KR20240000814A - Pharmaceutical composition for the treatment of retinal diseases comprising the CRISPR/Cas complex that specifically works on the retinal pigment epithelium as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating retinal diseases, comprising the CRISPR/Cas complex as an active ingredient. The present invention is a study to develop a technology that can target the target cells to be treated for the fundamental treatment of retinal diseases, specifically macular degeneration (Age-related Macular Disease (AMD)), expressed under the human VMD2 promoter. Cas9 was produced to induce retinal pigment epithelium (RPE)-specific expression, and it was confirmed that pVMD2-Cas9 was specifically expressed and operated in RPE cells in both in vivo mouse and in vitro human retinal organism models. Using this, gene editing (correction) will be possible limited to RPE cells, which is expected to be greatly used in the fundamental treatment of various hereditary and non-hereditary eye diseases related to RPE cells.

Description

Pharmaceutical composition for the treatment of retinal diseases comprising the CRISPR/Cas complex that specifically works on the retinal pigment epithelium as an active ingredient active ingredient}

The present invention relates to a pharmaceutical composition for the treatment of retinal diseases containing as an active ingredient a CRISPR/Cas complex that specifically operates on the retinal pigment epithelium.

The CRISPR/Cas system is a bacterial defense mechanism that enables precise editing of the genome, and is a powerful technology used as a gene editing tool to selectively modify DNA sequences at specific locations in the genome with much greater precision than existing genome modification technologies. The CRISPR-Cas system consists of two components, protein and RNA, and Cas9, a protein, is an intranucleic acid hydrolase and causes site-specific double-strand breaks in the genome induced by guide RNA (gRNA). Strand DNA Breaks (DSB) can be created. In contrast to zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), which require significant protein engineering to modify each DNA target site, the CRISPR-Cas9 system requires only changes to the gRNA sequence. Do this. For this reason, CRISPR-Cas9 technology has been rapidly and widely adopted by the scientific community to target, edit or modify the genomes of various cells and organisms.

RNA-guided genome editing (RNA-guided genome surgery or RNA-guided genome editing) using CRISPR-Cas9 nuclease is expected to be helpful in treating various genetic diseases, but CRISPR-Cas9 nuclease is used for non-genetic diseases. The effectiveness of treatment has been revealed to a limited extent. An example of a non-genetic disease is macular degeneration (e.g., Age-related Macular Disease (AMD). AMD is a major cause of blindness in the elderly population of developed countries. Choroidal neovascularization (CNV) is the main pathological feature of neovascular AMD, and is mainly caused by angiogenic cytokines such as vascular endothelial growth factor A (VEGFA). Until now, VEGFA has been used as a treatment for macular degeneration. Targeting monoclonal antibodies or aptamers have mainly been developed. However, because VEGFA is continuously expressed and secreted by retinal cells, these anti-VEGFA agents, which have a limited duration of effect, must be administered repeatedly, on average 7 times per year. It is administered more than once.

When using the CRISPR/Cas9 system for therapeutic purposes, there may be disease-related target cells that need to be modified. However, if the CRISPR/Cas9 system operates in all types of cells, the problem of gene correction occurring even in unwanted cells may occur, and technology development for this is required.

Therefore, the present invention is to develop a technology that can target the target cells to be treated for the fundamental treatment of eye disease, specifically macular degeneration (Age-related Macular Disease (AMD)), by developing a technology that targets cells expressed under the human VMD2 promoter. Cas9 was produced to induce retinal pigment epithelium (RPE)-specific expression, and it was confirmed that pVMD2-Cas9 was specifically expressed and operated in RPE cells in both in vivo mouse and in vitro human retinal organoid models. Using this, gene editing (correction) will be possible limited to RPE cells, which is expected to be greatly used in the fundamental treatment of various hereditary and non-hereditary eye diseases related to RPE cells.

The present inventors have made extensive research efforts to develop technology that can target the target cells to be treated for the fundamental treatment of macular degeneration (Age-related Macular Disease (AMD)). As a result, Cas9 expressed under the human VMD2 promoter was produced to induce retinal pigment epithelium (RPE)-specific expression, and pVMD2-Cas9 was specifically expressed in RPE cells in both in vivo mouse and in vitro human retinal organoid models. By confirming that it works, the present invention has been completed.

Therefore, the purpose of the present invention is to provide a pharmaceutical composition for preventing or treating retinal diseases, comprising the CRISPR/Cas9 complex as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

DETAILED DESCRIPTION OF THE INVENTION Various embodiments described herein are described below with reference to the drawings. In the following description, various specific details, such as specific forms, compositions, and processes, are set forth in order to provide a thorough understanding of the invention. However, certain embodiments may be practiced without one or more of these specific details or in conjunction with other known methods and forms. In other instances, well-known processes and manufacturing techniques are not described in specific detail so as not to unnecessarily obscure the invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Accordingly, the phrases “in one embodiment” or “an embodiment” expressed in various places throughout this specification do not necessarily refer to the same embodiment of the invention. Additionally, particular features, shapes, compositions, or properties may be combined in any suitable way in one or more embodiments.

Unless there is a special definition in the specification, all scientific and technical terms used in the specification have the same meaning as commonly understood by a person skilled in the art in the technical field to which the present invention pertains.

Throughout the specification, when a part is said to “include” a certain element, this means that it may further include other elements rather than excluding other elements, unless specifically stated to the contrary.

According to one aspect of the present invention, the present invention provides a guide RNA containing a VMD2 promoter and a vascular endothelial growth factor (VEGF) gene.

The present inventors have made extensive research efforts to develop technology that can target the target cells to be treated for the fundamental treatment of macular degeneration (Age-related Macular Disease (AMD)). As a result, Cas9 expressed under the human VMD2 promoter was produced to induce retinal pigment epithelium (RPE)-specific expression, and pVMD2-Cas9 was specifically expressed and operated in retinal pigment epithelial cells in both in vivo mouse and in vitro human retinal organism models. Confirmed.

As used herein, the term “promoter” refers to the upstream region of a gene involved in the initiation of transcription, which is the step of synthesizing RNA from DNA. In other words, it refers to the part of the DNA strand where RNA Polymerase binds or the part where RNA complementary to one strand of DNA is synthesized, that is, transcription begins.

According to the present invention, the VMD2 promoter uses the human VMD2 promoter. Specifically, the 623 bps VMD2 promoter located in the sequence order -585 to +38 of human VMD2 was used, but is not limited thereto.

As used herein, the term “Vascular endothelial growth factor (VEGF)” refers to a signaling protein produced by many cells that stimulates blood vessel formation. Vascular endothelial growth factor is a subfamily of growth factors, a member of the platelet-derived growth factor family of cystine knot growth factors, and is an important signaling protein involved in angiogenesis, which is the formation of new blood vessels in the embryonic circulatory system and the growth of blood vessels from the existing vascular system. .

As used herein, the term “guide RNA (gRNA)” refers to a piece of RNA that serves as a guide for an RNA or DNA targeting enzyme and forms a complex with RNA. With high frequency, these enzymes delete, insert or modify target RNA or DNA. Although they occur naturally and provide important functions, they can also be engineered for use in targeted editing, such as CRISPR-Cas9 and CRISPR-Cas12.

According to a specific embodiment of the present invention, the vascular endothelial growth factor is vascular endothelial growth factor A (VEGFA), placental growth factor (PGF), and vascular endothelial growth factor B (Vascular endothelial growth factor B). factor B; VEGFB), Vascular endothelial growth factor C (VEGFC), Hypoxia-inducible factor 1-alpha (Hif1α), and Vascular endothelial growth factor D (Vascular endothelial growth factor D) D; VEGFD), which is any one selected from the group consisting of guide RNA (Guide RNA). Specifically, it may be vascular endothelial growth factor A, but is not limited thereto.

As used herein, the term “Vascular endothelial growth factor A (VEGFA)” refers to a dimeric glycoprotein encoded by the vascular endothelial growth factor A gene in humans. Vascular endothelial growth factor A is essential in adults during wound healing, tumor angiogenesis, vascular-related diseases such as diabetic retinopathy and age-related macular degeneration, and organ remodeling. Early in vertebrate development, blood vessel formation occurs and the endothelium condenses into blood vessels. The differentiation of endothelial cells depends on the expression of vascular endothelial growth factor A, and if expression is stopped, embryo death can occur. Vascular endothelial growth factor A is produced by three major isoform groups as a result of alternative splicing, with three isoforms produced (VEGFA120, VEGFA164, and VEGFA188) causing vascular defects and total vascular endothelial growth factor in mice. A Knockout does not cause death. Vascular endothelial growth factor A is essential for the role of neurons because they require vascular supply, and abrogating the expression of vascular endothelial growth factor A in neural progenitor cells can lead to defects in brain angiogenesis and neuronal apoptosis. Anti-VEGFA therapy can be used to treat patients with undesirable angiogenesis and vascular leakage in cancer and ophthalmic diseases and may result in inhibition of neurogenesis and neuroprotection.

As used herein, the term "placental growth factor (PGF)" refers to the protein encoded by the placental growth factor gene in humans. Placental growth factor is a member of the vascular endothelial growth factor subfamily, particularly vascular during embryonic development. It is a key molecule in formation and angiogenesis.The main source of placentogenic factors during pregnancy is placental trophoblasts, and placentogenic factors are also expressed in many other tissues, including villous trophoblasts.

As used herein, the term "Hypoxia-inducible factor 1-alpha (Hif1A)" refers to a subunit of the heterodimeric transcription factor hypoxia-inducible factor 1 (HIF-1) encoded by the HIF1A gene. . HIF1A is a basic helix-loop-helix PAS domain containing protein that serves as a master transcriptional regulator of cellular and developmental responses to hypoxia, and dysregulation and overexpression of HIF1A by hypoxia or genetic alterations have implications not only in cancer biology, but especially in angiogenesis. and many other pathophysiologies in the areas of angiogenesis, energy metabolism, cell survival and tumor invasion.

According to another aspect of the present invention, the present invention provides a CRISPR/Cas complex, including a guide RNA including a VMD2 promoter and a vascular endothelial growth factor gene, and a Cas (CRISPR associated protein) nuclease.

As used herein, the term “nuclease” refers to an enzyme that can cleave phosphodiester bonds between nucleotides of nucleic acids. Also called nuclease or nucleic acid hydrolase. Nucleases have various effects on single- and double-strand breaks in target molecules.

As used herein, the term "CRISPR (Clustered regularly interspaced short palindromic repeats)-Cas" refers to a gene editing technology resulting from the adaptive immunity phenomenon of microorganisms. It enables simpler and more efficient genetic manipulation by precisely cutting the target DNA and then allowing the DNA to be repaired naturally. This system consists of guide RNA (gRNA) and Cas nuclease, and is also called RNA-guided engineered nucleases (RGENs) technology. gRNA is composed of crRNA that binds complementary to the target sequence and tracrRNA for Cas-binding. gRNA serves to guide Cas to the target portion and binds complementary to the target DNA sequence. There must be a PAM (Protospacer adjacent motif) sequence at the 3' end of the target DNA sequence. When gRNA forms a complex with Cas nuclease and specifically binds to the target sequence, Cas nuclease recognizes the PAM sequence and causes a double strand break (DSB) in the 3 bp upstream part of PAM.

According to the present invention, the Cas is a CRISPR/Cas complex selected from the group consisting of Cas9, Cas12, Cas13, and Cas14. Specifically, it may be Cas9, but is not limited thereto.

As used herein, the term “Cas9 (CRISPR associated protein 9)” refers to a 160 kilodalton protein that plays an important role in the immune defense of certain bacteria against DNA viruses and plasmids. It is widely used in genetic engineering applications, and its main function is to change the genome of a cell by cutting DNA.

As used herein, the term “Cas12” refers to an RNA-guided endonuclease that forms part of the CRISPR system in some bacteria. In addition to cleaving the target gene upon recognition of the protospacer, Cas12 causes collateral cleavage of non-target surrounding single-stranded DNA (ssDNA). Cas12 is utilized in the development of various portable diagnostic technologies using its secondary cleavage function. The Cas12acrRNa complex incidentally degrades single-stranded DNA, and when it binds to the target double-stranded DNA, it causes approximately 1,250 incidental cleavages per second. Therefore, attention is being paid to Cas12a as an enzyme that can simultaneously detect nucleic acids and amplify signals. Cas12 specifically recognizes double-stranded sequences with the PAM sequence of 5'-(T)TTN-3', and the commonly used Cas12s are Cas12a and Cas12b. When the target is single-stranded DNA, the PAM sequence is not 100% identical and is known to undergo enzymatic cleavage even if there are changes.

As used herein, the term “Cas13” refers to an RNA-derived RNA endonuclease, which does not cleave DNA but only single-stranded RNA. The Cas13 group forms a ribonucleoprotein and gRNA consisting of a 28-30 bp spacer that can recognize target genes. The Cas13 protein acts as an RNA-degrading enzyme rather than a DNA-degrading enzyme, and Cas13 incidentally cleaves RNA, unlike Cas12, which incidentally cleaves DNA. Among the Cas13 group, Cas13a, previously known as C2C2, was the first to be used for nucleic acid detection. Cas13a degrades single-stranded RNA targets with a protospacer matching the crRNA. Once bound to single-stranded RNA, Cas13a protein acts as a non-specific RNA degrading enzyme and degrades surrounding RNA even if it is not the target RNA. It has been reported that a single target recognition causes at least 104 collateral cuts. There are two types of enzymatic cleavage: cleavage of the target gene and cleavage of non-specific surrounding RNA sequences. Since Cas13 does not cleave the complementary protospacer, but cleaves the surrounding area, the protospacer is maintained intact, so it can cleave the bond multiple times, resulting in an amplification effect and can be used for sensitive detection. The Cas13 protein does not require a PAM sequence, but requires a guanine base called a protospacer flaking site (PFS) next to the protospacer. The most widely used Cas13 proteins in biotechnology and diagnostics are Cas13a and Cas13b, and Cas13b is known to be more stable for cell genetic manipulation.

As used herein, the term “cas14” refers to an RNA endonuclease that can recognize the protospacer of single-stranded DNA. The Harrington group developed Cas14-DETECTR to detect single nucleotide mutations. However, since Cas14 activates collateral cleavage through the identification of single-stranded DNA, when double-stranded DNA must be detected, there is a complexity in the process of having to denature the double-stranded DNA into single-stranded DNA. Cas14 was discovered most recently and is divided into Cas14a, Cas14b, and Cas14c, which cleaves single-stranded nucleic acids regardless of the sequence of the PAM. However, it has been reported that a PAM sequence containing a large amount of base sequence T is required to cleave a double-stranded target gene. Unlike Cas12a, which has problems distinguishing similar single-stranded sequences, Cas14a can identify single-stranded target genes even when there is only one difference. This shows the possibility of being used to identify SNPs in single-stranded sequences even without the PAM sequence.

According to a specific embodiment of the present invention, the CRISPR/Cas complex suppresses vascular endothelial growth factor gene expression in the retinal pigment epithelium (RPE) and vascular endothelial growth factor gene expression in the neural retina (NR). It is a CRISPR/Cas complex that does not suppress expression.

As used herein, the term "retinal pigment epithelium (RPE)" refers to the layer of pigment cells immediately outside the neurosensory retina that nourishes retinal visual cells and is tightly attached to the underlying choroid and overlying retinal visual cells. It is attached. The retinal pigment epithelium has several functions, such as light absorption, epithelial transport, spatial ion buffering, visual cycle, phagocytosis, secretion, and immune regulation.

As used herein, the term “retina” refers to the innermost light-sensitive layer of eye tissue in most vertebrates and some molluscs. The optics of the eye produce a focused two-dimensional image of the visual world on the retina and translate this image into electrical nerve impulses to the brain to create visual perception, functioning similar to the film or image sensor in a camera. The neural retina is composed of several layers of neurons connected by synapses and supported by an outer layer of pigmented epithelial cells.

According to another aspect of the present invention, the present invention provides a vector containing a complex containing a VMD2 promoter, a guide RNA containing a vascular endothelial growth factor gene, and a Cas nuclease.

In the present invention, the “vector” is a nucleic acid molecule capable of transporting another nucleic acid to which a nucleic acid molecule is linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA into which additional DNA segments can be ligated. Another type of vector is a phage vector. Another type of vector is a viral vector, in which additional DNA segments can be ligated into the viral genome. Some vectors are capable of autonomous replication in the host cell into which they are introduced (e.g., bacterial vectors are episomal mammalian vectors that have a bacterial origin of replication). Other vectors (e.g., non-episomal mammalian vectors) can be introduced into the host cell and integrated into the host cell's genome, thereby replicating along with the host genome. In addition, some vectors can direct the expression of genes to which they are operationally linked. Such vectors are referred to herein as “recombinant expression vectors” or simply “expression vectors”. In general, expression vectors useful in recombinant DNA techniques often exist in the form of plasmids. In this specification, “plasmid” and “vector” can be used interchangeably because plasmid is the most commonly used form of vector.

Specific examples of the expression vector in the present invention include widely used commercially available pCDNA vectors, F, R1, RP1, Col, pBR322, ToL, and Ti vectors; cosmid; Phages such as lambda, lambdoid, M13, Mu, p1 P22, Qμμ, T-even, T2, T3, T7; It may be selected from the group consisting of plant viruses, but is not limited thereto, and all expression vectors known to those skilled in the art as expression vectors can be used in the present invention, and when selecting an expression vector, it depends on the properties of the target host cell. Introduction of vectors into host cells may be performed by calcium phosphate transfection, viral infection, DEAE-dextran control transfection, lipofectamine transfection, or electroporation, but is not limited thereto, and those skilled in the art will use the method. An introduction method suitable for the expression vector and host cell can be selected and used. Preferably, the vector contains one or more selection markers, but is not limited to this, and selection can be made depending on whether or not the product is produced using a vector that does not contain a selection marker. The selection marker is selected based on the desired host cell, and since this method is already known to those skilled in the art, the present invention is not limited thereto.

According to a specific embodiment of the present invention, the vector is an adenovirus (Adenovirus), a retrovirus (Retrovirus), an Adeno-Associated Virus (AAV), a Herpes simplex virus (HSV), a lentivirus ( It is a vector selected from the group consisting of Lentivirus, Plasmid, and Liposome. Specifically, it may be a lentivirus, but is not limited thereto.

As used herein, the term “Adenovirus” refers to a medium-sized virus of 90 to 100 nm and has no envelope. It is icosahedral in shape and has DNA in the form of a double helix. Adenovirus is the cause of 5 to 10% of upper respiratory diseases in children, and adults can also be infected. The most common symptom of adenovirus infection is upper respiratory tract illness. Adenovirus infection is often accompanied by conjunctivitis, tonsillitis, otitis media, laryngitis, and gastroenteritis. Children in particular can develop bronchiolitis or pneumonia, which can worsen significantly. Babies may cough as if they have whooping cough. Additionally, adenovirus can rarely cause encephalitis or cystitis.

As used herein, the term “retrovirus” refers to a type of virus that changes the genome of an invading host cell by inserting a copy of its RNA genome into the DNA of the host cell. Once inside the host cell's cytoplasm, the virus uses its reverse transcriptase enzyme to create DNA from its RNA genome, the reverse of the usual pattern and thus in reverse (reverse direction). The new DNA is integrated into the host cell genome by the integrase enzyme, where the retroviral DNA is called a provirus. The host cell then treats the viral DNA as part of its own genome, transcribing and translating the viral genes along with the cell's own genes to produce the proteins needed to assemble new copies of the virus.

As used herein, the term “lentivirus” refers to a type of retrovirus that causes chronic and fatal diseases characterized by a long incubation period in humans and other mammalian species. The genus includes human immunodeficiency virus (HIV), which causes AIDS. Lentiviruses are distributed throughout the world and are known to inhabit apes, cattle, goats, horses, cats, sheep, and many other mammals. Lentiviruses are one of the most efficient methods of gene transfer because they can integrate significant amounts of viral complementary DNA into the DNA of host cells and can efficiently infect non-dividing cells. Lentiviruses can become endogenous and integrate their genome into the host germline genome, allowing the virus to subsequently be passed on to the host's descendants.

According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating macular degeneration (Age-related Macular Disease (AMD)) comprising a vector containing a CRISPR/Cas complex as an active ingredient.

As used herein, the term “age-related macular degeneration (AMD)” refers to a disease that occurs with various changes in the macular part of the retina as one ages. The incidence rate increases with age, and in developed countries, it is the number one cause of blindness in adults and is known to have approximately 200 million patients worldwide. Therefore, as the elderly population increases in Korea, the frequency of occurrence is expected to increase further. The macula refers to the central part of the nervous tissue called the retina. It is densely packed with photoreceptor cells that respond to light stimulation and is responsible for central vision.

As used herein, the term “pharmaceutical composition” refers to a composition administered for a specific purpose. For the purpose of the present invention, the pharmaceutical composition of the present invention is for preventing or treating macular degeneration, and may include a compound involved therein and a pharmaceutically acceptable carrier, excipient, or diluent. Additionally, the pharmaceutical composition according to the present invention contains 0.1 to 50% by weight of the active ingredient of the present invention based on the total weight of the composition. Carriers, excipients and diluents that may be included in the composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, Examples include, but are not limited to, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. Pharmaceutically acceptable salts must have low toxicity to the human body and not adversely affect the biological activity and physicochemical properties of the parent compound. Pharmaceutically acceptable salts include, but are not limited to, acid addition salts of pharmaceutically acceptable free acids and base compounds.

As used herein, the term “prevention” refers to suppressing the occurrence of a disease or disease in a subject who has not been diagnosed as having the disease or disease but is likely to develop the disease or disease.

As used herein, the term “treatment” refers to (a) inhibiting the development of a disease, condition or symptom; (b) alleviation of a disease, condition or symptom; or (c) means eliminating a disease, condition or symptom. When the composition of the present invention is introduced into a subject suffering from macular degeneration, it suppresses, eliminates, or reduces the function of the VEGFA gene. Accordingly, the composition of the present invention may itself be a composition for treating these diseases, or may be administered together with other pharmacological ingredients and applied as a treatment adjuvant for these diseases. Accordingly, in this specification, the term “treatment” or “therapeutic agent” includes the meaning of “treatment aid” or “treatment aid.”

As used herein, the term "administration" or "administer" refers to directly administering a therapeutically effective amount of the composition of the present invention to a subject so that the same amount is formed in the subject's body.

According to a specific embodiment of the present invention, it is a pharmaceutical composition for treating macular degeneration, which is dry or wet.

According to the present invention, age-related macular degeneration causes visual impairment due to the loss of photoreceptor cells in the macular area as aging progresses, and can be divided into ① wet or exudative form and ② dry or non-exudative form. The wet (wet = neovascular, exudative) form is when choroidal neovascularization grows under the retina and is treated with intraocular injection of anti-vascular endothelial growth factor (VEGF) monoclonal antibody. Dry (atrophic) form accounts for the majority of AMD and refers to lesions such as drusen, pigmentary abnormality, or atrophy of the retinal epithelium.

According to a specific embodiment of the present invention, the composition containing the vector as an active ingredient inhibits vascular endothelial growth factor gene expression in the retinal pigment epithelium and does not inhibit vascular endothelial growth factor gene expression in the neural retina. It is a composition.

According to the present invention, vascular endothelial growth factor is a powerful vascular permeability factor that acts as a vascular endothelial cell inducer by hypoxia and is a factor that induces vasculogenesis and angiogenesis. Vascular endothelial growth factor acts through the representative receptors Flt-1 and KDR/Flt-1, and these two receptors are essential for the development of a normal vascular system. Similar to the regulation of vascular development, in the central nervous system, hypoxia increases the secretion of vascular endothelial growth factors from glial cells, which increases angiogenesis. Additionally, the vascular endothelial growth factor secreted in this way has a direct effect on nerve cells. In the nervous system, vascular endothelial growth factors act as neurotrophic factors, inducing axonal outgrowth, improving cell survival, and promoting the proliferation of Schwann cells. Vascular endothelial growth factor is the most important protein in the creation of the vascular system and also acts to regulate the development of the nervous system. Therefore, excessive inhibition of vascular endothelial growth factor in nerve cells may result in side effects, and the pharmaceutical composition containing the active ingredient of the present invention inhibits vascular endothelial growth factor to improve macular degeneration, resulting in neural retina. It has the property of suppressing vascular endothelial growth factor gene expression only in the retinal pigment epithelium and not in the retinal pigment epithelium (NR).

According to another aspect of the present invention, the present invention provides a transformant transformed with a vector containing a CRISPR/Cas complex.

According to a specific embodiment of the present invention, the transformant is a microorganism, cell, or animal entity other than a human.

As used herein, the term "transformation" refers to a DNA chain fragment or plasmid containing a different type of gene from that of the original cell infiltrating between cells and combining with the DNA present in the original cell to change the genetic characteristics of the cell. This refers to a changing molecular biological phenomenon. Transformation is commonly observed in bacteria and can be achieved through artificial genetic manipulation. Transformed recipient cells can spread new genetic traits through conjugation and transduction. A transformed individual is called a transformant.

According to another aspect of the present invention, the present invention includes the steps of (a) confirming inhibition of blood vessel development in the retina of a transformant transformed with a vector;

(b) administering a candidate substance for promoting blood vessel development to the transformant; and,

(c) determining that the candidate material is a material for the treatment of retinal disease when the development of blood vessels in the retina of the transformant increases.

According to a specific embodiment of the present invention, the retinal disease is a disease caused by inhibition of blood vessel formation in the retina or damage to blood vessels.

According to a specific embodiment of the present invention, the retinal disease may be any one selected from the group consisting of diabetic retinopathy, retinopathy of prematurity, retinal artery occlusion, retinal vein occlusion, and other retinal vascular diseases, It is not limited to this.

As used herein, the term “diabetic retinopathy” refers to a disease in which damage to the retina occurs due to diabetes. It is also called diabetic eye disease (DED). It is a major cause of blindness in developed countries and is a disease in which the microcirculation of blood vessels in the retina is damaged. This accounts for a high proportion of the causes of blindness in countries around the world, and occurs in approximately 90% of patients with diabetes for 30 years or more, and in cases around 15 years old, the incidence reaches approximately 60-70%.

As used herein, the term “retinopathy of prematurity” refers to a disease in which vascular changes in the retina occur due to abnormal development of retinal blood vessels. The younger the gestational age and the smaller the birth weight, the more it occurs. In premature babies born before the retinal blood vessels are fully developed, the retinal tissue is exposed to the atmosphere or oxygen, and when the oxygen concentration increases, the retinal blood vessels contract.

As used herein, the term “retinal artery occlusion” refers to a disease in which blood flow to the retina is blocked. Like a stroke, the symptoms can be mild or severe, and the location and range of occurrence vary. Typically, it occurs in one in 10,000 people, with 1 to 2% of cases occurring in both eyes. Before vascular occlusion occurs, one eye may be temporarily completely blind, and when vascular occlusion occurs, the eyes become dark as if there is a dark cloud in front of them, and in more than 90% of cases, vision deteriorates rapidly to the point where fingers in front of the eyes cannot be clearly distinguished. .

As used herein, the term “retinal vein occlusion” refers to a disease in which the venous vessels in the eye are blocked, causing blood circulation problems, resulting in new blood vessels, bleeding and edema. Depending on the location of the occluded retinal vein, it is classified into central vein occlusion or branch vein occlusion. In most cases, vision suddenly becomes difficult in one eye without pain and stereoscopic vision is reduced. Vision appears in various ways, including asymptomatic symptoms, visual disturbances, and decreased vision. Approximately 25% of patients regain vision naturally, but for the remaining patients, vision does not recover or may deteriorate further.

According to one aspect of the present invention, the present invention provides a CRISPR/Cas complex, including a guide RNA including a VMD2 promoter and a Cas (CRISPR associated protein) nuclease.

According to a specific embodiment of the present invention, the guide RNA is a CRISPR/Cas complex containing vascular endothelial growth factor (VEGF).

According to a specific embodiment of the present invention, the vascular endothelial growth factor is vascular endothelial growth factor A (VEGFA), placental growth factor (PGF), and vascular endothelial growth factor B (Vascular endothelial growth factor B). factor B; VEGFB), Vascular endothelial growth factor C (VEGFC), Hypoxia-inducible factor 1-alpha (Hif1α), and Vascular endothelial growth factor D (Vascular endothelial growth factor D) D; VEGFD), which is any one selected from the group consisting of CRISPR/Cas complex. Specifically, it may be vascular endothelial growth factor A, but is not limited thereto.

According to a specific embodiment of the present invention, the CRISPR/Cas complex specifically inhibits vascular endothelial growth factor gene expression in the retinal pigment epithelium (RPE) and vascular endothelium of the neural retina (NR). It is a CRISPR/Cas complex that does not inhibit growth factor gene expression.

According to a specific embodiment of the present invention, the Cas nuclease is a CRISPR/Cas complex selected from the group consisting of Cas9, Cas12, Cas13, and Cas14.

According to another aspect of the present invention, the present invention provides a vector containing a CRISPR/Cas complex, including a guide RNA containing a VMD2 promoter and a Cas (CRISPR associated protein) nuclease.

According to a specific embodiment of the present invention, the vector is an adenovirus (Adenovirus), a retrovirus (Retrovirus), an Adeno-Associated Virus (AAV), a Herpes simplex virus (HSV), a lentivirus ( It is a vector selected from the group consisting of Lentivirus, Plasmid, and Liposome.

According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating retinal diseases comprising a vector containing a complex as an active ingredient.

According to a specific embodiment of the present invention, the retinal disease is any one selected from the group consisting of macular degeneration, diabetic retinopathy, retinopathy of prematurity, retinal artery occlusion, retinal vein occlusion, and other retinal vascular diseases. It is a composition.

According to a specific embodiment of the present invention, the retinal disease is a pharmaceutical composition in which the retinal disease is a disease caused by inhibition of blood vessel formation in the retina or damage to blood vessels.

According to a specific embodiment of the present invention, it is a pharmaceutical composition for treating macular degeneration, which is dry or wet.

According to another aspect of the present invention, the present invention provides a transformant transformed with a vector containing the complex.

According to a specific embodiment of the present invention, the transformant is a microorganism, cell, or animal entity other than a human.

According to another aspect of the present invention, the present invention includes the steps of (a) confirming the inhibition of blood vessel development in the retina of the transformant of claim 12;

(b) administering a candidate substance for promoting or inhibiting blood vessel development to the transformant; and,

(c) determining that the candidate material is a material for the treatment of retinal disease when the development of blood vessels in the retina of the transformant increases or decreases.

According to a specific embodiment of the present invention, the retinal disease is a disease caused by inhibition of blood vessel formation in the retina or damage to blood vessels.

According to a specific embodiment of the present invention, the retinal disease is any one selected from the group consisting of macular degeneration, diabetic retinopathy, retinopathy of prematurity, retinal artery occlusion, retinal vein occlusion, and other retinal vascular diseases. am.

SEQ ID NO: 1: VEGFA (human) & Vegfa (mouse) Forward oligonucleotides

caccgctcct ggaagatgtc cacca

SEQ ID NO: 2: VEGFA (human) & Vegfa (mouse) Reverse oligonucleotides

aaactggtgg acatcttcca ggagc

SEQ ID NO: 3: AAVS1 (human) Forward oligonucleotides

caccgggggc cactagggac aggat

SEQ ID NO: 4: AAVS1 (human) Reverse oligonucleotides

aaacatcctg tccctagtgg ccccc

SEQ ID NO: 5: Rosa26 (mouse) Forward oligonucleotides

caccgggcgg tcctcagaag ccagg

SEQ ID NO: 6: Rosa26 (mouse) Reverse oligonucleotides

aaaccctggc ttctgaggac cgccc

SEQ ID NO: 7: VEGFA (human) Forward primer

acactctttc cctacacgac gctcttccga tctgcctctc atgcagtggt gaa

SEQ ID NO: 8: VEGFA (human) Reverse primer

gtgactggag ttcagacgtg tgctcttccg atctccacct gcatggtgat gttg

SEQ ID NO: 9: Vegfa (mouse) Forward primer

acactctttc cctacacgac gctcttccga tctcccacac agtgatcaag ttc

SEQ ID NO: 10: Vegfa (mouse) Reverse primer

gtgactggag ttcagacgtg tgctcttccg atctcttcat cgttacagca gcctg

SEQ ID NO: 11: AAVS1 (human) Forward primer

acactctttc cctacacgac gctcttccga tctgaccacc ttatattccc aggg

SEQ ID NO: 12: AAVS1 (human) Reverse primer

gtgactggag ttcagacgtg tgctcttccg atctgtgggg gttagaccca atatc

SEQ ID NO: 13: Rosa26 (mouse) Forward primer

acactctttc cctacacgac gctcttccga tctatcagta agggagctgc agtg

SEQ ID NO: 14: Rosa26 (mouse) Reverse primer

gtgactggag ttcagacgtg tgctcttccg atctcagaag actcccgccc atc

SEQ ID NO: 15: Vegfa (mouse) off target 1 Forward primer

acactctttc cctacacgac gctcttccga tctgtgatca gctgacttcc agttc

SEQ ID NO: 16: Vegfa (mouse) off target 1 Reverse primer

gtgactggag ttcagacgtg tgctcttccg atctctccac aactcaagtc ccattac

SEQ ID NO: 17: Adapter sequence Forward primer

acactctttc cctacacgac gctcttccga tct

SEQ ID NO: 18: Adapter sequence Reverse primer

gtgactggag ttcagacgtg tgctcttccg atct

SEQ ID NO: 19: Target sequences of Vegfa (mouse) off target 1

ctcctggaag attttcacca ggg

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a pharmaceutical composition for preventing or treating retinal diseases, comprising the CRISPR/Cas complex as an active ingredient.

(b) The present invention is a study to develop a technology that can target the target cells to be treated for the fundamental treatment of eye disease, specifically macular degeneration (Age-related Macular Disease (AMD)), human VMD2 Cas9 expressed under a promoter was produced to induce retinal pigment epithelium (RPE)-specific expression, and it was confirmed that pVMD2-Cas9 was specifically expressed and operated in RPE cells in both in vivo mouse and in vitro human retinal organism models. Using this, gene editing (correction) will be possible limited to RPE cells, which is expected to be greatly used in the fundamental treatment of various hereditary and non-hereditary eye diseases related to RPE cells.

Figure 1 shows the schematic construction of the pVMD2-SpCas9-E2A-mRFP-T2A-Puro vector, and the VMD2 promoter with a size of 623 bps located at −585 to +38 of human VMD2 was used to replace the CMV promoter.
Figure 2 shows the expression patterns of pCMV-SpCas9-RFP and pVMD2-SpCas9-RFP in mouse in vivo and human retinal organoids in vitro, according to an experimental example of the present invention, and the pCMV vector is expressed in mouse in vivo (Figures 2A and 2B). ) and in human retinal organoids in vitro (Figure 2E and 2F) expressed RFP in both the retinal pigment epithelium and neural retina, whereas the pVMD2 vector expressed RFP in mouse in vivo (Figure 2C and 2D) and in human retinal organoids in vitro (Figure 2C and 2D). In Figures 2G and 2H), red fluorescent protein (RFP) was expressed only in the retinal pigment epithelium. Figures 2A, 2C, 2E, and 2G show brightfield images, and Figures 2B, 2D, 2F, and 2H show fluorescence images. The scale bar in Figures 2A-2D is 100 μm and in Figures 2E-2H is 500 μm.
Figure 3 shows the results of retinal pigment epithelium-specific gene editing by pVMD2-SpCas9, according to an experimental example of the present invention. Figures 3A and 3B show subretinal injection of two lentiviruses expressing pVMD2-SpCas9 and mouse Vegfa or Rosa26 targeting guide RNA (gRNA), resulting in generation of the two mouse genes in the retinal pigment epithelium and neural retina (NR). Insertion-deletions (insertions and deletions) were investigated. Indel efficiency was significantly higher in the retinal pigment epithelium than in the neural retina (Vegfa, p = 0.005; Rosa26, p < 0.001). Figure 3C shows that when lentiviruses of pVMD2-SpCas9 and human AAVS1 targeting gRNA were transduced into human retinal organoids containing retinal pigment epithelial spheres, indel efficiency was significantly higher in the retinal pigment epithelium than in the neural retina (p = 0.016). ). Figure 3D defines retinal pigment epithelium specificity as the ratio of indels generated in the retinal pigment epithelium compared to indels generated in the neural retina. pVMD2-SpCas9 showed significantly higher retinal pigment epithelium specificity than pCMV-SpCas9 (p = 0.002).
Figure 4 shows the results confirming that retinal pigment epithelium-specific Vegfa ablation efficiently regresses choroidal neovascularization according to an experimental example of the present invention. Figures 4A and 4B show that when evaluating the therapeutic effects of gRNA targeting pVMD2-SpCas9/pCMV-SpCas9 and mouse Vegfa via subretinal injection in a laser-induced CNV mouse model, gRNA targeting pVMD2-SpCas9 and Vegfa compared to the control group. It significantly regressed CNV and was similar to pCMV-SpCas9 and Vegfa targeting gRNA and Aflibercept. Scale bar is 200 μm. Figure 4C showed that the amount of mouse vascular endothelial growth factor protein in the retinal pigment epithelium was significantly decreased in both groups of pCMV-SpCas9 and Vegfa targeting gRNA and pVMD2-SpCas9 and Vegfa targeting gRNA compared to the control group. .

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Construction of lentiviral vector plasmids encoding Cas9 and guide RNA.

The human VMD2 promoter sequence (-585 to +38) with a size of 623 base pairs was amplified with forward primer 5'-accggtATGGAATTCTGTC-3' and reverse primer 5'-aacttAGGTCTGGCCTACTAG-3', and was used to generate HEK293T (ATCC, VA, obtained from genomic DNA from the United States). In the pCMV-Cas9-mRFP-Puro vector, pCMV was replaced with pVMD2 using the appropriate restriction enzymes Mlu° and HIND III. To create a lentiviral vector, pVMD2-Cas9-mRFP-Puro and pCMV-Cas9-mRFP-Puro were subcloned into the lentiCRISPRv2 (#52961, Addgene, USA) vector.

The LentiGuide-Puro (#52963, Addgene, USA) vector was used as a lentiviral vector to express gRNA. Target genes and sequences, protospacer adjacent motif (PAM) sequences, and oligonucleotides for vector subclones of gRNA are summarized in Table 1. For gRNAs targeting mouse Vegfa and human VEGFA , common sequences between the two species were selected.

Target gene Target sequences Forward oligo
(5' to 3') Reverse oligo
(5' to 3') VEGFA (human) & VEGFA (mouse) CTCCTGGAAGATGTCCACCA GGG caccgCTCCTGGAAGATGTCCACCA aaacTGGTGGACATCTTCCAGGAGc AAVS1 (human) GGGGCCACTAGGGACAGGAT TGG caccgGGGGCCACTAGGGACAGGAT aaacATCCTGTCCCTAGTGGCCCCc Rosa26 (mouse) GGCGGTCCTCAGAAGCCAGG AGG caccgGGGCGGTCCTCAGAAGCCAGG aaacCCTGGCTTCTGAGGACCGCCc

animal

Adult C57BL/6J mice weigh 18-20 g and are 8-10 weeks old. All mice were treated in accordance with the Association for Research in Vision and Ophthalmology (ARVO) Statement for the Use of Animals in Ophthalmic and Vision Research. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Yonsei University College of Medicine (IACUC number: 2017-0239). C57BL/6 mice were maintained under a 12-hour light, 12-hour dark cycle.

Lentivirus production

To produce lentivirus, HEK293T cells were incubated with a plasmid mixture (20 μg) of the genes of interest, psPAX2 (#12260, Addgene) and pMD2.G (#12259, Addgene) with Lipofectamine 2000 (Thermo Fisher Scientific). , USA) was used to transfer to a weight ratio of 4:3:1. The supernatant containing the virus was collected at 36 and 60 hours after the initial infection (transfer), and the supernatant filtered through a Millex-HV 0.45 μm low protein binding membrane (Millipore, USA) was treated with Vivaspin 20. (Vivaspin 20; Sartorius, Gottingen, Germany) and concentrated by centrifugation. To obtain the high titer, ultracentrifugation (BECKMAN COULTER, USA) was secondarily performed at 24,000 rpm at 4°C for 2 hours. After ultracentrifugation, the supernatant was completely removed, and the virus pellet was stored in 200 μl PBS at 4°C overnight and then stored at -80°C. Lentiviral data were measured with the Nucellospirop RNA virus kit (Takara, Shiga, Japan) and the LentiX qRT-PCR titration kit (Takara, Shiga, Japan) according to the manufacturer's instructions.

Sub-retinal injection and in vivo choroidal neovascularization model

Mice aged 8 to 10 weeks were intraperitoneally administered a mixture of tiletamine and zolazepam (1:1, 2.25 mg/kg body weight) and xylazine hydrochloride (0.7 mg/kg body weight). Anesthetized by injection. Then, Cas9 and gRNA contained in the lentiviral vector were delivered by intravitreal injection using a Nanofil syringe with a 33G blunt needle (World Precision Instruments Inc.) under an operating microscope (Leica Microsystems Ltd.). Afterwards, choroidal neovascularization was modeled using a laser. Subretinal injections were performed with a 33-gauge submicroliter injection system (World Precision Instruments, FL, USA).

2 μl of 8 × ¹⁰ viral genomes (vg)/mL consisting of 1 μl of pVMD2-Cas9 or pCMV-Cas9 and 1 μl of gRNA targeting Vegfa or Rosa26 were delivered to the mouse subretinal space, 1 week after lentivirus introduction. Then, choroidal neovascularization was induced using laser photocoagulation by an argon laser system (NIDEK, CA, USA) with the parameters of 532 nm wavelength, 50 μm spot size, 100 mW power, and 100 ms exposure time. Only burns that foamed without bleeding were included in the analysis, and clinically used fibrin was injected into the body at the same time as CNV induction as a positive control, and tissue was collected or CNV size was evaluated 1 week after CNV induction.

Retinal organoid differentiation and lentivirus transduction

Retinal organoids were differentiated from human embryonic stem cells (hESC) and H9 according to a previous protocol with minor modifications. After 130-160 days of differentiation, retinal organoids containing retinal pigment epithelium (RPE) spheres were selected for transduction experiments. A total of 8 × 10 ⁹ per organoid (Cas9-related, 4 × 10 ⁹ and gRNA-related, 4 × 10 ) in 200 μl of Long-Term Retina (LTR) medium containing 8 μg/ml polybrene (Sigma-Aldrich, MO, USA). 10 ⁹ ) lentivirus was transduced. 300 μl of LTR medium was added 24 hours after transduction, and after culturing for 48 hours, the transduced retinal organoids were rinsed in 3X PBS and then maintained in LTR medium without lentivirus. Two weeks after lentiviral transduction, fluorescence images were analyzed or cells were harvested, and retinal pigment epithelial spheres and neural retina were manually separated from retinal organoids and used for analysis.

Immunohistochemistry and angiography of mouse retina

To analyze cross-sectional images of the mouse neural retina and retinal pigment epithelium, eyes were enucleated, corneas were drilled, and the eyes were fixed in 4% paraformaldehyde in PBS for 1 hour. The fixed eyes were cryopreserved by submerging them in 15% sucrose in PBS and then equilibrating them in 30% sucrose. The eyes were embedded in OCT compound and frozen solid by liquid nitrogen. The samples were cut to a thickness of 7 μm using a freezer, and the cryosection samples were immunostained with the primary antibody, anti-RFP antibody, and secondary antibody, Alexa FluorTM 594 anti-rabbit IgG (Invitrogen, USA).

To assess the size of CNV, FITC-dextran was injected intravenously 5 min before mouse sacrifice. The extracted eyes were fixed in 4% paraformaldehyde for 1 hour at room temperature. The retinal pigment epithelium complex (RPE/choroid/sclera) was flat-mounted and observed under a fluorescence microscope (BX43, Olympus, Tokyo, Japan). CNV areas were measured by a blinded observer using Image J software (NIH), and an average of 3-4 CNV areas per eye were analyzed.

Targeted deep sequencing

For targeted deep sequencing, target and off-target regions of genomic DNA were amplified using specific primers listed in Table 2. Deep sequencing libraries were generated by PCR, and each sample was labeled using TruSeq HT Dual Index primers. The pooled library was subjected to paired-end sequencing using HiSeq X (Illumina, CA, USA). Indels around the 3 bp region upstream of the PAM sequence were considered mutations due to Cas9 activity, and the indel frequency was calculated using bioinformatics tools.

Target gene PCR Forward primer (5' to 3') Reverse primer (5' to 3') VEGFA (human) ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCCTCTCATGCAGTGTGTGAA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCACCTGCATGGTGATGTTG Vegfa (mouse) ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCCACACAGTGATCAAGTTC GTGACTGGAGTTCAGAGCGTGTGCTCTTCCGATCTCTTCATCGTTACAGCAGCCTG AAVS1 (human) ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACCACCTTATATTCCCAGGG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTGGGGGTTAGACCCAATATC Rosa26 (mouse) ACACTCTTTCCCTACACGACGCTCTTCCGATCTATCAGTAAGGGAGCTGCAGTG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAGAAGACTCCCGCCCATC Vegfa (mouse) off target 1 ACACTCTTTTCCCTACACGACGCTCTTCCGATCTGTGATCAGCTGACTTCCAGTTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTCCACAACTCAAGTCCCATTAC

Mouse vascular endothelial growth factor enzyme-linked immunosorbent assay (Mouse VEGF ELISA)

Retinal pigment epithelial complexes were isolated from the neural retina and lysed in 120 μl of RIPA buffer (Rockland immunochemicals, PA, USA) with protease inhibitors (Quartett, Berlin, Germany). Mouse vascular endothelial growth factor protein levels were measured using the mouse vascular endothelial growth factor Quantikine ELISA kit (R&D Systems, USA), according to the manufacturer's instructions.

Experiment result

For retinal pigment epithelium (RPE)-specific expression, in pCMV-SpCas9-E2A-mRFP-T2A-Puro, a ubiquitously expressed Cas9 vector, the CMV promoter is replaced with the human VMD2 promoter, a retinal pigment epithelium (RPE)-specific promoter. It has been done. A VMD2 promoter sequence as short as possible, 623 bps in size, with sufficient expression, located at -585 to +38 of human VMD2, was selected (Figure 1).

The expression patterns of the two vectors were tested in an in vitro mouse model and in vitro human retinal organoids, as determined by the fluorescence of red fluorescent protein (RFP), pCMV-SpCas9-E2A-mRFP-T2A-Puro(pCMV-SpCas9) and pVMD2. Lentivirus expressing -SpCas9-E2A-mRFP-T2A-Puro(pVMD2-SpCas9) was transduced into human retinal organoids containing retinal pigment epithelial cells and into the mouse subretinal space via subretinal injection.

In both models, the pCMV vector expressed RFP in the retinal pigment epithelium and neural retina (Figures 2A, 2B, 2E, and 2F), whereas the pVMD2 vector expressed RFP only in the retinal pigment epithelium (Figures 2C, 2D, and 2G; and 2H). After subretinal injection of two lentiviruses expressing pVMD2-SpCas9 and gRNA targeting mouse Vegfa or Rosa26 , indels (insertions and deletions) were examined in the retinal pigment epithelium and neural retina (NR), respectively, through targeted sequencing. . For gRNAs targeting two different mouse genes, the indel frequency was significantly higher in retinal pigment epithelium than in NR [NR vs. RPE, mean ± standard error of the mean (SEM); Vegfa , 0.25±0.03% vs. 5.97±0.42%, p=0.005; Rosa26, 0.275 ± 0.14% vs. 4.27 ± 0.43%, p < 0.001] (Figures 3A and 3B). There was only one region in the entire mouse genome that had 1 or 2 base mismatches with the target sequence of Vegfa gRNA, and no off-target effects were observed for that region in analysis using targeted deep sequencing. Lentiviral transduction of pVMD2-SpCas9 and human AAVS1 targeting gRNA into human retina organoids showed 1.07 ± 0.27% indels in NR and 24.13 ± 5.69% indels in retinal pigment epithelium (p = 0.016) (p = 0.016) Figure 3C). The ratio of indels generated in retinal pigment epithelium compared to indels generated in NR was defined as retinal pigment epithelium specificity, and when comparing the respective ratios in pCMV-SpCas9 and pVMD2-SpCas9, the ratio of indels (RPE/NR ) was 3.48±0.93. 17.40 ± 2.41 for pCMV-SpCas9 and 17.40 ± 2.41 for pVMD2-SpCas9 showed significantly higher retinal pigment epithelium specificity (p = 0.002) (Figure 3D).

The therapeutic effects of gRNA targeting pVMD2-SpCas9 and mouse Vegfa were evaluated in regressing laser-induced CNV in mice in vivo. Rosa26 targeting gRNA and pCMV-SpCas9 or pVMD2-SpCas9 did not significantly reduce CNV size compared with the negative control of PBS injections (CNV size, μm ² , mean ± SEM; PBS, 17335 ± 1231; pCMV- Cas9 and Rosa26 gRNA, 16517 ± 1007, pVMD2-Cas9 and Rosa26 gRNA, 15074 ± 1493). pVMD2-SpCas9 and Vegfa targeting gRNAs significantly regressed CNVs compared to controls (CNV size, μm ² , mean ± SEM, pVMD2-SpCas9 and Rosa26 gRNA, 15074 ± 1493 vs. pVMD2-SpCas9 and Vegfa gRNA, 90,001 ± 0.03159). . pCMV-SpCas9 and Vegfa targeting gRNA and clinically used intravitreal Aflibercept (CNV size, μm ² , mean ± SEM; pCMV-SpCas9 and Vegfa gRNA, 8999 ± 971; Aflibercept, 9405 ± 890). were similar (Figure 4A).

The amount of mouse vascular endothelial growth factor protein in the retinal pigment epithelium was significantly increased in both groups: pCMV-SpCas9 and Vegfa targeting gRNA and pVMD2-SpCas9 and Vegfa targeting gRNA compared with the PBS group (mVEGF, pg/mg protein, mean ± SEM ; pCMV-Cas9 and Vegfa gRNA, 50.29 ± 14.93; pVMD2-Cas9 and Vegfa gRNA, 47.98 ± 7.553; PBS, 172.5 ± 13.45, p < 0.001), there was no difference between the two groups (Figure 4C).

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Yonsei University Industry-Academic Cooperation Foundation <120> Pharmaceutical composition for the treatment of retinal diseases comprising the CRISPR/Cas complex that specifically works on the retinal pigment epithelium as an active ingredient <130>PDPB222321 <160> 19 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> VEGFA (human) & Vegfa (mouse) Forward oligonucleotides <400> 1 caccgctcct ggaagatgtc cacca 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> VEGFA (human) & VEGFA (mouse) Reverse oligonucleotides <400> 2 aaactggtgg acatcttcca ggagc 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AAVS1 (human) Forward oligonucleotides <400> 3 caccgggggc cactagggac aggat 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AAVS1 (human) Reverse oligonucleotides <400> 4 aaacatcctg tccctagtgg ccccc 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Rosa26 (mouse) Forward oligonucleotides <400> 5 caccgggcgg tcctcagaag ccagg 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Rosa26 (mouse) Reverse oligonucleotides <400> 6 aaaccctggc ttctgaggac cgccc 25 <210> 7 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> VEGFA (human) Forward primer <400> 7 acactctttc cctacacgac gctcttccga tctgcctctc atgcagtggt gaa 53 <210> 8 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> VEGFA (human) Reverse primer <400> 8 gtgactggag ttcagacgtg tgctcttccg atctccacct gcatggtgat gttg 54 <210> 9 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Vegfa (mouse) Forward primer <400> 9 acactctttc cctacacgac gctcttccga tctcccacac agtgatcaag ttc 53 <210> 10 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Vegfa (mouse) Reverse primer <400> 10 gtgactggag ttcagacgtg tgctcttccg atctcttcat cgttacagca gcctg 55 <210> 11 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> AAVS1 (human) Forward primer <400> 11 acactctttc cctacacgac gctcttccga tctgaccacc ttatatccc aggg 54 <210> 12 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> AAVS1 (human) Reverse primer <400> 12 gtgactggag ttcagacgtg tgctcttccg atctgtgggg gttagaccca atatc 55 <210> 13 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Rosa26 (mouse) Forward primer <400> 13 acactctttc cctacacgac gctcttccga tctatcagta agggagctgc agtg 54 <210> 14 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Rosa26 (mouse) Reverse primer <400> 14 gtgactggag ttcagacgtg tgctcttccg atctcagaag actcccgccc atc 53 <210> 15 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Vegfa (mouse) off target 1 Forward primer <400> 15 acactctttc cctacacgac gctcttccga tctgtgatca gctgacttcc agttc 55 <210> 16 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Vegfa (mouse) off target 1 Reverse primer <400> 16 gtgactggag ttcagacgtg tgctcttccg atctctccac aactcaagtc ccattac 57 <210> 17 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Adapter sequence Forward primer <400> 17 acactctttc cctacacgac gctcttccga tct 33 <210> 18 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Adapter sequence Reverse primer <400> 18 gtgactggag ttcagacgtg tgctcttccg atct 34 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Target sequences of Vegfa (mouse) off target 1 <400> 19 caccgctcct ggaagatgtc cacca 25

Claims (16)

A CRISPR/Cas complex containing a guide RNA containing the VMD2 promoter and a Cas (CRISPR associated protein) nuclease. According to clause 1,
The guide RNA is a CRISPR/Cas complex containing vascular endothelial growth factor (VEGF). According to clause 2,
The vascular endothelial growth factors include vascular endothelial growth factor A (VEGFA), placental growth factor (PGF), vascular endothelial growth factor B (VEGFB), and vascular endothelial growth factor. Selected from the group consisting of Vascular endothelial growth factor C (VEGFC), Hypoxia-inducible factor 1-alpha (Hif1α), and Vascular endothelial growth factor D (VEGFD) One of which is the CRISPR/Cas complex. According to clause 1,
The CRISPR/Cas complex specifically inhibits vascular endothelial growth factor gene expression in the retinal pigment epithelium (RPE), but does not inhibit vascular endothelial growth factor gene expression in the neural retina (NR). In, CRISPR/Cas complex. According to clause 1,
The Cas nuclease is any one selected from the group consisting of Cas9, Cas12, Cas13, and Cas14. A vector containing the complex of claim 1. According to clause 6,
The vector includes Adenovirus, Retrovirus, Adeno-Associated Virus (AAV), Herpes simplex virus (HSV), Lentivirus, Plasmid, and A vector selected from the group consisting of liposomes. A pharmaceutical composition for preventing or treating retinal diseases comprising the vector of claim 6 as an active ingredient. According to clause 8,
The pharmaceutical composition, wherein the retinal disease is any one selected from the group consisting of macular degeneration, diabetic retinopathy, retinopathy of prematurity, retinal artery occlusion, retinal vein occlusion, and other retinal vascular diseases. According to clause 8,
A pharmaceutical composition, wherein the retinal disease is a disease caused by inhibition of blood vessel formation in the retina or damage to blood vessels. According to clause 9,
A pharmaceutical composition wherein the macular degeneration is dry or wet. A transformant transformed with the vector of claim 6. According to clause 12,
The transformant is a microorganism, cell, or animal entity other than a human. (a) confirming the inhibition of blood vessel development in the retina of the transformant of Article 12;
(b) administering a candidate substance for promoting or inhibiting blood vessel development to the transformant; and,
(c) determining that the candidate material is a material for the treatment of retinal disease when the development of blood vessels in the retina of the transformant increases or decreases. According to clause 14,
The method wherein the retinal disease is a disease caused by inhibition of blood vessel formation in the retina or damage to blood vessels. According to clause 14,
The method, wherein the retinal disease is any one selected from the group consisting of macular degeneration, diabetic retinopathy, retinopathy of prematurity, retinal artery occlusion, retinal vein occlusion, and other retinal vascular diseases.