KR20230156882A - Novel peptides and anti-cancer compositions including thereof - Google Patents

Abstract

The present invention relates to a peptide that can be used as an anticancer agent. Specifically, the peptide has binding activity to fibronectin and binds to fibronectin competitively with disedherin, thereby inhibiting the binding between disedherin of the cancer cell membrane and fibronectin of the ECM. It can be used as an anticancer agent to weaken the survival, migration, or invasion of cancer cells.

Description

Novel peptides and anti-cancer compositions containing them {NOVEL PEPTIDES AND ANTI-CANCER COMPOSITIONS INCLUDING THEREOF}

The present invention relates to a novel peptide and an anticancer composition containing the same, which can be used in the medical field for the prevention or treatment of cancer.

Dysadherin is a cancer-related antigen and cell membrane glycoprotein with an FXYD motif. Disedherin is overexpressed in a wide range of human cancers, including thyroid, esophageal, gastric, colorectal, pancreatic, cervical, testicular, breast, and head and neck tumors, but surface expression of disedherin is limited in normal cells and disedherin is expressed in non-tumor cells. Edherin is rarely expressed. Disedherin is a potent inducer of cancer invasion and metastasis, and clinical studies have shown that high disedherin expression in tumor tissue is significantly correlated with clinicopathological parameters such as distant metastasis, recurrence, and low survival rate. However, the molecular mechanisms involved in disedherin remain ambiguous, and in particular, the potential physiological relevance of disedherin in tumorigenesis is unknown.

Extracellular matrix (ECM) molecules trigger a variety of important signaling signals and play an important role in the regulation of cell phenotype and behavior. During tumor development, interactions between the ECM and cancer cells continuously occur and lead to changes in cell structure, adhesion properties, and response to signals from ECM proteins. Some of these changes in cellular phenotype are achieved by the availability of cells that can sense mechanical forces, which are then converted into biochemical signals within the cell, activating several cellular mechanisms, including cell adhesion, proliferation, survival and migration.

The inventors of the present invention performed a comprehensive bioinformatics analysis to discover new therapeutic agents for cancer treatment and discovered the relationship between disedherin and ECM signaling. The present inventors completed the present invention by analyzing disadherin-interacting ECM proteins and downstream signaling pathways to develop peptides effective in cancer treatment.

Ino Y, Gotoh M, Sakamoto M, Tsukagoshi K, Hirohashi S Dysadherin, a cancer-associated cell membrane glycoprotein, down-regulates E-cadherin and promotes metastasis. Proc Natl Acad Sci USA 2002;99:365-70.

The purpose of the present invention is to provide a peptide and a composition containing the same that are effective in preventing and treating cancer.

1. A peptide consisting of at least part of the sequence of SEQ ID NO: 1, wherein the part is 5 aa or more in length.

2. The peptide of 1 above, wherein some of the peptides are 10 aa or more in length.

3. The peptide according to 1 above, which consists of any one of the sequences of SEQ ID NOs: 2 to 7.

4. A pharmaceutical composition for preventing or treating cancer, comprising at least part of the sequence of SEQ ID NO: 1, wherein the part includes a peptide with a length of 5 aa or more.

5. The pharmaceutical composition for preventing or treating cancer according to item 4 above, wherein some of the above are 10 aa or more in length.

6. The pharmaceutical composition for preventing or treating cancer according to item 4 above, wherein the peptide comprises a sequence selected from the group consisting of SEQ ID NOs: 2 to 7.

7. The pharmaceutical composition for preventing or treating cancer according to item 4 above, wherein the peptide consists of the sequence of SEQ ID NO: 2 or 5.

8. In item 4 above, the cancer is colon cancer, breast cancer, colon cancer, small intestine cancer, rectal cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, penile cancer, urethra cancer, ureter cancer, renal pelvis cancer, esophagus cancer, laryngeal cancer, stomach cancer, Gastrointestinal cancer, skin cancer, keratoacinoma, follicular carcinoma, melanoma, lung cancer, small cell lung carcinoma, non-small cell lung carcinoma (NSCLC), lung adenocarcinoma, squamous cell carcinoma of the lung, pancreatic cancer, thyroid cancer, papillary cancer, bladder cancer, liver cancer, and bile duct cancer. , bone cancer, hair cell cancer, oral cancer, lip cancer, tongue cancer, salivary gland cancer, pharynx cancer, kidney cancer, prostate cancer, vulva cancer, thyroid cancer, endometrial cancer, uterine cancer, brain cancer, central nervous system cancer, peritoneal cancer, hepatocellular cancer, A pharmaceutical composition for the prevention or treatment of cancer, leukemia, or leukemia.

9. The pharmaceutical composition for preventing or treating cancer according to item 4 above, wherein the cancer is colon cancer, liver cancer, or breast cancer.

The peptide of the present invention and the pharmaceutical composition for preventing or treating cancer can effectively inhibit the binding between disedherin in the cancer cell membrane and fibronectin in the extracellular matrix.

The peptide and pharmaceutical composition for preventing or treating cancer of the present invention have excellent anticancer effects.

Figure 1 shows the genetic ratio of pups born from a litter of Fxyd5 ^+/- mice and the results of analyzing the intestines of wild type and Fxyd5 ^-/- mice. (A) Schematic showing targeting of exons 2-7 of the Fxyd5 gene using three guide RNAs (gRNAs). Arrows indicate 5'- and 3'-primer pairs used for genotyping. (B) Detection of Fxyd5 deleted chromosomes by PCR. Of the six pups that received zygote injection, four showed defective bands. Asterisks indicate pups with the deleted allele. (C) Sequencing analysis of mouse strains 661 and 662. Mouse strains 661 and 662 carried 5740-bp and 5751-bp deletions between the gRNA #1 and gRNA #3 target regions. Because the deleted region includes the first ATG sequence of exon 2 and most of the coding region, the chromosomes carrying the deletion in mouse strains 661 and 662 were null. (D) Generation of Fxyd5-KO founders in mouse strain 661. For experiments, at least five serial breedings were performed using C57BL/6J mice. (E) Pups born from litters of Fxyd5 ^+/− mice followed Mendelian ratios. Statistical values were estimated using the chi-square test. (F) H&E staining images of wild-type or Fxyd5 ^−/− mouse intestines. The length of fossae and villi was measured in mice with the indicated genotypes (n = 7/group).
Figure 2 shows results showing that disedherin deficiency inhibits intestinal tumor formation. (A) Apc ^Min/+ ; Acquisition of dysedherin expression in intestinal tumor epithelium (EpCAM+) of Fxyd5 ^+/+ mice and Apc ^Min/+ ; Immunofluorescence (IF) results showing complete ablation of dysedherin expression in intestinal tumor epithelium of Fxyd5 ^−/− mice. (B) Tumor incidence (number of tumor-bearing mice/number of mice examined) in Apc ^Min/+ ;Fxyd5 ^+/+ and Apc ^Min/+ ;Fxyd5 ^−/− mice at the indicated ages. (C) Number of intestinal tumors and total tumor burden per mouse (Apc ^Min/+ , Fxyd5 ^+/+ , n = 12; Apc ^Min/+ , Fxyd5 ^−/− , n = 20). (D) Left: Schematic diagram of the AOM/DSS-induced intestinal tumorigenesis model. Right: Colon tumor number and total tumor burden in 22-week-old AOM/DSS mice (Fxyd5 ^+/+ , n = 7; Fxyd5 ^−/− , n = 7). (E) Representative images showing intestinal tumor types derived from Apc ^Min/+ mice subjected to knockdown of Fxyd5. (F) Effect of disedherin knockdown on tumor type survival and size (n = 3/group).
Figure 3 shows the effect of disedherin deficiency on intestinal tumor formation in Apc ^Min/+ mice and AOM/DSS treated mice. (A) Number and total tumor burden of intestinal tumors per mouse in 20-week-old Apc ^Min/+ mice (Apc ^Min/+ , Fxyd5 ^+/+ , n = 12; Apc ^Min/+ , Fxyd5 ^+/− , n = 14). was quantified. (B) Representative images of immunohistochemical detection of Ki67 and cleaved caspase 3 in intestinal tumors of 20-week-old Apc ^Min/+ mice. Nuclei were counterstained with hematoxylin. The graph shows protein levels of Ki67 and cleaved caspase 3 in intestinal tumors of 20-week-old Apc ^Min/+ mice (Apc ^Min/+ ; Fxyd5 ^+/+ , n = 8; Apc ^Min/+ ; Fxyd5 ^−/− , n = 8). (C) Representative image of hematoxylin and eosin-stained intestinal tumor tissue from a 20-week-old Apc ^Min/+ mouse. In control mice (Apc ^Min/+ ;Fxyd5 ^+/+ ), tumor cells (arrowheads) invaded the muscularis mucosa (MM, dotted line) and muscularis propria (MP) and reached the serosa (Se). In dysedherin-deficient mice (Apc ^Min/+ ;Fxyd5 ^−/− ), tumor cells remained on the MM. (D) IF analysis of intestines from 20-week-old Apc ^Min/+ mice labeled for the epithelial markers EpCAM and α-smooth muscle actin (SMA). Stacked bar graphs show the percentage of invasive or non-invasive tumors among the tumors examined per group. (E) Colon tumor number and total tumor burden in 22-week-old AOM/DSS mice (Fxyd5 ^+/+ , n = 7; Fxyd5 ^+/− , n = 7; Fxyd5 ^−/− , n = 7). Mice were divided into three groups according to intestinal tumor diameter: small tumors, <3 mm; intermediate tumors, >3 mm and <5 mm; and large tumors, >5 mm. Tumor burden was calculated according to the following formula: Tumor burden = (number of small tumors) × 1 + (number of medium tumors) × 2 + (number of large tumors) × 3. AOM: Azoxymethane, DSS: Dextran Sulfate Sodium. C-Caspase3: cleaved-Caspase 3, Dys: dysedherin, IOD: integrated optical density.
Figure 4 shows the substrate depletion effect of disedherin in a syngeneic mouse model. (A) Left: Schematic diagram of the syngeneic mouse model. Luciferase-labeled MC38 cells (C57BL/6 mouse-derived colon cancer cell line) were inoculated subcutaneously. with C57BL/6J mice (5 x 10 ⁴ /mouse). Middle and right: Tumor growth was monitored by measuring luciferase activity until necropsy (Fxyd5 ^+/+ , n=6; Fxyd5 ^−/− , n=6). (B) Tumor volume was calculated according to the following formula: tumor volume = length x width ² /2. (C) Left: Tumor weight was measured after autopsy. Right: Representative images of MC38 tumors grown in Fxyd5 ^+/+ or Fyxd5 ^−/− mice. (D) Immune cell and hematological parameters of naïve control and MC38-inoculated mice with the indicated genotypes were compared.
Figure 5 verifies siRNA efficacy using MC38 cells and intestinal tumor types derived from Apc ^Min/+ mice. (A) MC38 cells were transfected with scrambled siRNA (siCTRL) and siRNA targeting mouse Fxyd5 (siFxyd5). Fxyd5 transcript levels were determined by real-time RT-qPCR 96 h after transfection. Relative Fxyd5 levels were normalized to endogenous Hprt. (B) Intestinal tumor types from Apc ^Min/+ mice were isolated into single cells and transfected with siCTRL or siFxyd5 by electroporation (NEPA Gene, Chiba, Japan). mRNA expression levels were determined 96 h after transfection.
Figure 6 shows the clinical significance of disedherin expression in CRC patients and its pleiotropic role in CRC cells. (A) mRNA expression of dysedherin (FXYD5) was measured by real-time RT-qPCR in tumor tissue and matched adjacent normal tissue (total n = 187, Stage I n = 30, Stage II n = 79, Stage III n = 78). Statistical significance was determined by paired Student's t-test. (B) Protein immunoblot showing increased disedherin protein expression in tumors versus adjacent normal tissues from seven CRC patients. (C) Representative immunohistochemical staining of disedherin in tumors and adjacent normal tissues from CRC patients. (D) Graph showing the integrated optical density (IOD) of disedherin protein levels in the epithelium of the indicated groups. Statistical significance was determined by paired samples t-test. (E,F) Kaplan-Meier survival analysis of CRC patients. Patients were divided into four groups according to stage (stage 2 and 3) and dysedherin expression (high and low). Statistical significance was determined by the log-rank test. (G) LDA was performed to compare tumor formation potential. Different numbers of SW480 cells with and without KO of dysedherin were inoculated subcutaneously into NOD.Cg-Prkdcscid/J mice (n = 6/group). (H) Luciferase-labeled SW480 cells with or without KO of disedherin were inoculated into the spleens of NOD.Cg-Prkdcscid/J mice (n = 6/group). Metastatic tumor formation was observed through bioluminescence and autopsy.
Figure 7 is an evaluation of disedherin expression in CRC patients, with mRNA expression data obtained from an open source database (R2: Genomic Analysis and Visualization Platform) showing FXYD5 expression in normal and tumor tissues.
Figure 8 shows the effect of disedherin expression on CRC cell behavior, including cell growth, survival, apoptosis, migration and invasion potential. (A) Protein immunoblot analysis in a panel of human CRC cell lines. (B) Protein immunoblot confirming establishment of disedherin-KO and disedherin-OE CRC cell lines. Number of viable cells at indicated time points (n = 5/group) determined by automated cell counter. (C) Viability measured by clonogenic assays (n = 3/group). (D) Disedherin-KO and disedherin-OE cells were cultured in serum-free medium for 72 hours. Annexin V/PI staining and subsequent FACS analysis were performed to determine the population of apoptotic cells (n = 3/group). (E) Boyden chamber assay without Matrigel matrixcoated membrane was performed to compare the chemotactic migration potential of disedherin-KO or -OE cells (n = 3/group). (F) Boyden chamber assay using Matrigel matrix coated membranes was performed to compare invasion potential (n = 3/group). EV: empty vector, PI: propidium iodide.
Figure 9 identifies disedherin-related mechanisms through bioinformatics analysis. (A) Schematic showing CRC patient groups according to disedherin expression. mRNA expression data of patients' tumors were obtained from the GEO database (GSE21510), and patients were divided into two groups according to median disedherin levels (disedherin ^high , n=52; disedherin ^low , n=52). A list of differentially expressed genes (DEGs) was obtained through R2 analysis using the GEO platform (p<0.001) and used for gene set enrichment analysis (GSEA) to determine associated gene signatures. (B) Gene signatures associated with hallmarks of cancer malignancies, such as poor prognosis gene clusters, metastasis gene clusters, and cell migration gene clusters, were significantly enriched in dysedherin ^high tumors. (C) Significant enrichment of ECM receptor pathway genes, such as genes involved in ECM organization, ECM regulators, and integrin signaling, was observed in dysedherin ^high tumors from CRC patients. (D) IPA was applied to the list of DEGs in disedherin-KO SW480 cells (n = 4,437, p<0.05). Bar graph shows the top 20 major diseases and functions associated with dysedherin KO. Cancer was most affected by Dysedherin KO. Dys: disedherin, FDR: false discovery rate, NES: normalized enrichment score.
Figure 10 shows that the ECM-integrin pathway is a potential downstream mediator of disedherin with tumorigenesis. (A) GSEA was performed using mRNA sequencing profiles of dysedherin-KO and control (EV-transfected) cells. Gene signatures related to the ECM-integrin pathway were significantly enriched in control cells compared to disedherin-KO cells. (B,C) Ingenuity pathway analysis (IPA) was performed with the list of differentially expressed genes in disedherin-KO cells to reveal disedherin-related mechanisms. (B) Disease and functional analysis shows significant reduction in tumor frequency, tumor incidence, and malignancy development upon disedherin KO. p<0.05 and |z-score| >2 was considered statistically significant. (C) Upstream analysis indicates a potential link between the integrin pathway and cancer-related functional decline, with integrin target gene expression significantly reduced upon disedherin KO, resulting in overall reduced tumor development. (D,E) RT-qPCR analysis of integrin target genes and potential relationship between disedherin and integrin signaling pathways verified by IF in SW480 (D) and HCT116 (E) cell lines. RT-qPCR heatmap shows changes in integrin signaling target genes upon disedherin KO (D) and OE (E). IF staining for human activated β1 integrin (12G10) and disedherin in disedherin-KO or -OE CRC cells. (F) Murine activated β1 integrin (9EG7) and disedherin in intestinal tumor tissues of Apc ^Min/+ , Fxyd5 ^+/+ and Apc ^Min/+ , Fxyd5 ^−/− mice (n = 8/group). For IF staining. Dys: disedherin, FC: fold change, FDR: false discovery rate, MFI: mean fluorescence intensity, NES: normalized enrichment score, EV: empty vector.
Figure 11 confirms and verifies the binding between disedherin and fibronectin. (A) Identification of disedherin binding proteins based on co-immunoprecipitation (co-IP) with anti-disedherin (M53) monoclonal antibody and subsequent liquid chromatography with tandem mass spectrometry (LC-MS). Schematic flow for. (B) Confirmation of the purified recombinant disedherin structure produced in E. coli. (C) Schematic of the disedherin open reading frame (ORF) sequence used to establish HCT116 cell lines overexpressing wild-type (full-length) or mutant disedherin. Arrows indicate the binding site of a primer set designed to detect mutant forms of disedherin. Right: Confirmation of wild-type or mutant disedherin OE by RT-qPCR analysis (n=3/group). (D) IF analysis to visualize His-tagged disedherin (green) and fibronectin (red). His-tagged wild-type or mutant disedherin was transfected into HCT116 cells, and the localization of disedherin was visualized by staining with an anti-His antibody. OE of wild-type or ΔC-mutant disedherin increased colocalization of disedherin and fibronectin at the cell membrane, but OE of ΔN-mutant disedherin did not. (E) IF staining for fibronectin and disedherin in SW480 cells with or without disedherin KO. (F) Apc ^Min/+ ; Fxyd5 ^+/+ and Apc ^Min/+ ; IF staining for fibronectin and dysedherin in intestinal tumor tissue from Fxyd5 ^−/− mice. Dys: Disadherin, FN: Fibronectin, Full: Full length, GO: Gene Ontology, IgG: Immunoglobulin G, MFI: Mean fluorescence intensity, SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis, ΔC: ΔC -Mutation, ΔN: ΔN- mutation.
Figure 12a shows that the extracellular domain of disedherin directly binds to fibronectin. (A) Co-IP and subsequent protein immunoblot analysis using an anti-disedherin antibody (M53) verify the binding of disedherin to endogenous fibronectin in CRC cells. (B) Co-IP using M53 and subsequent protein immunoblot analysis confirm that the amount of disedherin-bound fibronectin is reduced by disedherin KO but increased by disedherin OE. (C) This is the result of comparing the amount of secreted fibronectin by extracting the total protein lysate and membrane fraction from the cells at the indicated time points, collecting the culture medium, and applying it to dot blot analysis. RT-qPCR analysis was performed to compare fibronectin mRNA transcript levels (n = 3/group). (D) Schematic representation of wild-type (full-length) and mutant disedherin proteins purified from E. coli. (E) Pull-down assay results using various forms of purified His-tagged disedherin protein and purified fibronectin protein to analyze direct protein-protein interactions. Dys: disedherin, FN: fibronectin, Mem: membrane, Sec: secretion, ΔC: ΔC-mutant, ΔN: ΔN-mutant.
Figure 12b is a schematic diagram used to identify candidate sites and peptide sequences that can bind fibronectin.
Figure 12c shows the results of a pull-down assay to determine specific sequences with fibronectin binding activity using purified fibronectin and purified His-tagged synthetic peptides.
Figure 12d shows the cell survival rate for each candidate site peptide treatment in colon cancer, liver cancer, and breast cancer cell lines. Cell viability was measured by MTT assay 48 h after annotated peptide treatment in cells with or without KO of disedherin.
Figure 13 shows the effect of disedherin on cancer cell attachment ability to fibronectin and confirmation of fibronectin knockdown using siRNA. (A,B) Cancer cell adhesion to various ECM proteins was determined by measuring the relative number of bound cells on culture plates coated with the indicated proteins 1 hour after cell seeding. Top: Representative images of attached cells stained with crystal violet. Bottom: Graph shows relative cell number determined by measuring absorbance at OD 595 nm (n=3/group). (C) Activation of FAK (p-FAK) in SW480 cells 1 h after cell seeding on culture plates with or without fibronectin coating, visualized by IF. (D) The gene silencing effect of siRNA targeting fibronectin (siFN1) was confirmed by RT-qPCR analysis 96 hours after transfection. Cells transfected with scrambled siRNA (siCTRL) were used as a control. (E) Protein immunoblot analysis shows a decrease in fibronectin protein levels in siFN1-transfected cells without effect on disadherin protein levels. (F) FAK activation in 4-day culture of CRC cells after gene silencing of fibronectin. BSA: bovine serum albumin, COL1: collagen type 1, Dys: dysedherin, FN: fibronectin, LM: laminin, OD: optical density.
Figure 14 shows that disedherin promotes CRC attachment to fibronectin and induces pro-tumor activity by activating the fibronectin-integrin-FAK axis. (A) Activation of FAK (p-FAK) was visualized by IF in HCT116 cells with or without OE of disedherin 1 hour after cell seeding on culture plates with or without fibronectin coating. (B) Apc ^Min/+ ; Fxyd5 ^+/+ and Apc ^Min/+ ; Results of IF staining for p-FAK and disadherin in intestinal tumor tissue from Fxyd5 ^-/- mice. The graph shows fibronectin protein levels in the indicated groups (n = 8/group). (C,D) The extent of FAK activation was determined in CRC cells with and without KO (SW480 cells) and OE (HCT116 cells) of dysedherin at the indicated time points after seeding the cells on fibronectin-coated culture dishes. (E, F) FAK activation was measured in 4-day cultures of CRC cells without fibronectin coating. (G) Shows the viability of HCT116 cells overexpressing wild-type (full-length) or mutant disedherin compared in a clonogenic assay (n = 3/group). (H) Invasion potential of HCT116 cells overexpressing wild-type or mutant disedherin was compared by Boyden chamber assay. Dys: disadherin, FN: fibronectin, MFI: mean fluorescence intensity, ΔC: ΔC-mutant, ΔN: ΔN-mutant, T-FAK: [definition], EV: empty vector
Figure 15 shows the functional involvement of the fibronectin/integrin/FAK axis in disedherin-mediated protumor activity. (A) The number of viable cells was determined by automated cell counter (Countess II, ThermoFisher Scientific, Waltham, MA, USA) at the indicated time points (n = 3/group) in HCT116 cells overexpressing wild-type (full-length) or mutant dysedherin. ) was measured. EV-transfected cells were used as controls. (B) To determine the effect of fibronectin and FAK signaling on cancer cell growth, disedherin-OE or control cells were transfected with control siRNA (siCTRL) or siRNA targeting fibronectin (siFN1). 24 hours after transfection, cells were dissociated, reseeded, and incubated for 12 hours for cell attachment. Cells were then incubated for 36 h with or without FAK inhibitor treatment (VS-4718, 3 μM). Relative cell numbers were determined by MTT assay (n = 3/group). (C) Protein immunoblot confirming the inhibitory effect of FAK inhibitor (VS-4718) on fibronectin-induced FAK activation. Cells were seeded on fibronectin-coated culture plates with or without VS-4718 at 1 or 3 μM. After 4 h, cells were lysed and whole cell extracts were subjected to protein immunoblot analysis to visualize FAK activation status. (D) The migratory potential of HCT116 cells overexpressing wild-type or mutant disedherin was compared in a wound healing assay. To determine the effect of fibronectin and FAK signaling on cancer cell migration, cells were transfected as in (B). 24 hours after transfection, cells were isolated and reseeded for wound healing analysis. The black dotted line represents the initial wound area and the blue line represents the cell boundaries determined after 48 hours of culture in serum-free medium. FAK inhibitor (VS-4718, 1 μM) was added at an early time point in the wound healing assay. Bar graph shows percentage of wound closure (n = 3/group). (E) The viability of HCT116 cells overexpressing wild-type disedherin or EV was compared. Cells were transfected with control siRNA (siCTRL) or siRNA targeting fibronectin (siFN1). The next day, cells were incubated with or without FAK inhibitor (VS-4718, 3 μmol/L) for 24 h and then isolated and reseeded for clonogenic analysis (n = 3/group). (F) Comparison of the invasion potential of HCT116 cells overexpressing wild-type disadherin or EV by Boyden chamber assay. Fibronectin knockdown was performed as in e. Transfected cells were isolated and reseeded in the upper chamber with or without FAK inhibitor (3 μmol/L) in serum-free medium. After 24 hours of incubation, cells that had penetrated to the bottom of the membrane were fixed, stained with crystal violet, and counted under a phase contrast microscope (n = 3/group). (G) IF staining for disedherin and fibronectin or p-FAK in CRC patient tumors. Patients were classified as high or low expressers of dysedherin. The graph shows protein levels of fibronectin or p-FAK in the tumor epithelium of the indicated groups (n = 3/group). EV: empty vector, FN: fibronectin, Full: full length, ΔC: ΔC-mutant, ΔN: ΔN-mutant.
Figure 16 shows that disedherin enhances mechanical force and promotes YAP mechanotransduction in CRC cells. (A) The degree of mechanical force applied by CRC cells was measured by collagen gel contraction assay. Since the shrinkage index means percent gel shrinkage disturbance/percent gel shrinkage control, an increase in shrinkage index means an increase in shrinkage. Image shows CRC cell induced gel contraction 48 hours after cell seeding. The graph shows the extent of disedherin KO or OE induced gel contraction relative to control cells. (B,C) Results of IF analysis of mechanotransduction by visualizing paxillin-positive focal adhesions (B) and YAP (C) in CRC cells with disedherin OE or KO. Hydrogels with defined elastic moduli (0.5 kPa and 12 kPa) were used as positive controls for mechanical force. (D) RT-qPCR verification results for YAP target gene expression in CRC cells upon disedherin OE or KO.
Figure 17 shows the effect of disedherin on F-actin stress fibers. IF of cytoskeletal tension was analyzed by visualizing F-actin in CRC cells upon disadherin OE (HCT116 cells) or KO (SW480 cells). CRC cells were seeded on fibronectin-coated glass slides and stained with alexa555-conjugated phalloidin.
Figure 18 shows that disedherin is potentially involved in YAP activation during cell attachment to fibronectin. Protein immunoblot analysis was performed in HCT116 cells overexpressing (OE) wild-type (full-length) or mutant disedherin to visualize YAP activation status. Cells were starved in serum-free medium for 24 hours, then detached and reseeded on fibronectin-coated culture plates. After the indicated times, cells were lysed, and whole cell extracts were subjected to protein immunoblot analysis to visualize YAP activation status. EV-transfected cells were used as controls. The extent of active YAP increases and the extent of inactive YAP (phosphorylated-YAP; p-YAP) decreases upon cell attachment to fibronectin, suggesting that YAP activation occurs during cell attachment to fibronectin. Disedherin OE enhanced fibronectin-induced YAP activation. Deletion of the extracellular domain of disedherin (ΔN-mutant) attenuated the disedherin-mediated increase in YAP activation, but deletion of the intracellular domain (ΔC-mutant) did not. EV: empty vector, ΔC: ΔC-mutant, ΔN: ΔN-mutant.

Hereinafter, the present invention will be described in detail.

The present invention relates to a peptide consisting of at least part of the sequence of SEQ ID NO: 1 (AA 64-115 in Figure 12b herein), wherein said part is at least 5 aa in length.

The peptide may include a sequence of 5 aa or more starting from any sequence of SEQ ID NO: 1, that is, all parts that can be arbitrarily cut from SEQ ID NO: 1, or may consist of the entire sequence of SEQ ID NO: 1. Part of the sequence of SEQ ID NO: 1 may be a contiguous amino acid sequence.

The length of the peptide may be 5 to 52aa, 5 to 30aa, 5 to 20aa, 5 to 15aa, 10 to 20aa, or 10 to 15aa, but is not limited thereto.

Some of the above may be 10aa or more in length.

Specifically, the peptide may consist of any one of SEQ ID NOs: 2 to 7. SEQ ID NOs: 2 to 7 are part of the extracellular domain of disedherin and correspond to sequences N#04 to N#09, respectively, schematized in FIG. 12B herein.

The peptide is, for example, a portion of the sequence of SEQ ID NO: 1, consisting of PADETPQPQTQ (SEQ ID NO: 8), TQQLEGTDGP (SEQ ID NO: 9), LVTDPETHKS (SEQ ID NO: 10), KAAHPTDDTT (SEQ ID NO: 11), and TLSERPSPST (SEQ ID NO: 12). It may consist of or include a sequence selected from the group.

The above part is a motif portion that can bind to fibronectin in the peptide of SEQ ID NO: 1.

As long as the peptide maintains the property of binding to fibronectin, it may have more than 80%, more than 90%, more than 95%, more than 97%, or more than 99% homology to the sequence.

The peptide can inhibit the binding between disedherin and fibronectin by competitively binding to fibronectin with disedherin.

The peptide can be used to prevent or treat cancer by attenuating the survival, migration, or invasion of cancer cells.

Specifically, the peptide has binding activity to fibronectin and binds to fibronectin competitively with disedherin, so it can interfere with the bond between disedherin in the cancer cell membrane and fibronectin in the ECM, and adhesion between cancer cells is strengthened by the bond. and subsequent biochemical signal transduction, such as FAK and YAP activation, thereby attenuating the survival, migration, or invasion of cancer cells.

Disadherin is a cell membrane glycoprotein overexpressed in a wide range of cancers, and the types of cancers for which the peptide can be used are not particularly limited, for example, colon cancer, breast cancer, colon cancer, small intestine cancer, rectal cancer, ovarian cancer, cervical cancer, and prostate cancer. Cancer, testicular cancer, penile cancer, urethral cancer, ureteral cancer, renal pelvis cancer, esophagus cancer, laryngeal cancer, stomach cancer, gastrointestinal cancer, skin cancer, keratoacanthoma, follicular carcinoma, melanoma, lung cancer, small cell lung carcinoma, non-small cell lung carcinoma (NSCLC) , lung adenocarcinoma, squamous cell carcinoma of the lung, pancreatic cancer, thyroid cancer, papillary cancer, bladder cancer, liver cancer, bile duct cancer, bone cancer, hair cell cancer, oral cancer, lip cancer, tongue cancer, salivary gland cancer, pharynx cancer, kidney cancer, prostate cancer, vulva cancer, It may be thyroid cancer, endometrial cancer, uterine cancer, brain cancer, central nervous system cancer, peritoneal cancer, hepatocellular cancer, Hodgkin's or leukemia, and preferably colon cancer, liver cancer or breast cancer.

The method of producing the peptide is not particularly limited, and may be synthesized or obtained by transforming a gene expressing the peptide into a microorganism.

The peptide can be administered to animals, including humans, for the prevention or treatment of cancer.

The peptide can be administered in a prophylactically or therapeutically effective amount.

In the present invention, ‘effective amount’ refers to the amount of peptide that can exhibit the above-mentioned effects. The effective amount of the peptide may vary depending on the form in which it is commercialized, but the daily dosage may be, for example, 0.0001 to 100 mg/kg based on the amount of the peptide.

The administration means introducing the peptide into the subject by any appropriate method, and the composition of the present invention can be administered through various oral or parenteral routes as long as it can reach the target tissue.

For example, local administration around the tumor, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, intranasal administration, intrapulmonary administration, or intrarectal administration may be performed, but is not limited thereto.

When administered, the peptide may be administered together with one or more active ingredients that exhibit the same or similar function, or may be administered together with a compound that maintains/increases the solubility and/or absorption of the active ingredient.

In addition, the present invention relates to a pharmaceutical composition for preventing or treating cancer, which includes at least part of the sequence of SEQ ID NO: 1, and the part includes a peptide with a length of 5 aa or more.

Some of the above may be 10aa or more in length.

Specifically, the peptide may include any one of SEQ ID NOs: 2 to 7. SEQ ID NOs: 2 to 7 correspond to sequences N#04 to N#09, respectively, schematized in FIG. 12B herein.

The peptide is, for example, a portion of the sequence of SEQ ID NO: 1, consisting of PADETPQPQTQ (SEQ ID NO: 8), TQQLEGTDGP (SEQ ID NO: 9), LVTDPETHKS (SEQ ID NO: 10), KAAHPTDDTT (SEQ ID NO: 11), and TLSERPSPST (SEQ ID NO: 12). It may include a sequence selected from the group.

As described above, a peptide comprising at least part of the sequence of SEQ ID NO: 1, for example, any one of SEQ ID NOs: 2 to 7, or a sequence selected from the group consisting of PADETPQPQTQ, TQQLEGTDGP, LVTDPETHKS, KAAHPTDDTT and TLSERPSPST It can be used for the prevention or treatment of cancer by inhibiting the survival, migration, or invasion of cancer cells by interfering with the binding between disedherin and fibronectin, and the composition, including the peptide, has an equivalent or higher cancer prevention or treatment effect. You can have

As long as the peptide includes a motif portion that binds to fibronectin, the length, additional sequence, etc. are not limited.

The peptide may include a plurality of some of the sequences of SEQ ID NO: 1, and the plurality of sequences may be the same or different from each other.

In addition to the above sequence, the peptide may additionally contain other peptide sequences that have anti-cancer effects themselves or enhance the effect of the peptide.

For example, in addition to part of the sequence of SEQ ID NO: 1, the peptide further includes other peptide sequences derived from disedherin, specifically the peptide sequence of the region where disedherin binds to substances in the extracellular matrix in controlling tumor formation. can do. The material of the extracellular matrix may be selected from Table 10, for example. The peptide may include a linker to connect the peptides.

The peptide may contain a His-tag, which is an amino acid sequence overlapping Histidine. In this case, it binds better to nickel and can be easily purified by affinity chromatography using nickel resin. For example, 6 to 8 histidine may be used.

The composition may be administered in combination with a composition containing each of the above peptides.

The composition may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injectable solutions according to conventional methods. Not limited.

Carriers, excipients, and diluents that may be contained in the composition include lactose, dextrose, sucrose, dextrin, maltodextrin, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, and calcium phosphate. , calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants, but is not limited thereto.

Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, etc., but these solid preparations contain at least one excipient, such as starch or calcium carbonate, to the compound. It is prepared by mixing , sucrose or lactose, and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used.

Liquid preparations for oral use include suspensions, oral solutions, emulsions, syrups, etc. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. . Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used.

Meanwhile, the composition of the present invention can additionally contain ingredients that have an anti-cancer effect themselves or are well known to aid the anti-cancer effect, thereby achieving a more desirable anti-cancer effect.

Experimental method

1. Experimental design

Prior approval for animal research was obtained from the Gwangju Institute of Science and Technology (GIST, GIST2018-049), and the sample size was determined according to the 3Rs (replacement, reduction, and purification) for all analyses.

Humane endpoints were defined as breathing difficulties and/or hunching accompanied by weight loss of 10% or more. Evaluation of experimental results was performed in a blinded manner without prior reference to genotype, and this report is consistent with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines. All in vitro experiments were performed on three separate occasions. No blinding was used in the in vitro analysis. Outliers were included in all experiments. Analysis of dysedherin expression in CRC patients was pre-approved by the institutional review board of GIST (No. 20200108-BR-50-07-02). All work involving human tissues was performed in accordance with the Declaration of Helsinki. Written informed consent was obtained from all participants before the study. As this was a retrospective study using tissue microarray (TMA) slides, study size calculations were not performed. Tissue Clinical evaluations were performed blinded and automatically scored using Image-Pro Premier 9.2 software (Media Cybernetics Inc., Rockville, MD, USA) in a blinded manner without clinical information.Clinically relevant data were reported consistent with REMARK guidelines. did.

2. Chemicals and reagents

10X cell lysis buffer (#9803), 3X sodium dodecyl sulfate (SDS) sample buffer (#7722), and protein A agarose beads (#9863) were purchased from Cell Signaling Technology (Beverly, MA, USA). Fluorescence-activated cell sorting (FACS) LysingTM Solution was purchased from BD Biosciences (San Diego, CA, USA). TRIzol reagent was purchased from Ambion (Austin, TX, USA). VS-4718 was purchased from Tocris Bioscience (Ellisville, MO, USA). Anti-disadherin monoclonal antibody (M53) was provided by Dr. Yoshinori Ino (National Cancer Center Research Institute, Tokyo, Japan).

3. Generation of Fxyd5 knockout (KO) mice

Fxyd5 ^−/− mice were purchased from Vitalstar (Beijing, China). Ear tagging was used for mouse identification and record keeping throughout the research project. Fxyd5 ^−/− mice were generated using CRISPR/Cas9 technology. Three guide RNAs (gRNA sequences: AGGCTGCTAGGCATCTCGGGGGG, TCTTCCTGGGCTCGGTCACGTGG, and CCCCGATGAGCGATACAGAGACA) were used to cut genomic DNA in Fxyd5 introns 1 and 7, resulting in deletion of the ATG start codon and exons 2–7 containing most of the coding sequence. . Four mouse strains carrying the Fxyd5 mutation (gene targeting efficiency: 4/6=66.66%) were identified. Mouse strain 661, a heterozygous mouse strain carrying a 5740-bp deletion of Fxyd5 (Fxyd5 null), was selected as the founder. At least five backcrosses with C57BL/6J were performed using mouse strain 661 to minimize off-target effects. No differences by gender were observed. The list of primers used for genotyping is given in Table 1-4.

4. Animal model

All mice used in these experiments were housed under specific pathogen-free conditions and managed according to international guidelines pre-approved by the IACUC of GIST. The exact number of mice for each experiment is indicated in the figure. To investigate dysedherin deficiency on intestinal tumor development, a new murine model was developed by crossing female dysedherin-KO (Fxyd5 ^-/- ) mice with male Apc ^Min/+ mice on a C57BL/6J background. did. Apc ^Min/+ mice were purchased from Jackson Laboratory (Bar Harbor, ME, USA) and Fxyd5 ^−/− mice were purchased from Vitalstar (Beijing, China). Ear tags were used for mouse identification and record keeping throughout the research project.

To compare the tumor development status between Apc ^Min/+ ;Fxyd5 ^-/- and Apc ^Min/+ ;Fxyd5 ^+/+ mice, male mice were sacrificed at 4, 6, 8, and 20 weeks of age, and the intestinal tract was opened. The intestinal tract was opened vertically and the tumor was carefully examined in a blinded manner without any genotypic information.

To prepare a chemically induced intestinal tumor mouse model, 8-week-old male wild-type (Fxyd5 ^+/+ ) and Fxyd5 ^−/− mice were treated with a single intraperitoneal injection (day 0) of 10 mg/kg AOM. After 1 week, mice were treated with 2.0% DSS in drinking water for 1 week, and then the drinking water containing DSS was replaced with regular water for 2 weeks. This 3-week DSS treatment course was conducted a total of 4 times over 12 weeks. After an additional week, mice were sacrificed and CRC development status was assessed as described above.

5. Apc ^Min/+ Mouse polyp-derived cancer organoid culture

Single cells were isolated from intestinal polyps of 20-week-old Apc ^Min/+ mice and cultured as described in a previous report with slight modifications. Briefly, mouse intestines containing polyps were cultured with chelating ethylenediamine tetraacetic acid (EDTA). After buffer chelation on ice for 60 min, the isolated normal intestinal epithelial cells were removed by centrifugation and the tumor cells remained attached to the mesenchyme.

Intestinal fragments containing tumor cells were dissociated with collagenase. Isolated tumor cells were counted and pelleted, and then a total of 20,000 cells or 100 cells were plated in 50 μL or 10 μL of Matrigel (Corning Matrigel® Growth Factor Reduced Basement Membrane Matrix, #356231, #356231, in 24-well plates or 96-well plates, respectively). Corning, NY, USA) and plated. After polymerization of Matrigel, 500 mL of IntestiCult™ Organoid Growth Medium (Mouse, #06005, STEMCELL Technology) was added. From the day of seeding, the growth and morphology of the organoids were observed every day, and on the 7th day of organoid culture, a resazurin-based Cell Titer Blue assay (Promega, Leiden, The Netherlands) was performed to evaluate the viability of the organoids. The average diameter of tumor types from each well was measured using Image-Pro Premier 9.2 software (Media Cybernetics Inc., Rockville, MD, USA). For generation of Fxyd5 knockdown tumor types, isolated tumor cells were transfected with siRNA against the Fxyd5 gene using a NEPA21 superelectroporator (NEPAGENE, Chiba, Japan). The transfected cells were then cultured and monitored as described above. A list of siRNA sequences used for Fxyd5 knockdown is provided in Table 5.

6. Histological evaluation

All tissue samples were formalin fixed and paraffin embedded or frozen in optimal cutting temperature compound (Leica Microsystems, Buffalo Grove, IL, USA) within 30 min after removal from the mouse. Paraffin-embedded or composite-embedded tissue blocks were manually cut with a microtome to obtain 4–5 μm thick sections. Paraffin sections were dewaxed and stained with hematoxylin (Dako, Carpinteria, CA, USA) and eosin (Millipore, Billerica, MD, USA) according to the supplier's instructions. Target proteins were visualized by immunohistochemistry (IHC) and immunofluorescence (IF). Proteins were visualized using specific antibodies described in Tables 6-8.

Nuclei were counterstained with hematoxylin (Dako, Carpinteria, CA, USA) for IHC or 4',6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) for IF. Target proteins were visualized using secondary antibodies conjugated with horseradish peroxidase (HRP, Dako) or fluorescent dye (Life Technologies, Carlsbad, CA, USA). For IHC, target proteins were visualized by DAB reaction and observed under a light microscope (Leica Microsystems) at 400x magnification. DAB intensity was automatically quantified using Image-Pro Premier 9.2 software (Media Cybernetics Inc., Rockville, MD, USA) at three random points per every tissue sample in a blinded manner without genotype information. The integrated optical density (IOD) of the target protein was calculated by multiplying the area and the average density. Fluorescent signals were visualized using an Axio Imager 2 (Carl Zeiss, Oberkochen, Germany) or a confocal LSM880 microscope (Carl Zeiss) at a total magnification of 400x or 1000x. Relative expression levels of target proteins were measured based on fluorescence intensity as described above and normalized to DAPI intensity.

7. Real-time reverse transcriptase quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated using TRIzol reagent (Invitrogen). The purity of RNA was confirmed by measuring the absorbance ratios of 260/280 and 260/230. The cDNA template was synthesized from 0.5 μg of total RNA using the PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara Biomedicals, Kusatsu, Japan) with random primers. PCR amplification of cDNA was performed using Power SYBR Green PCR Master Mix and Step-One Real-time PCR System (Applied Biosystems, Foster City, CA, USA). The list of primers used for RT-qPCR is given in Table 1.

8. Clinical analysis and statistics

TMA slides from 123 CRC patients were immunostained to detect disedherin using a specific monoclonal antibody (M53). TMA slides contained three tumor tissue cores from each patient and two matched normal tissue cores. After heat-induced epitope retrieval, slides were permeabilized and incubated with primary antibody (1:500) overnight at 4°C. After repeating the washing steps, slides were incubated with anti-mouse biotinylated antibody (Vector ABC Kit, Vector Laboratories, Burlingame, CA, USA) for 30 min at room temperature and disedherin expression was visualized by DAB reaction and light microscopy. (Leica Microsystems, Buffalo Grove, IL, USA). Expression of dysedherin in CRC epithelium was automatically quantified using Image-Pro Premier 9.2 software (Media Cybernetics Inc., Rockville, MD, USA) in a blinded manner without clinical information. The IOD of disedherin was calculated by randomly selecting three spots per core and multiplying the area by the average density.

The ratio of disedherin expression in tumor tissue versus normal tissue (average IOD of three tumor tissue cores/average IOD of two normal tissue cores) was used to determine the association of disedherin expression with clinicopathological variables. . Patients are divided into two groups according to IOD values. disedherin ^high (≥75%, n = 27) and disedherin ^low (<75%, n = 96). Statistical significance of differences was assessed using the chi-square test or Fisher's exact test for categorical data, and continuous variables were compared using the independent samples t-test. Relapse-free survival (RFS) was defined as the time from the date of surgery to the date of recurrence or death, whichever occurred first, and patients surviving at the last follow-up were recorded at that time. Patients were censored at the time of analysis. Overall survival (OS) was calculated from disease diagnosis to death from all causes, and patients alive at final follow-up were recorded. Survival rates were calculated using the Kaplan-Meier method and compared using the log-rank test. Factors associated with RFS and OS were identified by univariate and multivariate Cox proportional hazards regression models using hazard ratios and 95% confidence intervals. Statistical analyzes were performed using SPSS version 21.0 (IBM Corporation, Armonk, NY, USA). All p-values were two-sided and p < 0.05 was used as an indicator of statistical significance.

9. Cell lines

HCT116 (KCLB Cat# 10247, RRID:CVCL_0291), SW480 (KCLB Cat# 10228, RRID:CVCL_0546), LoVo (KCLB Cat# 10229, RRID:CVCL_0399), KCLB Cat# 10188, RRID:CVCL_1384) and HT29 (KCLB B Cat # 30038, RRID:CVCL_0320) cell lines were purchased from Korea Cell Line Bank (Seoul, Korea). SW48 cell line (ATCC Cat# CCL-231, RRID:CVCL_1724) was purchased from American Type Culture Collection (Rockville, MD, USA). MC38 C57BL6 murine intestinal tumor cell line (RRID:CVCL_B288) was purchased from Kerafast (Boston, MA, USA). All cells were cultured according to the supplier's instructions. Cells were routinely tested for mycoplasma contamination every 6 months using the e-Myco™ Mycoplasma detection kit (iNtron Biotechnology, Seongnam, Korea), and all experiments were performed within 20 passages after the first thawing.

10. Syngeneic mouse model using murine colon cancer cell lines

Luciferase-labeled MC38 cells (a colon cancer cell line derived from C57BL/6J mice) were inoculated subcutaneously (sc) into 8-week-old male Fxyd5 ^+/+ or Fxyd5 ^−/− C57BL/6J mice (5 × 10 ⁴ /mouse). Tumor growth was monitored by measuring luciferase activity for 18 days from cell inoculation to necropsy (Fxyd5 ^+/+ , n=6; Fxyd5 ^−/− , n=6). After autopsy, tumor volume was calculated according to the following formula: tumor volume = length x width ^2/2 . Blood was collected from the abdominal vena cava, stored in an EDTA blood collection tube, and hematological tests were performed using an Exigo Veterinary Hematology Analyzer (Boule Medical, Stockholm, Sweden). Age-matched naïve C57BL/6J mice were used as controls (Fxyd5 ^+/+ , n=3; Fxyd5 ^−/− , n=3).

11. Protein isolation and protein immunoblot analysis

Tissues or cells were homogenized in RIPA buffer for 20 min on ice. Protein concentration was determined based on bicinchoninic acid (BCA) assay using the BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Proteins were denatured with SDS (Sigma-Aldrich) by boiling at 95°C for 5 min. Equal amounts of total protein (4-15 μg) were separated by 8% or 10% polyacrylamide gel electrophoresis (PAGE), and the separated proteins were transferred to a polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA). moved to Membranes were blocked with 5% bovine serum albumin (Sigma-Aldrich) and incubated overnight at 4°C with the indicated primary antibodies. The membrane was then incubated with HRP-conjugated secondary antibody. Chemiluminescence of HRP was developed with ECL reagent (Atto, Tokyo, Japan) and detected with a digital imaging system (ProteinSimple, San Jose, CA). Antibodies used for protein immunoblot analysis are listed in Tables 6-8.

12. Establishment of disedherin-knockout (KO) or -overexpression (OE) cell lines

The disedherin-KO (FXYD5 ^−/− ) SW480 cell line was generated by Transomic Technologies (Huntsville, AL, USA).

Specific gRNAs targeting different regions of the human FXYD5 gene were designed and cloned into the pCLIPAll (EFS-Puro) expression vector. SW480 cells were infected with lentiviral particles and selected with puromycin for 1 week. Dilution cloning was performed to obtain different monoclonal cell populations. The KO efficiency of multiple clones was estimated by real-time RT-qPCR and protein immunoblotting, and the single clone (gRNA sequence: GAGATGGGTCTTACCTC TGG) showing the strongest KO efficiency was selected and used for further experiments. To establish the disedherin-OE cell line, HCT116 cells were transfected with a disedherin expression vector (pcDNA-L3HSV) [6] and selected with G418 for 1 week. Dilution cloning was performed and the OE of the disedherin gene was confirmed through RT-qPCR and protein immunoblot analysis. For generation of HCT116 cell lines overexpressing mutant forms of disedherin, the coding sequence was synthesized and cloned into the pcDNATM4/HisMax vector by Thermo Fisher Scientific. Vector transfection, stable cell line generation, and validation were performed as described above.

13. Cloning analysis

Cells were seeded in 12-well plates (200 cells/well) and cultured for 14 days. The number of colonies larger than 50 μm in size was counted after staining with crystal violet (n = 3/group).

14. Cell growth assay

Cells were seeded in 6-well or 96-well plates and incubated for various time points. The number of viable cells was determined by automated cell counter (Countess II, ThermoFisher Scientific, Waltham, MA, USA) or by staining with thiazolyl blue tetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MO, USA). Absorbance was measured using a microplate spectrophotometer (Bio-Tek Instruments Inc., Winooski, VT, USA).

15. Wound healing analysis

Cells were seeded on culture inserts (Ibidi, GmbH, Martinsried, Germany). After scraping the wound, cells were cultured for 48 h (endpoint). Phase contrast images of cells were captured using an attached camera.

Microscope (Carl Zeiss) at a total magnification of 100x. Wound area at time 0 or endpoint was measured using Image-Pro Premier 9.2. Wound closure area was calculated as a percentage of the initial wound area. To minimize the effects of differences in cell growth rates, cycloheximide, which inhibits protein synthesis and blocks mitotic entry, was added to the culture medium during the wound closure period.

16. Apoptosis assay (Annexin V+)

The rate of cell apoptosis was quantitatively analyzed by performing an apoptosis assay using Annexin VFluorescein Isothiocyanate (FITC) Apoptosis Detection Kit I (BD Biosciences). Cell suspension (1 × 10 ⁶ /mL) was prepared by washing the cells twice with cold PBS. Then, 100 μL of the suspension was transferred to a tube containing 5 μL of FITC, annexin V, and propidium iodide. The mixture was gently vortexed and incubated in the dark for 15 minutes at room temperature. After incubation, 400 μL of 1X binding buffer was added before analysis using flow cytometry. FACS analysis was performed using a BD AccuriTM flow cytometer (BD Biosciences). FACS data were analyzed using FlowJo software (TreeStar, San Carlos, CA, USA).

17. Boyden chamber analysis

The Transwell system (8 μm pore size, Corning) was used for migration and invasion assays. For migration assay, 3 × 10 ⁵ cells were seeded into the upper chamber in serum-free medium. For the invasion assay, 3 x 10 ⁵ cells were inoculated into the upper chamber of a Matrigel-coated Transwell system (8 μm pore size, Corning) with serum-free medium, and the lower chamber was filled with medium supplemented with 20% fetal bovine serum.

After incubation at 37°C for 24 h, cells that migrated or invaded Matrigel through the bottom of the insert membrane were fixed, stained with crystal violet, and counted under a phase contrast microscope (Carl Zeiss, Biological Triple).

18. CRC xenograft mouse model

In vivo limiting dilution assay (LDA) was performed to compare the tumorigenic potential of disedherin-KO cells with control cells transfected with empty vector (EV). Cells were grown from male NSG mice (NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ, #005557, Jackson Laboratory, Bar Harbor, ME, USA) at various cell dilutions (50000, 10000, 5000, 1000 cells/mouse, n = 6/group). was inoculated subcutaneously. After 56 days, the incidence of tumors in mice was determined by final necropsy. LDA graphs were generated, and statistical values were calculated using online software provided by Walter+Eliza Hall Bioinformatics (http://bioinf.wehi.edu.au/softwar e/elda/).

Spleen injection experiments were performed to estimate metastasis and distant organ colonization. In this model, EV-transfected control cells or dysedherin-KO cells were tagged with luciferase and inoculated into the spleen of NSG mice followed by splenectomy (1x10 ⁶ cells/mouse). Surviving cells that emerge from the spleen and grow in distant organs will contribute to the formation of liver metastases. Liver metastases were routinely monitored weekly by visualizing luciferase activity for 33 days. After sacrifice, the liver was removed to identify and quantify liver metastases.

19. Bioinformatics analysis using open source databases

Gene expression data from an open source database (R2: Genomic Analysis and Visualization Platform, https://hgserver1.amc.nl/cgi-bin/r2/main.cgi) to compare FXYD5 mRNA expression levels between normal and tumor tissues. got it Gene set enrichment analysis (GSEA) lists of differentially expressed genes (DEGs) were obtained using the R2 platform (GSE21510 data set) comparing two groups of CRC patients (separated by median disedherin level, n = 52/group). The total DEG list (p<0.001) was applied as the ranked gene list. GSEA of ranked gene list Java implementation of GSEA obtained from http://www.broadinstitue.org/gsea/ (1,000 permutations; minimum term size: 15; maximum term size: 500, C2: all selected genes) It was carried out using Normalized enrichment scores account for differences in gene set size. The false discovery rate q-value was used to set the significance threshold.

20. RNA Sequencing and Ingenuity Pathway Analysis (IPA)

RNA-sequencing was performed to find altered gene expression signatures between disedherin-KO and control (EV-transfected) SW480 cells. Samples were prepared in biological triplicate, and RNA sequencing analysis was performed by LAS science (Seoul, Korea). mRNA sequencing libraries were prepared using the TruSeq Stranded mRNA sample preparation kit and the Illumina NextSeq platform. The list of DEGs altered in disedherin-KO SW480 cells (n = 4,437, p<0.05) was analyzed by IPA (Qiagen, Redwood City; CA, USA).

21. Identification of disedherin interacting proteins

Potential disedherin-interacting proteins were identified in total protein lysates from SW480 cells (KCB Cat# KCB 200848YJ) using M53 monoclonal antibody-based co-immunoprecipitation (co-IP). Incubation with an isotype IgG control antibody was used as a negative control. Co-IP proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and digested in the gel with trypsin. Peptide samples were purified and concentrated using a column containing C18 reversed phase resin. Peptides were confirmed by LC-MS. Raw mass spectrometry data were processed with Sorcerer 2-SEQUEST (Sage-N Research, Milpitas, CA, USA). Lists of abundant proteins in anti-dysadherin co-IP samples versus IgG control IP samples were analyzed by enrichment analysis of proteins via Top3 TICs used in the Scaffold 4 Q + S program (version 4.6.1, Proteome Software Inc., Portland, OR, USA). Obtained by measuring the degree.

22. Pull-down assay for measurement of direct protein-protein interactions

The coding sequence of wild-type or mutant forms of disedherin was synthesized by Thermo Fisher Scientific and cloned into the pET151/DTOPO vector. OE of His-tagged disedherin was achieved using E. coli grown in Luria-Bertani (LB) broth medium. Isopropyl β-D-1-thiogalactopyranoside (IPTG, 0.5mM) was added to LB broth medium to induce expression of the protein of interest, and the mixture was incubated at 37°C for 5 hours. Then, it was dissolved using RIPA buffer and purified using a Ni-NTA column (R90101, Thermo Fisher Scientific). The concentrated purified protein was measured using a BCA Protein Assay kit (Thermo Fisher Scientific), and the purified protein was measured at 10% It was separated and visualized with SDS. Purified proteins were separated on a 10% SDS-polyacrylamide gel and visualized by staining with Coomasie Brilliant Blue. Purified fibronectin protein was purchased from Sigma Aldrich.

A mixture of purified His-tagged disedherin protein (1 μg) and purified fibronectin protein (0.5 μg) was incubated with anti-His mouse monoclonal antibody (MA1-21315, Thermo Fisher Scientific) overnight at 4°C. .

Protein G agarose beads (#37478, Cell Signaling Technology, Beverly, MA, USA) were added and samples were incubated at 4°C for 6 hours. After the bead binding step, samples were centrifuged and the pellet was boiled in 3X SDS-PAGE loading buffer for protein immunoblotting. The presence of His-tagged disedherin and fibronectin proteins was confirmed by protein immunization using anti-His rabbit monoclonal antibody (#12698, Cell Signaling Technology) and anti-fibronectin rabbit polyclonal antibody (ab2413, Abcam, Cambridge, MA, USA). Determined by blot analysis. Pull-down analysis of peptides was performed using Ni-NTA agarose beads (R90101, Thermo Fisher Scientific).

His-tagged disedherin protein was purchased from Abcam (ab140573), and the peptide was synthesized by ANYGEN (Cheongju, Korea). The purity of each peptide was measured to be more than 95% by LC-MS.

A mixture of purified fibronectin protein (0.5 μg, Abcam, F2006) and His-tagged disedherin protein (2 μg) or peptide (20 μg) was incubated in 50 mM NaH PO (pH 7.4), 250 mM NaCl, and 10 mM imidazole for 1 hour on ice. time, followed by the addition of 15 μL of Ni-NTA agarose beads (R90101, Thermo Fisher Scientific) with end-to-end rotation for 1 h at 4°C. Beads were sedimented by centrifugation at 2,000 × g for 3 min and then washed five times with 500 μL of binding buffer containing 30 mM imidazole. Beads were boiled in 3X SDS-PAGE loading buffer and proteins were separated by 15% SDS-PAGE. The presence of His-tagged disedherin, disedherin peptide, and fibronectin was determined by staining with Coomassie Brilliant Blue.

23. Collagen gel contraction assay

Gel contraction by force was performed by embedding CRC cells (1 × 10 ⁶ cells) in 1 mL collagen-I to produce a final collagen I concentration of 1.5 mg/mL and seeding them in 12-well plates. When performing gel contraction assays, wells were pre-coated with 1% bovine serum albumin. Highly concentrated Corning collagen-I purified from rat tail (#354249) was used. After gelation at 37°C for 1 hour, the cells were washed once for 1 hour in regular medium and re-immersed in fresh medium. Gel shrinkage was monitored by taking pictures of the gel after 48 hours. The percentage of gel shrinkage was quantified using the following formula: Percentage gel shrinkage = 100 x ((well area-gel area)/well area)). To normalize the data points, a shrinkage index was generated using the following formula: Shrinkage index = (percentage of gel shrinkage perturbation/percentage of gel shrinkage control). Therefore, an increase in the shrinkage index means an increase in shrinkage.

24. Statistical analysis

All results are expressed as mean ± standard error of the mean. Statistical comparisons for data from two groups were performed using Student's t-test or two-way ANOVA and Bonferroni's multiple comparison test, and statistical comparisons for three or more groups were performed using one-way ANOVA and Dunnett's multiple comparison test. GraphPad Prism (GraphPad Software Inc, San Diego, California, USA). The log-rank test was used for Kaplan-Meier analysis using SPSS version 21.0 (IBM Corp., Armonk, NY, USA). Specific biological copy numbers are shown in the figures. Asterisks are used to indicate statistical significance. *, ** and *** indicate p<0.05, <0.01 and <0.001, respectively.

Experiment result

1. Removal of disedherin attenuates intestinal tumor formation.

To confirm the role of disedherin in intestinal tumorigenesis, disedherin-KO (Fxyd5 ^-/- ) mice were generated by deleting exons 2-7 of Fxyd5 using CRISPR/Cas9 technology ( Fig. 1A-D ). Fxyd5 ^−/− mice were viable without any discernible phenotypic differences, were born at Mendelian proportions ( Fig. 1E ), and showed no intestinal abnormalities ( Fig. 1F ). In the Apc ^Min/+ mouse model, histological evaluation of Apc ^Min/+ mice revealed dysedherin expression in epithelial cell adhesion molecule-positive (EpCAM+) epithelial cells present within intestinal tumors, but no dysedherin expression was observed. didn't Epithelial cells within normal intestine (Figure 2A). We confirmed the complete absence of dysedherin expression in the intestinal tumor epithelium of Apc ^Min/+ and Fxyd5 ^−/− mice. Disedherin deletion did not completely block intestinal tumor formation by Apc ^Min/+ but delayed tumor development, as indicated by a reduction in tumor incidence in younger mice (6 and 8 weeks of age, Figure 2B). Consistently, the number of tumors and total tumor burden in older (20-week-old) mice were significantly reduced by disedherin deletion ( Fig. 2C and Fig. 3A ). Additional histological analysis showed decreased cell proliferation and increased apoptosis in dysedherin-deficient tumor cells (Figure 3B). Approximately 6.3% of tumors in 20-week-old Apc ^Min/+ mice showed local invasion through fissures in the mucosal muscle layer. However, all tumors in Apc ^Min/+ , Fxyd5 ^−/− mice remained above the mucosal muscular layer, suggesting a noninvasive phenotype ( Fig. 3C,D ). In a mouse model of azoxymethane/dextran sulfate sodium (AOM/DSS)-induced intestinal tumorigenesis, disedherin deletion also significantly reduced both tumor number and total tumor burden (Figures 2D and 3E), which We show that disedherin expression contributes to intestinal tumorigenesis in both genetically and chemically induced intestinal cancer mouse models.

Conversely, when we examined the stromal effect in the case of disedherin depletion on tumor formation by inoculating murine intestinal tumor cells (MC38) into Fxyd5 ^+/+ and Fxyd5 ^−/− mice, we found that the physiological effect of disedherin-KO was The environment did not affect tumor seeding and growth (Figures 4A-C). Additionally, blood analysis showed no hematological differences between Fxyd5 ^+/+ and Fxyd5 ^−/− mice (Figure 4D). Although these data cannot completely rule out a potential role for disedherin in the stromal cell compartment during tumorigenesis, they suggest that further mechanistic studies should focus on the role of disedherin in tumor epithelial cells. Moreover, the majority of CRC cells are known to originate from intestinal epithelial cells of the colorectal mucosa, which acquire the advantage of clonal growth and expansion during tumor development. Therefore, to verify the effect of disedherin deficiency on the growth of tumor epithelium, intestinal tumorotypes derived from polyps of 20-week-old Apc ^Min/+ mice were cultured and disedherin expression was silenced using siRNA. First, we tested the effectiveness of siRNA targeting mouse dysedherin (siFxyd5) in MC38 cells and selected the most effective sequence (Figures 5A,B). Confirming the importance of disedherin expression during the growth of tumor epithelium, we found that disedherin silencing significantly inhibited the growth of intestinal tumor types (Figures 2E,F).

Consistent with the mouse experiments, clinical investigation of 187 patients with CRC showed increased dysedherin at both mRNA and protein levels in tumor tissue compared to matched normal tissue ( Fig. 6A,B ). Analysis of the open source genomic database (R2) further confirmed increased disedherin mRNA levels in tumors of CRC patients (Figure 7). Histopathological analysis of tissues from 123 patients with CRC confirmed that dysedherin was not expressed in normal epithelium, but its expression was increased in tumor epithelium (Figures 6C,D). The increased degree of disedherin expression in the tumor epithelium was significantly correlated with tumor T stage and recurrence (Table 9), and disedherin expression was an independent and important prognostic marker of poor clinical outcome, short OS, and RFS in CRC patients. was (Figure 6E, F).

2. Dysedherin plays a pleiotropic role in CRC cells.

The combination of increased dysadherin expression and decreased E-cadherin expression is known to reflect tumor aggressiveness and is considered a prognostic marker of poor clinical outcome in patients with a wide range of cancers. Consistent with these clinical observations, protein immunoblot analysis of a panel of human CRC cell lines showed a significant trend toward increased dysedherin expression and decreased membrane E-cadherin expression (Figure 8A). For mechanistic studies, disedherin was removed from SW480 cells, which express the highest levels of disedherin among CRC cell lines. We also overexpressed disedherin in HCT116 cells, which express the lowest levels of disedherin. Disedherin KO attenuated the growth of SW480 cells, and disedherin OE promoted the growth of HCT116 cells (Figure 8B). In clonogenic assays, disedherin KO decreased the survival potential of SW480 cells, whereas disedherin OE increased the survival potential of HCT116 cells (Figure 8C). Additionally, apoptosis was increased in disedherin deletion and decreased in disedherin OE (Figure 8D). This is consistent with previously observed results in breast cancer and liver cancer cells. Additionally, Boyden chamber assays with or without Matrigel coating revealed that disedherin OE promoted invasive and chemotactic migration of CRC cells, whereas disedherin KO suppressed these aggressive phenotypes ( Figures 8E,F ). . Next, we investigated the in vivo function of disedherin in a CRC xenograft mouse model. Limiting dilution analysis confirmed a decrease in the tumor-initiating potential of CRC cells upon disedherin deletion (Figure 6G). These results reflect that dysedherin plays an important role in determining the tumorigenic capacity of CRC cells, as observed in genetically and chemically induced CRC mouse models (Figures 2B-D). Additionally, in the spleen injection mouse model, we confirmed that dysedherin deficiency reduced the metastatic potential of CRC cells injected into the liver (Figure 2H). Collectively, these data suggest that dysedherin expression is required for various processes in CRC cells, including growth, survival, migration, and invasion.

3. The ECM-integrin pathway is the major disedherin signaling pathway.

To gain more mechanistic insights, we compared gene expression profiles of tumors with higher dysedherin expression (dysedherin ^high ) and lower dysedherin expression (dysedherin ^low ) in 104 CRC patients (GSE21510). did. The list of differentially expressed genes in disedherin ^high tumors was subjected to GSEA (Figure 9A). Malignant gene signatures associated with poor clinical outcome, metastases, and migratory clusters were significantly enriched in dysedherin ^high tumors (Figure 9B). Gene signatures related to ECM organization, ECM regulators, and ECM receptor pathways such as integrin signaling were also significantly upregulated in dysedherin ^high tumors (Figure 9C). Consistent with clinical data, GSEA of RNA sequencing data from disedherin-KO SW480 cells (n = 4,437, p < 0.05) was indicated by an enriched gene signature related to ECM organization, ECM regulators, and integrin-cell surface interactions. As shown, the link between dysedherin and the ECM receptor pathway was repeatedly confirmed (Figure 10A). Next, we explored potential molecular networks involved in the relationship between disedherin and ECM receptor pathways by Ingenuity Pathway Analysis of differentially expressed genes in disedherin-KO SW480 cells. The data showed which diseases and functions were most affected by disedherin KO (Figure 9D). As expected, cancer was the disease most affected by disedherin KO, which led to a strong reduction in tumor frequency, tumor incidence, and malignant tumor development (Figure 10B). Analysis of upstream regulators suggests that this reduction in cancer-related functions is probably regulated by a set of integrin signaling target genes (Figure 10C).

Validation using CRC cells confirmed that integrin target gene expression tended to decrease in disedherin KO and increase in disedherin OE. Next, integrin activation was assessed by immunofluorescence staining using an antibody that specifically recognizes the active form of β1 integrin (clone 12G10). The extent of active β1 integrin was significantly reduced by disedherin KO but increased by disedherin OE (Figure 10D,E). Using an antibody that specifically recognizes the active form of murine β1 integrin (clone 9EG7), Apc ^Min/+ showed a significant reduction in β1 integrin activation in the absence of disedherin (Figure 10F); Fxyd5 ^−/− mice and Apc ^Min/+ ; In intestinal tumors of Fxyd5 ^+/+ mice, we confirmed the role of disedherin in regulating β1 integrin activation. Collectively, this comprehensive analysis suggests the possible involvement of ECM-integrin signaling in disedherin-mediated intestinal tumorigenesis.

4. Disedherin binds directly to fibronectin through its extracellular domain.

To identify the downstream mechanisms by which disedherin regulates intestinal tumorigenesis, potential disedherin-interacting proteins in SW480 cell extracts were co-IPed with a monoclonal anti-disedherin antibody (M53) via LC-MS. Confirmed through . A total of 301 proteins were pulled down with the M53 antibody and identified as potential disedherin interacting proteins (Figure 11A). Gene ontology analysis using DAVID, a web-based functional annotation platform, showed that ECM proteins constitute one of the top clusters of disedherin-interacting proteins. In particular, among ECM proteins, fibronectin is known to act as a ligand for various integrin receptors and connect ECM to intracellular signaling cascades. Fibronectin was significantly abundant among anti-disadherin and co-IPed proteins (Table 10).

Therefore, we performed further investigation into the potential interaction between disedherin and fibronectin. Protein immunoblot analysis of anti-disedherin co-IP samples confirmed disedherin-fibronectin interaction in SW480 cells (Figure 12A). Additionally, the amount of disedherin-bound fibronectin increased when exogenous fibronectin was added prior to anti-disedherin co-IP. Disedherin-fibronectin interaction was reduced by disedherin KO in SW480 cells and increased by disedherin OE in HCT116 cells (Figure 12B).

To gain further insight into the above phenomenon, we compared the amount of fibronectin in the secretome of total cellular protein extracts, membrane fraction extracts, culture media, and mRNA transcripts in disedherin-KO and disedherin-OE CRC cells (Figure 12C). Disadherin-induced changes in fibronectin protein levels were not due to changes in mRNA or secreted protein levels. Rather, membrane-bound fibronectin decreased in disedherin KO and increased in disedherin OE, suggesting that disedherin-fibronectin interactions enrich fibronectin in the cell membrane. Accordingly, fibronectin became more abundant in CRC cell protein extracts over time.

Disadherin is a membrane protein composed of a short C-terminal cytoplasmic tail, a transmembrane domain, and a long extracellular domain. This unusually long extracellular domain may facilitate interactions with other membrane proteins or ECM components, resulting in alterations in signaling dynamics. Therefore, we generated purified recombinant His-tagged disedherin protein to further investigate the interaction between disedherin and fibronectin (Figure 11B). Two mutant forms of disedherin were generated (Figure 12D): one lacking the extracellular N-terminal sequence (amino acids 22-135, ΔN-mutant) and the other lacking the intracellular C-terminal sequence (amino acids 22-135, ΔN-mutant). 165-178, ΔC-mutant). Pull-down analysis of this purified His-tagged protein verifies direct binding of disedherin to fibronectin. The ΔC-mutant was still able to bind fibronectin, but the ΔN-mutant lost the ability to bind fibronectin (Figure 12E). Next, we generated HCT116 cell lines overexpressing three different forms of disedherin coupled to the His tag: full-length, ΔN-mutant, or ΔC-mutant (Figure 11C). IF showed binding of fibronectin to full-length disedherin and the ΔC-mutant form as indicated by co-localization of fibronectin and disedherin in the cell membrane, but the ΔN-mutant form did not interact with fibronectin at the cellular level. (Figure 11D).

In further analysis, to search for specific amino acid sequences involved in disedherin-fibronectin binding, we synthesized several His-tagged peptides that mimicked the amino acid sequences of disedherin found in several different regions of the extracellular domain (Figure 12b). . Then, a pull-down assay was performed with purified fibronectin. Peptide N#4 (amino acids 54-74, SEQ ID NO: 2), #5 (amino acids 64-84, SEQ ID NO: 3), #6 (amino acids 75-94, SEQ ID NO: 4), #8 (96-115, SEQ ID NO: 6) and #9 (amino acids 106-125, SEQ ID NO: 7) exhibit fibronectin binding activity, while N#1 (amino acids 22-42), #2 (amino acids 33-52), and #3 (amino acids 43-63) , #10 (amino acids 116-135) and #11 (amino acids 126-145) were found to be otherwise (Figure 12c).

Furthermore, according to these results, among the experimental results of peptides N#1, 2, 5, 8, and 11, only N#5 and 8 showed selective cytotoxicity against SW480, PLC/PRF/5, and MDA-MB-231 cells. , showed limited effect on disedherin KO cells (Figure 12d). The above results suggest that the intermediate sequence within the extracellular domain of disedherin is important for its binding activity to fibronectin.

Disedherin KO significantly reduced cell membrane fibronectin in SW480 cells (Figure 11E). Consistent with these in vitro data, fibronectin is Apc ^Min/+ ; Fxyd5 ^+/+ was significantly enriched in the membranes of disedherin-expressing tumor cells in mouse intestinal tumors, and enrichment of fibronectin was significantly reduced in disedherin-deficient mouse tumors (Figure 11F). These results suggest that disedherin and fibronectin interact in tumor cells and that the extracellular domain of disedherin is a key regulatory element involved in fibronectin binding.

5. Disadherin-fibronectin interaction promotes sustained activation of the fibronectin-integrin-FAK axis.

Fibronectin is a major ECM component that mediates diverse cellular interactions with the ECM and plays pleiotropic roles in various processes of cancer, such as cancer cell growth, migration, and invasion. Additionally, fibronectin is an adhesive glycoprotein primarily involved in cell adhesive interactions. Therefore, we investigated whether disedherin expression affects fibronectin-mediated cell adhesion. First, we compared the adhesion of disedherin-OE HCT116 cells on various ECM protein coatings. A trend was observed for all ECM proteins tested (fibronectin, laminin, and collagen type I) to have greater adhesion with increasing concentration, with dysedherin OE enhancing HCT116 cell adhesion in fibronectin-coated conditions (Figure 13A). . Similarly, disedherin KO reduced the ability of SW480 cells to adhere to fibronectin without affecting their ability to adhere to laminin or collagen type I (Figure 13B), suggesting that disedherin is involved in cell-fibronectin adhesion. suggests a specific role.

Fibronectin serves as a ligand for numerous integrins, activating the focal adhesion kinase (FAK) signaling pathway through autophosphorylation of FAK at tyrosine 397 (Y397). Therefore, we investigated the potential relationship between dysedherin and the fibronectin-integrin-FAK pathway with cell adhesion on exogenous fibronectin-coated culture plates. Consistent with the adhesion assay, disedherin-OE HCT116 cells showed a higher adhesion phenotype in fibronectin-coated conditions than control cells, with increased cell spreading, polymerized F-actin at protrusions, and more distinct spike-like filopodia. (spike-like filopodia) and intercellular filaments and increased FAK phosphorylation (p-FAK, Figure 14A), and dysedherin-KO SW480 cells showed a lower adhesion phenotype with a decrease in p-FAK (Figure 14A). Figure 13C). Consistently, p-FAK was elevated in dysedherin-positive cells within intestinal tumors of Apc ^Min/+ /Fxyd5 ^+/+ mice, and this increase in p-FAK was significantly reduced by disedherin deletion (Figure 14B) . Protein immunoblot analysis of SW480 cells showed that p-FAK was induced by cell adhesion to fibronectin. However, the level of p-FAK was significantly reduced by disedherin KO (Figure 14C). In HCT116 cells, disedherin OE enhanced p-FAK levels after cells adhered to fibronectin (Figure 14D). In these experiments, we found that deletion of the extracellular domain of disedherin (ΔN-mutant) abolished the effect of disedherin on FAK activation during cell adhesion to fibronectin.

Because we observed fibronectin secretion and adhesion to CRC cell membranes over 4 days of in vitro culture (Figure 12C), we next investigated the potential effect of disedherin on endogenous FAK activation status. Protein immunoblot analysis of CRC cells cultured for 4 days showed that endogenous p-FAK levels were attenuated or enhanced by disedherin KO or OE, respectively (Figures 14E,F). In these experiments, we repeatedly observed that OE of ΔN-mutant disedherin did not increase FAK activation, indicating that the role of the extracellular domain of disedherin in FAK activation is essential. Next, to determine whether fibronectin was involved in the disedherin-mediated increase in FAK activation, fibronectin expression was silenced in both wild-type and disedherin-OE HCT116 cells (Figure 13D,E). The results showed that fibronectin silencing reduced the disedherin-induced increase in p-FAK levels (Figure 13F), suggesting that fibronectin mediates disedherin-induced FAK activation. Collectively, these data provide evidence that disedherin-fibronectin interaction through the extracellular domain of disedherin contributes to sustained activation of the fibronectin-integrin-FAK axis in CRC cells.

6. Inhibition of the disedherin-fibronectin-FAK axis weakens the protumor activity of disedherin.

To investigate whether disedherin-fibronectin interaction and subsequent FAK activation are important for disedherin-mediated protumor activation, we disrupted the disedherin-fibronectin-FAK axis in three different ways and observed the effects on various cellular functions. We investigated: CRC growth, CRC cell survival and migration, and invasion.

First, we used disedherin with the extracellular domain deleted (ΔN-mutant) to investigate whether the fibronectin-binding domain is a key regulatory element mediating the biological functions of disedherin. Second, by inhibiting fibronectin expression, we determined whether fibronectin binding mediates a critical step in disedherin function. Finally, cells were treated with the FAK inhibitor VS-4718 to investigate whether the biological function of disedherin depends on FAK activation. In the context of CRC growth, deletion of the fibronectin binding domain (ΔN-mutant) blocked disedherin-induced tumor growth promotion (Figure 15A). In particular, fibronectin knockdown and FAK inhibition reduced disedherin-induced CRC growth and also attenuated the growth of wild-type HCT116 cells (Figure 15B). These results are consistent with the FAK activation status shown in Figures S9F and 10C, showing that both fibronectin knockdown and treatment with VS-4718 reduced basal p-FAK levels. Similarly, disruption of the disedherin-fibronectin interaction by removal of the extracellular domain of disedherin (ΔN-mutant) inhibited disedherin-induced increases in CRC survival, migration, and invasion (Figure 14G ,H and 15D). This disedherin-induced aggressive phenotype was attenuated by fibronectin knockdown or FAK inhibition (Figure 15D-F). Collectively, these results suggest that the fibronectin-integrin-FAK pathway is a key mechanism in dysedherin-induced intestinal tumorigenesis. Consistently, IF staining of CRC tissue from patients revealed that the levels of fibronectin and p-FAK within the tumor epithelium were significantly increased in dysedherin ^high tumors compared to dysedherin ^low tumors (Figure 15G).

7. Disedherin transduces mechanical force and promotes YAP signaling activation.

During cell adhesion, the integrin-FAK axis of focal adhesions (FA) integrates biomechanical signals by linking the ECM with the actin cytoskeleton to generate mechanical forces in the cell, which promote reciprocal ECM remodeling. Therefore, we sought to determine whether disedherin acts as a regulator of mechanical force. Collagen gel contraction assay has been used as a classic tool in the field of mechanobiology to study cell-induced contraction of ECM, which plays an important role in tumor progression and attack. This assay was used to analyze the extent of gel shrinkage for disedherin OE and KO. Disedherin OE significantly increased gel contraction compared to control transfected cells, whereas disedherin KO decreased the extent of gel contraction (Figure 16A). In accordance with these data, we also confirmed that disedherin expression is a positive regulator of cytoskeletal tension, manifested by an increase or decrease in F-actin stress fibers for disedherin OE or KO, respectively (Figure 17). These data suggest that disedherin generates mechanical forces in cells. To determine whether mechanical forces caused by disedherin activate downstream biochemical signals, we visualized signal transduction, such as FA assembly and yes-associated protein 1 (YAP) activation. FA assembly was visualized by staining for the FA adapter protein paxillin.

In this experiment, a hydrogel with a defined elastic modulus was used as a positive control for mechanical force. As a result, disedherin-OE cells showed larger cell spreading areas and more FA assemblies, similar to how cells grown on stiff hydrogels (12 kPa) showed greater cell spreading and FA assemblies than cells grown on soft hydrogels (0.5 kPa). It exhibited large size and FA (Figure 16B). Consistently, the nuclear translocation of YAP was upregulated in cells grown on stiff hydrogels, confirming that mechanical stress enhances YAP signaling activation. In accordance with these results, disedherin OE significantly increased the nuclear YAP ratio during cell attachment to fibronectin, whereas disedherin KO decreased it (Figure 16C). Moreover, verification using CRC cells confirmed that YAP target gene expression increased in disedherin OE and tended to decrease upon disedherin deletion (Figure 16D), and protein immunoblot showed that disedherin OE was deleted. It was confirmed that activation of YAP is promoted by phosphorylation (Figure 18). Collectively, these data suggest that disedherin promotes cell adhesion to fibronectin, translating mechanical forces into biochemical signals within the cell (Figure 6E).

Claims (9)

A peptide consisting of at least part of the sequence of SEQ ID NO: 1, wherein the part is 5 aa or more in length.
The peptide of claim 1, wherein the portion is at least 10 aa in length.
The peptide according to claim 1, which consists of any one of SEQ ID NOs: 2 to 7.
A pharmaceutical composition for preventing or treating cancer, comprising at least a portion of the sequence of SEQ ID NO: 1, wherein the portion includes a peptide with a length of 5 aa or more.
The pharmaceutical composition for preventing or treating cancer according to claim 4, wherein the portion is 10 aa or more in length.
The pharmaceutical composition for preventing or treating cancer according to claim 4, wherein the peptide comprises a sequence selected from the group consisting of SEQ ID NOs: 2 to 7.
The pharmaceutical composition for preventing or treating cancer according to claim 4, wherein the peptide consists of the sequence of SEQ ID NO: 2 or 5.
The method of claim 4, wherein the cancer is colon cancer, breast cancer, colon cancer, small intestine cancer, rectal cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, penile cancer, urethra cancer, ureter cancer, renal pelvis cancer, esophagus cancer, laryngeal cancer, stomach cancer, and gastrointestinal cancer. , skin cancer, keratoacanthoma, follicular carcinoma, melanoma, lung cancer, small cell lung carcinoma, non-small cell lung carcinoma (NSCLC), lung adenocarcinoma, squamous cell carcinoma of the lung, pancreatic cancer, thyroid cancer, papillary cancer, bladder cancer, liver cancer, bile duct cancer, bone cancer. , hair cell cancer, oral cancer, lip cancer, tongue cancer, salivary gland cancer, pharynx cancer, kidney cancer, prostate cancer, vulva cancer, thyroid cancer, endometrial cancer, uterine cancer, brain cancer, central nervous system cancer, peritoneal cancer, hepatocellular cancer, Hodgkin's or Pharmaceutical composition for preventing or treating leukemia or cancer.
The pharmaceutical composition for preventing or treating cancer according to claim 4, wherein the cancer is colon cancer, liver cancer, or breast cancer.