KR20240016039A - Composition for preventing or treating angiogenesis disease comprising Nitraria alkaloid derivatives - Google Patents

Abstract

The present invention relates to a composition for preventing or treating angiogenic diseases comprising a nitriria alkaloid derivative, and more specifically, the nitraria alkaloid derivative, which is a derivative of cyclohexanone, cyclohexanol, nitramine or isonitramine. Inhibits the protein stability or inhibits the transcriptional activity of HIF1-α, a key transcription factor in a hypoxic environment, and as a result has the effect of inhibiting the target genes EPO, GLUT1, and VEGF, so it is a pharmaceutical composition for preventing or treating angiogenic diseases. Alternatively, it can be useful as a health food.

Description

Composition for preventing or treating angiogenesis disease comprising Nitraria alkaloid derivatives}

The present invention relates to a composition for preventing or treating angiogenic diseases, which includes derivatives of cyclohexanone, cyclohexanol, nitramine, or isonitramine as nitraria alkaloid derivatives.

Angiogenesis is a process in which new capillaries are formed from existing microvessels. When angiogenesis occurs normally, it occurs in embryonic development, tissue regeneration and wound healing, and the corpus luteum, a periodic change in the female reproductive system. It is time for development, and even in this case, progress is strictly controlled.

In adults, vascular endothelial cells grow very slowly and do not divide relatively well compared to other types of cells. The process in which angiogenesis occurs is generally the breakdown of the vascular basement membrane by protease, migration and proliferation of vascular endothelial cells, and the formation of a lumen by vascular endothelial cell differentiation through stimulation of angiogenesis-promoting factors, resulting in blood vessels being reorganized and new capillaries forming. It consists of being created.

However, there are diseases caused by angiogenesis not being regulated autonomously and growing pathologically. Diseases related to angiogenesis that occur in pathological conditions include hemangioma, angiofibroma, vascular malformation, and cardiovascular diseases such as arteriosclerosis, vascular adhesion, and edematous sclerosis. Eye diseases caused by angiogenesis include corneal transplant angiogenesis and angiogenesis. These include glaucoma, diabetic retinopathy, corneal disease caused by new blood vessels, spot degeneration, pterygium, retinal degeneration, posterior lens fibroplasia, and granular conjunctivitis. Chronic inflammatory diseases such as arthritis, psoriasis, telangiectasia, pyogenic granuloma, seborrheic dermatitis, dermatological diseases such as acne, Alzheimer's and obesity are also related to angiogenesis, and cancer growth and metastasis are necessarily dependent on angiogenesis.

The development of substances that inhibit angiogenesis is actively underway to treat diseases dependent on angiogenesis, including tumors. In particular, with the report that blood supply is essential in the process of tumor growth and metastasis, the complex process of angiogenesis that induces tumors is being identified, and the focus is on discovering factors that destroy or inhibit this process. In this attempt, as it became known that various powerful inhibitors that inhibit the division and migration of vascular endothelial cells are naturally secreted by tumors generated in the body, proteins that inhibit angiogenesis were discovered and research was conducted to identify their mechanism of action. It is progressing actively.

However, the use of existing angiogenesis inhibitors has the problem of increasing hypoxia inside the tumor. Hypoxia not only causes cancer drug resistance but is also a major cause of cancer progression and metastasis.

As the currently used angiogenesis inhibitors have the above-mentioned serious problems, the development of new angiogenesis inhibitors is urgently needed, as well as effectively controlling angiogenesis diseases by more efficiently controlling the triggering mechanisms of ocular diseases induced by angiogenesis. The development of prevention and treatment technologies is necessary.

Republic of Korea Patent No. 10-2413243 (published on June 27, 2022)

The purpose of the present invention is to provide a composition for preventing or treating angiogenic disease, which includes a derivative of cyclohexanone, cyclohexanol, nitramine, or isonitramine as a nitrile alkaloid derivative.

The present invention provides a pharmaceutical for preventing or treating angiogenic disease comprising a compound selected from the group consisting of a nitrile alkaloid derivative selected from the following Formula 1 or Formula 2, stereoisomers thereof, and racemic mixtures thereof, or a pharmaceutically acceptable salt thereof. Provided is a composition:

[Formula 1]

[Formula 2]

In Formula 1 or Formula 2, R ¹ or R ² may each be the same or different, and may be a (C1-C5) alkyl ester group or a (C1-C5) cyanoalkyl group, or R ¹ and R ² may be connected to each other and substituted. or forms an unsubstituted (C4~C8) ring compound or (C4~C8) heterocyclic compound,

Y is carbon or nitrogen,

R ³ or R ⁴ may be the same or different, respectively, and may be a (C1~C5) alkyl ester group or a (C1~C5) cyanoalkyl group, or R ³ and R ⁴ may be connected to each other to form a substituted or unsubstituted (C4~C8) ) Form a ring compound or (C4~C8) heterocyclic compound,

When Y is nitrogen, Y and R ³ are connected to each other to form (C4~C8) heterocycloalkene,

represents the chiral center.

In addition, the present invention provides a method for preventing or improving angiogenic diseases comprising a compound selected from the group consisting of nitriaria alkaloid derivatives selected from the following Formula 1 or Formula 2, stereoisomers thereof, and racemic mixtures thereof, or pharmaceutically acceptable salts thereof. Provides a health food composition for use.

According to the present invention, cyclohexanone, cyclohexanol, nitramine, or isonitramine derivatives as nitraria alkaloid derivatives inhibit the protein stability or inhibit the transcriptional activity of HIF1-α, a key transcription factor in a hypoxic environment, As a result, it has the effect of inhibiting the target genes EPO, GLUT1, and VEGF, so it can be usefully used as a pharmaceutical composition or health food for preventing or treating angiogenic diseases.

Figure 1 shows the structure of a nitrile alkaloid derivative according to the present invention.
Figure 2 shows the ¹ H-NMR spectrum results of Compound 2 of the present invention.
Figure 3 shows the ¹ H-NMR spectrum result of compound 3 of the present invention.
Figure 4 shows the ¹ H-NMR spectrum results of compound 4 of the present invention.
Figure 5 shows the ¹ H-NMR spectrum results of compound 5 of the present invention.
Figure 6 shows the ¹ H-NMR spectrum results of compound 6 of the present invention.
Figure 7 shows the ¹ H-NMR spectrum results of compound 7 of the present invention.
Figure 8 shows the ¹ H-NMR spectrum result of compound 8 of the present invention.
Figure 9 is a ¹ H-NMR spectrum result of isonitramine of the present invention.
Figure 10 is a ¹ H-NMR spectrum result of nitramine of the present invention.
Figure 11 shows the results of measuring the MTT assay cytotoxicity of each nitrile alkaloid derivative according to the present invention.
Figure 12 confirms the inhibitory effect on the HIF-1α transcription factor for each nitrile alkaloid derivative according to the present invention.
Figure 13 confirms the inhibitory effect of each nitrile alkaloid derivative according to the present invention on the mRNA expression of HIF-1α and its target genes.
Figure 14 confirms the inhibitory effect on the transcriptional activity of the HIF-1α transcription factor for each nitrile alkaloid derivative according to the present invention.

Hereinafter, the present invention will be described in more detail.

Representative natural products isolated from Nitraria family plants are known as Nitraria alkaloids, such as nitramine, isonitramine (ISN), and sibirine. Looking at their structural characteristics, nitramine and isonitramine are known. is a diastereomeric relationship, and civirine has a methyl group substituted on the isonitramine N atom. These Nitraria alkaloids have been synthesized by many researchers for many years, but no research results on their biological activity have been reported.

Meanwhile, the inventor of the present invention not only developed a method for synthesizing isonitramine among Nitraria alkaloids, but also identified the physiological activity of isonitramine for the first time in the world, and more efficiently controlled the triggering mechanism of diseases caused by angiogenesis. While researching and developing compounds that can effectively prevent and treat angiogenic diseases, nitriaria alkaloid derivatives such as cyclohexanone, cyclohexanol, nitramine, or isonitramine are key transcription factors in a hypoxic environment. The present invention was completed by inhibiting the protein stability of HIF1-α or suppressing its transcriptional activity, and as a result, the effect of inhibiting the target genes EPO, GLUT1, and VEGF was confirmed.

Accordingly, the present invention provides a method for preventing or treating angiogenic diseases comprising a compound selected from the group consisting of a nitrile alkaloid derivative selected from the following Formula 1 or Formula 2, stereoisomers thereof, and racemic mixtures thereof, or a pharmaceutically acceptable salt thereof. Provided is a pharmaceutical composition for:

[Formula 1]

[Formula 2]

In Formula 1 or Formula 2, R ¹ or R ² may be the same or different, and may be a (C1-C5) alkyl ester group or a (C1-C5) cyanoalkyl group, or R ¹ and R ² may be connected to each other and substituted. or forms an unsubstituted (C4~C8) ring compound or (C4~C8) heterocyclic compound,

Y is carbon or nitrogen,

R ³ or R ⁴ may be the same or different, respectively, and may be a (C1~C5) alkyl ester group or a (C1~C5) cyanoalkyl group, or R ³ and R ⁴ may be connected to each other to form a substituted or unsubstituted (C4~C8) ) Form a ring compound or (C4~C8) heterocyclic compound,

When Y is nitrogen, Y and R ³ are connected to each other to form (C4~C8) heterocycloalkene,

represents the chiral center.

Here, the 'stereoisomer' means that the molecular formula and connection method of constituent atoms are the same, but the spatial arrangement between atoms is different, and can be generated by the chiral center of the compound of Formula 1 or Formula 2. .

The 'racemic mixture' means that the (+)-form and the (-)-form are mixed in the same ratio, that is, 50:50, and two or more stereoisomers of Formula 1 or Formula 2 are mixed in 50:50, respectively. There may be a mixture present.

The ‘pharmaceutically acceptable salt’ may be used in the form of either a pharmaceutically acceptable basic salt or an acidic salt. Basic salts can be used in the form of either organic base salts or inorganic base salts, such as sodium salts, potassium salts, calcium salts, lithium salts, magnesium salts, cesium salts, aminium salts, and ammonium salts. , triethylaminium salt, pyridinium salt, etc. can be used, but are not limited thereto.

Additionally, an acid addition salt formed by a free acid is useful as the acid salt. Inorganic acids and organic acids can be used as free acids. Hydrochloric acid, hydrobromic acid, sulfuric acid, sulfurous acid, and phosphoric acid can be used as inorganic acids, and citric acid, acetic acid, maleic acid, fumaric acid, gluconic acid, and methanesulfonic acid can be used as organic acids. , benzenesulfonic acid, camphorsulfonic acid, oxalic acid, malonic acid, glutaric acid, acetic acid, glyconic acid, succinic acid, tartaric acid, 4-toluenesulfonic acid, galacturonic acid, embonic acid, glutamic acid, citric acid, aspartic acid. etc. can be used. Preferably, hydrochloric acid can be used as the inorganic acid, and methanesulfonic acid can be used as the organic acid.

In addition, the composition according to the present invention may include not only pharmaceutically acceptable salts, but also all salts, hydrates, and solvates that can be prepared by conventional methods.

The addition salt according to the present invention can be prepared by conventional methods, for example, by dissolving the compound of Formula 1 or Formula 2 in a water-miscible organic solvent, such as acetone, methanol, ethanol, or acetonitrile, and adding an excess of organic base. It can be prepared by adding or adding an aqueous solution of an inorganic base and then precipitating or crystallizing it. Alternatively, an addition salt can be obtained by evaporating the solvent or excess base from this mixture and drying it, or it can be prepared by suction filtration of the precipitated salt.

In the above formula (1) or (2), R ¹ or R ² may be the same or different, and may be an ethyl ester group or a cyanoethyl group, or R ¹ and R ² may be linked to each other to form a substituted or unsubstituted (C4~ C8) forms a cycloalkane, (C4~C8) heterocycloalkane, (C4~C8) cycloalkanone or (C4~C8) heterocycloalkanone,

Y is carbon or nitrogen,

R ³ or R ⁴ may be the same or different, respectively, and may be an ethyl ester group or a cyanoethyl group, or R ³ and R ⁴ may be connected to each other to form a substituted or unsubstituted (C4~C8) cycloalkane, (C4~C8) hetero Forming a cycloalkane, (C4~C8) cycloalkanone or (C4~C8) heterocycloalkanone,

When Y is nitrogen, Y and R ³ may be connected to each other to form a heterocyclic compound having 4 to 7 carbon atoms substituted with nitrogen, and specifically, may form a substituted or unsubstituted trihydropyridine.

Specifically, in the compound of Formula 1 or Formula 2, R ¹ or R ² may be the same or different, respectively, and may be an ethyl ester group or a cyanoethyl group, or R ¹ and R ² may be substituted or unsubstituted by being connected to each other. forming cyclohexane, piperidine, cyclohexanone or piperidinone,

Y is carbon or nitrogen,

R ³ or R ⁴ may be the same or different, respectively, and may be an ethyl ester group or a cyanoethyl group, or R ³ and R ⁴ may be connected to each other to form substituted or unsubstituted cyclohexane, piperidine, cyclohexanone, or piperidinone. to form,

When Y is nitrogen, Y and R ³ may be connected to each other to form a heterocyclic compound having 4 to 7 carbon atoms substituted with nitrogen, and specifically, may form a substituted or unsubstituted trihydropyridine.

More preferably, the compound may be any one selected from the following Formulas 1-1 to 1-6 and Formulas 2-1 to 2-3:

[Formula 1-1]

[Formula 1-2]

[Formula 1-3]

[Formula 1-4]

[Formula 1-5]

[Formula 1-6]

[Formula 2-1]

[Formula 2-2]

[Formula 2-3]

In the present invention, the angiogenic disease may be selected from the group consisting of HIF1-α or VEGF-mediated cancer disease or ocular vascular disease including diabetic retinopathy, macular degeneration, retinopathy of prematurity, age-related degenerative plaques, or neovascular glaucoma. However, it is not limited to this.

The pharmaceutical composition may be provided in one or more formulations selected from the group consisting of gels, emulsions, injections, powders, granules, aerosols, pastes, transdermal absorbents, and patches according to conventional methods, but is not limited thereto.

In another embodiment of the present invention, the pharmaceutical composition includes suitable carriers, excipients, disintegrants, sweeteners, coating agents, swelling agents, lubricants, lubricants, flavoring agents, antioxidants, buffers, and bacteriostatic agents commonly used in the preparation of pharmaceutical compositions. , it may further include one or more additives selected from the group consisting of diluents, dispersants, surfactants, binders, and lubricants.

Specifically, carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, and microcrystalline. Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil can be used. Solid preparations for oral administration include tablets, pills, powders, granules, and capsules. agents, etc., and such solid preparations can be prepared by mixing the composition with at least one or more excipients, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium styrate and talc can also be used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, etc. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used.

The preferred dosage of the compound according to the present invention may vary depending on the subject's condition and weight, type and degree of disease, drug form, administration route and period, and may be appropriately selected by a person skilled in the art. According to one embodiment of the present invention, but is not limited thereto, the daily dosage may be 0.01 to 200 mg/kg, specifically 0.1 to 200 mg/kg, and more specifically 0.1 to 100 mg/kg. Administration may be administered once a day or may be divided into several administrations, and the scope of the present invention is not limited thereby.

In the present invention, the 'subject' may be a mammal, including humans, but is not limited to these examples.

In addition, the present invention provides a method for preventing or improving angiogenic disease comprising a compound selected from the group consisting of a nitrile alkaloid derivative selected from Formula 1 or Formula 2, stereoisomers thereof, and racemic mixtures thereof, or a pharmaceutically acceptable salt thereof. Provides a health food composition for use.

The health food may be provided in the form of powder, granules, tablets, capsules, syrup, or beverage. The health food may be used with other foods or food additives in addition to the active ingredient compound, and may be used appropriately according to conventional methods. there is. The mixing amount of the active ingredient can be appropriately determined depending on its purpose of use, for example, prevention, health, or therapeutic treatment.

The effective dose of the compound contained in the health food may be used in accordance with the effective dose of the pharmaceutical composition, but in the case of long-term intake for the purpose of health and hygiene or health control, it may be below the above range, Since the active ingredient has no safety issues, it is certain that it can be used in amounts exceeding the above range.

There are no particular restrictions on the types of health foods, and examples include meat, sausages, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, Examples include drinks, alcoholic beverages, and vitamin complexes.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it is understood by those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. It will be self-evident.

<Example> Synthesis of cyclohexanone or cyclohexanol derivative

Isonitramine, nitramine, and compounds 2 to 8 disclosed in Figure 1 were synthesized as follows.

1. Synthesis of Compound 2

Acetonitrile (20 mL) was added to a 100 mL round bottom flask containing Compound 1 (1 mL, 6.23 mmol), and 18-crown-6 (83 mg, 0.31 mmol) and potassium carbonate (4.3 g, 31.43 mmol) were added to the dissolved solution. , acrylonitrile (2 mL, 31.43 mmol) was added in that order and stirred at room temperature for 1 hour. After monitoring the reaction using TLC, when the reaction is completed, the solvent is removed under reduced pressure conditions. The reaction mixture was diluted with ethyl acetate, washed with brine, and dried over anhydrous MgSO ₄ . The residue is filtered and concentrated under reduced pressure conditions. The concentrated reaction product was purified by flash column chromatography (silica gel 70~230 mesh, 20% EtOAc/hexane) to synthesize Compound 2, a colorless oil (1.1 g, 79% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 4.32-4.21 (m, 2H), 2.61-2.55 (m, 1H), 2.55-2.49 (m, 2H), 2.49-2.41 (m, 1H), 2.30 ( ddd, J = 16.7, 9.6, 6.1 Hz, 1H), 2.20 (ddd, J = 13.9, 9.6, 5.6 Hz, 1H), 2.10-1.99 (m, 1H), 1.92 (ddd, J = 13.9, 9.6, 6.2 Hz, 1H), 1.84-1.74 (m, 1H), 1.70-1.60 (m, 2H), 1.54-1.41 (m, 1H), 1.30 (t, J = 7.1 Hz, 3H) ppm (Fig. 2).

2. Synthesis of compound 3

Add methanol (25 mL) to dissolve Compound 2 (1.5 g, 6.72 mmol) in a 100 mL round bottom flask, then add sodium borohydride (508 mg, 13.44 mmol) at 0°C. Afterwards, stir at room temperature for 2 hours. 1 N hydrochloric acid was added dropwise to the reaction until it became acidic, then the reaction was diluted with ethyl acetate (200 mL), washed with brine (3×200 mL), and dried over anhydrous MgSO4. The residue is filtered and concentrated under reduced pressure conditions. The concentrated reaction product was purified by flash column chromatography (silica gel 70~230 mesh, 20% EtOAc/hexane) to synthesize compound 3, a clear oil (1.26 g, 83% yield).

¹ H-NMR(500MHz, CDCl ₃ ) δ 4.31-4.17 (m, 2H), 3.38-3.32 (m, 1H), 2.62-2.14 (m, 4H), 2.05-1.87 (m, 2H), 1.82-1.47 (m, 4H), 1.47-1.12 (m, 6H) ppm (Figure 3).

3. Synthesis of Compound 4

Compound 3 (2.25 g, 10.0 mmol) and methanol (50 mL) were added to a 100 mL round bottom flask, and Raney Ni was added at room temperature. Afterwards, stir at 60°C for 4 hours under hydrogen conditions. The reaction was filtered and concentrated under vacuum conditions. The concentrated reaction product was purified by column chromatography (silica gel 70~230 mesh, 3% MeOH/dichloromethane) to synthesize Compound 4 as a white solid (1.43 g, 78% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 6.22 (s, 1H), 5.68 (s, 1H), 3.74 (t, J = 3.3 Hz, 1H), 3.32-3.27 (m, 2H), 2.19 (td) , J = 14.2, 13.4, 4.3 Hz, 1H), 2.03 (ddd, J = 13.8, 5.9, 3.2 Hz, 1H), 1.89-1.71 (m, 4H), 1.64-1.35 (m, 6H) ppm (Figure 4 ).

4. Synthesis of Compound 5

Compound 6 (1.2 g, 6.55 mmol) and dichloromethane (DCM, 25 mL) were added to a 100 mL round bottom flask, and pyridinium chlorochromate (PCC, 2.8 g, 13.10 mmol) and NaOAc (214.9 mg, 2.62 mmol) were added at room temperature. . Afterwards, stir for 24 hours. The reaction product is filtered and concentrated under vacuum conditions. The concentrated reaction product was purified by column chromatography (silica gel 70~230 mesh, 50% EtOAc/hexane) to synthesize Compound 5 as a white solid (1.05 g, 88% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 6.30 (brs, 1H), 3.36-3.21 (m, 2H), 2.65 (dt, J = 14.7, 5.8 Hz, 1H), 2.58-2.42 (m, 2H) , 2.41-2.32 (m, 1H), 2.04-1.94 (m, 1H), 1.94-1.86 (m, 2H), 1.81-1.60 (m, 5H) ppm (Figure 5).

5. Synthesis of compound 6

Compound 7 (1.9 g, 8.5 mmol) and methanol (40 mL) were added to a 100 mL round bottom flask, and Raney Ni was added at room temperature. Afterwards, stir at 60°C for 4 hours under hydrogen conditions. The reaction product is filtered and concentrated under vacuum conditions. The concentrated reaction product was purified by column chromatography (silica gel 70~230 mesh, 50% EtOAc/hexane) to synthesize Compound 6 as a white solid (1.01 g, 65% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 6.21 (s, 1H), 4.19-4.11 (m, 1H), 3.27-3.13 (m, 2H), 2.64 (s, 1H), 1.94-1.86 (m, 1H), 1.79-1.61 (m, 6H), 1.55 (td, J = 13.3, 3.7 Hz, 1H), 1.41-1.19 (m, 4H) ppm (Figure 6).

6. Synthesis of Compound 7

The air in a 100 mL round bottom flask containing Compound 2 (1.5 g, 6.72 mmol) was replaced with argon, tetrahydrofuran (20 mL) was added and dissolved, and then lithium tri-tert-butoxyaluminum hydride 1 M in THF solution (6.72 mL, 6.72 mmol) was added at 0°C and stirred. When the reaction is completed, 1.0 N hydrochloric acid is added dropwise to the reactant until it becomes acidic, then the reactant is diluted with ethyl acetate (200 mL), washed with brine (3×200 mL), and dried over anhydrous MgSO4. The residue is filtered and concentrated under vacuum conditions. The concentrated reaction product was purified by column chromatography (silica gel 70~230 mesh, 15% EtOAc/hexane) to synthesize compound 7, a clear oil (1.32 g, 87% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 4.25-4.18 (m, 2H), 4.06 (dt, J = 8.8, 3.7 Hz, 1H), 3.43-3.29 (m, 1H), 2.57-2.41 (m, 2H), 2.37-2.19 (m, 2H), 2.04-1.94 (m, 1H), 1.79-1.66 (m, 3H), 1.63-1.49 (m, 2H), 1.46-1.36 (m, 2H), 1.30 ( t, J = 7.1 Hz, 3H) ppm (Figure 7).

7. Synthesis of compound 8

Compound 2 (1.55 g, 6.94 mmol) and methanol (25 mL) were added to a 100 mL round bottom flask, and Raney Ni was added at room temperature. Afterwards, stir at 60°C for 4 hours under hydrogen conditions. The reaction product is filtered and concentrated under vacuum conditions. The concentrated reaction product was purified by column chromatography (silica gel 70~230 mesh, 5% MeOH/EtOAc) to synthesize compound 8, a yellow viscous oil (1.1 g, 76% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ ¹ H NMR (500 MHz, Chloroform-d) δ 4.21 (q, J = 7.1 Hz, 2H), 3.72-3.63 (m, 1H), 3.56-3.45 (m , 1H), 2.40-2.31 (m, 3H), 2.04-1.98 (m, 1H), 1.92-1.86 (m, 1H), 1.72-1.67 (m, 1H), 1.62-1.41 (m, 5H), 1.35 (td, J = 13.1, 3.6 Hz, 1H), 1.27 (t, J = 7.1 Hz, 3H) ppm (Figure 8).

8. Synthesis of isonitramine

Add and dissolve tetrahydrofuran (25 mL) in a 250 mL round bottom flask containing Compound 6 (1.37 g, 7.5 mmol), then add lithium aluminum hydride 1 M in THF solution (75 mL, 75.0 mmol) at 0°C. Then stir at 67°C for 3 hours. Water (50 mL) was added to the reaction at 0°C, and the residue was filtered and concentrated under vacuum conditions. The concentrated reaction product was purified by column chromatography (silica gel 70~230 mesh, 50% MeOH/chloroform (1% NH4OH)) to synthesize isonitramine as a white solid (1.1 g, 87% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 3.63 (dd, J = 11.2, 3.5 Hz, 1H), 3.01 (d, J = 11.0 Hz, 1H), 2.91 (d, J = 11.3 Hz, 1H), 2.57 (td, J = 11.5, 3.4 Hz, 1H), 2.49 (d, J = 11.3 Hz, 1H), 2.21 (d, J = 13.9 Hz, 1H), 2.09-1.96 (m, 1H), 1.72-1.65 (m, 2H), 1.57-1.42 (m, 2H), 1.40-1.31 (m, 2H), 1.28-1.14 (m, 3H), 1.04 (td, J = 13.3, 5.4 Hz, 1H), 0.99-0.88 (m, 1H) ppm (Figure 9).

9. Synthesis of nitramine

Add and dissolve tetrahydrofuran (25 mL) in a 250 mL round bottom flask containing Compound 6 (1.47 g, 8 mmol), then add lithium aluminum hydride 1 M in THF solution (80 mL, 80.0 mmol) at 0°C. Then stir at 67°C for 3 hours. Water (50 mL) was added to the reaction at 0°C, and the residue was filtered and concentrated under vacuum conditions. The concentrated reaction product was purified by column chromatography (silica gel 70~230 mesh, 50% MeOH/chloroform (1% NH ₄ OH)) to synthesize nitramine as a white solid (947.9 mg, 70% yield).

¹ H-NMR (500 MHz, CD ₃ OD) δ 3.53 (dd, J = 9.4, 3.8 Hz, 1H), 3.11-3.05 (m, 2H), 3.01 (d, J = 13.0 Hz, 1H), 2.08- 1.97 (m, 1H), 1.89-1.67 (m, 5H), 1.58-1.19 (m, 6H) ppm (Figure 10).

<Experimental Example> Inhibitory Activity of Nitraria Alkaloid Derivatives on HIF-1α/VEGF Signaling Pathway

1. Cell culture

HCT-116 (human colon cancer cells, ATCC, USA) cells were grown in Dulbecco Modified Eagle Medium (DMEM, Gibco BRL, USA) supplemented with 10% fetal bovine serum (FBS, Gibco BRL, USA) at 37°C under 5% CO2 conditions. It was cultured. To induce hypoxia in cells, a hypoxia chamber (Modular Incubation Chambers, #MIC 101, Billups-Rothenberg, CA, USA) or a chemical hypoxia mimetic CoCl2 (Sigma, USA) was used. After treating the cells with Nitraria Alkaloid derivatives, they were placed in an incubator chamber and the air inside the chamber was quickly exchanged with a mixed gas (95% N2, 5% CO2, 1% O2) to create hypoxic conditions. The control group was cultured under normal oxygen concentration (21% O2) for the same time as the hypoxic condition.

2. Cytotoxicity test

For the MTT reagent, Thiazolyl blue Tetrazolium Bromide (Sigma, USA) was dissolved in PBS to a final concentration of 5 mg/mL, blocked from light, and stored at 4°C. The HCT-116 cell line was made into a single cell suspension, counted, added to each well of a 96 well plate (5 × 10³), and cultured overnight. After confirming that the cells were stably attached to the plate, the cell culture medium was removed, and each derivative was mixed in DMEM and dispensed onto the well wall. Nitraria alkaloid derivatives, that is, ISN (isonitramine), Nitramine, and isonitramine derivatives 2, 3, 4, 5, 6, 7, and 8 were mixed at 500 μM each and treated for 24 hours. The control group and the group treated with 9 derivatives were divided into 10 groups, and four wells were used for each group. After treating the 9 derivatives for 24 hours, MTT reagent was added to the culture medium and MTT reagent in a ratio of approximately 10:1, and cultured at 37°C in a 5% CO2 incubator for 2 hours. After removing the culture medium, 100 μL of 100% DMSO was added to the well to dissolve the MTT formazan absorbed by the cells, and the absorbance was measured at 570 nm with a Microplate Reader (Varioskan LUX Multimode Microplate Reader, Thermo Scientific, USA). The average absorbance of 4 wells was measured. was used as the result.

3. Real-time PCR

RNA was isolated using TRI reagent (MRC, Cincinnati, USA). At this time, the layers were separated with chloroform, the supernatant was transferred to a new tube, and isopropanol was added to precipitate RNA. Afterwards, the RNA pellet was washed with 70% ethanol, dried, dissolved in RNase-free water, and quantified using Nano drop. Real-time PCR was performed on a Rotor-Gene Q cycler (QIAGEN, Inc., Hilden, Germany) using the Rotor Gene SYBR Green RT-PCR kit (Qiagen) according to the manufacturer's instructions. PCR primers were purchased from Bioneer (Daejeon, Korea). The nucleotide sequences of the primers used in the experiment were as shown in Table 1 below.

name direction Base sequence (5'->3') sequence number HIF-1α forward GAACGTCGAAAAGAAAAGTCTCG One reverse CCTTATCAAGATGCGAACTCACA 2 VEGF forward CCATGAACTTTCTGCTGTCTT 3 reverse ATCGCATCAGGGGCACACAG 4 GLUT1 forward CATCATCTTCATCCCGGC 5 reverse CTCCTCGTTGCGGTTGAT 6 EPO forward GGAGGGCCGAGAATATCACGAC 7 reverse CCCTGCCAGACTTCTACGG 8

4. Western blot

HCT-116 cells treated with Nitraria Alkaloid derivatives under hypoxic conditions are cultured in a 60mm culture dish for 16 hours, and then the supernatant is separated and collected in a tube. After the cells were rinsed twice with PBS at 4°C, the PBS was completely removed and quenched in liquid nitrogen. After mixing whole-cell extraction buffer (1M HEPES (pH 7.9), 5M NaCl, 0.5M EDTA, 100% glycerol, 1M DTT) and 100X PI (proteinase inhibitor) in a frozen culture dish, 90㎕ was added to extract the protein. Extracted. The cell lysate collected in the tube was tapped 4 times every 5 minutes, centrifuged at 13000 rpm for 30 minutes at 4°C, and the supernatant was transferred to a new tube, quantified at 40 μg using the bicinchoninic acid method, and then mixed with sample buffer. Boiled at 100°C for 5 minutes. Proteins are placed in wells on a 7% SDS-PAGE gel, and proteins separated according to size are transferred to a nitrocellulose membrane. Membrane is 5% low-fat skim milk to prevent non-specific binding, and HIF-1α (Biosciences, MA, USA) primary antibody diluted at 1:1000 in 5% low-fat skim milk is treated on the membrane and reacted at 4°C overnight. I ordered it. After thoroughly rinsing the membrane with PBS-T (0.5% Tween 20), the secondary antibody was reacted at room temperature for 1 hour. The expression level of the protein was confirmed using Chemiluminece (FUSION-SL4, Vilber, Germany).

5. Transient transfection and luciferase reporter gene assay

Luciferase reporter gene is used to inject and transform HCT-116 cell line, and transient transfection method is used in this case. For transfection, jetPEI (polyplus, France) was used, and based on a 12-well plate, 0.03 μg of renilla, 0.3 μg of PGL VEGF luciferase reporter, 0.05 μg of pBOS HIF1-α, and 0.05 μg of pBOS ARNT were mixed well and then added to each well of a 24-well plate. 75 The transfected cells were washed with PBS (phosphate buffered saline) after 24 hours, treated with Nitratia Alkaloid derivatives according to the experimental conditions, and treated with 300 μM CoCl₂, an inducer that mimics hypoxia, for 20 hours to produce HIF-, a key transcription factor in a hypoxic environment. The transcriptional activity of 1α was increased. After the induction time, the medium was removed, and each lysate was obtained using 500 μL of 1X passive buffer from the Firefly & Renilla Luciferase Single Tube Assay Kit (Biotium, CA, USA). Luciferase activity was measured using the Firefly & Renilla Luciferase Single Tube Assay Kit.

6. Statistical analysis

All data represent the mean (±standard deviation) of analyzes performed in triplicate, reported as relative values. The statistical analysis performed on the data is as shown in the figure. Differences between treatment and control groups were assessed by Student's t-test or one-way ANOVA followed by a post-hoc test using GraphPad Prism 6 (CA, USA). Statistical significance was set at P<0.05.

7. Experimental results

The degree of toxicity of Nitraria Alkaloid derivatives, which showed an inhibitory effect on the activity of Hypoxia-Inducible Factor 1-α in HCT-116 cells, to cells was measured using MTT assay. As a result of measuring the cytotoxicity of the Nitraria alkaloid derivative according to Example 1, as shown in Figure 11, HCT-116 cells were treated with each Nitraria Alkaloid derivative at a concentration of 500 μM for 24 hours, but the cell survival rate was lower than that of the Nitraria Alkaloid derivative treated. There was no significant decrease compared to the group that did not do so. Therefore, it was confirmed that Nitraria Alkaloid derivatives themselves do not cause cytotoxicity to cancer cells.

In rapidly proliferating tumors, when locally hypoxic conditions occur, the transcription factor HIF-1α binds to HRE (hypoxia response element) and participates in activating downstream VEGF expression. Therefore, HIF-1α is deeply involved in regulating the expression of VEGF, an angiogenesis inducer. We sought to determine the effect of ISN and its derivatives on the expression of HIF-1α, which is essential for tumor progression. Looking at Figure 12, when hypoxia was induced in a hypoxia chamber and treated with 500 μM of Nitraria Alkaloid derivative for 4 hours, HIF-1α was strongly expressed in the hypoxic group compared to the normal condition group, and ISN and 4, 5, 6, 7, and 8 It was confirmed that derivative No. 1 decreased HIF-1α expression compared to the hypoxic group, and among them, derivative No. 7 and No. 8 were confirmed to have the best inhibitory effect. Therefore, it is believed that derivatives 7 and 8 have the greatest influence on the stabilization of HIF-1α protein induced under hypoxia.

To confirm the inhibitory activity of Nitraria Alkaloid derivatives on HIF-1α and its downstream factor mRNA expression, hypoxia was induced in a hypoxia chamber and treated with Nitraria Alkaloid derivatives at a concentration of 500 μM for 8 hours. As a result, as shown in Figure 13, HIF-1α mRNA was constant without change in concentration. On the other hand, the mRNA expression levels of VEGF, GLUT-1, and EPO, which are downstream targets of HIF-1α, were confirmed to be decreased in both ISN and its derivatives. Among them, derivatives 7 and 8 showed a strong inhibitory effect compared to the hypoxic group.

To determine the inhibitory effect of Nitraria Alkaloid derivatives on HIF1-α transcriptional activity using a luciferase reporter gene assay, how much of the HIF1-α transcriptional activity induced by 300 μM CoCl₂, which simulates hypoxia, was inhibited by Nitraria Alkaloid derivatives? A Luciferase test was conducted to see if this was confirmed. As shown in Figure 14, the inhibitory effect of Nitraria Alkaloid derivatives on the transcriptional activity of HIF1-α was slightly better than that of isonitramine. Among them, nitramine and isonitramine derivatives 3, 4, 5, 6, and 8 had good inhibitory activity. Unlike the previous case where derivative number 8 inhibited the protein expression of HIF1-α, derivatives 4, 5, and 6 had little effect at the protein level but appeared to specifically inhibit transcriptional activity.

Looking at the above experiment, the Nitraria Alkaloid derivative inhibited the protein stability or suppressed the transcriptional activity of HIF1-α, a key transcription factor in a hypoxic environment, and as a result, showed the effect of inhibiting its target genes, EPO, GLUT1, and VEGF. Therefore, considering the above experimental results, Nitraria Alkaloid derivatives are very effective drugs for preventing and treating not only HIF1-α or VEGF-mediated cancer, but also ocular vascular diseases such as diabetic retinopathy, macular degeneration, and retinopathy of prematurity. Confirmed.

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. will be. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (7)

A pharmaceutical composition for preventing or treating angiogenic disease comprising a compound selected from the group consisting of a nitraria alkaloid derivative selected from the following Formula 1 or Formula 2, stereoisomers thereof, and racemic mixtures thereof, or a pharmaceutically acceptable salt thereof:
[Formula 1]

[Formula 2]

In Formula 1 or Formula 2, R ¹ or R ² may be the same or different, and may be a (C1-C5) alkyl ester group or a (C1-C5) cyanoalkyl group, or R ¹ and R ² may be connected to each other and substituted. or forms an unsubstituted (C4~C8) ring compound or (C4~C8) heterocyclic compound,
Y is carbon or nitrogen,
R ³ or R ⁴ may be the same or different, respectively, and may be a (C1~C5) alkyl ester group or a (C1~C5) cyanoalkyl group, or R ³ and R ⁴ may be connected to each other to form a substituted or unsubstituted (C4~C8) ) Form a ring compound or (C4~C8) heterocyclic compound,
When Y is nitrogen, Y and R ³ are connected to each other to form (C4~C8) heterocycloalkene,
represents the chiral center. In claim 1,
In the above formula (1) or (2), R ¹ or R ² may be the same or different, respectively, and may be an ethyl ester group or an ethyl cyanide group, or R ¹ and R ² may be connected to each other to form a substituted or unsubstituted cyclohexanone. or forming heterocyclohexanone,
Y is carbon or nitrogen,
R ³ or R ⁴ may be the same or different, respectively, and are an ethyl ester group or an ethyl cyanide group, or R ³ and R ⁴ are connected to each other to form substituted or unsubstituted cyclohexanone or heterocyclohexanone,
When Y is nitrogen, Y and R ³ are linked together to form a heterocycloalkene with 6 carbon atoms. A pharmaceutical composition for preventing or treating angiogenic diseases. In claim 1,
The compound is a pharmaceutical composition for preventing or treating angiogenic disease, characterized in that any one selected from the following Formulas 1-1 to 1-6 and Formulas 2-1 to 2-3:
[Formula 1-1]

[Formula 1-2]

[Formula 1-3]

[Formula 1-4]

[Formula 1-5]

[Formula 1-6]

[Formula 2-1]

[Formula 2-2]

[Formula 2-3]
The method according to any one of claims 1 to 3,
The angiogenic disease is a blood vessel characterized in that it is selected from the group consisting of HIF1-α or VEGF-mediated cancer disease or ocular vascular disease including diabetic retinopathy, macular degeneration, retinopathy of prematurity, age-related degenerative plaques, or neovascular glaucoma. Pharmaceutical composition for preventing or treating new diseases. A health food composition for preventing or improving angiogenic disease comprising a compound selected from the group consisting of nitraria alkaloid derivatives selected from the following Formula 1 or Formula 2, stereoisomers thereof, and racemic mixtures thereof, or a pharmaceutically acceptable salt thereof:
[Formula 1]

[Formula 2]

In Formula 1 or Formula 2, R ¹ or R ² may be the same or different, and may be a (C1-C5) alkyl ester group or a (C1-C5) cyanoalkyl group, or R ¹ and R ² may be connected to each other and substituted. or forms an unsubstituted (C4~C8) ring compound or (C4~C8) heterocyclic compound,
Y is carbon or nitrogen,
R ³ or R ⁴ may be the same or different, respectively, and may be a (C1~C5) alkyl ester group or a (C1~C5) cyanoalkyl group, or R ³ and R ⁴ may be connected to each other to form a substituted or unsubstituted (C4~C8) ) Form a ring compound or (C4~C8) heterocyclic compound,
When Y is nitrogen, Y and R ³ are connected to each other to form (C4~C8) heterocycloalkene,
represents the chiral center. In claim 5,
The compound is a health food composition for preventing or improving angiogenic disease, characterized in that any one selected from the following Formulas 1-1 to 1-6 and Formulas 2-1 to 2-3:
[Formula 1-1]

[Formula 1-2]

[Formula 1-3]

[Formula 1-4]

[Formula 1-5]

[Formula 1-6]

[Formula 2-1]

[Formula 2-2]

[Formula 2-3]
In claim 5 or claim 6,
The angiogenic disease is a blood vessel characterized in that it is selected from the group consisting of HIF1-α or VEGF-mediated cancer disease or ocular vascular disease including diabetic retinopathy, macular degeneration, retinopathy of prematurity, age-related degenerative plaques, or neovascular glaucoma. Health food composition for preventing or improving new diseases.