KR20230161366A - Gene expression particle based on metal nanoparticle-nucleic acid conjugate and manufacturing method thereof - Google Patents

Abstract

The present invention relates to a gene delivery system containing a nucleic acid molecule containing a gene of interest bound to the surface of a metal nanoparticle for delivery and expression into cells, its use, a gene expression method using the same, and a method for producing the same.

Description

Gene carrier based on metal nanoparticle-nucleic acid conjugate {Gene expression particle based on metal nanoparticle-nucleic acid conjugate and manufacturing method thereof}

The present invention relates to a gene carrier comprising a metal nanoparticle and a double helix-shaped nucleic acid molecule bound to the surface of the nanoparticle, a gene expression method using the same, and a method for producing the same.

Nanoparticles are particles with a nanoscale size and have various physical and chemical properties due to their small size and high surface area. Gold nanoparticles, the most widely used nanoparticles, generate surface electromagnetic resonance (SPR) by absorption and scattering in the visible light region depending on their size and shape, so they are used for detection and imaging based on fluorescent labels, and the introduction of surface functional groups is necessary. It is easy to use and has high biological affinity and stability, so it can be used to deliver biomaterials such as DNA, RNA, proteins, and antibodies, as well as various drugs.

Like cell therapy, technologies for delivering genetic material into cells to produce antigens or proteins for treatment or prevention are being continuously researched. In particular, vaccine development technology has grown significantly due to the recent pandemic, with DNA vaccines, mRNA vaccines, Various genetic vaccines, such as viral vector vaccines, have been developed.

DNA is the simplest genetic material and can be easily genetically modified, shortening the development period for use as a treatment such as a vaccine. In addition, it is very economical in terms of production facility construction and production costs compared to other vaccine candidates such as viruses, proteins, and RNA, and has excellent stability, making it easy to store and distribute. However, DNA vaccines require a process to be delivered to the nucleus of a cell and produce mRNA directly within the nucleus. DNA injected into the nucleus can continuously produce mRNA and antigen proteins, but since other genes are injected into the cell nucleus in our body, there is a risk of side effects such as innate immune response. Additionally, when delivered through a plasmid, DNA may deliver bacterial-derived genes in addition to antigens, causing side effects such as mutations in the body. Therefore, research on carriers and delivery technologies to safely deliver DNA is necessary.

Accordingly, the present inventors have made extensive research efforts to develop nucleic acid delivery technology to efficiently deliver nucleic acid molecules, especially double stranded DNA (dsDNA), that can be delivered into cells and expressed independently, into the nucleus of cells. As a result, metal The present invention has been completed regarding a delivery system that can directly attach a nucleic acid molecule containing a gene of interest to the surface of a nanoparticle and deliver it into a cell by covalent bonding, a method of expressing a gene through the same, and a method of manufacturing the delivery system.

Therefore, the object of the present invention is metal nanoparticles; and a nucleic acid molecule containing one or more genes of interest that bind to the metal nanoparticle and are delivered and expressed into cells.

Another object of the present invention is to provide a pharmaceutical composition containing the gene carrier.

Another object of the present invention is to provide a composition for detecting a target substance containing the gene carrier.

Another object of the present invention is to provide a composition for intracellular delivery of a gene of interest, including the gene carrier.

Another object of the present invention is to modify the surface of the metal nanoparticles by treating the metal nanoparticles with an acidic solution; and binding a nucleic acid molecule containing one or more genes of interest to be expressed by being delivered into cells to the surface of the metal nanoparticle.

Another object of the present invention is to provide a method for expressing a gene of interest through a nucleic acid molecule that is bound to the surface of a metal nanoparticle and expressed alone within a cell.

In order to achieve the above object, the present invention provides metal nanoparticles; And it provides a gene carrier comprising a nucleic acid molecule containing one or more genes of interest that binds to the metal nanoparticle and is delivered and expressed into cells.

Additionally, in order to achieve another object of the present invention, the present invention provides a pharmaceutical composition containing the gene carrier.

In addition, in order to achieve another object of the present invention, the present invention provides a composition for detecting a target substance containing the gene carrier.

In order to achieve another object of the present invention, the present invention provides a composition for intracellular delivery of a gene of interest, including the gene carrier.

In addition, in order to achieve another object of the present invention, the present invention includes the steps of modifying the surface of the metal nanoparticles by treating the metal nanoparticles with an acidic solution; and binding a nucleic acid molecule containing one or more genes of interest to be expressed by being delivered into cells to the surface of the metal nanoparticle.

In addition, in order to achieve another object of the present invention, the present invention provides a method of expressing a gene of interest through a nucleic acid molecule that is bound to the surface of a metal nanoparticle and expressed alone in a cell.

Hereinafter, the present invention will be described in detail.

In one aspect, the present invention provides metal nanoparticles; and a gene carrier comprising a nucleic acid molecule containing one or more genes of interest that binds to the metal nanoparticle and is delivered and expressed into cells.

The gene carrier of the present invention includes metal nanoparticles. The metal nanoparticles have a diameter in nanoscale and are not limited in size, but preferably have a diameter of 5 to 500 nm, more preferably 10 to 200 nm, and nanoparticles of this size have a stable particle size. It is easy to manufacture in this shape, and the size can be easily adjusted during the manufacturing process. In addition, in the case of the metal nanoparticles for use as gene carriers as in the present invention, when the diameter increases beyond 500 nm, not only the characteristics as nanoparticles disappear, but the bond between the metal surface and the functional group becomes weak. It has the disadvantage of being difficult to manufacture a delivery vehicle using nanoparticles. In addition, the metal nanoparticles may preferably be gold nanoparticles, and the gold nanoparticles are harmless to the human body and have high biocompatibility, unlike heavy metals such as manganese, aluminum, cadmium, lead, mercury, cobalt, nickel, and beryllium. has

As an example, gold nanoparticles used in the present invention can be prepared, for example, as follows: gold nanoparticles were prepared by reducing HAuCl ₄ using HAuCl ₄ as a gold source and sodium citrate as a reducing agent. . In this case, the size of the gold nanoparticles can be adjusted by varying the added citrate. In other words, as the amount of citrate added increases, nucleation increases and the size of gold nanoparticles decreases.

The metal nanoparticle of the present invention has a nucleic acid molecule containing a gene of interest bound to its surface. The nucleic acid molecule is incorporated into the cell and bound to the surface of the metal nanoparticle for the purpose of delivering the gene of interest for independent expression.

The nucleic acid molecule is not limited to its type. In the present invention, a nucleic acid molecule refers to a compound with a structure in which a base, sugar, and phosphoric acid are linked by a phosphodiester bond, which is 2'-deoxyribonucleic acid ( naturally occurring oligonucleotides such as 2'-deoxyribonucleic acid (hereinafter "DNA") and ribonucleic acid (hereinafter "RNA"), and modified sugar residues, modified phosphate residues, or modified nuclei. Includes nucleic acids containing a base (necleobase). Modifications to sugar moieties include replacement of the ribose ring with a hexose, cyclopentyl, or cyclohexyl ring. On the other hand, the D-ribose ring of naturally occurring nucleic acids can be replaced by an L-ribose ring, or the β-anomer (β) of naturally occurring nucleic acids. -anomer) can be replaced with a-anomer (α-anomer). Nucleic acid molecules may also contain one or more abasic moieties. Modified phosphate moieties may also include phosphorothioates, phosphorodithioates, methylphosphonates, and methyl phosphate. Such nucleic acid analogs are known to those skilled in the art. Nucleic acid molecules comprising a mixture of two or more of the above mixtures may be prepared, for example, from mixtures of deoxyribonucleosides, especially 2'-O-methyl ribonucleosides (2'-O-methyl ribonucleoside) or a mixture of deoxyribonucleosides such as 2'-O-methoxyethyl ribonucleoside and 2'-O-substituted ribonucleosides.

More specifically, the nucleic acid molecule may be selected from DNA, RNA, or DNA/RNA molecules, and more specifically, may be double-stranded DNA. The double-stranded DNA may include cDNA, gDNA, plasmid DNA, and PCR DNA that can be expressed alone. In one embodiment, the double-stranded DNA is bound to a gold nanoparticle in a double-helix state, and is used to transport the double-stranded DNA into a cell. This means that after the single-stranded DNA is bound to the gold nanoparticle, it is transferred into the cell. This is different from being imported and hybridized with a complementary strand.

Additionally, the nucleic acid molecule may contain one or more genes of interest and be expressed alone after being introduced into the cell. As used herein, the term "gene of interest" refers to any nucleic acid or functional peptide or polypeptide (protein) of interest that has a therapeutic, diagnostic, and/or prophylactic effect and/or induces a desired biological and/or pharmacological effect. nucleic acids encoding native or modified peptides/proteins).

In the present invention, 'solely expressed' means that the gene of interest contained in the nucleic acid molecule undergoes a process of transcription and/or translation independently without being integrated into the genome of the injected cell. As an example, but not limited thereto, in order to be expressed alone, the nucleic acid molecule may include one or more promoters, open reading frames, or terminators, and more preferably, may be operably linked to the gene of interest. It may include one or more promoters linked. Promoter sequences are often virally derived or truncated eukaryotic promoters, such that promoters include the proopiomelanocortin promoter (POMC), adenovirus promoter, baculovirus promoter, CMV promoter, parvovirus promoter, herpesvirus promoter, It may be a poxvirus promoter, adeno-associated virus promoter, Semliki Forest virus promoter, SV40 promoter, vaccinia virus promoter, or retrovirus promoter. Examples of promoters include the human simplex virus thymidine kinase (HSV TK or miniTK) promoter, cauliflower mosaic virus (CaMV) 35S promoter, human cytomegalovirus CMV promoter (miniCMV), CMV53 (minCMV with an upstream GC box added) ), simian virus 40 promoter (minSV40), MLP (-38 to +6 region of adenovirus major late promoter), minP (synthetic promoter consisting of TATA box and transcription start site - Promega product), pJB42CAT5 (derived from human junB gene) promoter), YB_TATA, and super core promoter 1 (SCP1) promoters. Several promoters (sometimes referred to as “core promoters”) are described in Ede et al., ACS Synth Biol. 2016 May 20; 5(5): 395-404.

The terms “operably arranged,” “operably linked,” and “operably linked” refer to the precise functional location of a promoter (and/or enhancer) on a nucleic acid sequence to control transcription initiation and expression of that nucleic acid. and orientation. An enhancer is “operably linked” to a promoter when it is in the correct functional position and orientation to increase transcriptional activity of the promoter.

In one embodiment, the nucleic acid molecule further comprises a polyadenylation (poly(A)) sequence. The poly(A) sequence causes appropriate polyadenylation of the nucleic acid (transcript) of interest. Representative examples of poly(A) sequences include SV40 poly(A) and/or bovine growth hormone poly(A), which are known to be convenient and/or function well in a variety of target cells.

In one embodiment the nucleic acid molecule further comprises a transcription termination sequence. A “termination signal” or “termination factor” consists of a DNA sequence that is involved in the specific termination of RNA transcripts by RNA polymerase.

In addition, but not limited thereto, the nucleic acid molecule may produce a transcription and/or translation product through an expression process in which transcription and/or translation are performed. The transcription and/or translation products are not limited thereto, but may include, for example, mRNA, non-coding RNA, protein, antigen, or antibody.

The gene delivery vehicle of the present invention is one in which nucleic acid molecules are bound to the surface of gold nanoparticles. The nucleic acid molecule contains one or more functionalities for binding to the gold nanoparticle surface. The functional group is not limited to its type, and may be a thiol group or an amine group, and may be included in one or more residues of the nucleic acid molecule to be delivered. In one embodiment of the present invention, the nucleic acid molecule contains one or more thiolated residues, through which it binds directly to the surface of the gold nanoparticle. The linkage does not involve a separate spacer or linker. The thiolated residue may be the 3' end, the 5' end, or one or more bases included in the base sequence of the nucleic acid molecule.

In addition, one or more nucleic acid molecules are bound to the surface of the gold nanoparticle, but are not limited thereto, and for expression, 1 to 20 nucleic acid molecules may be bound to the surface of the gold nanoparticle. Additionally, the length of the linked nucleic acid molecule is at least 100 bp, 200 bp, or 300 bp, but is not limited to that length. Additionally, in some cases, the nucleic acid molecule is greater than 30 nucleotides. In another embodiment, the nucleic acid molecule is greater than 35 nucleotides. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 50 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In another embodiment, the length is at least 4000 nucleotides. In another embodiment, the length is at least 5000 nucleotides, or greater than 5000 nucleotides.

In another aspect of the present invention, the present invention relates to a pharmaceutical composition containing the above-described gold nanoparticles and a gene carrier containing double-stranded DNA. The pharmaceutical composition is intended for the prevention, improvement or treatment of diseases, is not limited to its type, and may have different uses depending on the type and expression product of the double-stranded DNA bound to the gold nanoparticle.

The pharmaceutical composition may be a cell gene therapy product including cell therapy, genetically modified cell therapy, gene therapy, and RNA therapy, and the cell gene therapy may include vaccines, antibiotics, and anticancer agents.

The cell therapy product involves proliferating and selecting live autologous, allogenic, or xenogeneic cells in vitro or changing the biological characteristics of the cells by other methods in order to restore the tissue and function of the cells. It refers to medicines used for the purpose of treatment, diagnosis, and prevention through a series of actions. When genes in cells are modified, they are also classified as genetically modified cell therapy.

In addition, the gene therapy is a medicine manufactured for the purpose of treating or preventing genetic defects by correcting defective genes or adding new functions to cells by transferring normal genes and therapeutic genes into the patient's cells using genetic manipulation such as genetic recombination. am.

In addition, the RNA therapeutic agent exhibits drug efficacy while suppressing the protein production process that induces disease from the target gene, and may include mRNA, RNAi, ASO (antisense oligonucleotide), RNA aptamer, etc.

The pharmaceutical composition according to the present invention may further include appropriate carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions. The excipient may be, for example, one or more selected from the group consisting of diluents, binders, disintegrants, lubricants, adsorbents, humectants, film-coating materials, and controlled-release additives.

The pharmaceutical composition according to the present invention can be prepared as powder, granules, sustained-release granules, enteric-coated granules, solutions, eye drops, ellipsis, emulsions, suspensions, spirits, troches, perfumes, and limonadese according to conventional methods. , tablets, sustained-release tablets, enteric-coated tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric-coated capsules, pills, tinctures, soft extracts, dry extracts, liquid extracts, injections, capsules, perfusate, It can be formulated and used in the form of external preparations such as warning agents, lotions, pasta preparations, sprays, inhalants, patches, sterilized injection solutions, or aerosols, and the external preparations include creams, gels, patches, sprays, ointments, and warning agents. , it may have a dosage form such as lotion, liniment, pasta, or cataplasma.

Carriers, excipients, and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, and calcium. These include phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat the disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and It can be determined based on factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the medical field. The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art to which the present invention pertains.

The pharmaceutical composition of the present invention can be administered to an individual through various routes. All modes of administration are contemplated, including oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, intrarectal injection, vaginal injection. It can be administered by internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, etc.

The pharmaceutical composition of the present invention is determined depending on the type of drug that is the active ingredient along with various related factors such as the disease to be treated, the route of administration, the patient's age, gender, weight, and severity of the disease.

In the present invention, “individual” refers to a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, cows, etc. refers to mammals of

In the present invention, “administration” means providing a given composition of the present invention to an individual by any appropriate method.

In the present invention, “prevention” refers to any action that suppresses or delays the onset of the desired disease, and “treatment” refers to the improvement or improvement of the desired disease and its associated metabolic abnormalities by administration of the pharmaceutical composition according to the present invention. It refers to all actions that are beneficially changed, and “improvement” refers to all actions that reduce parameters related to the target disease, such as the degree of symptoms, by administering the composition according to the present invention.

In one aspect of the present invention, the present invention provides a vaccine composition comprising a gene carrier containing the metal nanoparticle of the present invention and a nucleic acid molecule containing a gene of interest. The term 'vaccine' refers to a biological agent containing an antigen that provides immunity to an individual, and refers to an immunogenic or antigenic substance that generates immunity by administering it to humans or animals, for example, by injection or oral administration, to prevent disease.

The vaccine may be a DNA vaccine. The term 'DNA vaccine' refers to a vaccine that induces an immune response by artificially replicating some of the genes of pathogens, viruses, etc. and then administering them. The vaccine composition may form immunity against various infectious diseases, genetic diseases, other diseases, or cancer.

The vaccine composition can be injected into an individual in various forms. The 'injection' may be performed by any one method selected from the group consisting of subcutaneous injection, intramuscular injection, subcutaneous injection, intraperitoneal injection, intranasal administration, oral administration, transdermal administration, and oral administration, and more preferably The DNA vaccine can be administered by any suitable route, for example, subcutaneously, intramuscularly, intraperitoneally, or intravenously.

The vaccine composition may include one or more adjuvants to improve or strengthen the immune response. Suitable adjuvants may include peptides, aluminum hydroxides, aluminum phosphates, aluminum oxides and compositions consisting of mineral or vegetable oils such as Marcol 52 and one or more emulsifiers, or surface active substances such as lysolcecithin, polyvalent cations, polyanions, etc. there is.

In another aspect of the present invention, the present invention relates to a composition for diagnostic or target substance detection comprising the above metal nanoparticles and a gene carrier containing a nucleic acid molecule containing a gene of interest.

In another aspect of the present invention, the present invention relates to a composition for intracellular delivery of a gene of interest, comprising the above metal nanoparticle and a nucleic acid molecule containing the gene of interest.

In another aspect of the present invention, the present invention includes the steps of modifying the surface of the metal nanoparticles by treating the metal nanoparticles with an acidic solution; The present invention relates to a method for producing a gene carrier comprising the step of binding a nucleic acid molecule containing one or more genes of interest to be expressed by being delivered into cells to the surface of the metal nanoparticle.

In another aspect of the present invention, the present invention relates to a method of expressing a gene of interest through a nucleic acid molecule that is bound to the surface of a metal nanoparticle and expressed alone within a cell.

The present invention relates to a metal nanoparticle and a gene carrier comprising a nucleic acid molecule containing a gene of interest bound to the surface of the metal nanoparticle, a method for producing the same, and a use thereof, wherein the nucleic acid molecule containing one or more genes, particularly a double helix, Nucleic acid molecules in the form of DNA are directly bound to the surface of gold nanoparticles through covalent bonds and are delivered and expressed into cells. This enables stable delivery and expression, and can be used as a gene therapy, vaccine, and composition for disease diagnosis. has

Figure 1 is a schematic diagram showing the structure of a nucleic acid molecule containing a gene of interest bound to a gold nanoparticle in an embodiment of the present invention.
Figure 2 shows the results of confirming the binding efficiency of nucleic acid molecules bound to the gold nanoparticles of the present invention through thiolated residues.
Figure 3 shows the results of confirming intracellular delivery of genes according to the thiolated strand ((+), (-)) of the double-stranded DNA that binds to the gold nanoparticle of the present invention.
Figure 4 is a production example of AuNP-dsDNA, which enables intracellular delivery and expression by binding thiolated double-stranded DNA of various lengths to gold nanoparticles.
Figure 5 confirms the results of functionalizing and binding thiolated double-stranded DNA to the surface of gold nanoparticles.
Figure 6 shows the results of confirming gene transfer and expression in a small animal model of a gold nanocarrier loaded with double-stranded DNA having various lengths of SEQ ID NOs: 1 to 4.
Figure 7 shows the results of functionalizing the luciferase (SEQ ID NO: 5) gene on the surface of gold nanoparticles.
Figure 8 shows the results of confirming whether the luciferase gene is delivered and expressed intracellularly through a gold nanocarrier.

Hereinafter, examples will be given in detail to explain the present specification in detail. However, the embodiments according to the present specification may be modified into various other forms, and the scope of the present specification is not to be construed as being limited to the embodiments described in detail below. The embodiments of this specification are provided to more completely explain the present specification to those with average knowledge in the art.

Example 1. Preparation of gold nanoparticles (AuNP-dsDNA) bound to double-stranded DNA (GFP)

AuNP-dsDNA capable of intracellular delivery and expression was prepared by binding thiolated double-stranded DNA for intracellular expression to gold nanoparticles in the following steps, a schematic diagram of which is shown in Figure 1.

1-1. Manufacturing dsDNA capable of expressing intracellular antigens

Using plasmid pcDNA3.1, the target gene for transfer was cloned between the CMV promoter and bGH terminator of the plasmid. The thiolated residues of the genes were synthesized through PCR using thiolated primers to synthesize double-stranded DNA in which the 5' end, 3' end, or internal residues were thiolated, respectively.

As the target gene for delivery, the eGFP gene of SEQ ID NO: 1 was cloned through the above method, and the 5' end thiolation primer sequence in Table 1 below was used to thiolate the 5' end, 3' end, or internal residues, Thiolated double-stranded DNA of eGFP was synthesized.

Thiolation type Thiolation strand eGFP sequence (+) (-) 5' end - - 5' CTTAGGGTTAGGCGTTTTGC ~~ (eGFP expression system) ~~ GTATCCCCACGCGCCCTGTAG 3'
3' GAATCCCAATCCGCAAAACG ~~ (eGFP expression system) ~~ CATAGGGGTGCGCGGGACATC 5' ○ - 5' (Thiolation) CTTAGGGTTAGGCGTTTTGC ~~ (eGFP expression system) ~~ GTATCCCCACGCGCCCTGTAG 3'
3' GAATCCCAATCCGCAAAACG ~~ (eGFP expression system) ~~ CATAGGGGTGCGCGGGACATC 5' - ○ 5' CTTAGGGTTAGGCGTTTTGC ~~ (eGFP expression system) ~~ GTATCCCCACGCGCCCTGTAG 3'
3' GAATCCCAATCCGCAAAACG ~~ (eGFP expression system) ~~ CATAGGGGTGCGCGGGACATC (Thiolation) 5' ○ ○ 5' (Thiolation) CTTAGGGTTAGGCGTTTTGC ~~ (eGFP expression system) ~~ GTATCCCCACGCGCCCTGTAG 3'
3' GAATCCCAATCCGCAAAACG ~~ (eGFP expression system) ~~ CATAGGGGTGCGCGGGACATC (Thiolation) 5' internal residues - ○ 5' CTTAGGGTTAGGCGTTTTGC ~~ (eGFP expression system) ~~ GTATCCCCACGCGCCCTGTAG 3'
3' GAATCCCAATCCGCAAAACG ~~ (eGFP expression system) ~~ CA*T*A*G*G*GGTGCGCGGGACATC 5'

*Phosphorothiolated backbone

1-2. Thiolated double-stranded DNA pretreatment

After dissolving the synthesized thiolated double-stranded DNA in water to a final concentration of 1 μM, 20 μl of 3M sodium acetate (pH 5.2) and 30 μl of 1N DTT (dithiothreitol) were added to 150 μl of thiolated double-stranded DNA. Added and reacted at room temperature for 60 minutes. To remove DTT containing unwanted thiol molecules, 200 μl of ethyl acetate was added and mixed, then centrifuged to remove the supernatant, and this process was repeated three times. Then, thiolated double-stranded DNA was precipitated using the ethanol precipitation method (EtOH precipitating method).

1-3 Preparation of dsDNA functionalization of gold nanoparticles (AuNP-dsDNA)

The thiolated double-stranded DNA pretreated and precipitated through the above steps 1-2 was dissolved in water, added to gold nanoparticles, and combined with salt aging method. Specifically, thiolated double-stranded DNA was added to 7 nM gold nanoparticles (AuNP: thiolated double-stranded DNA = 1:40) and thoroughly mixed, then NaCl was added to the concentration to 0.1M and mixed for 4 hours. . After 4 hours, NaCl was added to the concentration to 0.2M and mixed for 4 hours. After 4 hours, NaCl was added to bring the concentration to 0.3M and mixed for 12 hours.

After 12 hours, the thiolated double-stranded DNA and gold mixture was collected by centrifugation at ~10,000 x g for 20 minutes, and unreacted double-stranded DNA in the supernatant was removed, and this process was repeated three times.

The final AuNP-thiolated double-stranded DNA conjugate (AuNP-thiolated dsDNA) was dispersed in 10mM sodium phosphate buffer (pH 7.4) containing 0.1 M NaCl. The prepared AuNP-thiolated double-stranded DNA conjugate was analyzed by electrophoresis on a 10% acrylamide 8M urea gel, and it was confirmed that 1.98 to 9.27 thiolated double-stranded DNA was bound per one gold nanoparticle (Figure 2).

Example 2. Confirmation of gene delivery and expression by AuNP-dsDNA (GFP) in small animal model

For convenience of experiment, a xenograft tumor model was used. HeLa cells were injected into 6-week-old immunodeficient BALB/c-nu/nu mice (Central Lab Animal Inc, Korea) to develop cervical cancer, and AuNP-thiolated dsDNA was injected into the xenograft tumor. 36 hours later, the xenograft tumor were extracted and the expression of the injected GFP was observed using FOBI (Fluorescence In Vivo Imaging System). As a result, it was confirmed that AuNP-thiolated dsDNA, which was thiolated at the 5' end of the (+) strand or (-) strand or (+), (-) strand, or had a thiol group inside, was expressed in tumors injected (Figure 3 ).

Example 3. Preparation of gold nanoparticles bound to dsDNA of different lengths

AuNP-dsDNA capable of intracellular delivery and expression was prepared by binding thiolated double-stranded DNA of various lengths to gold nanoparticles, and a schematic diagram thereof is shown in Figure 4.

3-1. Manufacturing double-stranded DNA that can be expressed in cells

Using plasmid pcDNA3.1, eGFP (SEQ ID NO: 1, SEQ ID NO: 2), A3APO-FLAG (SEQ ID NO: 3), and pFOX-FLAG (SEQ ID NO: 4) genes contained between the CMV promoter and bGH terminator of the plasmid were Each was cloned. Thiolated residues of the above genes were synthesized through PCR using 5'-thiolated primers to synthesize double-stranded DNA in which one of the 5'-end, 3'-end, or internal residues was thiolated. did.

The synthesized thiolated double-stranded DNA was pretreated in the same manner as in Experimental Example 1-2, and the thiolated double-stranded DNA was precipitated using the ethanol precipitation method (EtOH precipitating method).

3-2 Preparation of dsDNA functionalization of gold nanoparticles (AuNP-dsDNA)

The thiolated double-stranded DNA synthesized, pretreated, and precipitated through the process 3-1 was functionalized on the surface of the gold nanoparticles through the same process as 1-3. The prepared AuNP-thiolated dsDNA complex was analyzed by electrophoresis on a 10% acrylamide 8M Urea gel, and it was confirmed that 2.38 to 5.67 thiolated double-stranded DNAs were bound to one gold nanoparticle (Figure 5).

Example 4. Confirmation of gene delivery and expression in a small animal model of gold nanoparticles loaded with dsDNA of various lengths

For convenience of experiment, a xenograft tumor model was used. Tumors were generated by subcutaneously injecting HeLa cells into 6-week-old immunodeficient BALB/c-nu/nu mice (Central Lab Animal Inc, Korea), and cells containing the cells of SEQ ID NOs: 1 to 4 (6 kbp, 1.7 kbp, or 0.5 kbp) were produced. AuNP-thiolated dsDNA bound to double-stranded DNA was injected around the tumor. 36 hours after injection, the xenograft tumor or gastrocnemius muscle was removed, sections were created using frozen sectioning, and protein expression by the injected dsDNA was observed through immunofluorescence staining. As a result, protein expression by dsDNA of 6 kbp, 1.7 kbp, or 0.5 kbp of SEQ ID NOs: 1 to 4 was confirmed in the mouse tumor or gastrocnemius muscle, respectively. (Figure 6)

Example 5. Preparation of gold nanoparticles expressing luciferase

In order to confirm whether the gold nanoparticle delivery vehicle can be expressed well in mouse in vivo tissues, thiolated double-stranded DNA expressing luciferase was bound to the gold nanoparticle to enable intracellular delivery and expression of AuNP-dsDNA. was manufactured and confirmed.

5-1. Manufacturing double-stranded DNA that can be expressed in cells

Using plasmid pcDNA3.1, the Luciferase (SEQ ID NO: 5) gene contained between the CMV promoter and bGH terminator of the plasmid was cloned. The thiolated residues of the genes are synthesized through PCR using 5'-thiolated primers to synthesize double-stranded DNA in which one of the 5'-end, 3'-end, or internal residues is thiolated. did.

The synthesized thiolated double-stranded DNA was pretreated in the same manner as in Experimental Example 1-2, and the thiolated double-stranded DNA was precipitated using the ethanol precipitation method (EtOH precipitating method).

5-2 Preparation of dsDNA functionalization of gold nanoparticles (AuNP-dsDNA)

The thiolated double-stranded DNA synthesized, pretreated, and precipitated through the process 5-1 above was functionalized on the surface of the gold nanoparticles through the same process as 1-3 above. The prepared AuNP-thiolated dsDNA conjugate was analyzed by electrophoresis on a 10% acrylamide 8M Urea gel, and it was confirmed that 2.4 thiolated double-stranded DNAs were bound to each gold nanoparticle (Figure 7).

Example 6. Confirmation of gene delivery and expression by AuNP-dsDNA (luciferase) in small animal model

Physiological saline or AuNP-thiolated dsDNA was injected into both gastrocnemius muscles of 7-week-old Balb/c mice, and corresponding amounts of AuNP or luciferase dsDNA were injected as a comparison group, respectively. After injection, the subjects were anesthetized with isoflurane every 12 or 24 hours, and D-Luciferin was injected intraperitoneally to measure luciferase activity. As a result of imaging using LUCI (Luciferase In Vivo Imaging System), the enzymatic activity of luciferase was confirmed in the gastrocnemius muscle injected with luciferase dsDNA bound to AuNP (Figure 8).

So far, the present invention has been examined focusing on its preferred embodiments. A person skilled in the art to which the present invention pertains will understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is indicated in the claims, not the foregoing description, and all differences within the equivalent scope should be construed as being included in the present invention.

Claims (19)

metal nanoparticles; and
A gene carrier comprising a nucleic acid molecule containing one or more genes of interest that binds to the metal nanoparticle and is delivered and expressed into cells.
According to paragraph 1,
A gene carrier, wherein the nucleic acid molecule includes a promoter operably linked to the gene of interest.
According to paragraph 1,
A gene carrier wherein the gene of interest is not replicated within the cell.
According to paragraph 1,
A gene carrier wherein the gene of interest is not integrated into the genome of the injected cell.
According to paragraph 1,
A gene carrier wherein the gene of interest produces a product through transcription and/or translation within the cell.
According to clause 5,
A gene carrier wherein the product produced through the transcription and/or translation is at least one selected from the group including mRNA, non-coding RNA, protein, antigen, or antibody.
According to paragraph 1,
A gene carrier wherein the nucleic acid molecule is expressed alone or independently within a cell.
According to paragraph 1,
A gene carrier wherein the nucleic acid molecule binds to the surface of the metal nanoparticle through one or more thiolated residues.
According to clause 8,
A gene carrier wherein one or more of the thiolated residues is included at the 3' end, 5' end, or in the base sequence of the nucleic acid molecule.
According to paragraph 1,
A gene carrier wherein the metal nanoparticles have a size of 5 to 500 nm.
According to paragraph 1,
A gene carrier wherein the metal nanoparticles are gold nanoparticles.
According to paragraph 1,
A gene carrier wherein the nucleic acid molecule is selected from DNA, RNA, or DNA/RNA molecules.
According to clause 12,
The DNA is a gene carrier that is double-stranded DNA.
According to paragraph 1,
A gene carrier wherein the nucleic acid molecule has a length of at least 100 bp, 200 bp, or 300 bp.
A pharmaceutical composition comprising the gene carrier of claim 1.
A composition for detecting a target substance comprising the gene carrier of claim 1.
metal nanoparticles; and
A composition for intracellular delivery of a gene of interest, comprising a nucleic acid molecule bound to the metal nanoparticle and containing one or more genes of interest that are delivered and expressed into cells.
Modifying the surface of the metal nanoparticles by treating the metal nanoparticles with an acidic solution;
A method of producing a gene carrier comprising binding to the surface of the metal nanoparticle a nucleic acid molecule containing one or more genes of interest to be expressed and delivered into cells.
A method of expressing a gene of interest through a nucleic acid molecule bound to the surface of a metal nanoparticle and expressed alone within a cell.