KR20240015217A - Microneedle patch for skin improvement comprising DNA aptamer and/or alloferon and manufacturing method thereof - Google Patents

Abstract

The present invention relates to a microneedle patch for skin improvement containing DDNA aptamer and alloferon and a method of manufacturing the same. The microneedle transdermal patch of the present invention mounts a DNA aptamer composition on a biocompatible polymer microstructure and, when permeated into the skin, not only has excellent dissolution properties in the skin, but also stably delivers an effective amount of the loaded composition to the skin. It can improve effects such as whitening, wrinkle improvement, skin trouble improvement, and bruising relief.

Description

Microneedle patch for skin improvement comprising DNA aptamer and/or alloferon and manufacturing method thereof}

The present invention relates to a microneedle patch for skin improvement containing DNA aptamer and/or allopheron and a method of manufacturing the same.

Vitamins, antioxidants, etc. are known to have various physiological effects such as skin whitening, wrinkle improvement, skin elasticity improvement, and removal of harmful oxygen, and have been used as active ingredients in cosmetics or dermatological medicines. However, these active ingredients are easily oxidized and destroyed when exposed to light or air, so their use has been limited. Destruction reactions by oxidation proceed particularly rapidly when these active ingredients exist in aqueous solution or come into contact with water.

Conventional methods for stabilizing the active ingredients by minimizing their contact with water include a method of formulating the active ingredients in the form of a dry powder as described in Japanese Patent Publication No. 63-130514, and separation as described in U.S. Patent No. 4,818,512. A method of packaging the powdered active ingredient and an emulsified cosmetic liquid in two containers and then mixing them just before use by the consumer; U.S. Patent No. 5,322,683 discloses a method of formulating an anhydrous formulation so as not to contain moisture; however, these This method has the advantage of maintaining the stability of the active ingredient to some extent, but has the disadvantage that the formulation is limited to powder, mixing is cumbersome and packaging is expensive, or the feeling of use is poor due to excessive oily feeling when applied to the skin.

Transdermal Drug Delivery System (TDDS) is a series of technologies that deliver drugs to target sites such as cells and tissues by controlling the absorption and release of drugs through the skin, enabling efficient and safe administration of pharmaceutical substances. Research has been continuously conducted for this purpose.

Among these, injection therapy has problems in that it is difficult to administer, such as injection by an expert, and may be accompanied by pain depending on the patient, and there are limitations in controlling the drug release rate other than temporarily injecting the drug. To improve these shortcomings of injection therapy, research has been conducted on microneedles, which are much smaller and less painful than syringe needles, and research is being conducted in various fields such as drug delivery, blood collection, biosensors, and skin care.

In the case of conventional microneedles for skin improvement, the skin improvement effect was confirmed by loading general beauty ingredients with properties such as whitening, wrinkles, and troubles. However, some ingredients have the disadvantage of low satisfaction compared to the expected effect due to stability issues. .

The present invention solves the above problems and was created in response to the above necessity. The purpose of the present invention is to provide a microneedle patch that effectively improves skin whitening, wrinkles, troubles, and bruises.

In order to achieve the above object, the present invention provides a microneedle patch for skin improvement containing DNA aptamer and/or allopheron.

In one embodiment of the present invention, the patch preferably further contains an antioxidant substance, but is not limited thereto.

In one embodiment of the present invention, the antioxidant substance is preferably ascorbic acid or an ascorbic acid derivative, but is not limited thereto.

In another embodiment of the present invention, the microneedle patch preferably includes a biocompatible polymer and a support, but is not limited thereto.

In one embodiment of the present invention, the biocompatible polymer is cross-linked hyaluronic acid, non-cross-linked hyaluronic acid, sodium hyaluronate, alginic acid, pectin, carrageenan, chondroitin (sulfate), and dextran (sulfate). , chitosan, polylysine, collagen, gelatin, carboxymethyl chitin, fibrin, agarose, pullulan poly lactide, polyglycolide (PGA), polylactide-glycolide copolymer (PLGA) ), hyaluronic acid, alginic acid, pectin, carrageenan, chondroitin (sulfate), dextran (sulfate), chitosan, polylysine, collagen, gelatin, carboxymethyl chitin ( carboxymethyl chitin), fibrin, agarose, pullulan polyanhydride, polyorthoester, polyetherester, polycaprolactone, polyesteramide, poly( butyric acid), poly(valeric acid), polyurethane, polyacrylate, ethylene-vinylacetate polymer, acrylic substituted cellulose acetate, non-degradable polyurethane, polystyrene, polyvinyl chloride, polyvinyl fluoride, poly(vinyl) imidazole), chlorosulphonate polyolefins, polyethylene oxide, polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), polymethacrylate, hydroxypropylmethylcellulose (HPMC), ethylcellulose (EC) , hydroxypropyl cellulose (HPC), carboxymethyl cellulose, cyclodextrin, copolymers of monomers forming these polymers, and cellulose. It is preferred, but is not limited thereto.

The present invention will be described below.

Aptamers are DNA or RNA oligonucleotides with high affinity and specificity for target molecules including proteins and small organic molecules. Unlike antibodies, aptamers can easily bind to target molecules such as chemicals (vitamins) that are very small in size, and it is easy to maintain their efficacy at a constant level. Additionally, it has the advantages of smaller size, superior tissue penetration, and not causing an immune response compared to antibodies. Increasing the stability of cosmetic ingredients using aptamers is a safe and innovative new concept approach compared to existing methods, and can be manufactured to maximize effectiveness by applying it to various industries. In particular, it will be a catalyst to dramatically change the existing chemical-based cosmetics, nutritional supplements, and food markets into a DNA (BIO)-based market. It can also be used in a variety of fields in various industries. In the future, the DNA market will increase explosively and innovative solutions will be provided.

In the present invention, we develop a microneedle and manufacturing method that can improve skin whitening, wrinkles, and skin troubles using a biocompatible polymer composition containing DNA aptamer, DNA aptamer-antioxidant complex, or DNA aptamer-alloperon complex. did.

Dissolvable microneedle patch containing DNA aptamer

The present invention also provides a microneedle transdermal patch including a support to which at least one soluble microneedle is attached.

The method for manufacturing dissolvable microneedles of the present invention includes the following steps.

Step (a): supplying the aptamer composition and biocompatible polymer to the micromold,

In this step, according to the present invention, first, the aptamer composition and the biocompatible polymer are supplied to the micromold.

Step (b): Injecting the aptamer composition and biocompatible polymer into the hole of the micromold,

In this step, the aptamer composition and biocompatible polymer are injected into the hole of the micro mold. According to one embodiment of the present invention, the injection of the present invention is performed by applying an outward force to the aptamer composition and the biocompatible polymer. According to another embodiment of the present invention, the outward force is centrifugal force or reduced pressure.

Step (c): Separating the aptamer composition and the biocompatible polymer from the micro mold to finally form a microneedle containing the aptamer.

The method of the present invention is described in detail for each step as follows: Step (a): supplying an aptamer composition and a biocompatible polymer to a micromold;

According to the present invention, first, the aptamer composition and the biocompatible polymer are supplied to the micromold.

The micro mold of the present invention can be manufactured using any micro mold manufacturing technique known in the art. For example, MEMS (Micro-Electro Mechanical System) manufacturing techniques, photolithography (Biodegradable polymer microneedles: Fabrication, mechanics and transdermal drug delivery, Journal of Controlled Release 104, 51-66, 2005) manufacturing techniques, and soft lithography (soft lithography). Lithography) manufacturing techniques, etc. can be used to manufacture the micro mold of the present invention, but are not limited thereto. Among these, when using soft lithography manufacturing techniques, an elastomer mold such as PDMS (polydimethylsiloxane) or PMMA (poly(methyl methacrylate)) can be manufactured and used to manufacture microstructures. The technology for manufacturing PDMS molds is a type of plastic processing technology, and the desired molding structure can be obtained through various methods such as casting, injection, and hot-embossing. For example, by coating a photosensitive material on a substrate such as a silicon wafer or glass and patterning it using a photomask, a master is created. By casting PDMS as a mold and sintering it, a PDMS mold that functions as a stamp can be completed.

According to one embodiment of the present invention, in step (a), the aptamer and/or allopheron composition and the biocompatible polymer may be included at a concentration of 1-5% (w/v) based on the total microstructure composition. .

In detail about this, the solid contents of the composition for manufacturing microneedles (MIX solution containing aptamer and/or allopheron and biocompatible material HA) have a concentration of 1-5% based on the total microstructure composition. (w/v), in the example, it is 3%, of which about 97% of moisture is dried and removed during the microneedle manufacturing process, and the HA content in the final manufactured structure is about 95% as shown in Table 2. am.

Step (b): Injecting the aptamer and/or alloferon composition and the biocompatible polymer into the hole of the micromold;

Next, the aptamer composition and the biocompatible polymer are injected into the hole of the micromold.

According to one embodiment of the present invention, the injection of the present invention is performed by supplying the aptamer composition and the biocompatible polymer to the micro mold, and then (i) applying a centrifugal force of 800-1000 g to the micro mold, or (ii) 500 g. Can be performed under -860 mmHg pressure.

For example, when performing a centrifugal force of 800-1000g on the micro mold, centrifugation may be performed at 800-1000g for 10-20 minutes, or centrifugation may be performed at 900g for 15 minutes. Additionally, when performed under vacuum pressure, the injection can be performed for 5-20 minutes under a pressure of 500-860 mmHg, or for 10-30 minutes under a pressure of 600-760 mmHg.

According to a specific embodiment of the present invention, the biocompatible polymer includes hyaluronic acid, carboxymethyl cellulose (CMC), alginic acid, pectin, carrageenan, chondroitin (sulfate), dextran, (sulfate), Chitosan, polylysine, collagen, gelatin, carboxymethyl chitin, fibrin, agarose, pullulan polylactide, polyglycolide (PGA), polylactide-glycolide copolymer (PLGA) , pullulan polyanhydride, polyorthoester, polyetherester, polycaprolactone, polyesteramide, poly(butyric acid), poly(vale) ric acid), polyurethane, polyacrylate, ethylene-vinylacetate polymer, acrylic substituted cellulose acetate, non-degradable polyurethane, polystyrene, polyvinyl chloride, polyvinyl fluoride, poly(vinyl imidazole), chlorosulfonate Polyolefins (chlorosulphonate polyolefins), polyethylene oxide, polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), polymethacrylate, hydroxypropylmethylcellulose (HPMC), ethylcellulose (EC), hydroxypropylcellulose (HPC) ), one or more polymers selected from the group consisting of cyclodextrin and copolymers of monomers forming such polymers, and cellulose. According to a specific embodiment of the present invention, the adhesive is selected from the group consisting of silicone, polyurethane, hyaluronic acid, physical adhesive (Gecko), polyacrylic, ethyl cellulose, hydroxy methyl cellulose, ethylene vinyl acetate and polyisobutylene. Contains one or more substances.

Step (c): Drying of the aptamer and/or alloferon composition and the biocompatible polymer.

After step (b), the aptamer and/or alloferon composition and the biocompatible polymer are dried.

According to one embodiment of the present invention, step (c) is (i) carried out at room temperature for 36-60 hours, (ii) carried out at 40-60° C. for 5-16 hours, or (iii) 60-60 hours. It can be carried out at 80℃ for 2-4 hours. According to another embodiment of the present invention, step (c) is (i) carried out at 20-30°C for 42-54 hours, (ii) carried out at 45-55°C for 5-7 hours, or (iii) ) can be carried out at 65-75℃ for 2-4 hours. According to a specific embodiment of the invention, step (c) is (i) carried out at 25°C for 48 hours, (ii) carried out at 50°C for 6 hours, or (iii) carried out at 70°C for 3 hours. can do. This drying process increases the mechanical strength of the microstructure.

Composition for skin improvement containing DNA aptamer

In one embodiment of the present invention, the composition for improving skin containing the DNA aptamer provides a composition containing a DNA aptamer, a DNA aptamer-antioxidant complex, or alloferon.

In one embodiment of the present invention, the DNA aptamer or DNA aptamer complex is preferably characterized by an ingredient that has the effect of preventing skin aging, removing wrinkles, whitening, improving skin trouble, and alleviating bruises, but is not limited thereto.

In addition, the characteristic ingredient of the present invention can be any raw material used in a composition for skin improvement, regardless of the type of extract or active substance. Examples include arbutin, vitamin C, retinol, astaxanthin, resveratinol, polyphenol, green tea extract, golden extract, and red ginseng extract, which are good for whitening, and apricot extract, oil extract, orange extract, lemon extract, and bamboo extract, which are good for aging prevention. , guava extract, rosemary extract, Cornus officinalis extract, Reishi extract, Ginkgo biloba extract, Seosyokyoksan extract, Jaumdan extract, moisturizing quince extract, white lotus extract, paprika extract, aloe extract, loofah extract, seaweed extract, carrot extract with antioxidant effect , soybean extract, grapefruit seed extract, grape seed extract, portulaca extract, caviar, pomegranate, and ginseng extract that help improve wrinkles, peach extract that helps in skin regeneration, Cheongung extract, centella asiatica extract, peppermint extract that is good for acne, and ginseng extract. , Houttuynia cordata extract, peony extract, wood vinegar, which is good for anti-inflammatory and antibacterial properties, dandelion extract, calendula extract, yellow bark extract, tangerine extract, goldenrod extract, fennel extract, compuri extract, elastin, collagen, coenzyme Q10, effectin, EGF, which are good for elasticity. Various extracts are applied, such as:

The microneedle transdermal patch of the present invention is a biocompatible polymer microstructure that not only has excellent dissolution properties in the skin when permeated into the skin, but also stably delivers an effective amount of the loaded composition to whiten the skin, improve wrinkles, improve skin troubles, and It can improve effects such as relieving bruising.

Hereinafter, the present invention will be described in more detail through the following examples. However, the following examples are only for illustrating the present invention in more detail, and it will be obvious to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. will be.

Example 1: Preparation of microstructure

A positive or negative master mold is manufactured on a silicon wafer using a photolithography manufacturing technique, and then a final negative mold is made from the master mold using curable silicon (PDMS, polydimethylsilozane). was manufactured.

The aptamer of the present invention used the aptamer shown in Table 1 below, and hyaluronic acid was used as the biocompatible polymer. For other composition-related matters, the components and composition are listed in Table 2.

The composition containing the aptamer and hyaluronic acid was supplied to the PDMS micromold and then injected into the hole formed in the micromold for 10-30 minutes under a vacuum (600-760 mmHg) environment. Hyaluronic acid microstructures were prepared by drying and injecting at room temperature (25°C) for 48 hours, 50°C for 6 hours, or 70°C for 3 hours, and then removing the mold.

sequence name sequence information Sequence 1 GTGGAGGGCGGTGGCCAGTCTCATACGCGGCAG Rank 2 AGAGCTCGCGCCGGAGTTCTCAATGCAAGAGC

Table 1 shows the aptamer sequences used in the present invention.

serial number Ingredient name Usage content range Yarn production sample final content (%) One Sodium Hyaluronate ~100% 95.497 / 96.397 2 Sodium Hyaluronate Crosspolymer-2 0.1~5% 1.000 3 Panthenol (D-Panthenol) 0.5~2% 2.000 4 SH-Oligo Peptide-1
(Sh-Oligopeptide-1) 0.0001~0.001% 0.001 5 Sh-Polipeptide-2 0.0001~0.001% 0.001 6 Madecassoside 0.01~0.1% 0.100 7 Ascorbic Acid 0.1% 0.100 8 Ethyl Ascobyl Ether 0.1~0.5% 0.300 9 Aptamer 0.001% or 0.01% 0.001 10 Alloferon 0.01~1% 1　 /　 0.1

Table 2 is a table showing the ingredients and composition of the composition used in the microstructure.

Claims (6)

Microneedle patch for skin improvement containing DNA aptamer and/or allopheron. The microneedle patch for skin improvement according to claim 1, wherein the patch further contains an antioxidant substance. The microneedle patch for skin improvement according to claim 2, wherein the antioxidant substance is ascorbic acid or an ascorbic acid derivative. The microneedle patch according to claim 1, wherein the microneedle patch includes a biocompatible polymer and a support. The method of claim 4, wherein the biocompatible polymer is cross-linked hyaluronic acid, non-crosslinked hyaluronic acid, sodium hyaluronate, alginic acid, pectin, carrageenan, chondroitin (sulfate), dextran (sulfate), chitosan, Polylysine, collagen, gelatin, carboxymethyl chitin, fibrin, agarose, pullulan poly lactide, polyglycolide (PGA), polylactide-glycolide copolymer (PLGA), hyaline Hyaluronic acid, alginic acid, pectin, carrageenan, chondroitin (sulfate), dextran (sulfate), chitosan, polylysine, collagen, gelatin, carboxymethyl chitin. , fibrin, agarose, pullulan polyanhydride, polyorthoester, polyetherester, polycaprolactone, polyesteramide, poly (butyric acid) , poly(valeric acid), polyurethane, polyacrylate, ethylene-vinylacetate polymer, acrylic substituted cellulose acetate, non-degradable polyurethane, polystyrene, polyvinyl chloride, polyvinyl fluoride, poly(vinyl imidazole) , chlorosulphonate polyolefins, polyethylene oxide, polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), polymethacrylate, hydroxypropylmethylcellulose (HPMC), ethylcellulose (EC), hydroxyl A microneedle patch, characterized in that it is one or more polymers selected from the group consisting of propylcellulose (HPC), carboxymethylcellulose, cyclodextrin, copolymers of monomers forming these polymers, and cellulose. A method of manufacturing a microneedle patch for skin improvement, characterized in that it contains DNA aptamer and/or allopheron.