide (Ta ₂ O ₅ ) or other suitable tantalum oxides, fluorooctatrichlorosilane (FOTS), polyethylene glycol, and the like.

In this exemplary method, photosensitive material 50 is photocurable resin 64; The photocurable resin 64 is deposited in direct contact with the protective layer 58'; Using the metal film 48 to develop the photosensitive material 50 involves exposing the photocurable resin 64 to light through the transparent substrates 14, 16, thereby exposing the light over the depression 20. A portion of the chemical conversion resin 64 is cured, and a portion of the photocurable resin 64 above the gap region 22 remains uncured; The method further includes removing the uncured portion of the photocurable resin 64 to expose the protective layer 58' in the gap region 22.

Photocurable resin 64 is any resin material that can be cured with actinic radiation and that includes or can be activated to include surface groups to attach to functionalized layer 24. In one example, photocurable resin 64 is a polyhedral oligomeric silsesquioxane-based resin that can be plasma ashed or silanized to create surface groups that react with functionalized layer 24.

In this example, using metal film 48 to develop photosensitive material 50 exposes photocurable resin 64 to light (e.g., ultraviolet light) through transparent substrates 14, 16. entails that The thicker metal film 48 (having a thickness T ₁ ) allows at least 75% of the light transmitted through the transparent substrates 14, 16 to be disposed in line with the thicker metal film 48, T ₁ . Blocks it from reaching (64). As such, these parts remain uncured and are removable. In contrast, UV light can be transmitted through the thinner metal film 48 (having a thickness T ₂ ), thereby curing the portion of the photocurable resin 64 above the depression 20 (FIG. 6D (shown at 64'). The uncured portion is removed, for example in a cleaning process, exposing portions of the protective layer 58'. The resulting structure is shown in Figure 6d.

In this exemplary method, using a modified photosensitive material 50' (in this example, a photocurable resin 64) to create a functionalized layer 24 in the first predetermined region 54 is used to create a functionalized layer 24. Concomitantly depositing layer 24, functionalized layer 24 adheres to cured portion 64' of photocurable resin 64 and does not adhere to protective layer 58' in gap region 22. No.

Functionalization layer 24 is deposited using any suitable method. In this example, functionalized layer 24 is covalently attached to cured portion 64' and has no affinity for exposed protective layer 58'. The curing process may be performed after deposition. The deposited functionalized layer 24 is shown in Figure 6E.

This method forms an example of a flow cell 10 having a protrusion (cured portion 64'of photocurable resin 64) with a functionalized layer 24 thereon. The exposed portion of protective layer 58' serves as a gap region 22 separating adjacent functionalized layers 24.

Although not shown, this method also includes attaching primer set 29 to functionalization layer 24. In some examples, primers 31, 33 (not shown in FIGS. 6A-6E) may be pre-grafted into functionalization layer 24. In this example, no additional primer grafting is performed.

In another example, primers 31 and 33 are not pre-grafted into functionalized layer 24. In this example, primers 31 and 33 may be grafted after functionalization layer 24 is applied (e.g., in Figure 6E).

When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique. By way of example, grafting can be accomplished by flow through deposition (e.g., using temporarily bound leads), dunk coating, spray coating, puddle dispensing, or other suitable methods. Each of these exemplary techniques may use a primer solution or mixture that may include primer(s) 31, 33, water, buffer, and catalyst. When the primers 31, 33 are attached to the functionalized layer pad 28, the primers 31, 33 are attached to the reactive groups of the functionalized layer 24 and have no affinity for the protective layer 58'. No.

Although one protrusion supporting the functionalized layer 24 is shown in Figure 6E, the method described with reference to Figures 6A-6E can be performed to span the surface of the base support 14 or the resin layer 18, It should be understood that one may create an array of protrusions supporting each functionalized layer 24 separated by exposed portions of protective layer 58'.

The series of views of FIGS. 8A to 8I/FIGS. 8J to 11A to 11E show a resin layer 18 of a single layer base support 14 or a multilayer structure 16 with depressions 20' defined therein. do. The depressions 20' may be etched, imprinted, or otherwise defined into the single layer base support 14 or resin layer 18 using any suitable technique. Figure 7 shows an example of a multi-depth depression 20' defined in a single layer base support 14 or a resin layer 18 of a multilayer structure 16. Multi-depth depression 20' includes a deep portion 66 and a shallow portion 68 defined by a step 70.

In each of the exemplary methods shown in FIGS. 8A-8I/FIGS. 8J-11A-11E, the metal material is sputter coated or thermally evaporated on the surface of the single layer base support 14 or the resin layer 18. During sputtering, the metallic material is deposited at a specific angle (e.g., 45° or 60°) relative to the surface. This creates a shadow effect in the depression 20' where little or no metallic material is deposited in the area of the depression 20' across the incoming metallic material. Accordingly, the transparent substrate (e.g., single layer base support 14 or multilayer structure 16) is rotated via sputtering to introduce metallic material into these region(s) of multi-depth depression 20'. . Because metal material continues to be applied to gap areas 22 as the substrate rotates, this method deposits more metal material in gap areas 22 and less metal material in depressions 20'. A similar effect can be achieved using thermal evaporation. Low pressure can be used in both processes to maximize effectiveness. Accordingly, as a result of sputtering or thermal evaporation, a first thickness T ₁ over the interstitial region 22 with a second thickness T ₂ over the surface 72 and a depression in the deep portion 66 of the depression 20 ′. A metal film 48 (see FIGS. 8A , 9A , 10A , and 11A ) having a third thickness T ₃ is created over the surface 74 in the shallow portion 68 of 20 ′. Accordingly, in the series of Figures 8-11, each depression is a multi-depth depression 20' comprising a deep portion 66 and a shallow portion 68 adjacent to the deep portion 66; A metal film 48 is created over the deep portion 66 of each multi-depth depression 20' and the shallow portion 68 of each multi-depth depression 20'; The metal film 48 over the deep portion 66 of each multi-depth depression 20' has a second thickness T ₂ (which is less than or equal to about 30 nm and is at least 10 nm greater than the first thickness T _{1 )} . tenuity); The metal film 48 over the shallow portion 68 of each multi-depth depression 20' has a third thickness T ₃ that is less than the first thickness and greater than the second thickness T ₂ . The second thickness T ₂ allows UV light to transmit through the metal film 48 in the thin portion, while the first thickness T ₁ and the third thickness T ₃ allow UV light to pass through the metal film 48 in the thick portion. It is sufficient to block penetration.

Any metallic material disclosed herein may be used. As a result of sputtering or thermal evaporation, metal films 48 with various thicknesses T ₁ , T ₂ , T ₃ are formed on the single layer base support 14 as shown in FIGS. 8A, 9A, 10A and 11A respectively. or over a multi-depth depression 20' in the resin layer 18.

Two examples of the method are shown in Figure 8 series. One method is shown in Figures 8A-8I. Another method is shown in Figures 8A-8F and Figures 8J-8N.

Initially, the method shown in the Figure 8 series, if the base support 14 or the resin layer 18 does not include surface groups covalently attached to the functionalization layer 24, the base support 14 or the resin layer 18 ( 18) can first be activated, for example via silanization or plasma ashing. If the base support 14 or the resin layer 18 includes surface groups covalently attached to the functionalization layer 24, the activation process is not performed.

8A-8N, photosensitive material 50 is positive photoresist 52; Positive photoresist 52 is deposited in direct contact with metal film 48; Using metal film 48 to develop photosensitive material 50 involves exposing positive photoresist 52 to light through transparent substrates 14, 16, forming each multi-depth depression ( The portion of the positive photoresist 52 overlying the deep portion 66 of the 20') is soluble, and the portion of the positive photoresist 52 overlying the shallow portion 68 and over the interstitial region 22 is an insoluble positive photoresist. defines resist 52'; The insoluble positive photoresist 52' is a modified photosensitive material 50'; The shallow portion 68 and interstitial region 22 of each multi-depth depression 20' is a first predetermined region 54 (see FIG. 8C in which modified photosensitive material 50' is formed); The deep portion 66 of each multi-depth depression 20' is a second predefined region 56 (see FIG. 8F where the functionalized layer 24 is formed).

As shown in Figure 8B, positive photoresist 52 is deposited on metal film 48. Any positive photoresist 52 and any deposition technique described herein may be used in this example.

In this example, developing photosensitive material 50 (e.g., positive photoresist 52) using metal film 48 allows light (e.g., ultraviolet light) to pass through transparent substrates 14, 16. ) involves exposing the positive photoresist 52 to . The thicker portion of the metal film 48 (with a thickness T ₁ or a thickness T ₃ ) allows at least 75% of the light transmitted through the transparent substrates 14, 16 to pass through the thicker metal film 48, T ₁ , T ₃ is blocked from reaching the positive photoresist 52 located in a straight line. As such, these portions become insoluble portions 50', 52' as shown in Figure 8c. In contrast, UV light may be transmitted through the thinner metal film 48 (having a thickness T2) and thus the portion of positive photoresist 52 over the deep portion 66 of the depression 20'. becomes soluble. The soluble portion is removed, for example by a developer, exposing the thinner metal film 48, T ₂ , present in the depression 20'. The resulting structure is shown in Figure 8c.

Modified photosensitive material 50' (e.g., insoluble positive photoresist 52') is then used to create functionalization layer 24 in second predetermined region 56. This includes etching the metal film 48 from the deep portion 66 of each multi-depth depression 20' (FIG. 8D); and depositing a functionalization layer 24 over the insoluble positive photoresist 52' and the deep portion 66 of each depression 20' (FIG. 8E).

Metal film 48 may be removed from surface 72 of deep portion 66 using dry or wet etching. Dry etching of metal film 48 from deep portion 66 may involve reactive ion etching with BCl ₃ + Cl ₂ . The dry etching process can be stopped if the surface of support 14 or resin layer 18 is exposed. Wet etching of the aluminum metal film 48 can be performed using acidic or basic conditions, and wet etching of the copper metal film 48 can be performed using FeCl ₃ or iodine and iodide solutions. In this example, support 14 or layer 18 acts as an etch stop for the etch process. The etching process exposes the surface 72 of the support 14 or layer 18 located in the deep portion 66. In this example, surface 72 is the second desired region 56 on which functionalization layer 24 will be formed. Removal of metal film 48 from deep portion 66 is shown in Figure 8D.

A functionalized layer 24 is then deposited over the insoluble positive photoresist 52' and deep portions 66 of depressions 20'. Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. The functionalized layer 24 is covalently attached to the base support 14 or the resin layer 18 in the deep portion 66 of the depression 20'. The deposited functionalized layer 24 is shown in Figure 8E.

In the exemplary method shown in FIGS. 8A-8I , the method removes the insoluble positive photoresist 52' to form a metal film 48 in the shallow portion 68 of each multi-depth depression 20'. exposing above and above the gap region 22 (FIG. 8f); Wet etching the metal film 48 from the shallow portion 68 and interstitial region 22 of each multi-depth depression 20' (FIG. 8G); Depositing a second functionalized layer (26) over the shallow portion (68) of each multi-depth depression (20') and over the interstitial region (22) (FIG. 8H); and polishing the second functionalized layer 26 from the interstitial regions 22 (FIG. 8I).

The insoluble positive photoresist 52' can be removed using a remover such as dimethyl sulfoxide (DMSO) using sonication, or acetone, or propylene glycol monomethyl ether acetate, or based on N-methyl-2-pyrrolidone (NMP). It can be lifted off using a stripper. The lift off process removes i) at least 99% of the insoluble positive photoresist 52' and ii) the functionalization layer 24 positioned thereon, as shown in Figure 8F.

In this example, any wet etch process described herein may be used to remove metal film 48. This exposes the surface 74 of the support 14 or resin layer 18 in the shallow portion 68 and also exposes the interstitial area 22. This is shown in Figure 8g.

As shown in Figure 8H, a second functionalized layer 26 may then be applied over the surface 74 of the support 18 or resin layer 18 and also over the interstitial regions 22 in the shallow portion 68. there is. The second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) may be applied using any suitable deposition technique. In this example, when deposition of the gel material is performed under high ionic strength (e.g., in the presence of 10x PBS, NaCl, KCl, etc.), the second functionalized layer 26 is similar to the first functionalized layer 24. It does not deposit on or adhere to the surface. As such, the second functionalized layer 26 does not contaminate the first functionalized layer 24.

In Figure 8I, the second functionalized layer 26 located over the interstitial region 22 is removed using, for example, a polishing process. The polishing process may remove the functionalized layer(s) 24 and/or 26 from interstitial regions 22 without detrimentally affecting the underlying substrate (e.g., 14 or 18) in these regions 22. This can be accomplished using a chemical slurry (including, for example, an abrasive, buffer, chelating agent, surfactant, and/or dispersant). Alternatively, polishing can be performed using a solution that does not contain abrasive particles.

A chemical slurry may be used in a chemical mechanical polishing system to polish the surface of interstitial regions 22. Polishing head(s)/pad(s) or other polishing tool(s) are positioned over interstitial regions 22 while leaving functionalized layers 24, 26 of depression(s) 20' at least substantially intact. Any functionalized layers 24, 26 that may be present may be polished. As an example, the polishing head may be a Strasbaugh ViPRR II polishing head.

A cleaning and drying process may be performed after polishing. The cleaning process may use water bath and ultrasonic treatment. The water bath may be maintained at a relatively low temperature ranging from about 22°C to about 30°C. The drying process may involve drying via spin drying or other suitable techniques.

In the exemplary method shown in FIGS. 8A-8F and 8J-8N, the method removes the insoluble positive photoresist 52' to form a metal film 48 in each multi-depth depression 20'. exposing over the shallow portion 68 and over the gap region 22 (FIG. 8f); patterning the negative photoresist 60 to form an insoluble negative photoresist 60' over the deep portion 66 of each multi-depth depression 20' (FIG. 8J); wet etching the metal film (48) from the shallow portion (68) and gap region (22) of each multi-depth depression (20'); Depositing a second functionalized layer (26) over the insoluble negative photoresist (60'), the shallow portion (68) of each multi-depth depression (20') and the interstitial region (22) (FIG. 8L); removing the insoluble negative photoresist 60', exposing the functionalized layer 24 (FIG. 8M); and removing the second functionalized layer 26 from the interstitial region 22 (FIG. 8N).

As mentioned above, the insoluble positive photoresist 52' can be removed using a remover such as dimethylsulfoxide (DMSO) using sonication, or acetone, or propylene glycol monomethyl ether acetate, or NMP (N-methyl-2 -pyrrolidone)-based stripper can be used to lift off. The lift off process removes i) at least 99% of the insoluble positive photoresist 52' and ii) the functionalization layer 24 positioned thereon, as shown in Figure 8f.

Negative photoresist 60 is then deposited on functionalization layer 24 and metal layer 48 (FIGS. 8A-8F or 8J-8N). Any deposition technique described herein may be used. In this example, negative photoresist 60 is exposed to light (e.g., ultraviolet light) through transparent substrates 14 and 16. The thicker metal film 48 (with thickness T ₁ and thickness T ₃ ) allows at least 75% of the light transmitted through the transparent substrates 14, 16 to pass through the thicker metal film 48, T ₁ , T ₃ and the like. It blocks the negative photoresist 60 located in a straight line from reaching it. As such, these parts become fusible. The soluble portion is removed, for example using a developer, exposing the metal film 48 over the surface 74 and over the interstitial region 22 in the shallow portion 68 . In contrast, UV light may be transmitted through the thinner metal film 48 (having a thickness T ₂ ) and thus the negative photoresist 60 over the deep portion 66 of the depression 20'. The part becomes insoluble. The resulting structure comprising insoluble negative photoresist 60' in the deep portion 66 is shown in Figure 8J.

In this example, any wet etch process described herein may be used to remove metal film 48. This exposes the surface 74 of the support 14 or resin layer 18 in the shallow portion 68 and also exposes the interstitial area 22. The insoluble negative photoresist 60' remains intact during this process. This is shown in Figure 8k.

As shown in Figure 8L, a second functionalized layer 26 may then be applied over the surface 74 of the support 14 or resin layer 18 and also over the interstitial regions 22 in the shallow portion 68. there is. The second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) may be applied using any suitable deposition technique. In this example, a second functionalized layer 26 is also applied over the insoluble negative photoresist 60' (which overlies functionalized layer 24).

Removal of the insoluble negative photoresist 60' may then be performed, as shown in FIG. 8M, to expose the functionalized layer 24 in the deep portion 66 of the depression 20'. The insoluble negative photoresist 60' is insoluble in the developer, but is soluble (at least 99% soluble) in the remover. Suitable strippers may include those in dimethyl sulfoxide (DMSO) or acetone using sonication, or using N-methyl-2-pyrrolidone (NMP) based strippers.

The second functionalized layer 26 is then removed from the gap region 22 using, for example, polishing as described with reference to Figure 8I. The resulting structure is shown in Figure 8n.

Although not shown, the method shown in FIG. 8 also includes attaching each primer set 30, 32 to the functionalization layer 24, 26. In some examples, primers 34, 36 or 34', 36' (not shown in FIGS. 8A-8N) may be pre-grafted into functionalization layer 24. Similarly, primers 38, 40 or 38', 40' (not shown in FIGS. 8A-8N) may be pre-grafted into functionalization layer 26. In this example, no additional primer grafting is performed.

In another example, primers 34, 36 or 34', 36' are not pre-grafted into functionalized layer 24. In this example, primers 34, 36 or 34', 36' may be grafted after functionalization layer 24 is applied (e.g., in Figure 8E). In this example, primers 38, 40 or 38', 40' may be pre-grafted into second functionalized layer 26. Alternatively, in this example, 38, 40 or 38', 40' may not be pre-grafted to the second functionalized layer 26. Rather, primers 38, 40 or 38', 40' are (i) functionalized layer 26 (with functionalized layer 24) for attaching primers 38, 40 or 38', 40'. functionalization with different functional groups (in instances where the functionalization layer 24 is exposed) or ii) using, for example, Staudinger reduction to amines or further click reactions with inert molecules such as hexic acid. As long as any unreacted functional groups in layer 24 are quenched (in instances where functionalized layer 24 is exposed), or iii) the insoluble negative photoresist 60' is still in place (FIG. 8L), the second The functionalization layer 26 may be applied and then grafted (e.g., in Figures 8H or 8L).

When grafting is performed during the method, the grafting may be accomplished using any of the grafting techniques described herein.

Although a single set of functionalized layers 24, 26 is shown in FIGS. 8I and 8N, the method described with reference to FIGS. 8A-8N can be used to form a single set of functionalized layers 24, 26 on the surface of the support 14 or resin layer 18 of the multilayer structure 16. It should be understood that this can be done to create an array of depressions 20' (with functionalized layers 24, 26 therein) separated by interstitial regions 22 across.

Another method involving multi-layer depressions 20' is shown in FIGS. 9A-9I. Initially, the method shown in the Figure 9 series, if the base support 14 or the resin layer 18 does not include surface groups covalently attached to the functionalization layer 24, the base support 14 or the resin layer ( 18) can first be activated, for example via silanization or plasma ashing. If the base support 14 or the resin layer 18 includes surface groups covalently attached to the functionalization layer 24, the activation process is not performed.

In the example method shown in FIGS. 9A-9I, photosensitive material 50 is negative photoresist 60; Negative photoresist 60 is deposited in direct contact with metal film 48; Using metal film 48 to develop photosensitive material 50 exposes negative photoresist 60 to light through a transparent substrate (e.g., single layer substrate 14 or multilayer structure 16). The portion of negative photoresist 60 overlying the deep portion 66 of each multi-depth depression 20' defines an insoluble negative photoresist 60'; The portion of the negative photoresist 60 above the shallow portion 68 of the depression 20' and above the gap region 22 becomes soluble; The insoluble negative photoresist 60' is a modified photosensitive material 50'; The deep portion 66 of each multi-depth depression 20' is a first predefined region 54 (in which modified photosensitive material 50' is formed); The shallow portion 68 of each multi-depth depression 20' is a second predefined region 56 (in which the first functionalized layer 24 is formed).

As shown in Figure 9B, negative photoresist 60 is deposited on metal film 48. Any negative photoresist 60 and any deposition technique described herein may be used in this example.

In this example, developing photosensitive material 50 (e.g., negative photoresist 60) using metal film 48 involves exposing light (e.g., ultraviolet light) through transparent substrates 14, 16. ) involves exposing the negative photoresist 60 to . The thicker metal film 48 (with thicknesses T ₁ and T ₃ ) allows at least 75% of the light transmitted through the transparent substrates 14, 16 to be aligned with the thicker metal film 48, T ₁ and T ₃ . It blocks the negative photoresist 60 located at . As such, these parts become fusible. The soluble portion is removed, for example using a developer, to expose the metal film 48 over the interstitial region 22 and over the shallow portion 68 of each multi-depth depression 20'. In contrast, UV light may be transmitted through the thinner metal film 48 (having a thickness T ₂ ) and thus the negative photoresist 60 over the deep portion 66 of the depression 20'. The part becomes insoluble. The resulting structure is shown in Figure 9c.

Modified photosensitive material 50' (e.g., insoluble negative photoresist 60') is then used to create functionalization layer 24 in second predetermined region 56. This includes etching the metal film 48 from the shallow portion 68 and gap region 22 of each multi-depth depression 20'; and depositing a functionalization layer 24 over the insoluble negative photoresist 60', shallow portions 68 of each multi-depth depression 20', and interstitial regions 22.

Metal film 48 may be removed from surface 74 and gap region 22 of shallow portion 68 using dry or wet etching. Dry etching of metal film 48 from shallow portion 68 and gap region 22 may involve reactive ion etching with BCl ₃ + Cl ₂ . The dry etching process can be stopped if the surface of support 14 or resin layer 18 is exposed. Wet etching of the aluminum metal film 48 can be performed using acidic or basic conditions, and wet etching of the copper metal film 48 can be performed using FeCl ₃ or iodine and iodide solutions. In this example, support 14 or layer 18 acts as an etch stop for the etch process. The etching process exposes the surface 74 of the support 14 or layer 18 located in the shallow portion 68 and also exposes the interstitial regions 22. In this example, surface 74 is the second desired region 56 on which functionalization layer 24 will be formed. Removal of metal film 48 from surface 74 and from gap region 22 in shallow portion 68 is shown in FIG. 9D.

A functionalization layer 24 is then deposited over the insoluble negative photoresist 60', shallow portions 68 of each multi-depth depression 20', and interstitial regions 22. Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. The functionalized layer 24 is covalently attached to the base support 14 or resin layer 18 in the interstitial regions 22 and in the shallow portions 68 of the depressions 20'. The deposited functionalized layer 24 is shown in Figure 9E.

9A-9I, the method removes the insoluble negative photoresist 60' to form a metal film 48 over the deep portion 66 of each multi-depth depression 20'. exposing (FIG. 9f); Wet etching the metal film 48 from the deep portion 66 of each multi-depth depression 20' (FIG. 9G); Depositing a second functionalized layer (26) over the deep portion (66) of each multi-depth depression (20') (FIG. 9H); and removing the functionalized layer 26 from the interstitial region 22 (FIG. 9I).

Removal of the insoluble negative photoresist 60' may then be performed to expose the metal layer 48 in the deep portion 66 of the depression 20'. The insoluble negative photoresist 60' is insoluble in the developer, but is soluble (at least 99% soluble) in the remover. Suitable strippers may include those in dimethyl sulfoxide (DMSO) or acetone using sonication, or using N-methyl-2-pyrrolidone (NMP) based strippers.

In this example, any wet etch process described herein may be used to remove metal film 48. This exposes the surface 72 or resin layer 18 of the support 14 in the deep portion 66. This is shown in Figure 9g.

As shown in Figure 9h, a second functionalized layer 26 may then be applied over the surface 72 of the support 14 or the resin layer 18 in the deep portion 66. The second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) may be applied using any suitable deposition technique. In this example, when deposition of the gel material is performed under high ionic strength (e.g., in the presence of 10x PBS, NaCl, KCl, etc.), the second functionalized layer 26 is similar to the first functionalized layer 24. It does not deposit on or adhere to the surface. As such, the second functionalized layer 26 does not contaminate the first functionalized layer 24.

In Figure 9I, the functionalized layer 24 located over the interstitial region 22 is removed using, for example, a polishing process. The polishing process may be performed as described herein. A cleaning and drying process may be performed after polishing. The cleaning process may use water bath and ultrasonic treatment. The water bath may be maintained at a relatively low temperature ranging from about 22°C to about 30°C. The drying process may involve drying via spin drying or other suitable techniques.

Although not shown, the method shown in FIGS. 9A-9I also includes attaching each primer set 30, 32 to the functionalization layer 24, 26. In some examples, primers 34, 36 or 34', 36' (not shown in FIGS. 9A-9I) may be pre-grafted into functionalization layer 24. Similarly, primers 38, 40 or 38', 40' (not shown in FIGS. 9A-9I) can be pre-grafted into functionalization layer 26. In this example, no additional primer grafting is performed.

In another example, primers 34, 36 or 34', 36' are not pre-grafted into functionalized layer 24. In this example, primers 34, 36 or 34', 36' may be grafted after functionalization layer 24 is applied (e.g., in Figure 9E). In this example, primers 38, 40 or 38', 40' may be pre-grafted into second functionalized layer 26. Alternatively, in this example, 38, 40 or 38', 40' may not be pre-grafted to the second functionalized layer 26. Rather, primers 38, 40 or 38', 40' are (i) functionalized layer 26 (with functionalized layer 24) for attaching primers 38, 40 or 38', 40'. as long as any unreacted functional groups of the functionalized layer 24 are quenched, either with different functional groups or ii) using, for example, Staudinger reduction to amines or further click reactions with inert molecules such as hexic acid. , the second functionalized layer 26 may be applied and then grafted (e.g., in FIG. 9H).

When grafting is performed during the method, the grafting may be accomplished using any of the grafting techniques described herein.

Although a single set of functionalization layers 24, 26 is shown in FIG. 9I, the method described with reference to FIGS. 9A-9I can be used to spread the multilayer structure 16 across the surface of the support 14 or resin layer 18. It should be understood that this can be done to create an array of depressions 20' (with functionalized layers 24, 26 therein) separated by interstitial regions 22.

Another method is shown in Figures 10A-10H.

In the method of FIGS. 10A-10H, photosensitive material 50 is negative photoresist 60; Negative photoresist 60 is deposited in direct contact with functionalization layer 24 (see Figure 10b); Using the metal film 48 to develop the photosensitive material 50 involves exposing the negative photoresist 60 to light through a transparent substrate 14 or 16, thereby forming a deep layer of the depressions 20'. The portion of negative photoresist 60 overlying portion 66 defines an insoluble negative photoresist 60', overlying a shallow portion 68 of each multi-depth depression 20' and interstitial region 22. ) the portion of the overlying negative photoresist 60 becomes soluble; The insoluble negative photoresist 60' is a modified photosensitive material 50'; The deep portion 66 of each depression 20' is a first predefined region 54 (see Figure 10D in which modified photosensitive material 50' is formed).

In this exemplary method, as shown in FIGS. 10A and 10B, prior to depositing photosensitive material 50 over metal film 48, the method deposits protective layer 58 in direct contact with metal film 48. ordering step; and depositing the functionalized layer (24) in direct contact with the protective layer (58).

In this example, the protective layer 58 has high resistance to degradation by chemicals used in nucleic acid sequencing (thereby preventing exposure of the underlying metal film 48) and also the functionalization layer 24, 26. ) can be any inorganic material that has or can be activated to have good adhesion to. Examples of suitable protective materials include silicon dioxide or Ta ₂ O ₅ , which can be silanized to create surface groups to react with the functionalization layers 24, 26. Protective layer 58 may be deposited using any suitable technique and coats metal film 48 as shown in Figure 10A.

A functionalized layer 24 is then deposited over protective layer 58. Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. Functionalization layer 24 is covalently attached to protective layer 58. The deposited functionalized layer 24 is shown in FIG. 10B.

In Figure 10C, negative photoresist 60 is deposited on functionalization layer 24. Any negative photoresist 60 material and any deposition technique described herein may be used.

In this example, developing photosensitive material 50 (e.g., negative photoresist 60) using metal film 48 involves exposing light (e.g., ultraviolet light) through transparent substrates 14, 16. ) involves exposing the negative photoresist 60 to . The thicker metal film 48 (with thicknesses T ₁ and T ₃ ) allows at least 75% of the light transmitted through the transparent substrates 14, 16 to be aligned with the thicker metal film 48, T ₁ , T ₃ It blocks the negative photoresist 60 located at . As such, these parts become fusible. The soluble portion is removed, for example using a developer, exposing the functionalized layer 24 located over the surface 74 and over the interstitial region 22 in the shallow portion 68 of the depression 20'. In contrast, UV light may be transmitted through the thinner metal film 48 (having a thickness T ₂ ) and thus the negative photoresist 60 over the deep portion 66 of the depression 20'. The part becomes insoluble. The resulting structure is shown in Figure 10d.

Modified photosensitive material 50' (e.g., insoluble negative photoresist 60') is then used to create functionalization layer 24 in first predetermined region 54. This involves dry etching the functionalized layer 24 from the shallow portion 68 and interstitial regions 22 of each multi-depth depression 20', such that the protective layer 58 is formed in each multi-depth depression (20'). 20'), with the functionalized layer 24 remaining in the deep portion 66 of each multi-depth depression 20'. . The dry etch process used to remove functionalized layer 24 may be performed using a plasma such as 100% O ₂ plasma, air plasma, argon plasma, etc. This etching process will remove the first functionalized layer 24 in the shallow portions 68 and will also remove the portion of the first functionalized layer 24 above the interstitial regions 22. Protective layer 58 acts as an etch stop. As shown in Figure 10E, after dry etching, the functionalized layer 24 remains in the deep portion 66 of the depression 20'.

This exemplary method exposes the second functionalized layer 26 over the insoluble negative photoresist 60' and in the shallow portions 68 and interstitial regions 22 of each multi-depth depression 20'. depositing on the protective layer 58 (FIG. 10f); removing the insoluble negative photoresist 60', exposing the functionalized layer 24 over the deep portion 66 of each multi-depth depression 20' (FIG. 10G); and removing the second functionalized layer 26 from the gap region 22 (FIG. 10H).

As shown in FIG. 10F , a second functionalized layer 26 may then be applied over the protective layer 58 in shallow portions 68 and interstitial regions 22 . The second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) may be applied using any suitable deposition technique. In this example, a second functionalization layer 26 is also applied over the insoluble negative photoresist 60'.

Removal of the insoluble negative photoresist 60' may then be performed, as shown in FIG. 10G, to expose the functionalized layer 24 in the deep portion 66 of the depression 20'. The insoluble negative photoresist 60' is insoluble in the developer, but is soluble (at least 99% soluble) in the remover. Suitable strippers may include those in dimethyl sulfoxide (DMSO) or acetone using sonication, or using N-methyl-2-pyrrolidone (NMP) based strippers. This process removes i) at least 99% of the insoluble negative photoresist 60' and ii) the functionalization layer 26 positioned thereon.

The second functionalized layer 26 is then removed from the protective layer 58 over the gap region 22 using, for example, polishing as described with reference to Figure 8I. The resulting structure is shown in Figure 10h.

Although not shown, the method shown in FIGS. 10A-10H also includes attaching each primer set 30, 32 to the functionalization layer 24, 26. In some examples, primers 34, 36 or 34', 36' (not shown in FIGS. 10A-10H) may be pre-grafted into functionalization layer 24. Similarly, primers 38, 40 or 38', 40' (not shown in FIGS. 10A-10H) may be pre-grafted into functionalization layer 26. In this example, no additional primer grafting is performed.

In another example, primers 34, 36 or 34', 36' are not pre-grafted into functionalized layer 24. In this example, primers 34, 36 or 34', 36' may be grafted after functionalization layer 24 is applied (e.g., in FIG. 10B). In this example, primers 38, 40 or 38', 40' may be pre-grafted into second functionalized layer 26. Alternatively, in this example, 38, 40 or 38', 40' may not be pre-grafted to the second functionalized layer 26. Rather, primers 38, 40 or 38', 40' are (i) functionalized layer 26 (with functionalized layer 24) for attaching primers 38, 40 or 38', 40'. functionalization with different functional groups (in instances where the functionalization layer 24 is exposed) or ii) using, for example, Staudinger reduction to amines or further click reactions with inert molecules such as hexic acid. As long as any unreacted functional groups in layer 24 are quenched (in instances where functionalized layer 24 is exposed), or iii) the insoluble negative photoresist 60' is still in place (FIG. 10F), the second After the functionalization layer 26 is applied (e.g., in Figure 10F, or Figure 10G, or Figure 10H), it may be grafted.

When grafting is performed during the method, the grafting may be accomplished using any of the grafting techniques described herein.

Although a single set of functionalization layers 24, 26 is shown in FIG. 10H, the method described with reference to FIGS. 10A-10H can be used to spread the multilayer structure 16 across the surface of the support 14 or resin layer 18. It should be understood that this can be done to create an array of depressions 20' (with functionalized layers 24, 26 therein) separated by a protective layer 58 over interstitial regions 22.

Another method is shown in Figures 11A-11H.

In the method of Figures 11A-11H, photosensitive material 50 is positive photoresist 52; Positive photoresist 50 is deposited in direct contact with functionalization layer 24; Using metal film 48 to develop photosensitive material 50 involves exposing positive photoresist 52 to light through transparent substrates 14, 16, forming each multi-depth depression ( The portion of positive photoresist 52 overlying the deep portion 66 of each multi-depth depression 20′) becomes soluble, overlying the shallow portion 68 of each multi-depth depression 20′ and overlying the gap region 22. A portion of positive photoresist 52 defines an insoluble positive photoresist 52'; The insoluble positive photoresist 52' is a modified photosensitive material 50'; The shallow portion 68 of each multi-depth depression 20' and gap region 22' is a first predetermined region 54.

In this exemplary method, as shown in FIGS. 11A and 11B, prior to depositing photosensitive material 50 over metal film 48, the method deposits protective layer 58 in direct contact with metal film 48. ordering step; and depositing the functionalized layer (24) in direct contact with the protective layer (58).

In this example, the protective layer 58 has high resistance to degradation by chemicals used in nucleic acid sequencing (thereby preventing exposure of the underlying metal film 48) and also the functionalization layer 24, 26. ) can be any inorganic material that has or can be activated to have good adhesion to. Examples of suitable protective materials include silicon dioxide or Ta ₂ O ₅ , which can be silanized to create surface groups to react with the functionalization layers 24, 26. Protective layer 58 may be deposited using any suitable technique and coats metal film 48 as shown in FIG. 11A.

A functionalized layer 24 is then deposited over protective layer 58. Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. Functionalization layer 24 is covalently attached to protective layer 58. The deposited functionalized layer 24 is shown in FIG. 11B.

In Figure 11C, positive photoresist 52 is deposited on functionalization layer 24. Any positive photoresist 52 material and any deposition technique described herein may be used.

In this example, developing photosensitive material 50 (e.g., positive photoresist 52) using metal film 48 allows light (e.g., ultraviolet light) to pass through transparent substrates 14, 16. ) involves exposing the positive photoresist 52 to . The thicker portion of the metal film 48 (with a thickness T ₁ or a thickness T ₃ ) allows at least 75% of the light transmitted through the transparent substrates 14, 16 to pass through the thicker metal film 48, T ₁ , T ₃ is blocked from reaching the positive photoresist 52 located in a straight line. As such, these portions become insoluble portions 50', 52' as shown in Figure 11D. In contrast, UV light may be transmitted through the thinner metal film 48 (having a thickness T ₂ ) and thus the positive photoresist 52 over the deep portion 66 of the depression 20'. Part becomes soluble. The soluble portion is removed, for example by a developer, exposing the functionalized layer 24 formed on the thinner metal film 48, T ₂ , present in the deep portion 66 of the depression 20'. The resulting structure is shown in Figure 11d.

Modified photosensitive material 50' (e.g., insoluble positive photoresist 52') is then used to create functionalization layer 24 in first predetermined region 54. This removes the functionalized layer 24 from the deep portion 66 of each multi-depth depression 20', such that the protective layer 58 is left in the deep portion 66 of each multi-depth depression 20'. 66), with the functionalized layer 24 remaining over the shallow portion 68 and interstitial region 22 of each multi-depth depression 20'. In this example, removing functionalization layer 24 involves ashing functionalization layer 24. To ash the functionalized layer 24, oxygen plasma, air plasma, or other gaseous plasma is used. The resulting structure is shown in Figure 11e.

This exemplary method places a second functionalized layer 26 over an insoluble positive photoresist 52' and a protective layer 58 exposed in the deep portion 66 of each multi-depth depression 20'. depositing on top (Figure 11f); Removing the insoluble positive photoresist 52', exposing the functionalized layer 24 over the shallow portion 68 of each multi-depth depression 20' and over the interstitial region 22 (FIG. 11G ); and removing the functionalized layer 24 from the interstitial region 22 (FIG. 11H).

As shown in FIG. 11F, a second functionalized layer 26 is applied over the protective layer 58 in the deep portion 66. In this example, a second functionalization layer 26 is also applied over the insoluble positive photoresist 52'. The second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) may be applied using any suitable deposition technique.

Thereafter, the insoluble positive photoresist 52' may be removed. The insoluble positive photoresist 52' can be removed using a remover such as dimethyl sulfoxide (DMSO) using sonication, or acetone, or propylene glycol monomethyl ether acetate, or based on N-methyl-2-pyrrolidone (NMP). It can be lifted off using a stripper. The lift off process removes i) at least 99% of the insoluble positive photoresist 52' and ii) the functionalization layer 26 positioned thereon. After this removal process, the functionalized layer 24 over the shallow portion 68 of the depression 20' and the interstitial region 22 is exposed. The functionalized layer 24 remains intact because it is covalently attached to the protective layer 58.

The functionalized layer 24 is then removed from the protective layer 58 over the gap region 22 using, for example, polishing as described with reference to Figure 8I. The resulting structure is shown in Figure 11h.

Although not shown, the method shown in FIGS. 11A-11H also includes attaching each primer set 30, 32 to the functionalization layer 24, 26. In some examples, primers 34, 36 or 34', 36' (not shown in FIGS. 11A-11H) may be pre-grafted into functionalization layer 24. Similarly, primers 38, 40 or 38', 40' (not shown in FIGS. 11A-11H) may be pre-grafted into functionalization layer 26. In this example, no additional primer grafting is performed.

In another example, primers 34, 36 or 34', 36' are not pre-grafted into functionalized layer 24. In this example, primers 34, 36 or 34', 36' may be grafted after functionalization layer 24 is applied (e.g., in FIG. 11B). In this example, primers 38, 40 or 38', 40' may be pre-grafted into second functionalized layer 26. Alternatively, in this example, 38, 40 or 38', 40' may not be pre-grafted to the second functionalized layer 26. Rather, primers 38, 40 or 38', 40' are (i) functionalized layer 26 (with functionalized layer 24) for attaching primers 38, 40 or 38', 40'. functionalization with different functional groups (in instances where the functionalization layer 24 is exposed) or ii) using, for example, Staudinger reduction to amines or further click reactions with inert molecules such as hexic acid. As long as any unreacted functional groups in layer 24 are quenched (in instances where functionalized layer 24 is exposed), or iii) the insoluble negative photoresist 52' is still in place (FIG. 11f), the second After the functionalization layer 26 is applied (e.g., in Figure 11F, or Figure 11G, or Figure 11H), it may be grafted.

When grafting is performed during the method, the grafting may be accomplished using any of the grafting techniques described herein.

Although a single set of functionalization layers 24, 26 is shown in FIG. 11H, the method described with reference to FIGS. 11A-11H can be used to spread the multilayer structure 16 across the surface of the support 14 or resin layer 18. It should be understood that this can be done to create an array of depressions 20' (with functionalized layers 24, 26 therein) separated by a protective layer 58 over interstitial regions 22.

Method for manufacturing flow cell structures with resins of various thicknesses

Another example of the method disclosed herein uses resin layers of varying thickness and UV transmission characteristics to create a mask used to pattern a photosensitive material 50, which in turn creates a mask used to pattern the functionalized layer(s) 24, 26) is used to pattern.

This method generally involves depositing a photosensitive material 50 onto a resin layer comprising depressions 20, 20' separated by gap regions 22, wherein the depressions 20, 20' are 1 over a first resin part having a thickness t ₁ , wherein the gap region 22 is over a second resin part having a second thickness t ₂ greater than the first thickness t ₁ ; By irradiating a predetermined dose of ultraviolet light based on the first thickness and the second thickness t ₁ and t ₂ through the resin layer, the photosensitive material 50 on the depressions 20 and 20' is exposed to ultraviolet light. and the second resin portion absorbs the ultraviolet light, thereby defining the modified photosensitive material (50') in the first predetermined region (54) over the resin layer; and creating a functionalized layer (24, 26) over the resin layer in the first predefined area (54) or in the second predefined area (56) using the modified photosensitive material (50').

In this exemplary method, the resin layer is either a single layer base support 14' as described herein or a resin layer 18' in a multi-layer structure 16'. Accordingly, the resin layers in this example are referred to as “resin layers 14', 18'" throughout the description of this method. While a multi-layer structure 16' may be used, the series of figures 12-17 illustrate a resin layer 18' but do not show the underlying base support 17'.

12 and the series of Figures 14-17 show resin layers 14', 18' with depressions 20 or 20' defined therein. The depressions 20 or 20' may be etched, imprinted, or otherwise defined in the resin layers 14', 18' using any suitable technique. In one example, nanoimprint lithography is used.

In some examples, when depressions 20 are used (as shown in FIG. 12A ), depressions 20 are over first resin portions 76 having a first thickness t ₁ and interstitial regions 22 ) is on the second resin portion 78 having a second thickness t ₂ greater than the first thickness t ₁ . The thickness t ₁ , t ₂ depends on the resin layer 14', 18' material and the UV dose to be applied. For example, nanoimprint lithography resins with a thickness t ₁ of 150 nm and a thickness t ₂ of 750 nm can transmit and absorb UV light at a UV dose of 90 mJ/cm ² respectively. For another example, nanoimprint lithography resins with a thickness t ₁ of 150 nm and a thickness t ₂ of 500 nm can transmit and absorb UV light at a UV dose of 30 mJ/cm ² respectively. In this example, the UV dose would have to be increased by a factor of 3 to 4 to penetrate through a part with thickness t ₂ .

In another example, when depressions 20 are used (as shown in Figure 17A), depressions 20 includes n depression subsets 20A, 20B, 20C, etc., where n is 3 or more; Each depression subset 20A, 20B, 20C has a different depth D _A , D _B , D _C than each other depression subset 20A, 20B, 20C. The corresponding resin parts have different thicknesses t _A , t _B , t _C with different UV absorbance characteristics.

When a depression 20' is used, the depression 20' includes a deep portion 66 and a shallow portion 68, as described herein. The depression 20' is shown in Figure 13. In this example, the deep portion 66 is over a first resin portion 76 having a first thickness t ₁ and the interstitial region 22 is a second resin portion 76 having a second thickness t _{2 greater} than the first thickness t 1 . It is above part (78). The shallow portion 68 is above the third resin portion 80 having a third thickness t ₃ . The third thickness t ₃ may block UV light from being transmitted through the resin layers 14', 18' in the third resin portion 80 or the resin layer in the third resin portion 80, depending on the applied UV dose. UV light can be transmitted through (14', 18').

12A to 12F, this method uses resin layers 14' and 18' with depressions 20 defined therein. In this method, photosensitive material 50 is negative photoresist 60; Negative photoresist 60 is deposited in direct contact with functionalization layer 24 (see Figure 12b); After a predetermined dose of ultraviolet light is irradiated through the resin layers 14', 18', the photosensitive material 50 overlying the depressions 20 defines an insoluble negative photoresist 60', and interstitial regions 22 ) the overlying photosensitive material 50 becomes soluble; The insoluble negative photoresist 60' is a modified photosensitive material 50'; The depression 20 is a first predetermined area 54 (see Figure 12D in which the modified photosensitive material 50' is formed).

In this exemplary method, as shown in FIGS. 12B and 12C, prior to depositing the photosensitive material 50, the method involves depositing the functionalized layer 24 in direct contact with the resin layers 14', 18'. Includes additional steps. Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. Functionalization layer 24 is covalently attached to resin layers 14', 18', which may have been exposed to an activation process early in the process. The deposited functionalized layer 24 is shown in FIG. 12B.

As shown in Figure 12C, negative photoresist 60 is deposited on functionalization layer 24. Any example of negative photoresist 60 may be used, and any deposition technique described herein may be used to deposit negative photoresist 60.

As shown in FIG. 12D, a predetermined dose of ultraviolet light is irradiated through the resin layers 14' and 18'. The thicker resin portion 78 (having a thickness t ₂ ) directs at least 75% of the light transmitted through the resin layers 14', 18' to a negative electrode located in line with the thicker resin portion 78, t ₂ . Blocks it from reaching the photoresist 60. As such, these parts become fusible. The soluble portion is removed, for example using a developer, exposing the functionalized layer 24 over the interstitial region 22. In contrast, UV light may be transmitted through the thinner resin portion 76 (having a thickness t ₁ ), thereby rendering the portion of negative photoresist 60 above the depression 20 insoluble. The resulting structure is shown in Figure 12d.

Modified photosensitive material 50' (e.g., insoluble negative photoresist 60') is then used to create functionalization layer 24 in first predetermined region 54. This includes removing the functionalized layer 24 from the gap region 22; and removing the insoluble negative photoresist 60'.

Functionalization layer 24 may be removed from interstitial regions 22 using an ashing process. Insoluble negative photoresist 60' protects the underlying functionalized layer 24 in depressions 20. The gap area 22 exposed after ashing is complete is shown in Figure 12E.

Removal of the insoluble negative photoresist 60' can then be performed to expose the functionalized layer 24 in the depressions 20. The insoluble negative photoresist 60' is insoluble in the developer, but is soluble (at least 99% soluble) in the remover. Suitable strippers may include those in dimethyl sulfoxide (DMSO) or acetone using sonication, or using N-methyl-2-pyrrolidone (NMP) based strippers. The resulting structure is shown in Figure 12f.

Although not shown, this method also includes attaching primer set 29 to functionalization layer 24. In some examples, primers 31, 33 (not shown in FIGS. 12A-12F) may be pre-grafted into functionalization layer 24. In this example, no additional primer grafting is performed.

In another example, primers 31 and 33 are not pre-grafted into functionalized layer 24. In this example, primers 31 and 33 may be grafted after functionalization layer 24 is applied (e.g., in Figure 12B or Figure 12F).

When grafting is performed during the method, the grafting may be accomplished using any suitable grafting technique disclosed herein. When grafting is performed after removing the insoluble negative photoresist 60', the primers 31, 33 are attached to the reactive groups of the functionalized layer 24 in the depressions 20 and are attached to the gap regions 22. There is no affinity.

Although a single depression 20 and functionalized layer 24 are shown in Figure 12F, the method described with reference to Figures 12A-12F can be performed to form a surface of base support 14' or resin layer 18'. It should be understood that an array of functionalized depressions separated by interstitial regions 22 can be created.

12A to 12F, the base support 14' or the resin layer 18' may absorb ultraviolet light and visible light equally or may be embedded with particles that absorb ultraviolet light better than visible light. there is. These particles have a visible light transmittance of at least 0.25, thereby improving the transmittance of the wavelengths used during nucleic acid sequencing. The particles may transmit the same or less UV light used for patterning, for example, may have a UV light transmittance of 0.25 or less. These particles can help increase the visible light transmittance of the base support 14' or resin layer 18' without detrimentally affecting the desired UV transmittance change. Some examples of suitable particles include tantalum pentoxide, zinc oxide, titanium oxide sol-gel, and the like.

In the series of Figures 14-16, each depression defined in the resin layers 14', 18' is a multi-depth depression comprising a deep portion 66 and a shallow portion 68 adjacent to the deep portion 66. It is wealth (20'). An example of this multi-depth depression is shown and explained with reference to FIG. 13 .

Two example methods are shown in Figures 14A-14J. One example method is shown in FIGS. 14A-14G and another example method is shown in FIGS. 14A-14E and 14H-14J.

In the portion of the method shown in FIGS. 14A-14E, photosensitive material 50 is positive photoresist 52; Positive photoresist 52 is deposited in direct contact with functionalization layer 24; After a predetermined dose of ultraviolet light is irradiated through the resin layers 14', 18', the portion of positive photoresist 52 overlying the deep portion 66 of each multi-depth depression 20' becomes soluble. wherein the portion of positive photoresist 52 overlying the shallow portion 68 of each multi-depth depression 20' and overlying the interstitial region 22 defines an insoluble positive photoresist 52'; The insoluble positive photoresist 52' is a modified photosensitive material 50'; Shallow portion 68 and interstitial region 22 of each multi-depth depression 20' is a first predefined region 54 (defined by first functionalized layer 24).

In this exemplary method, as shown in FIGS. 14A and 14B, prior to depositing the photosensitive material 50, the method includes depositing the functionalized layer 24 in direct contact with the resin layers 14', 18'. Includes additional steps. Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. Functionalization layer 24 is covalently attached to resin layers 14', 18', which may have been exposed to an activation process early in the process. The deposited functionalized layer 24 is shown in Figure 14A.

Photosensitive material 50 (positive photoresist 52 in this example) is deposited over functionalization layer 24 using any suitable deposition technique. The deposited photosensitive material 50 is shown in Figure 14B.

As shown in FIG. 14C, a predetermined dose of ultraviolet light is irradiated through the resin layers 14' and 18'. The thicker portions 78, 80 of the resin layers 14', 18' (having thickness t ₂ or thickness t ₃ ) allow at least 75% of the light transmitted through the resin layers 14', 18' These portions 78, t ₂ and 80, t ₃ are blocked from reaching the positive photoresist 52 located above. As such, these portions become insoluble portions 50', 52' as shown in Figure 14c. In contrast, UV light may be transmitted through the thinner portion 76 (having a thickness t ₁ ) and thus the portion of positive photoresist 52 above the deeper portion 66 of the depression 20'. becomes soluble. The soluble portion is removed, for example by a developer, exposing the functionalized layer 24 formed on the thinner portion 76, t ₁ , present in the deep portion 66 of the depression 20'. The resulting structure is shown in Figure 14c.

Modified photosensitive material 50' (e.g., insoluble positive photoresist 52') is then used to create functionalization layer 24 in first predetermined region 54. This removes the functionalized layer 24 from the deep portion 66 of each multi-depth depression 20', so that the resin layers 14', 18' are removed from the deep portion 66 of each multi-depth depression 20'. exposing the deep portion 66 of the , and the functionalized layer 24 remaining over the shallow portion 68 and interstitial region 22 of each multi-depth depression 20'. In this example, removing the functionalized layer 24 involves ashing the functionalized layer 24 using a suitable plasma. The resulting structure is shown in Figure 14d.

The exemplary method shown in FIGS. 14A-14G deposits the second functionalized layer 26 over the insoluble positive photoresist 52' and into the deep portion 66 of each multi-depth depression 20'. Depositing over exposed resin layers 14', 18' (FIG. 14E); Removing the insoluble positive photoresist 52', exposing the functionalized layer 24 over the shallow portion 68 of each multi-depth depression 20' and over the interstitial region 22 (FIG. 14F) ); and removing the functionalized layer 24 from the interstitial region 22 (FIG. 14G).

As shown in Figure 14E, the second functionalized layer 26 is over the insoluble positive photoresist 52' and the resin layer exposed in the deep portion 66 of each multi-depth depression 20'. It is applied on (14', 18'). The second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) may be applied using any suitable deposition technique.

Thereafter, the insoluble positive photoresist 52' may be removed. The insoluble positive photoresist 52' can be removed using a remover such as dimethyl sulfoxide (DMSO) using ultrasonic treatment, or acetone, or propylene glycol monomethyl ether acetate, or N-methyl-2-pyrrolidone (NMP) based strippers. It can be lifted off using: The lift off process removes i) at least 99% of the insoluble positive photoresist 52' and ii) the functionalization layer 26 positioned thereon. After this removal process, the functionalized layer 24 over the shallow portion 68 of the depression 20' and the interstitial region 22 is exposed. The functionalized layer 24 remains intact because it is covalently attached to the resin layers 14', 18'. This is shown in Figure 14f.

The functionalized layer 24 is then removed from the resin layers 14', 18' over the interstitial regions 22 using, for example, polishing as described with reference to Figure 8I. The resulting structure is shown in Figure 14g.

Referring back to FIG. 14D, the exemplary method shown in FIGS. 14A-14E and 14H-14J deposits the second functionalization layer 26 over the insoluble positive photoresist 52', and in each multi-depth depositing over the exposed resin layers 14', 18' in the deep portion 66 of the depression 20' (FIG. 14E); Removing the insoluble positive photoresist 52', exposing the functionalized layer 24 over the shallow portion 68 of each multi-depth depression 20' and over the interstitial region 22 (FIG. 14F) (similar to the example shown in ); Depositing a negative photoresist (60) over the functionalized layer (24) and the second functionalized layer (26) (FIG. 14H); By irradiating a second ultraviolet light dose higher than the predetermined ultraviolet light dose through the resin layers 14', 18', the negative photoresist 60 over the deep portion 66 and over the shallow portion 68 is exposure to ultraviolet light to produce an insoluble negative photoresist 60', with the negative photoresist 60 over the interstitial regions 22 becoming soluble (FIG. 14I); removing the functionalized layer 24 from the interstitial region 22 (FIG. 14J); and removing the insoluble negative photoresist 60' (FIG. 14J).

As explained with reference to Figure 14E, the second functionalized layer 26 is exposed resin over the insoluble positive photoresist 52' and in the deep portion 66 of each multi-depth depression 20'. It may be deposited on layers 14', 18'. As described with reference to FIG. 14E , the insoluble positive photoresist 52' is removed to form a functionalized layer 24 over the shallow portion 68 of each multi-depth depression 20' and in the interstitial regions. (22) Can be exposed above.

As shown in Figure 14h, negative photoresist 60 is deposited on functionalization layers 24, 26. Any example of negative photoresist 60 may be used, and any deposition technique described herein may be used to deposit negative photoresist 60.

As shown in FIG. 14I, a second predetermined dose of ultraviolet light is irradiated through the resin layers 14' and 18'. The thickest resin portion 78 (having a thickness t ₂ ) directs at least 75% of the light transmitted through the resin layers 14', 18' to a negative electrode located in line with the thickest resin portion 78, t ₂ . The second ultraviolet light dose is higher than the predetermined ultraviolet light dose (applied in Figure 14C) to block it from reaching the photoresist 60. As such, these parts become fusible. The soluble portion is removed, for example using a developer, exposing the functionalized layer 24 over the interstitial region 22. In contrast, UV light may be transmitted through the thinner resin portions 76, 80 (having thickness t ₁ and thickness t ₃ ) and thus the negative photoresist 60 above the depression 20'. The part becomes insoluble. Insoluble negative photoresist 60' is shown in Figure 14I.

Functionalization layer 24 may be removed from interstitial region 22 using an ashing process (eg, performed with a plasma such as 100% O ₂ plasma, air plasma, argon plasma, etc.). An insoluble negative photoresist 60' protects the underlying functionalized layers 24, 26' in the depressions 20'. The gap area 22 exposed after ashing is complete is shown in Figure 14j.

Removal of the insoluble negative photoresist 60' can then be performed to expose the functionalized layers 24 and 26 in the depressions 20'. The insoluble negative photoresist 60' is insoluble in the developer, but is soluble (at least 99% soluble) in the remover. Suitable strippers may include those in dimethyl sulfoxide (DMSO) or acetone using sonication, or using N-methyl-2-pyrrolidone (NMP) based strippers. The resulting structure is shown in Figure 14j.

Although not shown, the method shown in FIG. 14 also includes attaching each primer set 30, 32 to the functionalization layer 24, 26. In some examples, primers 34, 36 or 34', 36' (not shown in FIGS. 14A-14J) may be pre-grafted into functionalization layer 24. Similarly, primers 38, 40 or 38', 40' (not shown in FIGS. 14A-14J) can be pre-grafted into functionalization layer 26. In this example, no additional primer grafting is performed.

In another example, primers 34, 36 or 34', 36' are not pre-grafted into functionalized layer 24. In this example, primers 34, 36 or 34', 36' may be grafted after functionalization layer 24 is applied (e.g., in Figure 14A). In this example, primers 38, 40 or 38', 40' may be pre-grafted into second functionalized layer 26. Alternatively, in this example, 38, 40 or 38', 40' may not be pre-grafted to the second functionalized layer 26. Rather, primers 38, 40 or 38', 40' are (i) functionalized layer 26 (with functionalized layer 24) for attaching primers 38, 40 or 38', 40'. functionalization with different functional groups (in instances where the functionalization layer 24 is exposed) or ii) using, for example, Staudinger reduction to amines or further click reactions with inert molecules such as hexic acid. As long as any unreacted functional groups in layer 24 are quenched (in instances where functionalized layer 24 is exposed), or iii) the insoluble negative photoresist 52' is still in place (FIG. 14E), the second The functionalization layer 26 may be grafted after it is applied (e.g., at any point from FIG. 14E, or 14J).

When grafting is performed during the method, the grafting may be accomplished using any of the grafting techniques described herein.

Although a single set of functionalization layers 24, 26 is shown in FIGS. 14G and 14J, the method described with reference to FIGS. 14A-14J can be used to form a support 14' or a resin layer 18' of a multilayer structure 16'. It should be understood that this can be done to create an array of depressions 20' (with functionalized layers 24, 26 therein) separated by interstitial regions 22 over the surface of ).

Another example method is shown in Figures 15A-15H.

At the beginning of the process, if the resin layers 14', 18' do not contain surface groups covalently attached to the functionalization layers 24, 26, the resin layers 14', 18' are first coated with, for example, silane. It can be activated through fire or plasma ashing. If the resin layers 14', 18' include surface groups covalently attached to the functionalization layers 24, 26, the activation process is not performed.

In this method, photosensitive material 50 is positive photoresist 52; Positive photoresist 52 is deposited in direct contact with the resin layers 14', 18'; After a predetermined dose of ultraviolet light is irradiated through the resin layers 14', 18', the portion of positive photoresist 52 overlying the deep portion 66 of each multi-depth depression 20' becomes soluble. wherein the portion of positive photoresist 52 overlying the shallow portion 68 of each multi-depth depression 20' and overlying the interstitial region 22 defines an insoluble positive photoresist 52'; The insoluble positive photoresist 52' is a modified photosensitive material 50'; The shallow portion 66 and interstitial region 22 of each multi-depth depression 20' is a first predetermined region 54 (FIG. 15C in which modified photosensitive material 50' is formed); The deep portion 66 of each multi-depth depression 20' is the second predefined region 56 (FIGS. 15C and 15D where the functionalized layer 24 is formed).

As shown in Figure 15A, positive photoresist 52 is deposited on resin layers 14', 18'. Any example of positive photoresist 52 may be used, and any deposition technique described herein may be used to deposit positive photoresist 52.

As shown in FIG. 15B, a predetermined dose of ultraviolet light is irradiated through the resin layers 14' and 18'. The thicker portions 78, 80 of the resin layers 14', 18' (having thickness T ₂ or thickness T ₃ ) allow at least 75% of the light transmitted through the resin layers 14', 18'. These portions 78, T ₂ and 80, T ₃ are blocked from reaching the positive photoresist 52 located above. As such, these portions become insoluble portions 50', 52'. In contrast, UV light may be transmitted through the thinner portion 76 (having a thickness t ₁ ) and thus the portion of positive photoresist 52 above the deeper portion 66 of the depression 20'. becomes soluble. The soluble portion is removed, for example by a developer, to form a resin layer over the thinner portions 76 of the resin layers 14', 18' present in the deep portion 66 of the depression 20', _t1 . (14', 18') are exposed. The resulting structure is shown in Figure 15b.

In this exemplary method, using the modified photosensitive material 50' to create the functionalization layer 24 in the second predetermined region 56 forms the functionalization layer 24 with an insoluble positive photoresist 52. ') and over the exposed resin layers 14', 18' in the deep portion 66 of each multi-depth depression 20' (FIG. 15C); and removing the insoluble positive photoresist 52', exposing the shallow portion 68 and interstitial regions 22 of each multi-depth depression 20' (FIG. 15D).

Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. Functionalization layer 24 is covalently attached to resin layers 14', 18' in deep portion 66. The deposited functionalized layer 24 is shown in Figure 15C.

The insoluble positive photoresist 52' can then be removed as shown in FIG. 15D. The insoluble positive photoresist 52' can be removed using a remover such as dimethyl sulfoxide (DMSO) using ultrasonic treatment, or acetone, or propylene glycol monomethyl ether acetate, or N-methyl-2-pyrrolidone (NMP) based strippers. It can be lifted off using: The lift off process removes i) at least 99% of the insoluble positive photoresist 52' and ii) the functionalization layer 24 positioned thereon. After this removal process, the functionalized layer 24 is present in the deep portion 66 of the depression 20', and the resin layers 14', 18' and interstitial regions 22 are present in the shallow portion 68. exposed.

The exemplary method shown in FIGS. 15A-15H is to apply the second positive photoresist 52-2 to the deep portion 66 of each multi-depth depression 20', to each multi-depth depression 20. depositing on the functionalized layer 24 in the shallow portion 68 of the ') and interstitial regions 22 (FIG. 15E); By irradiating a second ultraviolet light dose higher than the predetermined ultraviolet light dose through the resin layer 14, the second positive photoresist 52-2 over the deep portion 66 and over the shallow portion 68 is formed. exposing the second positive photoresist 52-2 to ultraviolet light, becoming soluble, and overlying the gap region 22, creating a second insoluble positive photoresist 52'-2 (FIG. 15F); removing the soluble second positive photoresist 52-2, re-exposing the shallow portion 68 of each multi-depth depression 20' (FIG. 15F); A second functionalized layer 26 is placed over the insoluble positive photoresist 52'-2 and exposed resin layers 14', 18' in the shallow portions 68 of each multi-depth depression 20'. ) depositing on top (FIG. 15g); and removing the second insoluble positive photoresist 52'-2 to expose the gap region 22 (FIG. 15H).

As shown in Figure 15E, a second positive photoresist 52-2 is deposited on the exposed portions of the resin layers 14', 18' and the functionalized layer 24. Any example of positive photoresist 52 may be used, and any deposition technique described herein may be used to deposit positive photoresist 52.

As shown in FIG. 15F, a second predetermined dose of ultraviolet light is irradiated through the resin layers 14' and 18'. The thickest resin portion 78 (having a thickness t ₂ ) directs at least 75% of the light transmitted through the resin layers 14', 18' to the second layer located in line with the thickest resin portion 78, t ₂ . 2 The second ultraviolet light dose is higher than the predetermined ultraviolet light dose (applied in FIG. 15B) to block it from reaching the positive photoresist 52. As such, this portion becomes the second insoluble positive photoresist 52'-2. In contrast, UV light may be transmitted through the thinner resin portions 76, 80 (having thickness t ₁ and thickness t ₃ ), and thus the portion of positive photoresist 52 above depression 20. becomes soluble. The soluble portion is removed, for example using a developer, exposing the functionalized layer 24 over the deep portion 66 and the resin layers 14', 18 in the shallow portion 68.

Thereafter, the second functionalized layer 26 is deposited over the insoluble positive photoresist 52'-2 and the resin layer 14' exposed in the shallow portion 68 of each multi-depth depression 20'. 18') is applied on top. In this example, the second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) is reacted under high ionic strength (e.g., in the presence of 10x PBS, NaCl, KCl, etc. under) may be applied using any suitable deposition technique. Under these conditions, the second functionalized layer 26 does not deposit on or adhere to the first functionalized layer 24. As such, the second functionalized layer 26 does not contaminate the first functionalized layer 24.

Thereafter, the second insoluble positive photoresist 52'-2 may be removed from the gap region 22. The insoluble positive photoresist 52' can be removed using a remover such as dimethyl sulfoxide (DMSO) using ultrasonic treatment, or acetone, or propylene glycol monomethyl ether acetate, or N-methyl-2-pyrrolidone (NMP) based strippers. It can be lifted off using: The lift off process removes i) at least 99% of the second insoluble positive photoresist 52'-2 and ii) the second functionalized layer 26 positioned thereon. After this removal process, the functionalized layers 24, 26 of the depressions 20 remain intact because they are covalently attached to the resin layers 14', 18'.

Although not shown in the Figure 15 series, an alternative method may be performed. In this alternative, after the insoluble positive photoresist 52' is removed (FIG. 15D), the second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) has a high It can be applied using any suitable deposition technique under ionic strength (e.g., in the presence of 10x PBS, NaCl, KCl, etc.). By this deposition technique, the second functionalized layer 26 is not deposited on or attached to the first functionalized layer 24. As such, the second functionalized layer 26 does not contaminate the first functionalized layer 24. Polishing can then be used to remove the second functionalized layer 26 from the interstitial regions 22, creating the structure shown in FIG. 15H.

Although not shown, the method shown in FIGS. 15A-15H also includes attaching each primer set 30, 32 to the functionalization layer 24, 26. In some examples, primers 34, 36 or 34', 36' (not shown in FIGS. 15A-15H) may be pre-grafted into functionalization layer 24. Similarly, primers 38, 40 or 38', 40' (not shown in FIGS. 15A-15H) may be pre-grafted into functionalization layer 26. In this example, no additional primer grafting is performed.

In another example, primers 34, 36 or 34', 36' are not pre-grafted into functionalized layer 24. In this example, primers 34, 36 or 34', 36' may be grafted after functionalization layer 24 is applied (e.g., in Figure 15C). In this example, primers 38, 40 or 38', 40' may be pre-grafted into second functionalized layer 26. Alternatively, in this example, 38, 40 or 38', 40' may not be pre-grafted to the second functionalized layer 26. Rather, primers 38, 40 or 38', 40' are (i) functionalized layer 26 (with functionalized layer 24) for attaching primers 38, 40 or 38', 40'. as long as any unreacted functional groups of the functionalized layer 24 are quenched, either with different functional groups or ii) using, for example, Staudinger reduction to amines or further click reactions with inert molecules such as hexic acid. , the second functionalized layer 26 may be applied (in Figure 15g or 15h (or alternatively Figure 15d)) and then grafted.

When grafting is performed during the method, the grafting may be accomplished using any of the grafting techniques described herein.

Although a single set of functionalized layers 24, 26 is shown in Figure 15h, the method described with reference to Figures 15a-15h creates interstitial regions 22 across the surface of the support 14 or resin layers 18, 16. It should be understood that this can be done to create an array of depressions 20' (with functionalized layers 24, 26 therein) separated by ).

Another example method is shown in Figures 16A-16I.

At the beginning of the process, if the resin layers 14', 18' do not contain surface groups covalently attached to the functionalization layers 24, 26, the resin layers 14', 18' are first coated with, for example, silane. It can be activated through fire or plasma ashing. If the resin layers 14', 18' include surface groups covalently attached to the functionalization layers 24, 26, the activation process is not performed.

In this method, photosensitive material 50 is positive photoresist 52; Positive photoresist 52 is deposited in direct contact with the resin layers 14', 18' (Figure 16a); After a predetermined dose of ultraviolet light is irradiated through the resin layers 14', 18', the portion of positive photoresist 52 overlying the deep portion 66 of each multi-depth depression 20' becomes soluble. wherein the portion of positive photoresist 52 overlying the shallow portion 68 of each multi-depth depression 20' and overlying the interstitial region 22 defines an insoluble positive photoresist 52'; The insoluble positive photoresist 52' is the modified photosensitive material 50' (FIG. 16B); The shallow portion 66 and interstitial region 22 of each multi-depth depression 20' is a first predefined region 54 (FIG. 16B in which modified photosensitive material 50' is formed); The deep portion 66 of each multi-depth depression 20' is the second predefined region 56 (FIGS. 16C and 16D where the functionalized layer 24 is formed).

As shown in Figure 16A, positive photoresist 52 is deposited on resin layers 14', 18'. Any example of positive photoresist 52 may be used, and any deposition technique described herein may be used to deposit positive photoresist 52.

As shown in FIG. 16B, a predetermined dose of ultraviolet light is irradiated through the resin layers 14' and 18'. The thicker portions 78, 80 of the resin layers 14', 18' (having thickness t ₂ or thickness t ₃ ) allow at least 75% of the light transmitted through the resin layers 14', 18' These portions 78, t ₂ and 80, t ₃ are blocked from reaching the positive photoresist 52 located above. As such, these portions become insoluble portions 50', 52'. In contrast, UV light may be transmitted through the thinner portion 76 (having a thickness t ₁ ) and thus the portion of positive photoresist 52 above the deeper portion 66 of the depression 20'. becomes soluble. The soluble portion is removed, for example by a developer, to form a resin layer over the thinner portions 76 of the resin layers 14', 18' present in the deep portion 66 of the depression 20', _t1 . (14', 18') are exposed. The resulting structure is shown in Figure 16b.

In this exemplary method, using the modified photosensitive material 50' to create the functionalization layer 24 in the second predetermined region 56 comprises forming the functionalization layer 24 with an insoluble positive photoresist 52. ') and over the exposed resin layers 14', 18' in the deep portion 66 of each multi-depth depression 20' (FIG. 16C); and removing the insoluble positive photoresist 52', exposing the shallow portions 68 and interstitial regions 22 of each multi-depth depression 20' (FIG. 16D).

Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. Functionalization layer 24 is covalently attached to resin layers 14', 18' in deep portion 66. The deposited functionalized layer 24 is shown in Figure 16C.

The insoluble positive photoresist 52' can then be removed as shown in FIG. 16D. The insoluble positive photoresist 52' can be removed using a remover such as dimethyl sulfoxide (DMSO) using ultrasonic treatment, or acetone, or propylene glycol monomethyl ether acetate, or N-methyl-2-pyrrolidone (NMP) based strippers. It can be lifted off using: The lift off process removes i) at least 99% of the insoluble positive photoresist 52' and ii) the functionalization layer 24 positioned thereon. After this removal process, the functionalized layer 24 is present in the deep portion 66 of the depression 20', and the resin layers 14', 18' and interstitial regions 22 are present in the shallow portion 68. exposed.

The exemplary method shown in FIGS. 16A-16I applies negative photoresist 60 to the deep portion 66 of each multi-depth depression 20' and the shallow portion 66 of each multi-depth depression 20'. Depositing over the functionalized layer 24 in portions 66 and interstitial regions 22 (FIG. 16E); Irradiating a second dose of ultraviolet light through the resin layers 14', 18', exposing the negative photoresist 60 over the deep portion 66 to the ultraviolet light, creating an insoluble negative photoresist 60'; , the negative photoresist 60 over the shallow portions 66 and gap regions 22 becomes soluble (FIG. 16f); removing the soluble negative photoresist 60 to re-expose the shallow portion 68 and interstitial regions of each multi-depth depression 20' (FIG. 16F); A second functionalized layer 26 is placed over the insoluble negative photoresist 60' and a resin layer 14' exposed in the shallow portions 68 and interstitial regions 22 of each multi-depth depression 20'. , 18') depositing on top (FIG. 16g); removing the insoluble negative photoresist (60'), exposing the functionalized layer (24) over the deep portion (66) of each multi-depth depression (20'); and removing the second functionalized layer 26 from the gap region 22 (FIG. 16I).

As shown in Figure 16E, negative photoresist 60 is deposited on the exposed portions of resin layers 14', 18' and functionalized layer 24. Any example of negative photoresist 60 may be used, and any deposition technique described herein may be used to deposit negative photoresist 60.

As shown in FIG. 16F, a second predetermined dose of ultraviolet light is irradiated through the resin layers 14' and 18'. The thicker portions 78, 80 of the resin layers 14', 18' (having thickness t ₂ or thickness t ₃ ) allow at least 75% of the light transmitted through the resin layers 14', 18'. The second ultraviolet light dose may be equal to the predetermined ultraviolet light dose (applied in FIG. 16B) to block it from reaching the negative photoresist 60 located over these portions 78, t ₂ and 80, t ₃ . there is. As such, these parts become fusible. The soluble portion is removed, for example using a developer, exposing the resin layers 14', 18' in the shallow portions 68 and interstitial regions 22 of each multi-depth depression 20'. In contrast, UV light may be transmitted through the thinner resin portion 76 (having a thickness t ₁ ), thereby exposing the negative photoresist 60 above the deep portion 66 of the depression 20'. The portion becomes an insoluble negative photoresist (60').

A second functionalized layer 26 is then applied over the insoluble negative photoresist 60' and the resin layers 14', 18' exposed in shallow portions 68 and interstitial regions 22. In this example, second functionalized layer 26 (e.g., a gel material forming second functionalized layer 26) may be applied using any suitable deposition technique. The second functionalized layer 26 does not contaminate the first functionalized layer 24 because it is protected by the insoluble negative photoresist 60'. The deposited second functionalized layer 26 is shown in Figure 16g.

Removal of the insoluble negative photoresist 60' may then be performed, as shown in FIG. 16H, to expose the functionalized layer 24 in the deep portion 66 of the depression 20'. The insoluble negative photoresist 60' is insoluble in the developer, but is soluble (at least 99% soluble) in the remover. Suitable strippers may include those in dimethyl sulfoxide (DMSO) or acetone using sonication, or using N-methyl-2-pyrrolidone (NMP) based strippers.

The second functionalized layer 26 is then removed from the gap region 22 using, for example, polishing as described with reference to Figure 8I. The resulting structure is shown in Figure 16i.

Although not shown, the method shown in FIGS. 16A-16I also includes attaching each primer set 30, 32 to the functionalization layer 24, 26. In some examples, primers 34, 36 or 34', 36' (not shown in FIGS. 16A-16I) may be pre-grafted into functionalization layer 24. Similarly, primers 38, 40 or 38', 40' (not shown in FIGS. 16A-16I) can be pre-grafted into functionalization layer 26. In this example, no additional primer grafting is performed.

In another example, primers 34, 36 or 34', 36' are not pre-grafted into functionalized layer 24. In this example, primers 34, 36 or 34', 36' may be grafted after functionalization layer 24 is applied (e.g., in Figure 16C). In this example, primers 38, 40 or 38', 40' may be pre-grafted into second functionalized layer 26. Alternatively, in this example, 38, 40 or 38', 40' may not be pre-grafted to the second functionalized layer 26. Rather, primers 38, 40 or 38', 40' are (i) functionalized layer 26 (with functionalized layer 24) for attaching primers 38, 40 or 38', 40'. functionalization with different functional groups (in instances where the functionalization layer 24 is exposed) or ii) using, for example, Staudinger reduction to amines or further click reactions with inert molecules such as hexic acid. As long as any unreacted functional groups in layer 24 are quenched (in instances where functionalized layer 24 is exposed), or iii) the insoluble negative photoresist 60' is still in place (FIG. 16G), the second After the functionalization layer 26 is applied (e.g., in FIGS. 16G, 16H, or 16I), it may be grafted.

When grafting is performed during the method, the grafting may be accomplished using any of the grafting techniques described herein.

Although a single set of functionalization layers 24, 26 is shown in FIG. 16I, the method described with reference to FIGS. 16A-16I can be used to prepare the support 14' or the resin layer 18' of the multilayer structure 16'. It should be understood that this can be done to create an array of depressions 20'over a surface (with functionalized layers 24, 26 therein) separated by interstitial regions 22.

Another example method is shown in Figures 17A-17J. As shown in Figure 17A, this example includes resin layers 14', 18' having "n" subsets of depressions 20A, 20B, 20C, as defined herein, where n is 3 or more. am. The depression subsets 20A, 20B, 20C may be defined using any suitable technique, such as etching, nanoimprint lithography, etc.

Each of the depression subsets 20A, 20B, and 20C has a different depth D _A , D _B , and D _C than the other depression subsets 20A, 20B, and 20C, respectively. As the depths D _A , D _B , and D _C of the depression subsets 20A, 20B, and 20C decrease, the thicknesses t _A , t _B , and t _C of the lower resin portions 82, 84, and 86 increase. Accordingly, among all subsets 20A, 20B, 20C, the depression subset 20A with the longest depth D _A is above the resin portion 82 with the minimum thickness t _A , and among all subsets 20A, 20B, 20C ), a subset of depressions 20C with a minimum depth D _C is on a resin portion 86 with a maximum thickness t _C .

In this method, photosensitive material 50 is negative photoresist 60; Negative photoresist 60 is deposited in direct contact with functionalization layer 24 (see Figure 17b); After a predetermined dose of ultraviolet light is irradiated through the resin layers 14', 18', the photosensitive material 50 over the first subset of depressions 20A with the longest depth D _A is exposed to an insoluble negative photoresist 60. '), and the photosensitive material 50 over the interstitial region 22 and over the different subsets of depressions 20B and 20C, respectively, having depths D _B and D _C that are less than the longest depth D _A , becomes soluble and ; The insoluble negative photoresist 60' is a modified photosensitive material 50'; The first subset of depressions 20A is the first predefined area 54 (see FIG. 17C in which modified photosensitive material 50' is formed).

In this exemplary method, prior to depositing photosensitive material 50, the method further includes depositing a functionalized layer 24 in direct contact with the resin layers 14', 18'. Functionalization layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition. Functionalization layer 24 is covalently attached to resin layers 14', 18', which may have been exposed to an activation process early in the process. The deposited functionalized layer 24 is shown in FIG. 17B.

As shown in FIG. 17B, negative photoresist 60 is deposited on functionalization layer 24. Any example of negative photoresist 60 may be used, and any deposition technique described herein may be used to deposit negative photoresist 60.

As shown in FIG. 17C, a predetermined dose of ultraviolet light is irradiated through the resin layers 14' and 18'. The predetermined ultraviolet light dose is relatively low, which means that the thicker portions 84, 86 of the resin layers 14', 18' (with thickness t _B or thickness t _C ) It is selected to block at least 75% of the light transmitted through from reaching the negative photoresist 60 located over these portions 84, t _B and 86, t _C. As such, these parts become fusible. The soluble portion is removed using, for example, a developer, exposing the functionalized layer 24 in the depression subsets 20B and 20C, respectively, and in the interstitial region 22. In contrast, UV light may be transmitted through the thinner resin portion 82 (having a thickness t _A ) such that the portion of negative photoresist 60 overlying the depression subset 20A is an insoluble negative photoresist. It becomes resist (60').

In this example, creating a functionalized layer 24 in a first predetermined region using modified photosensitive material 50' may include forming an insoluble negative photoresist 60' in the first subset of depressions 20A. While present, this involves removing the functionalized layer 24 from the interstitial region 22 and from each of the different depression subsets 20B and 20C. In this example, removing the functionalized layer 24 involves ashing the functionalized layer 24 using a suitable plasma. The resulting structure is shown in Figure 17d.

The method shown in FIGS. 17A-17J then deposits a second functionalized layer 26 over the insoluble negative photoresist 60', interstitial regions 22, and different depression subsets 20B and 20C, respectively. step (FIG. 17e); removing the insoluble negative photoresist 60', exposing the functionalized layer 24 of the first subset of depressions 20A (FIG. 17F); Depositing a second negative photoresist 60-2 over the functionalized layer 24 of the first depression subset 20A, each of the other depression subsets 20B and 20C, and over the interstitial regions 22. step (FIG. 17f); A second ultraviolet light dose higher than a predetermined ultraviolet light dose is irradiated through the resin layers 14', 18' to form a second longest depth of the functionalized layer 24 of the first subset of depressions 20A. A second negative photoresist 60-2 over the second depression subset 20B having D _B defines a second insoluble negative photoresist 60', over the gap region 22, and overlying the second negative photoresist 60-2. The second negative photoresist 60-2 over each different subset of depressions 20C having a depth D _C less than the longest depth D _B becomes soluble (FIG. 17G); and while the second insoluble negative photoresist (60'-2) is present in the first and second depression subsets (20A, 20B), the second functionalized layer (26) is removed from the interstitial region (22) and 2. Removing from each different subset of depressions 20C having a depth D _C less than the longest depth D _B .

With specific reference to Figure 17E, second functionalized layer 24 may be any of the gel materials described herein and may be applied using any suitable method. The curing process may be performed after deposition.

Removal of the insoluble negative photoresist 60' may then be performed to expose the functionalized layer 24 in the depression subset 20A. The insoluble negative photoresist 60' is insoluble in the developer, but is soluble (at least 99% soluble) in the remover. Suitable strippers may include those in dimethyl sulfoxide (DMSO) or acetone using sonication, or using N-methyl-2-pyrrolidone (NMP) based strippers.

After the insoluble negative photoresist 60' is removed, a second negative photoresist 60-2 is deposited on the functionalization layers 24, 26, as shown in Figure 17F. Any example of negative photoresist 60 may be used for second negative photoresist 60-2, and any deposition technique described herein may be used to deposit second negative photoresist 60-2. there is.

As shown in Figure 17g, a second dose of ultraviolet light is irradiated through the resin layers 14' and 18'. The second predetermined ultraviolet light dose is higher than the predetermined ultraviolet light dose, which means that the thickest portion 86 of the resin layer 14', 18' (having a thickness t _C ) is This portion 86 is selected to block at least 75% of the light transmitted through from reaching the second negative photoresist 60-2 located above _tC . As such, these parts become fusible. The soluble portion is removed, for example using a developer, exposing the functionalized layer 26 in the depression subset 20C and interstitial regions 22. In contrast, UV light may be transmitted through thinner resin portions 82, 84 (having thickness t _A or thickness t _B ) and thus the second negative photoresist of the depression subsets 20A, 20B. The portion of (60-2) becomes an insoluble negative photoresist (60').

The second functionalized layer 26 is then removed, for example via ashing using a suitable plasma. As shown in FIG. 17I (e.g., when negative photoresist 60-3 is not present), this process creates a subset of depressions 20C with a third longest depth D _C and a gap region 22. ) is exposed.

The process described in Figures 17F-17H is repeated using third functionalized layer 88 (see Figure 17H) and third negative photoresist 60-3 (see Figure 17I). The method comprises forming the third functionalized layer 88 into a second insoluble negative photoresist 60'-2, a gap region 22, and a different subset of depressions, each having a depth D _C less than the second longest depth D _B. depositing on (20C) (Figure 17h); The second insoluble negative photoresist 60'-2 is removed to form the functionalized layer 24 of the first subset of depressions 20A and the second functionalized layer 26 of the second subset of depressions 20B. ) exposing; A third negative photoresist 60-3 was applied over the functionalized layer 24 of the first subset of depressions 20A and over the second functionalized layer 26 of the second subset of depressions 20B. Depositing the third functionalized layer 88 on three depression subsets 20C, each on another depression subset if n is greater than 3, and on interstitial regions 22 (FIG. 17I); A third ultraviolet light dose higher than the second ultraviolet light dose is irradiated through the resin layers 14', 16', over the functionalized layer 24 of the first subset of depressions 20A, and forming the second depressions. A third _negative photoresist (60- 3) defines a third insoluble negative photoresist (not shown), overlying interstitial regions 22 and, when n is greater than 3, a different subset of depressions each having a depth less than the third longest depth D _C The third negative photoresist 60-3 above becomes soluble; and a third functionalized layer (88) from the gap region (22) while a third insoluble negative photoresist is present in the first, second, and third depression subsets (20A, 20B, 20C); If n is greater than 3, removing from each different subset of depressions having a depth less than the third longest depth D _C . Each process described in this paragraph may be performed as described herein. This process results in the structure shown in Figure 17j. This process may be repeated for n subsets of depressions (20A, 20B, 20C, etc.).

Although not shown, the method shown in FIGS. 17A-17J also includes attaching each set of primers to the functionalization layers 24, 26, and 88. Different primer sets (e.g., P5 and P7, PA and PB, and PC and PD) can be used for different functionalization layers (24, 26, 88). In some examples, each primer set may be pre-grafted into the functionalization layer 24, 26, 88. In another example, each set of primers may be pre-grafted onto the functionalization layer 24, 26, 88 after deposition and before creating an insoluble negative photoresist (60', 60'-2, etc.). When grafting is performed during the method, the grafting may be accomplished using any of the grafting techniques described herein.

Although a single set of functionalization layers 24, 26, 88 is shown in FIG. 17J, the method described with reference to FIGS. 17A-17J can be applied to the support 14' or resin layer 18' of the multilayer structure 16'. ) to create an array of depression subsets 20A, 20B, 20C (each having functionalized layers 24, 26, 88 therein) separated by interstitial regions 22 across the surface of It must be understood that it can be done.

To further illustrate the invention, examples are given herein. It should be understood that these examples are provided for illustrative purposes and should not be construed as limiting the scope of the invention.

Non-limiting examples

Example 1

A flow cell containing fused silica and glass substrates and a patterned resin layer was sputter coated (60° angle) with aluminum at room temperature. The flow cell was rotated during sputtering. An SEM image (50,000X magnification) of several depressions is shown in Figure 18A, and a confocal microscope image of the same depressions (reproduced in black and white) is shown in Figure 18B. As illustrated in these figures, the portion of aluminum film formed on the gap region is thicker than the portion of aluminum film formed on the lower surface of the depression.

SEM images of the bottom of one depression and the gap area adjacent to the depression were taken at higher magnification (200,000X). These images are shown in Figure 19a (depression) and Figure 19b (gap area). The thickness of the aluminum film in the depression was measured to be approximately 8.5 nm, and the thickness of the aluminum film in the gap region was measured to be approximately 31 nm. These results illustrate the ability to produce metal films of various thicknesses using sputtering.

Example 2

A workflow similar to that shown in Figures 4A-4G was performed except that no protective layer was included.

Aluminum was sputtered onto the flow cell surface as described in Example 1. PAZAM was deposited on the metal film to coat both interstitial areas and depressions.

Negative photoresist (NR9-1500PY from Futurrex) was deposited on the PAZAM layer. After ultraviolet light (365 nm) was passed through the flow cell substrate, the soluble portion of the negative photoresist was removed in a developer (RD6 (tetramethylammonium hydroxide (TMAH)-based developer) from Futurrex). Afterwards, an SEM image of the surface of the flow cell was taken and shown in Figure 20. As shown, the negative photoresist became insoluble in each depression, thereby illustrating that UV light was transmitted through the thinner portion of the aluminum film. This illustrates that the negative photoresist became soluble across the gap regions, thereby blocking UV light in the thicker portions of the aluminum film.

The PAZAM layer was then plasma etched (150 W O ₂ plasma for approximately 2 minutes) from the interstitial regions, and then the insoluble negative photoresist was lifted off using acetone followed by isopropyl alcohol sonication. Afterwards, a confocal microscope image of the surface of the flow cell was taken and shown in Figure 21. As shown, the PAZAM layer was present in the depressions but not in the interstitial regions.

These results illustrate the ability of metal films of various thicknesses to be used as masks for patterning functionalization layers (e.g., PAZAM) on the flow cell surface.

Example 3

Three flow cells were used in this example, each containing a glass substrate and a nanoimprinted resin layer with depressions. A workflow similar to that shown in Figures 12A-12F was performed. The thickness of the resin layer in the interstitial region was about 500 nm, and the thickness of the resin layer at the bottom of each depression was about 150 nm.

In the first test, negative photoresist (NR9-1500PY from Futurrex) was deposited on the resin layer and ultraviolet light (365 nm) was passed through the flow cell substrate at a dose of 260 mJ/cm ² . Any soluble portion of the negative photoresist was removed in developer (RD6 (tetramethylammonium hydroxide (TMAH) based developer) from Futurrex). An SEM image of the upper portion of the flow cell was taken and shown in Figure 22A. As shown in Figure 22A, an insoluble negative photoresist was created across the flow cell surface. This indicates that the negative photoresist was exposed to UV light in both the thicker and thinner sections, and thus the UV dose for the thicker section was too high.

In a second test, the same negative photoresist was deposited on the resin layer and ultraviolet light (365 nm) was passed through the flow cell substrate at a dose of 90 mJ/cm ² . Any soluble portion of negative photoresist was removed in the same developer solution. An SEM image of the upper portion of the flow cell was taken and shown in Figure 22b. As shown in Figure 22b, insoluble negative photoresist was present in both the depressions and gap regions, but was thicker in the depressions. This indicates that the negative photoresist was more exposed to UV light in the recessed area, indicating that the transmittance was higher in the thin part than in the thick part. However, the presence of insoluble negative photoresist on the gap regions also indicates that a small amount of UV light was transmitted through the thick portion of the resin layer and into the negative photoresist.

In a third test, the same negative photoresist was deposited on the resin layer and ultraviolet light (365 nm) was passed through the flow cell substrate at a dose of 30 mJ/cm ² . Any soluble portion of negative photoresist was removed in the same developer solution. A SEM image of the upper portion of the flow cell was taken and shown in Figure 22C. As shown in Figure 22C, insoluble negative photoresist is present in the depressions but not in the interstitial regions. This indicates that the negative photoresist in the depression was exposed to UV light, while the negative photoresist in the gap region was not exposed to UV light. These results indicate that thicker portions of the resin layer effectively absorbed UV light at lower doses, whereas thinner portions of the resin layer effectively transmitted UV light.

Supplementary Notes

It should be understood that all combinations of the above and additional concepts discussed in more detail below (if the concepts are not mutually inconsistent) are considered to be part of the subject matter disclosed herein. In particular, any combination of claimed subject matter that appears at the end of this disclosure is considered to be part of the subject matter disclosed herein. It is also to be understood that terms explicitly used herein that may also appear in any disclosure incorporated by reference should be given a meaning most consistent with the specific concept disclosed herein.

References throughout this specification to “an example,” “another example,” “an example,” etc. refer to certain elements (e.g., features, structures, and/or characteristics) described in connection with the example. It means that it is included in at least one example described and may or may not be present in other examples. Additionally, it should be understood that elements described in any example may be combined in any suitable way in the various examples unless context clearly indicates otherwise.

Although several examples have been described in detail, it should be understood that the disclosed examples may vary. Accordingly, the above description should be considered non-limiting.

SEQUENCE LISTING <110> Illumina, Inc. Illumina Cambridge Limited <120> FLOW CELLS AND METHODS FOR MAKING THE SAME <130> IP-2152-PCT2 <150> 63/195,126 <151> 2021-05-31 <160> 14 <170> PatentIn version 3.5 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 1 aatgatacgg cgaccaccga gauctacac 29 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <220> <221> misc_feature <222> (22)..(22) <223> 8-oxoguanine or uracil <400> 2 caagcagaag acggcatacg anat 24 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <220> <221> misc_feature <222> (20)..(20) <223> 8-oxoguanine or uracil <400> 3 caagcagaag acggcatacn agat 24 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <220> <221> misc_feature <222> (23)..(23) <223> allyl-T <400> 4 aatgatacgg cgaccaccga ganctacac 29 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 5 gctggcacgt ccgaacgctt cgttaatccg ttgag 35 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 6 ctcaacggat taacgaagcg ttcggacgtg ccagc 35 <210> 7 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 7 cgtcgtctgc catggcgctt cggtggatat gaact 35 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 8 agttcatatc caccgaagcg ccatggcaga cgacg 35 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 9 acggccgcta atatcaacgc gtcgaatccg caact 35 <210> 10 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 10 agttgcggat tcgacgcgtt gatattagcg gccgt 35 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 11 gccgcgttac gttagccgga ctattcgatg cagc 34 <210> 12 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 12 gctgcatcga atagtccggc taacgtaacg cggc 34 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 13 aggagggagga ggaggaggag gagg 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 14 cctcctcctc ctcctcctcc tcct 24

Claims (22)

As a method:
Depositing a photosensitive material over a resin layer comprising depressions separated by interstitial regions, wherein the depressions are over a first resin portion having a first thickness and a second resin portion wherein the interstitial regions have a second thickness greater than the first thickness. A step above the resin part;
By irradiating a predetermined dose of ultraviolet light based on the first thickness and the second thickness through the resin layer, the photosensitive material over the depression is exposed to ultraviolet light and the second resin portion absorbs the ultraviolet light, resulting in altered photosensitivity. defining material in a first predetermined area over the resin layer; and
A method comprising creating a functionalized layer in a first predetermined region or in a second predetermined region over the resin layer using the modified photosensitive material. The method of claim 1 further comprising depositing the functionalized layer in direct contact with the resin layer prior to depositing the photosensitive material. According to paragraph 2,
The photosensitive material is a negative photoresist;
The negative photoresist is deposited in direct contact with the functionalization layer;
After a predetermined dose of ultraviolet light is irradiated through the resin layer, the photosensitive material over the depressions defines an insoluble negative photoresist, and the photosensitive material over the interstitial areas becomes soluble;
Insoluble negative photoresist is a modified photosensitive material;
The method of claim 1, wherein the depression is a first predetermined area. 4. The method of claim 3, wherein creating the functionalization layer in the first predetermined region using the modified photosensitive material comprises:
removing the functionalized layer from the interstitial region; and
A method comprising removing insoluble negative photoresist. 5. The method of claim 4, wherein the resin layer is embedded with particles that absorb ultraviolet light better than visible light. The method of claim 1, wherein each depression is a multi-depth depression comprising a deep portion and a shallow portion adjacent to the deep portion. 7. The method of claim 6, further comprising depositing the functionalized layer in direct contact with the resin layer prior to depositing the photosensitive material. In clause 7,
The photosensitive material is a positive photoresist;
The positive photoresist is deposited in direct contact with the functionalization layer;
After a predetermined dose of ultraviolet light is irradiated through the resin layer, the positive photoresist portion overlying the deep portion of each multi-depth depression becomes soluble, and the positive photoresist portion overlying the shallow portion of each multi-depth depression and overlying the interstitial region. The photoresist portion defines an insoluble positive photoresist;
Insoluble positive photoresist is a modified photosensitive material;
The method of claim 1, wherein the shallow portion and interstitial regions of each multi-depth depression are first predetermined regions. 9. The method of claim 8, wherein creating the functionalized layer using the modified photosensitive material in the first predetermined region comprises removing the functionalized layer from the deep portion of each multi-depth depression, such that the resin layer is formed in each multi-depth depression. A method involving the steps of being exposed in the deep portion of a depth depression, and the functionalized layer remaining over the shallow portion and interstitial regions of each multi-depth depression. According to clause 9,
Depositing a second functionalized layer over the insoluble positive photoresist and over the exposed resin layer in the deep portion of each multi-depth depression;
removing the insoluble positive photoresist, exposing the functionalized layer over the shallow portion of each multi-depth depression and over the interstitial regions; and
The method further comprising removing the functionalized layer from the interstitial region. According to clause 9,
Depositing a second functionalized layer over the insoluble positive photoresist and over the exposed resin layer in the deep portion of each multi-depth depression;
removing the insoluble positive photoresist, exposing the functionalized layer over the shallow portion of each multi-depth depression and over the interstitial regions;
Depositing a negative photoresist over the functionalized layer and the second functionalized layer;
By irradiating a second ultraviolet light dose higher than the predetermined ultraviolet light dose through the resin layer, the negative photoresist overlying the deep portion and overlying the shallow portion is exposed to the ultraviolet light, creating an insoluble negative photoresist over the interstitial regions. The negative photoresist is rendered soluble;
removing the soluble negative photoresist;
removing the functionalized layer from the interstitial region; and
A method further comprising removing the insoluble negative photoresist. According to paragraph 1,
The photosensitive material is a positive photoresist;
Positive photoresist is deposited in direct contact with the resin layer;
After a predetermined dose of ultraviolet light is irradiated through the resin layer, the positive photoresist portion overlying the deep portion of each multi-depth depression becomes soluble, and the positive photoresist portion overlying the shallow portion of each multi-depth depression and overlying the interstitial region. The photoresist portion defines an insoluble positive photoresist;
Insoluble positive photoresist is a modified photosensitive material;
The shallow portion of each depression and the gap region are the first predetermined regions;
The method wherein the deep portion of each multi-depth depression is a second predetermined region. 13. The method of claim 12, wherein creating a functionalization layer in the second predetermined region using the modified photosensitive material comprises:
depositing a functionalized layer over the insoluble positive photoresist and over the exposed resin layer in the deep portion of each multi-depth depression; and
A method comprising removing the insoluble positive photoresist to expose the shallow portions and interstitial regions of each multi-depth depression. According to clause 13,
Depositing a second positive photoresist over the functionalized layer in the deep portion of each multi-depth depression, the shallow portion of each multi-depth depression, and the interstitial region;
By irradiating a second ultraviolet light dose higher than the predetermined ultraviolet light dose through the resin layer, the second positive photoresist overlying the deep portion and over the shallow portion is exposed to the ultraviolet light, becomes soluble, and overlies the interstitial region. The second positive photoresist includes creating a second insoluble positive photoresist;
removing the soluble second positive photoresist to re-expose the shallow portion of each multi-depth depression;
Depositing a second functionalized layer over the second insoluble positive photoresist and over the resin layer exposed in the shallow portion of each multi-depth depression; and
The method further comprising removing the second insoluble positive photoresist, thereby exposing the interstitial regions. According to clause 13,
Depositing a negative photoresist over the functionalized layer in the deep portion of each multi-depth depression, the shallow portion of each multi-depth depression, and the interstitial region;
By irradiating a second dose of ultraviolet light through the resin layer, the negative photoresist over the deep portions is exposed to the ultraviolet light, creating an insoluble negative photoresist, and the negative photoresist over the shallow portions and interstitial regions becomes soluble. step;
removing the soluble negative photoresist to re-expose the shallow portions and interstitial regions of each multi-depth depression;
Depositing a second functionalized layer over the insoluble negative photoresist and over the resin layer exposed in the shallow portions and interstitial regions of each multi-depth depression;
removing the insoluble negative photoresist to expose the functionalized layer over the deep portion of each multi-depth depression; and
The method further comprising removing the second functionalized layer from the interstitial region. According to paragraph 1,
The depressions include n subsets of depressions, where n is at least 3;
Each depression subset has a different depth than each other depression subset. 17. The method of claim 16, further comprising depositing the functionalized layer in direct contact with the resin layer prior to depositing the photosensitive material. According to clause 17,
The photosensitive material is a negative photoresist;
The negative photoresist is deposited in direct contact with the functionalization layer;
After a predetermined dose of ultraviolet light is irradiated through the resin layer, the photosensitive material overlying the first subset of depressions having the longest depth defines an insoluble negative photoresist, overlying the interstitial regions, each having a depth less than the longest depth. The photosensitive material overlying the different subsets of depressions becomes soluble;
Insoluble negative photoresist is a modified photosensitive material;
The method of claim 1, wherein the first subset of depressions is a first predetermined region. 19. The method of claim 18, wherein creating the functionalized layer using the modified photosensitive material in the first predetermined region comprises forming the functionalized layer from the interstitial region and while the insoluble negative photoresist is present in the first subset of depressions. A method involving removal from each different subset of depressions. According to clause 19,
Depositing a second functionalized layer over the insoluble negative photoresist, the interstitial regions, and each different subset of depressions;
removing the insoluble negative photoresist to expose the functionalized layer in the first subset of depressions;
Depositing a second negative photoresist over the functionalized layer of the first depression subset, each over the other depression subset, and over the interstitial regions;
Irradiating a second ultraviolet light dose higher than a predetermined ultraviolet light dose through the resin layer to form a second ultraviolet light dose over the functionalized layer of the first subset of depressions and over the second subset of depressions having a second longest depth. The negative photoresist defines a second insoluble negative photoresist, overlying the interstitial regions and over each different subset of depressions having a depth less than the second longest depth, wherein the second negative photoresist becomes soluble; and
While the second insoluble negative photoresist is present in the first and second depression subsets, removing the second functionalized layer from the interstitial regions and from each other depression subset having a depth less than the second longest depth. A method that additionally includes . According to clause 20,
Depositing a third functionalized layer over the second insoluble negative photoresist, the interstitial regions, and each different subset of depressions having a depth less than the second longest depth;
removing the second insoluble negative photoresist to expose the functionalized layer in the first subset of depressions and the second functionalized layer in the second subset of depressions;
A third negative photoresist is deposited over the functionalized layer of the first subset of depressions, over the second functionalized layer of the second subset of depressions, and over the third functionalized layer of the third subset of depressions having the third longest depth. depositing over and, if n is greater than 3, over a different subset of depressions and over interstitial regions, respectively;
Irradiating a third ultraviolet light dose higher than the second ultraviolet light dose through the resin layer, overlying the functionalized layer in the first subset of depressions, over the second functionalized layer in the second subset of depressions, and A third negative photoresist overlying the third functionalized layer of the subset of 3 depressions defines a third insoluble negative photoresist, overlying the interstitial regions and, when n is greater than 3, having a depth less than the third longest depth. rendering the third negative photoresist over each different subset of depressions soluble; and
While a third insoluble negative photoresist is present in the first, second, and third subsets of depressions, a third functionalized layer is drawn from the interstitial region and, if n is greater than 3, to a depth less than the third longest depth. The method further comprising removing from each different subset of depressions having . As a flow cell:
A resin layer comprising depressions separated by interstitial regions, wherein the depressions include n depression subsets, where n is at least 3 and each depression subset has a different depth than the other depression subsets, Resin layer; and
A flow cell containing a different functionalization layer in each subset of depressions.

Images