KR20240010586A - Compositions comprising 1-O-acyl ceramide and their uses - Google Patents

Abstract

The present specification describes novel ceramides, specifically 1-O-acylceramides having a structure having fatty acid chains in both directions on the phytosphingosine skeleton, isomers thereof, salts thereof, solvates thereof or hydrates thereof, uses thereof for strengthening the skin barrier function, and A composition comprising:

Description

Compositions comprising 1-O-acyl ceramide and their uses}

The technology disclosed herein relates to compositions comprising 1-O-acylceramide and their uses.

Ceramide, which accounts for 40-50% of the human skin barrier lipids, plays a key role in moisturizing and protecting the skin. Ceramide is a representative sphingolipid substance that performs various structural roles within human cells and at the same time has important physiological activities necessary for cells to perform normal functions. All sphingolipids refer to lipids with a sphingoid backbone, which is made by polymerizing fatty acids (e.g., palmitic acid) and amino acids (e.g., serine), and are located in the head group of the backbone. There are four types of sphingoid skeletons depending on the attached hydroxy and amino groups and the presence or absence of double bonds: dihydrosphingosine, sphingosine, phytosphingosine, and 6-hydroxy. It has been reported that 6-hydroxysphingosine exists. Ceramides are made by combining fatty acids with amino groups of four types of sphingoid skeletons and are classified into several classes depending on the type of fatty acid attached. Ceramides have a high diversity of molecular structures, so new classes of ceramides are continuously being discovered, and it is known that there are more than hundreds of types of ceramides that actually exist in the skin. (International Journal of Cosmetic Science, 2017, 39, 366-372) Ceramides of various structures and lengths protect the human body by tightly filling the skin barrier and holding it together.

Ceramide is reported to be the substance most closely related to various skin diseases and skin troubles, and changes in ceramide are observed in most skin problems. Recently, with the development of analysis technology, it has become possible to track changes in each ceramide. In other words, it was previously reported that a decrease in the total content of ceramide is the cause of barrier abnormalities in various skin diseases such as atopy. Recently, it has been reported that among ceramides, ceramides such as NP, NH, EOS, EOP, and ω-hydroxyceramide decrease significantly, while ceramides NS and AP increase, so the importance of individual ceramides is increasingly emphasized.

Republic of Korea Patent Publication No. 10-2017-0084950 A

In one aspect, the present invention seeks to provide novel ceramides.

In one aspect, the present invention seeks to provide novel 1-O-acylceramides.

In one aspect, the present invention seeks to provide a composition for skin protection containing a novel ceramide.

In one aspect, the present invention seeks to provide a composition for topical skin application containing a novel ceramide.

In one aspect, the present invention seeks to provide a composition that stabilizes lamellar structures.

In one aspect, the present invention is a skin protection composition containing 1-O-acylceramide having the structure of the following formula (1), its stereoisomer, its salt, its solvate, or its hydrate as an active ingredient.

[Formula 1]

In the above formula, R1 and R2 are each independently a saturated or unsaturated aliphatic chain of C9-31, and n is an integer of 10 to 20.

In one aspect, the present invention is an external composition for skin containing 1-O-acylceramide having the structure of the following formula (1), its stereoisomer, its salt, its solvate, or its hydrate as an active ingredient.

[Formula 1]

In the above formula, R1 and R2 are each independently a saturated or unsaturated aliphatic chain of C9-31, and n is an integer of 10 to 20.

In one aspect, the present invention is a composition for improving the stability of lamellar structure comprising 1-O-acylceramide having the structure of the following formula (1), its stereoisomer, its salt, its solvate, or its hydrate as an active ingredient.

[Formula 1]

In the above formula, R1 and R2 are each independently a saturated or unsaturated aliphatic chain of C9-31, and n is an integer of 10 to 20.

In one aspect, using the present invention, novel 1-O-acylceramide can be obtained.

In one aspect, using the present invention, it is possible to strengthen skin barrier function, restore or improve weakened skin barrier function, improve skin moisturization, or improve, treat or prevent diseases caused by decreased skin barrier function.

In one aspect, the present invention can be used to provide excellent ceramides that can be used in various cosmetics and skin disease preparations.

In one aspect, the stability of the lamellar structure can be improved by using the present invention.

Figures 1 to 4 show NMR data of 1-O-acylceramide prepared according to an embodiment of the present invention.
Figure 5 is MS data of 1-O-acylceramide prepared according to an embodiment of the present invention.
Figure 6 shows toxicity test data of 1-O-acylceramide prepared according to an embodiment of the present invention.
Figures 7 to 9 are experimental data showing the effect of 1-O-acylceramide prepared according to an embodiment of the present invention on ceramide biosynthetic gene expression.
Figures 10 and 11 show MS data of 1-O-acylceramide prepared from green ceramide.
Figures 12A to 12D are polarizing microscope photographs of samples used in this clinical trial.
Figure 13 is a flowchart of the evaluation of clinical trials performed in this experiment.
Figure 14 is a graph showing the moisture content of the skin by using moisturizer for 4 weeks during the clinical trial.
Figure 15 is a graph showing the water content of the skin up to 72 hours after using the sample for 4 weeks.
Figure 16 is a graph showing the results of measuring transepidermal water evaporation (TEWL) before and after causing acute skin barrier damage after applying each sample.
Figure 17 is a graph showing the results of a skin penetration test of 1-O-acylceramide.
Figure 18 is a graph showing the effect of stabilizing liposome structure depending on the concentration of 1-O-acylceramide.

As used herein, “N-acylceramide” refers to a typical ceramide in which a fatty acid is bonded to the amino group of the sphingoid skeleton.

As used herein, “O-acylceramide” refers to a ceramide in which a fatty acid is bonded to the hydroxyl group at position 1 of the head group of the sphingoid skeleton. Since it is acyl at position 1, it is also called "1-O-acylceramide". Since it is a ceramide in which both N-acyl and O-acyl exist simultaneously, it can also be called “N, O-acylceramide.” It has bidirectional fatty acid chains, so it can spread fatty acids to the adjacent lamellar layers on both sides and play a role in holding the lamellar layers on both sides. 1-O-acylceramide is a major component of skin barrier lamellae and is a ceramide (Coupling bolt-like ceramide) that acts as a linker or coupling bolt to bind lamellae to neighboring lamellae in both directions.

Keratinocytes, the main cells that protect the skin, serve as a physical barrier against external forces and a permeability barrier that prevents the intrusion of external harmful substances or evaporation of moisture. In particular, the function as a permeability barrier is maintained in the best condition because the lipids between keratinocytes form a multi-lamellar structure and tightly fill the spaces between keratinocytes.

The chain length of ceramide N-acyl fatty acids (FAs) may be an essential factor affecting the physical and chemical properties of lipid layer organization and skin barrier function. In the human skin barrier, various types of ceramides containing FAs of various chain lengths (mainly C16-C26) exist. It was confirmed that the chain length of FA in atopic skin is relatively shorter than that in normal skin, and in atopic or dry skin, short chain FA ceramide increases and ultra-long chain FA (ULC) ceramide increases. was confirmed to be reduced. This means that skin permeability barrier function can be modulated by different ceramides with unique fatty acid chain lengths. In constructing a multilayer lipid membrane, ceramide molecules with fatty acids of various lengths form an interdigitation zone corresponding to the difference in fatty acid lengths. These are interdigitated and inhibit fluidity between the lipid membranes of each layer, thereby maintaining the overall multilayer structure. It appears that increasing the stabilization of the lipid membrane ultimately strengthens its barrier function as a permeability barrier. Here, the O-acylceramide described herein serves to stabilize the lamella structure and improve the corneocyte cohesion of human skin by fixing the multi-lamella in both directions.

As used herein, “isomer” specifically refers to optical isomers (e.g., essentially pure enantiomers, essentially pure diastereomers, or mixtures thereof), as well as conformational isomers ( Includes conformation isomers (i.e. isomers that differ only in the angle of one or more chemical bonds), position isomers (especially tautomers), or geometric isomers (e.g. cis-trans isomers). do.

As used herein, “essentially pure” means, for example, when used in relation to enantiomers or partial isomers, the specific compound, including enantiomers or partial isomers, is about 90% or more, preferably about 95% or more. , more preferably about 97% or more or about 98% or more, even more preferably about 99% or more, and even more preferably about 99.5% or more (w/w).

In this specification, the salt may be a pharmaceutically acceptable salt. As used herein, “pharmaceutically acceptable” means approval by the government or equivalent regulatory body that it can be used in animals, more specifically in humans, by avoiding significant toxic effects when used in normal medicinal dosages. means available, approved, listed in a pharmacopoeia, or otherwise recognized by a general pharmacopoeia.

As used herein, “pharmaceutically acceptable salt” refers to a salt according to one aspect of the present invention that is pharmaceutically acceptable and has the desired pharmacological activity of the parent compound.

As used herein, “salt thereof” or “pharmaceutically acceptable salt” is (1) formed with an inorganic acid such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc.; or acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl) Benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane-disulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-Toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo [2,2,2]-oct-2-ene-1-carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, tert -acid addition salts formed with organic acids such as butylacetic acid, lauryl sulfate, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, and muconic acid; or (2) a salt formed when an acidic proton present in the parent compound is replaced.

In this specification, “hydrate” refers to a compound to which water is bound, and is a broad concept that includes embedded compounds in which there is no chemical bond between water and the compound.

As used herein, “solvate” refers to a higher-order compound formed between a solute molecule or ion and a solvent molecule or ion.

In one aspect, the present invention relates to 1-O-acylceramide having the structure of the following formula (1), its isomer, its salt, its solvate, or its hydrate.

[Formula 1]

In the above formula, R1 and R2 are each independently a saturated or unsaturated aliphatic chain of C9-31, and n is an integer of 10 to 20.

In one embodiment, n in Formula 1 may be 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, or 13 or less. Additionally, in one embodiment, n in Formula 1 may be 10 or more, 11 or more, or 12 or more. In one embodiment, n can be 12.

In one embodiment, the present invention may be 1-O-acylceramide having the structure of Formula 2 below, its isomer, its salt, its solvate, or its hydrate.

[Formula 2]

In the above formula, R1 and R2 are each independently a saturated or unsaturated aliphatic chain of C9-31.

In one embodiment, R1 and R2 of Formula 1 may be an unbranched linear saturated or unsaturated aliphatic chain. In one embodiment, R1 may be an unsaturated aliphatic chain, and R2 may be a saturated aliphatic chain. In one embodiment, R1 and R2 may have carbon atoms of C9-31. For example, it may be C9 or higher, C11 or higher, C13 or higher, C15 or higher, or C17 or higher. Meanwhile, for example, it may be C31 or less, C29 or less, C27 or less, C25 or less, C23 or less, C21 or less, C19 or less, or C17 or less. For example, the carbon number may be C15 to C19. For example, the carbon number of R1 and R2 may be C17. In one embodiment, R1 may be a C17 unsaturated aliphatic chain, and R2 may be a C17 saturated aliphatic chain. In one embodiment, R1COO- may be oleoyl and R2COO- may be stearyl.

In one embodiment, fatty acid R1 or R2 can be used regardless of the presence or absence of double bonds or the number of double bonds.

In one embodiment, the 1-O-acylceramide may be 1-O-acylceramide, an isomer thereof, a salt thereof, a solvate thereof, or a hydrate thereof, having the structure of Formula 3 below.

[Formula 3]

In one embodiment, N-acylceramides of the phytosphingosine skeleton, such as N-stearoylphytosphingosine, or N-oleano, are used as starting materials for the preparation of O-acylceramides according to the present invention. N-oleanoylphytosphingosine can be used. So far, 1-O-acylceramides based on sphingosine (ceramide ENS) or sphinganine (ceramide ENDS) have been found in the skin, but phytosphingosine (ceramide ENP) has not yet been reported.

In one embodiment, the N-acylceramide of the phytosphingosine skeleton as a starting material for producing the 1-O-acylceramide of the present invention may be green ceramide. As used herein, “green ceramide” refers to a ceramide with fatty acids derived from natural sources. Green ceramide may contain two or more types of ceramides with different fatty acids. More specifically, “green ceramide” may refer to a mixture of ceramides or a composition comprising a mixture thereof, including the native fatty acid composition of a natural source, or having a composition derived from the native fatty acid composition. In another aspect, the fatty acid composition of the green ceramides may represent a composition within the range of ±30%, ±20%, ±15%, or ±10% of the weight or molar ratio of the major fatty acids from natural sources. . Meanwhile, ±30%, ±29%, ±28%, ±27%, ±26%, ±25%, ±24%, ±23%, ±22%, ±21%, ±20%, ±19% in composition ratio. %, ±18%, ±17%, ±16%, ±15%, ±14%, ±13%, ±12%, ±11%, ±10%, ±9%, ±8%, ±7%, It may mean falling within the range of ±6%, ±5%, ±4%, ±3%, ±2%, ±1%, or ±0.5%. In another aspect, the natural source may be natural wax, natural butter, or natural oil. Natural oils include argan oil, macadamia nut oil, camellia oil, meadowfoam seed oil, rose hip oil, olive oil, moringa oil, baobab oil, green tea seed oil, red palm oil, horse oil, berry oil, huskin oil, It may be one or more oils selected from sea buckthorn oil, sunflower seed oil, black sesame oil and emu oil. The natural wax may be beeswax. Natural butter may be shea butter. For example, it may be green ceramide made using the technology disclosed in Korean Patent Publication No. 10-2017-0084950 A (Korean Patent No. 10-1816019). In one embodiment, as a starting material for the production of O-acylceramide, N-acylceramide of phytosphingosine skeleton was used, and N-acylceramide was prepared from shea butter, meadowsweet oil, macadamia nut oil, and moringa oil. An example is green ceramide, which is a mixture of ceramides with fatty acids ranging from C16 to C24. In one aspect, the green ceramide is phytosphingosine; and natural sources; and may be prepared by a manufacturing method comprising the step of emulsifying.

In one embodiment, the production method may include the step of binding a fatty acid to ceramide of the phytosphingosine skeleton.

In one embodiment, the step of linking the fatty acid may include adding and reacting an acyl donor, which is one or more of fatty acids, triglycerides, or fatty acid esters, to ceramide of the phytosphingosine skeleton.

In one embodiment, the acyl donor may be triglyceride. Additionally, the triglyceride may be natural oil, natural butter, or wax, including those derived from animals, plants, or minerals. On the other hand, natural oils include argan oil, macadamia nut oil, camellia oil, meadowfoam seed oil, rose hip oil, olive oil, moringa oil, baobab oil, green tea seed oil, red palm oil, horse oil, and berry oil. , one or more oils selected from sea buckthorn oil, sunflower seed oil, black sesame oil and emu oil, shea butter, soybean oil, grape seed oil, blackcurrant oil, avocado oil, beeswax, candelina wax, carnauba wax, It may be butter or wax.

Additionally, in one embodiment, the fatty acid ester may include methyl fatty acid ester, ethyl fatty acid ester, etc.

In one embodiment, the production method according to the present invention may use an enzymatic conversion method. For example, lipase (E.C. 3.1.1) produced from Candida Antarctica can be used to induce an acylation reaction at the hydroxyl group at position 1 of ceramide.

In one embodiment, the manufacturing method according to the present invention includes mixing and melting ceramide and an acyl donor; It may include reacting the ceramide with the acyl donor melt.

In one embodiment, the manufacturing method according to the present invention includes mixing and melting ceramide and an acyl donor; It may include adding an enzyme to the ceramide and acyl donor melt and reacting it.

In one embodiment, the production method according to the present invention may be a method of using a solvent in the step of mixing and melting the ceramide and the acyl donor. In one embodiment, the solvent may be hexane.

In one embodiment, the production method according to the present invention may be a method that does not use a solvent in the step of mixing and melting the ceramide and the acyl donor.

In one embodiment, the production method according to the present invention may be a production method that uses a solvent in the step of reacting the acyl donor melt. In one embodiment, the solvent may be hexane.

In one embodiment, the production method according to the present invention may be a production method that does not use a solvent in the step of reacting the acyl donor melt.

In one embodiment, the step of binding the fatty acid may include adding an acyl donor to ceramide of the phytosphingosine skeleton, dissolving it by heating, and then reacting for 12 hours or more. Heating for the melting and/or reaction is 30°C or higher, 40°C or higher, 50°C or higher, 60°C or higher, 70°C or higher, 80°C or higher, 85°C or higher, 90°C or higher, 95°C or higher, 100°C or higher, It may be above 105℃ or above 110℃. For example, the heating may be heating to a temperature of 30 to 120°C or 80 to 120°C.

In one embodiment, the step of combining the fatty acids may further include adding an enzyme after heating and dissolving the ceramide and the fatty acid. The enzyme may be lipase. For example, the enzyme may be Lipozyme RM (Novozyme, Denmark, lipase (E.C. 3.1.1)).

In one embodiment, the reaction time may be 48 hours or less. For example, the reaction time is 48 hours or less, 46 hours or less, 44 hours or less, 42 hours or less, 40 hours or less, 38 hours or less, 36 hours or less, 34 hours or less, 32 hours or less, 30 hours or less, 28 hours or less, It may be 26 hours or less, 24 hours or less, 22 hours or less, 20 hours or less, 18 hours or less, or 16 hours or less. Meanwhile, the reaction time is, for example, 10 minutes or more, 20 minutes or more, 30 minutes or more, 40 minutes or more, 50 minutes or more, 60 minutes or more, 80 minutes or more, 100 minutes or more, 2 hours or more, 4 hours or more, 6 hours or more. It may be more than 8 hours, more than 10 hours, more than 12 hours, more than 14 hours, or more than 15 hours. In one embodiment, in the production method according to the present invention, the reaction time in the step of reacting the ceramide and the acyl donor melt may be 10 minutes to 48 hours.

In one embodiment, the reaction equivalent weight of the ceramide of the phytosphingosine skeleton and the acyl donor may be 1:1 to 3. For example, the reaction equivalent is 1:1 or more, 1:1.1 or more, 1:1.2 or more, 1:1.3 or more, 1:1.4 or more, 1:1.5 or more, 1:1.6 or more, 1:1.7 or more, 1:1.8 or more. , may be 1:1.9 or higher, or 1:2.0 or higher. Also, 1:3.0 or less, 1:2.9 or less, 1:2.8 or less, 1:2.7 or less, 1:2.6 or less, 1:2.5 or less, 1:2.4 or less, 1:2.3 or less, 1:2.2 or less, 1:2.1 It may be less than or equal to 1:2.0.

In one embodiment, the amount of enzyme added may be 5 to 30 parts by weight when the weight of sphingolipid, which is a substrate, is 100 parts by weight.

In one embodiment, the amount of the enzyme added is 5 parts by weight, 6 parts by weight, 7 parts by weight, 8 parts by weight, 9 parts by weight, or 10 parts by weight when the weight of the sphingolipid, which is the substrate, is 100 parts by weight. , It may be 12 parts by weight or more, 14 parts by weight or more, 16 parts by weight or more, 18 parts by weight or more, 19 parts by weight or more, 20 parts by weight or more, 24 parts by weight or more, or 28 parts by weight or more. In another embodiment, the amount of the enzyme added is 30 parts by weight or less, 28 parts by weight or less, 26 parts by weight or less, 24 parts by weight or less, 22 parts by weight or less, and 20 parts by weight when the weight of sphingolipid as a substrate is 100 parts by weight. Hereinafter, it may be 18 parts by weight or less, 16 parts by weight or less, 14 parts by weight or less, 13 parts by weight or less, 12 parts by weight or less, 11 parts by weight or less, or 10 parts by weight or less.

In one aspect, the present invention may be a skin protection composition containing 1-O-acylceramide having the structure of Formula 1, its stereoisomer, its salt, its solvate, or its hydrate as an active ingredient. In the above formula, R1 and R2 are each independently a C9-31 saturated or unsaturated aliphatic chain, and n may be an integer of 10 to 20. In one embodiment, R1 and R2 may be unbranched linear saturated or unsaturated aliphatic chains. In one embodiment, R1 and R2 may have carbon atoms of C13 to C21. In one embodiment, the 1-O-acylceramide may have the structure of Chemical Formula 3.

In one aspect, the use for skin protection may be for enhancing skin ceramide biosynthesis, improving skin barrier function, improving skin moisturization, and improving, preventing or treating diseases with abnormal skin barrier function. For example, skin diseases caused by decreased skin barrier function include atopy, psoriasis, etc. In one embodiment, the 1-O-acylceramide, its isomer, its salt, its solvate, or its hydrate is used to repair or improve skin barrier function damaged by various causes such as disease, autoimmunity, or external stimulation. can be used For example, it can be used to repair or improve skin barrier function damaged by diseases such as contact dermatitis, allergic dermatitis, and acne, or by ultraviolet rays or fine dust.

In one embodiment, the composition may be a pharmaceutical composition, food composition, cosmetic composition, or external skin composition.

In one embodiment, the composition may enhance the biosynthesis of ceramide in skin cells by increasing the expression of serine-palmitoyltransferase. In one embodiment, the composition may be administered or provided to a subject with reduced expression of serine-palmitoyltransferase. For example, the serine-palmitoyltransferase may be SPTLC-1 and SPTLC-2.

In one embodiment, the composition may enhance the biosynthesis of ceramide in skin cells by increasing ceramide synthase activity along with increasing serine-palmitoyltransferase expression. For example, the ceramide synthase may be CERS3.

In one embodiment, the 1-O-acylceramide, its isomer, its salt, its solvate or its hydrate can be administered to a subject in need at a daily dose of 0.09 mg/kg to 1.10 mg/kg. . For example, the 1-O-acylceramide, its isomer, its salt, its solvate or its hydrate is administered in a daily dose of 0.09 mg/kg or more, 0.10 mg/kg or more, 0.12 mg/kg or more, or 0.14 mg/kg or more, 0.16mg/kg or more, 0.18mg/kg or more, 0.20mg/kg or more, 0.22mg/kg or more, 0.24mg/kg, 0.26mg/kg or more, 0.28mg/kg or more, 0.30mg/kg or more, 0.32mg/ kg or more, 0.34 mg/kg or more, 0.36 mg/kg or more, 0.38 mg/kg or more, 0.40 mg/kg or more, 0.42 mg/kg, or 0.44 mg/kg or more. Also, for example, 1.11 mg/kg or less, 1.10 mg/kg or less, 1.05 mg/kg or less, 1.00 mg/kg or less, 0.90 mg/kg or less, 0.80 mg/kg or less, 0.70 mg/kg or less, 0.60 mg/kg or less. , may be 0.50 mg/kg or less, 0.49 mg/kg or less, 0.48 mg/kg or less, 0.47 mg/kg or less, or 0.46 mg/kg or less.

In one embodiment, the skin protection composition may further include N-acylceramide, a stereoisomer thereof, a salt thereof, a solvate thereof, or a hydrate thereof as an active ingredient. In one embodiment, the weight ratio of N-acylceramide, its stereoisomer, its salt, its solvate, or its hydrate: 1-O-acylceramide, its stereoisomer, its salt, its solvate, or its hydrate is 0.5 to 0.5. It could be 20:1. Alternatively, the weight ratio of N-acylceramide, its stereoisomer, its salt, its solvate, or its hydrate: 1-O-acylceramide, its stereoisomer, its salt, its solvate, or its hydrate is 0.8 to 15:1. It can be.

For example, the weight ratio of N-acylceramide, its stereoisomer, its salt, its solvate or its hydrate: 1-O-acylceramide, its stereoisomer, its salt, its solvate or its hydrate is 20 or less: 1, 19 and below: 1, 18 and below: 1, 17 and below: 1, 16 and below: 1, 15 and below: 1, 14 and below: 1, 13 and below: 1, 12 and below: 1, 11 and below: 1, 10 and below: 1, It may be 9:1 or less, 8:1 or less, 7:1 or less, 6:1 or less, 5:1 or less, or 4:1 or less. or 0.5:1 or greater, 0.7:1 or greater, 0.8:1 or greater, 0.9:1 or greater, 1:1 or greater, 1.5:1 or greater, 2:1 or greater, 2.5:1 or greater, 3:1 or greater, 3.5:1 or greater. , or it may be 4:1 or more.

In one aspect, the present invention provides a composition for external use for skin containing 1-O-acylceramide having the structure of Formula 1, its stereoisomer, its salt, its solvate, or its hydrate as an active ingredient, or a composition for improving lamellar structure stability. It may be a composition. In the above formula, R1 and R2 are each independently a C9-31 saturated or unsaturated aliphatic chain, and n may be an integer of 10 to 20. In one embodiment, R1 and R2 may be unbranched linear saturated or unsaturated aliphatic chains. In one embodiment, R1 and R2 may have carbon atoms of C13 to C21. In one embodiment, the 1-O-acylceramide may have the structure of Chemical Formula 3.

In one embodiment, the external skin composition may be in a lamellar structure formulation. For example, the lamellar structure formulation may be a liposome.

In one embodiment, the composition includes lecithin and a sphingolipid, wherein the sphingolipid is 1-O-acylceramide, a stereoisomer thereof, a salt thereof, a solvate thereof, or a hydrate thereof based on the total weight of the sphingolipid. As a standard, it may be included in an amount of 20 to 100% by weight. For example, the 1-O-acylceramide, its stereoisomer, its salt, its solvate or its hydrate, based on the total weight of the sphingolipid, at least 20% by weight, at least 30% by weight, at least 40% by weight, and at least 50% by weight. % or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% It may include weight percent.

One aspect of the present invention provides a cosmetic composition containing 1-O-acylceramide, its isomer, its salt, its solvate, or its hydrate. The cosmetic composition contains a cosmetically or dermatologically acceptable medium or base. These are all formulations suitable for topical application, for example solutions, gels, solids, pasty anhydrous products, emulsions obtained by dispersing the oil phase in the water phase, emulsions obtained by dispersing the water phase in the oil phase, multi-emulsions, suspensions, microemulsions, micro-emulsions. It can be used in the form of capsules, microgranulocytes, ionic (liposomes) and non-ionic vesicles, dispersants, foams, aerosols further containing compressed propellants, or patches. These compositions can be prepared according to conventional methods in the art.

In addition to the above-mentioned substances, the cosmetic composition may contain other ingredients that can preferably have a synergistic effect on the main effect, as long as they do not impair the main effect, and other ingredients other than the active ingredient of the present invention may be added to other cosmetics. Depending on the formulation or purpose of use of the composition, a person skilled in the art can appropriately select and mix the composition without difficulty. For example, the cosmetic composition of the present invention may contain, in addition to the above-mentioned active ingredients, other ingredients usually mixed in cosmetic compositions as needed, examples of which include fat ingredients, moisturizers, emollients, surfactants, organic and inorganic pigments, and organic pigments. Examples include powders, ultraviolet absorbers, preservatives, disinfectants, antioxidants, stabilizers, thickeners, glycerin, pH adjusters, alcohol, pigments, fragrances, blood circulation promoters, cooling agents, antiperspirants, and purified water. Other components that may be included in the cosmetic composition are not limited to this, and the amount of the components may be contained within a range that does not impair the purpose and effect of the present invention.

The formulation of the cosmetic composition is not particularly limited and can be appropriately selected depending on the purpose. For example, soap-type preparations, softening lotion, nourishing lotion, essence, nourishing cream, massage cream, pack, gel, makeup base, foundation, powder, lipstick, patch, spray, eye cream, eye essence, cleansing cream, cleansing foam. , consisting of cleansing water, cleanser, hair shampoo, hair conditioning, hair treatment, hair essence, hair lotion, scalp hair tonic, scalp essence, hair gel, hair spray, hair pack, body lotion, body cream, body oil and body essence. It may be prepared in one or more formulations selected from the group, but is not limited thereto.

One aspect of the present invention provides a pharmaceutical composition containing 1-O-acylceramide, its isomer, its salt, its solvate, or its hydrate composition. In addition to the active ingredients, these pharmaceutical compositions may contain preservatives, stabilizers, wetting agents, emulsification accelerators, salts and/or buffers for adjusting osmotic pressure, diluents (e.g. lactose, dextrose, sucrose, mannitol, sorbitol, cellulose or glycine), Lubricants (e.g. silica, talc, stearic acid and its magnesium or calcium salts or polyethylene glycol) or binders (e.g. magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose or polyvinyl chloride) It may additionally contain pharmaceutical auxiliaries such as (rolidine) or other therapeutically useful substances. In some cases, other pharmaceutical additives may be included, such as starch, agar, disintegrants such as alginic acid or its sodium salt, absorbents, colorants, flavoring agents, or sweeteners.

The pharmaceutical composition can be formulated into various oral or parenteral dosage forms according to conventional methods. The parenteral administration agent may be, for example, in the form of drops, ointments, lotions, gels, creams, sprays, suspensions, emulsions, suppositories, patches, injections, etc., but is not limited thereto.

The pharmaceutical composition according to one aspect of the present invention may be administered orally, parenterally, such as transdermally or intravenously. The composition complies with dosage forms and standards suitable for each administration method. In particular, in the case of intravenous injection, all additives unsuitable for this are excluded, and the purity of the composition itself is also very high.

The amount of the active ingredient to be applied will vary depending on the age, gender, weight, disease, pathological condition, route of administration, and the judgment of the prescriber of the subject to be treated. Determination of application amounts based on these factors is within the level of one skilled in the art.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples, comparative examples, and experimental examples. However, these examples, comparative examples, and experimental examples are provided only for illustrative purposes to aid understanding of the present invention, and the scope and scope of the present invention are not limited by the following examples, comparative examples, and experimental examples.

Example 1) Preparation of 1-O-acylceramide

To a certain amount of N-oleoylphytosphingosine (ceramide NP), add 1.5 equivalent moles of tristearin in the form of triglyceride as an acyl donor, add 2.5 times the volume of hexane solvent, heat to dissolve, and then dissolve with Lipozyme RM (Novozyme, Denmark, lipase (E.C. 3.1.1)) was added in an amount of 5 parts by weight when the weight of sphingolipid was 100 parts by weight, and then reacted in hexane solvent at a temperature of 55°C for 24 hours to produce 1-O- with a conversion rate of 56%. Acylceramide was obtained. The 1-O-acylceramide obtained from the reaction was separated and purified, its molecular weight was confirmed by MS (MW: 882.82), and NMR confirmed that the acyl chain was bound to the hydroxyl group No. 1 (Figures 1 to 5).

Experimental Example 1) Analysis of the effect of 1-O-acylceramide on ceramide biosynthesis

Cytotoxicity test

Human Epidermal Keratinocyte, neonatal (HEKn), Thermo Fisher Scientific, USA) were placed in 7x10 ³ cells in a 96 well plate and cultured for 24 hours at 37°C with 5% CO ₂ ventilation. Then, the 1-O-acylceramide sample was treated to a final volume of 100ul. The 96-well plate treated with 1-O-acylceramide was cultured for an additional 24 hours at 37°C and 5% CO ₂ aeration conditions. After removing the medium, it was washed once with PBS (phosphate buffered saline), and the same amount of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide or MTT) solution as the medium was added. Incubation was performed at 37°C for 90 minutes. After removing the MTT solution, 100ul of Stop solution (Dimethyl sulfoxide) was added and left at room temperature for 20 minutes. Absorbance was measured at 570 nm. The results are shown in Figure 6.

As shown in Figure 6, 1-O-acylceramide is toxic to cells depending on concentration. This was found to be similar to the range of toxicity generally shown by ceramide or phytosphingosine.

Cell culture and RNA extraction

Human Epidermal Keratinocyte, neonatal (HEKn), Thermo Fisher Scientific, USA) were added to a 12-well plate at 1x10 ⁵ cells per well and cultured for 24 hours at 37°C with 5% CO ₂ ventilation. The 1-O-acylcermide prepared in the above example was treated at concentrations of 0.1, 0.5, and 1uM, respectively, and then cultured for an additional 24 hours at 37°C and 5% CO ₂ aeration conditions. The medium was removed, washed once with PBS buffer, and RNA was extracted using the NucleoSpin RNA Plus kit (Germany). The conditions were that 350ul LBP (lysate buffer) was added to each well, scraped with a scraper, cell lysate was recovered in the NucleoSpin gDNA Removal Column (yellow ring), and centrifuged at 11,000g for 30 seconds. 100ul BS (Binding Solution) was added to the recovered solution, mixed, transferred to NucleoSpin RNA Plus Column (blue ring), and centrifuged at 11,000g for 15 seconds. 200ul Buffer WB1 (washing buffer) was added to the column and washed by centrifugation at 11,000g for 15 seconds. 600ul Buffer WB2 (washing buffer) was added again and washed by centrifugation at 11,000g for 15 seconds. Finally, 250ul Buffer WB2 (washing buffer) was added and washed by centrifugation at 11,000g for 2 minutes. Each step above involves removing remaining proteins, lipids, and DNA. 20ul RNase-free H ₂ O was added and centrifuged at 11,000g for 1 minute. (2 times) Collect the extracted RNA in a sterilized microtube and quantify the RNA. The absorbance of RNA was measured at 260 nm and 280 nm, and the amount of RNA was calculated. At this time, RNase free water was used as a blank.

RNA to cDNA synthesis

Add 1ul of oligo-dT primer to RNA correction value + DEPC water correction value (total 11ul), collect by centrifugation, and heat at 65°C for 5 minutes. After cooling and centrifugation, 4ul of Buffer + 2ul of dNTP mix + 1ul of RNase inhibitor + 1ul of RNA transcriptase (total 20ul) were added to each sample, left at room temperature for 5 minutes, and then subjected to enzyme reaction at 42°C for 1 hour. Enzyme stop reaction was performed at 70°C for 5 minutes.

RT-PCR

The RT-PCR mixture was as follows; 2ul of synthesized cDNA + 0.5ul of primer mix (10uM) + 12.5ul of TB Green® Premix Ex Taq and the remainder was filled with distilled water to make a total volume of 25ul. Operating conditions were 95℃ - heated once for 30 seconds, then 95℃ - It was cycled 40 times in steps of 5 seconds, 60°C - 30 seconds. The primer sequences used at this time are listed in Table 1. The values obtained through RT-PCR were quantified using equations (1) and (2) and then quantitatively analyzed.

… … … … … … … … Equation (1)

… … … … … … … Equation (2)

Name sequence Sequence Listing No. GAPDH (F) GAGTCAACGGATTTGGTCGT SEO ID NO: 1 GAPDH (R) TTGATTTTGGAGGGATCTCG SEO ID NO: 2 SPTLC-1(F) GCGCGCTACTTGGAGAAAGA SEO ID NO: 3 SPTLC-1(R) TGTTCCACCGTGACCACAAC SEO ID NO: 4 SPTLC-2(F) AGCCGCCAAAGTCCTTGAG SEO ID NO: 5 SPTLC-2(R) CTTGTCCAGGTTTCCAATTTCC SEO ID NO: 6 CER3(F) ACATTCCACAAGGCAACCATTG SEO ID NO: 7 CER3(R) CTCTTGATTCCGCCGACTCC SEO ID NO: 8

The primer sequences used, SPTLC-1 and SPTLC-2, are serine-palmitoyltransferases that correspond to the rate limiting step in the ceramide biosynthetic pathway. This enzyme causes a condensation reaction of serine and palmitoyl CoA, creating a sphingoid skeleton. This causes a series of biosynthetic reactions to synthesize ceramide to proceed. Through this example, 1-O-acylceramide can play a role in maintaining homeostasis of the skin barrier by promoting de novo synthesis (biosynthesis) of ceramide in skin cells by increasing the expression of serine-palmitoyltransferase by about two-fold. It is expected that there will be. Additionally, as the activity of ceramide synthase3, which is involved in ceramide synthesis, increases, it is expected to have the effect of promoting the synthesis of ceramide in the skin.

Example 2) Preparation of 1-O-acylceramide

Green ceramide was manufactured using the technology disclosed in Korean Patent Publication No. 10-2017-0084950 A (Korean Patent No. 10-1816019). Specifically, the fatty acid source is N-acylceramide prepared by mixing shea butter, meadow oil, macadamia nut oil, and moringa oil at a weight ratio of 1:1:1:1, and N-acyl fatty acids are C16 to C24. There are various ceramides. 100 g of the following natural sources and 10 g of phytosphingosine were placed in a beaker, heated, and stirred at a stirring speed of 200 rpm using a homogenizer at 100°C for 3 hours to prepare each green ceramide composition in emulsified form. No enzymes were used in the entire process. The obtained green ceramide was separated and purified. For separation and purification, 50 times the amount of hexane was added to precipitate, and then the precipitate was filtered. The ceramide thus obtained is N-acylceramide (Ceramide NP).

The types, manufacturers, and countries of origin of fatty acids are as follows:

Sheabutter (Butyrospermum Parkii (Shea) Butter) AAK Sweden

Limnanthes Alba (Meadowfoam) Seed Oil Kerfoot United Kingdom

Macadamia Integrifolia Seed Oil Macadamiaoils Australia

Moringa Oleifera Seed Oil Kerfoot United Kingdom

Stearic acid was bound to 1-OH of the obtained green ceramide through an enzyme reaction. Specifically, 1.5 equivalent moles of stearic acid or glyceride form of tristearin as an acyl donor was added to the green ceramide (N-acylceramide), and 2.5 times the volume of hexane solvent was added, heated and dissolved, and then dissolved in Lipozyme RM (Novozyme, Denmark, lipase (E.C. 3.1.1)) was added in an amount of 5 parts by weight when the weight of sphingolipid was 100 parts by weight, and then reacted in hexane solvent at a temperature of 55°C for 24 hours to produce 1-O- with a conversion rate of 56%. Acylceramide was obtained. (Ceramide ENP)

The 1-O-acylceramide obtained from the reaction was separated and purified, and its molecular weight was confirmed by MS (ceramide ENP). Specifically, 5.65 mg each of ceramide ENP and ceramide NP were dissolved in 1 mL of chloroform/methanol (4/1) and then diluted 10- and 100-fold with chloroform/methanol (1/9) to obtain 0.565 mg/ml and 0.0565 mg, respectively. It was prepared at a concentration of /ml and analyzed by LC-MS/MS under the following conditions.

MS operating conditions Model Shimadzu 8040 MS (triple quadrupole) Spray Vol. Vaporizer
Temp. Capillary
Temp. Sheath
(Neb) Gas Column Oven Ion Sweep Gas Aux Gas Drying Gas (+)4000V 300℃ 350℃ 35Arbs 40℃ 2.0 Arbs 10 Arbs 10 L/min Gas Neb/Dry/Aux gas Nitrogen Collision gas Argon MS/MS Dwell time 100 msec Pressure Product Ion Scan(-) NP: 554.5, 552.5, 582.5, 580.5, 578.5, 576.5, 610.5, 608.5, 638.5, 636.5, 634.5, 666.5 (CE: 30 eV)
1-O-acylceramide (ENP): 820.5, 818,5 848.5, 846.5, 844.5, 842.5, 876.5, 874.5, 904.5, 902.5, 900.5, 932.5 (CE: 30 eV) Q3 Scan(-) m/z 500~1000 (ENP), 300~700 (NP)

The fatty acid composition of the obtained ceramide NP and ceramide ENP and the molecular weight of each ceramide are as follows. Since it is a 1-O-acylceramide obtained from green ceramide, the fatty acid composition of natural sources, which is the fatty acid source of green ceramide, leads to the N-acyl fatty acid of ceramide NP and the N-acyl fatty acid of ceramide ENP. Ceramide ENP adds stearic acid, a 1-O acyl fatty acid, to ceramide NP, so the molecular weight increases by the molecular weight of the added stearic acid.

MS results are shown in Figures 10A-10B and Figures 11A-11F.

Example 3) Preparation of composition

Basic product containing purified water, dipropylene glycol, hexanediol, ceramide NP, hydrogenated lecithin, carbomo, cholesterol, behenic acid, stearic acid, behenyl alcohol, caprylic/capric triglyceride, squalane, phytosphingosine, etc. Clinical samples were prepared so that 0% (sample 1), 0.02% (sample 2), 0.05% (sample 3), and 0.2% (sample 4) of 1-O-acylceramide were added to the cream, respectively. The weight ratio of ceramide NP and ceramide ENP (1-O-acylceramide) of each sample is shown in the table below.

sample 1 sample 2 Sample 3 Sample 4 Ceramide NP 0.2% 0.2% 0.2% 0.2% Ceramide ENP
(1-O-acylceramide) 0% 0.02% 0.05% 0.2%

Figures 12A to 12D are polarizing microscope photographs of the samples used in this clinical trial. This shows that liquid crystals are well formed by the multilayer lamellar structure.

Experimental Example 2) Human clinical trial

1) Test subjects

In this clinical trial, among women in their 20s without any special skin diseases, those who satisfied the following test subject selection criteria and did not meet the exclusion criteria were selected. The clinical test subjects were women in their 20s to 50s with no specific skin diseases, and the total number of clinical test subjects was 20. Additionally, people who fall under any of the following 1 to 4 were excluded from the clinical trial.

1. Those who have taken medications that may affect skin reactions in the past month (adrenocortical hormones, retinoids, anticancer drugs, etc.)

2. Those who are severely irritated or allergic to cosmetics, medicines, or daily light exposure

3. Those who are participating in another clinical trial at the same time or have participated in a previous clinical trial and not enough time has passed

4. Persons judged by the attending physician to be unsuitable as subjects due to other diseases or reasons

2) Test method

- Evaluation of skin moisture retention ability

After lightly wiping the subject's forearm with water and stabilizing it for 30 minutes, five application sites were marked and selected on the subject's left lower arm. After measuring the moisture content (TEWL, hydration) at the beginning of the test (base line), the sample was applied twice a day in the morning and evening for 4 weeks, and the skin moisture content was measured once a week. In addition, the moisturizing effect was confirmed by measuring the amount of moisture in the skin (SC hydration) 24, 48, and 72 hours after stopping application for 4 weeks. During the test period, water contact with the test area was strictly regulated. During the test period, the temperature (23 ± 4°C) and humidity (40-60%) of the test site were kept constant.

- Evaluation of skin cohesion

After completing the skin moisture measurement, skin cohesion (SC cohesion) was measured. The base TEWL of the area where each sample was applied was measured, the TEWL value was measured after tape stripping 15 times, and the change in TEWL was compared.

- Clinical evaluation flow chart

As shown in Figure 13.

3) Observation items for effectiveness evaluation

For observation of the same case, the same person in charge objectively measures the TEWL value every time the test subject visits, and in cases where the test is discontinued during the test, it is observed/evaluated at the point of discontinuation.

4) Dropout criteria

Even test subjects selected according to the above criteria are excluded if they meet the criteria below, and the test data of the excluded test subjects are excluded from the calculation of test results.

1. If the test can no longer be conducted due to side effects caused by the use of the sample.

2. If the test subject experiences problems in evaluating the results due to excessive exposure to ultraviolet rays in the test area during the test process, excessive drinking, smoking, etc.

3. If the test subject is no longer able to proceed with the test due to physical illness, etc.

4. If it is difficult to follow-up the test subject due to personal circumstances during the test process.

5. If the test subject does not comply with the test method

6) Statistical analysis principles and methods

Statistical analysis of all objective data uses paired t-test for each of the vehicle and five types of moisturizers containing 1-O-acylceramide, and the statistical significance level of the data was set at p-value < 0.01.

The results of the clinical trial were as follows.

As shown in Figure 14, the moisture content of the skin showed a clear tendency to increase due to the use of moisturizer during the 4 weeks of the clinical trial. In addition, it can be seen that the skin moisture content clearly tends to increase in the sample containing O-acylceramide compared to sample 1 in which N-acylceramide was used alone. This is interpreted as O-acylceramide further suppressing moisture evaporation by firmly holding the lamellae of the skin barrier. This can be seen as important evidence showing that O-acylceramide can exhibit excellent moisturizing effects by increasing the skin barrier function in various skin compositions.

In addition, as shown in Figure 15, the results of measuring how much the water content of the skin decreases up to 72 hours after using the sample for 4 weeks showed that the water content of the sample containing O-acylceramide was higher than the sample without it. I was able to confirm that it appeared.

Meanwhile, the SC cohesion results, which evaluate the bonding strength of lamellae, showed that the skin barrier bonding strength increased in samples containing 1-O-acylceramide. Figure 16 is a graph showing the results of measuring transepidermal water evaporation (TEWL) before and after causing acute skin barrier damage after applying each sample. In general, a method of causing acute skin barrier damage is tape stripping. If the skin is removed with tape 10 to 15 times, the skin barrier collapses and transepidermal water evaporation (TEWL) increases. In the case of skin on which no sample was applied, the TEWL increased by about 8.5 on average over 15 tape strippings, whereas in the sample containing only N-acylceramide, the TEWL increased by 7, in the sample containing N-acylceramide and 1-O-acylceramide. showed a transepidermal water evaporation amount of less than 6, showing that relatively less skin damage was caused for the same skin damage. Tape stripping is a method of physically removing skin cells and the intercellular lamella layer, and 1-O-acylceramide can be interpreted as making it difficult for the skin barrier to fall by holding the lamella layer in both directions.

Through clinical trials, it was confirmed that 1-O-acylceramide plays a role in improving skin barrier function and preventing skin barrier damage by holding lamellae in both directions in the intercellular lipid layer of the skin barrier. This is because 1-O-acylceramide strengthens the basic skin and can be used as a material that has various skin effects such as moisturizing, preventing dryness, protecting the skin from various cleansers, suppressing skin damage, relieving various types of skin troubles including atopy, and preventing aging. It is believed that it can be done

Experimental Example 3) Skin Penetration Test

After applying a cream containing 0.5% of 1-O-acylceramide to the forearms of five testers, 30 minutes later, the skin was removed 15 times from the treated area with D-squame standard tape and then treated with methanol. Ceramides from the skin were extracted. To analyze ceramide, the extracted sample was dissolved in chloroform/methanol (1/9, w/w) and then diluted 10 times with methanol. Samples were analyzed using liquid chromatography-tandem mass spectrometry (LC-MS/MS). As shown in Figure 17, it was confirmed that 1-O-acylceramide was quickly absorbed into the skin barrier layer after application to the skin and exhibited barrier function.

Example 3) Effect of 1-O-acylceramide on liposome stabilization

Hydrogenated Lecithin: Sphingoslipid = Mix at a molar ratio of 96:4 and dissolve in solvent. For the above sphingolipids, the ratio of N-acylceramide (Ceramide NP (HPLCS)):1-O-acylceramide (ENP) was changed from 19:1 to 1:1. After completely removing the solvent, distilled water was added to make the lipids 1% and hydrated. The liposome particle size was adjusted to 150-200 nm using a tip type sonicator. Deoxycholic acid (DOC), a strong solubilizer, was prepared at different concentrations, and then the liposome solution was added and left at 60°C for 30 minutes to sufficiently dissolve. The degree of dissolution was confirmed by measuring the absorbance of each sample.

As shown in Figure 18, it was found that the dissolution of liposomes was delayed as the amount of 1-O-acylceramide increased. It appears that 1-O-acylceramide improved the packing of the liposome bilayer, making it difficult for DOC, a solubilizing agent, to penetrate into the bilayer. As a result, it can be seen that 1-O-acylceramide has the effect of increasing the stability of the membrane of lamellar structures such as liposomes.

Claims (18)

A skin protection composition comprising 1-O-acylceramide having the structure of the following formula (1), its stereoisomer, its salt, its solvate, or its hydrate as an active ingredient.
[Formula 1]

In the above formula, R1 and R2 are each independently a C9-31 saturated or unsaturated aliphatic chain, and n is an integer from 10 to 20. The composition for skin protection according to claim 1, wherein the skin protection is one or more of improving skin moisturization and improving skin barrier function. The composition for skin protection according to claim 2, wherein the composition is a pharmaceutical composition for improving, preventing or treating skin diseases caused by decreased skin barrier function. The skin protection composition according to claim 2, wherein the composition is a cosmetic composition for improving or preventing skin diseases caused by decreased skin barrier function. The composition for skin protection according to claim 2, wherein the composition is a food composition for improving or preventing skin diseases caused by decreased skin barrier function. The composition for skin protection according to claim 1, wherein the composition further comprises N-acylceramide, a stereoisomer thereof, a salt thereof, a solvate thereof, or a hydrate thereof as an active ingredient. According to clause 6,
N-acylceramide, its stereoisomer, its salt, its solvate or its hydrate: The weight ratio of 1-O-acylceramide, its stereoisomer, its salt, its solvate or its hydrate is,
0.5 to 20: 1 person,
Composition for skin protection. In clause 7,
N-acylceramide, its stereoisomer, its salt, its solvate or its hydrate: The weight ratio of 1-O-acylceramide, its stereoisomer, its salt, its solvate or its hydrate is,
0.8 to 15: 1 person,
Composition for skin protection. A composition for external use for skin containing 1-O-acylceramide having the structure of the following formula (1), its stereoisomer, its salt, its solvate, or its hydrate as an active ingredient.
[Formula 1]

In the above formula, R1 and R2 are each independently a C9-31 saturated or unsaturated aliphatic chain, and n is an integer from 10 to 20. The composition for external application for skin according to claim 9, wherein the composition for external application for skin is a lamellar structure formulation. The composition for external application for skin according to claim 10, wherein the lamellar structure formulation is a liposome formulation. The method of claim 11, wherein the composition includes lecithin and a sphingolipid, and the sphingolipid is 1-O-acylceramide, a stereoisomer thereof, a salt thereof, a solvate thereof, or a hydrate thereof in the total weight of the sphingolipid. A composition for external application for skin, comprising an amount of 20 to 100% by weight based on. A composition for promoting lamellar structure stability comprising 1-O-acylceramide having the structure of the following formula (1), its stereoisomer, its salt, its solvate, or its hydrate as an active ingredient.
[Formula 1]

In the above formula, R1 and R2 are each independently a C9-31 saturated or unsaturated aliphatic chain, and n is an integer of 10 to 20. The composition for enhancing lamellar structure stability according to claim 13, wherein the lamellar structure is a liposome. 15. The composition of any one of claims 1 to 14, wherein R1 and R2 are unbranched, linear, saturated or unsaturated aliphatic chains. The composition of claim 15, wherein R1 and R2 have carbon atoms of C13 to C21. The composition according to claim 16, wherein the 1-O-acylceramide has the structure of Formula 3 below.
[Formula 3]
The method according to any one of claims 1 to 8, wherein the 1-O-acylceramide, its stereoisomer, its salt, its solvate or its hydrate is administered in a daily dose of 0.09 mg/kg to 1.10 mg/kg. A composition for skin protection, which is administered.