KR20230153258A - Composition for preventing or treating coronavirus infectious disease comprising hotspot-oriented peptide-nucleic acids hybrid - Google Patents

Abstract

The present invention relates to a composition for preventing or treating coronavirus infection, including a hotspot-derived peptide-nucleic acid hybrid molecule. It was confirmed that the in vitro evolution-based hotspot-derived peptide-nucleic acid hybrid molecule produced through the production method of the present invention has high binding affinity to the RBD of SARS-CoV-2 VOC (alpha, beta, gamma, delta, and omicron). In particular, it was confirmed that Omicron, which had the greatest variation, showed the greatest binding resistance. In addition, it was confirmed that the hybrid molecule had high RBD binding affinity even in competition with RBD-binding nucleic acid aptamers, macrocyclic peptides, and monoclonal antibodies. In addition, it showed excellent nuclease resistance and serum stability, showing excellent potential as a virus neutralizing agent not only for SARS-CoV-2.

Description

Composition for preventing or treating coronavirus infectious disease comprising hotspot-oriented peptide-nucleic acids hybrid}

The present invention relates to a composition for preventing or treating coronavirus infection, including a hotspot-derived peptide-nucleic acid hybrid molecule.

When infection occurs, many viruses specifically recognize membrane proteins during entry into host cells. For example, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is covered with thousands of spike proteins and binds strongly to the membrane receptor human angiotensin-converting enzyme 2 (hACE2), resulting in membrane fusion. Viruses, including SARS-CoV-2, mutate to increase transmissibility, enhancing viral transmissibility over time and causing immune evasion. Since SARS-CoV-2 was first reported in 2019, many variants have emerged, with alpha (B.1.1.7), beta (B.1.351), and gamma (P) variants of concern (VOC). .1), Delta (B.1.617.2), and Omicron (B.1.1.529) occurred independently on different continents. The receptor binding domain (RBD) of the spike protein, which contributes to specific hACE2 recognition, is known to contain many common mutations. In particular, some positional mutations located in binding hotspots (e.g. N501Y) were found to increase the binding affinity of RBD to the target hACE2, thereby increasing the infectivity of SARS-CoV-2.

The frequent occurrence of variants can be a major obstacle to antiviral prevention and treatment research. The use of affinity reagents can be an effective way to avoid viral infection by blocking specific interactions between the virus and host cells. A number of neutralizing affinity reagents have been developed for SARS-CoV-2 to recognize various epitopes of the spike protein, some of which are known to partially overlap with the hACE2 contact surface. However, because avoidance mutations cause structural changes in the spike protein, the affinity reagent cannot specifically recognize the binding site, which inevitably reduces neutralization efficacy. Alternatively, non-competitive affinity reagents can be administered together, and the US Food and Drug Administration (FDA) has issued emergency use authorization for antibody cocktails such as REGN-COV2 due to the rapid emergence of SARS-CoV-2 variants. By accumulating escape mutations, viral variants tend to have stronger binding interactions with host cell receptors and become more resistant to antibody mixtures. Therefore, an effective and efficient neutralizing agent must be developed by considering binding resistance to variants along with high affinity for the target virus.

Republic of Korea Patent Publication No. 10-2482994

Accordingly, the present inventors, inspired by the improved receptor recognition of virus variants, invented a new creation of a receptor-mimicking synthetic reagent that can strongly interact with the target virus and its variants. Specifically, we focused on peptide motifs of host cell receptors that contribute significantly to the binding free energy at the center of the virus-receptor interface. Without a stable but insoluble transmembrane domain, short hotspot peptides cannot maintain optimal binding ability to target viruses. In this process, it was synergistically integrated with a soluble nucleic acid that could act not only as a structural stabilizer but also as a binding cooperator. Hybrid ligands can be easily prepared by selectively isolating and amplifying aptamer-like scaffolds that maximize hotspot interactions from numerous hotspot peptide-binding random nucleic acids (~10 ¹⁴ ), which can lead to strong binding to viral variants.

Additionally, the present inventors successfully created an hACE2 receptor mimic hybrid ligand that directly interacts with the hotspot of SARS-CoV-2. The synergistic interaction between the hotspot peptide and the aptamer scaffold efficiently blocked SARS-CoV-2 by binding to the RBD more effectively than reported affinity reagents (e.g., peptides, aptamers, or neutralizing antibodies). In addition, the present invention was completed by confirming that the hotspot binding hACE2 mimetic had no change in binding ability and maintained binding resistance when recognizing various SARS-CoV-2 variants (Alpha, Beta, Gamma, Delta, Omicron). .

Therefore, the object of the present invention is a composition for preventing or treating coronavirus infection, comprising a peptide-nucleic acid hybrid molecule,

The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,

The nucleic acid provides a composition for preventing or treating coronavirus infection, which includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.

Another object of the present invention is to provide a composition for preventing or treating coronavirus infection, comprising a peptide-nucleic acid hybrid molecule prepared by a method comprising the following steps:

(a) preparing a peptide-nucleic acid hybrid by site-specific combining a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15 and a random nucleic acid library;

(b) mixing and cultivating the target protein-coated magnetic beads and the peptide-nucleic acid hybrid of step (a); and

(c) Selecting peptide-nucleic acid hybrid molecules that bind to the target protein using a magnet.

Another object of the present invention is a quasi-drug composition for preventing or suppressing coronavirus infection, comprising a peptide-nucleic acid hybrid molecule,

The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,

The nucleic acid provides a quasi-drug composition for preventing or suppressing coronavirus infection, which includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.

Another object of the present invention is to provide an antiviral composition against coronavirus, comprising a peptide-nucleic acid hybrid molecule,

The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,

The aim is to provide an antiviral composition against coronavirus, wherein the nucleic acid includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.

Another object of the present invention is a composition for neutralizing coronaviruses, comprising a peptide-nucleic acid hybrid molecule,

The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,

The aim is to provide a composition for neutralizing coronavirus, wherein the nucleic acid includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.

However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below. There will be.

The terms used herein are for descriptive purposes only and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, terms such as “comprise” or “have” are intended to designate the presence of features, numbers, steps, operations, components, parts, or combinations thereof described in the specification, but are not intended to indicate the presence of one or more other features. It should be understood that this does not exclude in advance the possibility of the existence or addition of elements, numbers, steps, operations, components, parts, or combinations thereof.

Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by a person of ordinary skill in the technical field to which the embodiments belong. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related technology, and unless explicitly defined in the present application, should not be interpreted in an ideal or excessively formal sense. No.

Hereinafter, the present invention will be described in more detail.

The present invention is a composition for preventing or treating coronavirus infection, comprising a peptide-nucleic acid hybrid molecule,

The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,

The nucleic acid provides a composition for preventing or treating coronavirus infection, wherein the nucleic acid includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.

In the present invention, the peptide-nucleic acid hybrid molecule can be prepared through the following method, but is not limited to this:

(a) preparing a peptide-nucleic acid hybrid by site-specific combining a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15 and a random nucleic acid library;

(b) mixing and cultivating the target protein-coated magnetic beads and the peptide-nucleic acid hybrid of step (a); and

(c) Selecting peptide-nucleic acid hybrid molecules that bind to the target protein using a magnet.

Additionally, the method may further include, but is not limited to, the following steps:

(d) selectively amplifying and replicating the nucleic acid portion of the peptide-nucleic acid hybrid molecule selected in step (c);

(e) purifying the double-stranded DNA produced in step (d) into single-stranded DNA using nucleic acid hydrolase; and

(f) preparing a new random nucleic acid library composed of the single-stranded DNA of step (e) and repeating the selection, amplification, and purification processes of steps (a) to (f).

In the present invention, the hotspot-derived peptide refers to a peptide residue that is believed to be highly related to binding between a target protein and its receptor. The hotspot-derived peptide may be an amino acid in the binding site between the target protein and its receptor, and may include all or part of the amino acids involved in the binding site in the target protein sequence; Alternatively, it may be all or part of the amino acids involved in the binding site in the receptor sequence. In the present invention, an hACE2-derived hotspot peptide or an hACE2-derived RBD-binding peptide was used as a preferred embodiment of the hotspot-derived peptide. Specifically, among the RBD contact residues of hACE2, 7 from L351 to R357 (LGKGDFR, SEQ ID NO. 15) A dog amino acid fragment was used as a hotspot-derived peptide, and the hotspot-derived peptide may include a sequence having 80%, 85%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 15, but is limited thereto. It doesn't work.

In the present invention, the peptide-nucleic acid hybrid molecule can bind to the receptor binding domain (RBD) of the spike protein of the coronavirus. In addition, the peptide-nucleic acid hybrid molecule can exhibit excellent binding affinity to RBD even in competition with RBD binding affinity reagents, and can exhibit excellent binding affinity even when mutations occur in the binding site (RBD) of the spike protein. Therefore, the peptide-nucleic acid hybrid molecule can inhibit the interaction between the RBD of the coronavirus and the hACE2 (human angiotensin-converting enzyme 2) receptor, neutralize the coronavirus, and reduce the VOC (variant of concern) of the coronavirus. It can also be neutralized, but is not limited to this.

In the present invention, the RBD may be wild type (SEQ ID NO. 23) or mutant, and the mutations include N501Y, E484K, K417N, K417T, T478K, L452R, E484A, G339D, S371L, S373P, S375F, N440K, S477N, G446S. , Q493R, G496S, Q498R, and Y505H, but is not limited thereto.

[ RBD Sequence: SARS- CoV [319-537] amino acid sequence among -2 spike proteins]

319 - rv qptesivrfp nitnlcpf g e vfnatrfasv yawnrkrisn cvadysvlyn s a s f s tfkcy gvsptklndl cftnvyadsf virgdevrqi apgqtg k iad ynyklpddft gcviawnsn n ldskv g gnyn y l yrlfrksn lkpferdist eiy qag st pc ngv e gfncyf pl q sy g f q pt n gvg y qpyrv vvlsfellha patvcgpkks tnlvknk - 537 (SEQ ID NO: 23)

In the present invention, the peptide-nucleic acid hybrid molecule may satisfy the characteristics of nuclease resistance or serum stability, but is not limited thereto. Additionally, peptide-nucleic acid hybrid molecules can be administered through various administration routes depending on the therapeutic purpose and formulation method. For example, oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, intrarectal injection, intravaginal injection, ocular administration, ear administration, nasal administration. It may be administered by administration, inhalation, spray through the mouth or nose, dermal administration, or transdermal administration, but is preferably administered intravenously or through the respiratory tract, but is not limited thereto. Additionally, the peptide-nucleic acid hybrid molecule may be, but is not limited to, a hybrid ligand, a hotspot peptide binding aptamer scaffold, a receptor-mimetic hybrid ligand, or an hACE2-mimetic hybrid ligand.

In the present invention, the nucleic acid can be used to prepare a peptide-nucleic acid hybrid molecule by combining with a hotspot-derived peptide through a click reaction. Additionally, the nucleic acid can be isolated in vitro by repeated cycles of selection and amplification from numerous other nucleic acid libraries site-specifically linked to the hotspot peptide, and converted into a peptide-nucleic acid hybrid molecule through repeated cycles of selection and amplification to obtain a higher molecular weight. Nucleic acids that can provide binding capacity can be selected. In addition, the nucleic acid can increase the binding force and solubility of the binding site (RBD) between the spike protein and its receptor of the peptide-nucleic acid hybrid molecule, and can structurally stabilize the hACE2-derived RBD binding peptide. In addition, the nucleic acid may include one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20, and the nucleic acid may be selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20. It may include, but is not limited to, a sequence having 80%, 85%, 90%, 95%, 99%, or 100% identity with the selected base sequence. Additionally, the nucleic acid may be hexynyl modified ssDNA, an aptamer scaffold, or a hotspot peptide-supported aptamer scaffold, but is not limited thereto.

In the present invention, an aptamer scaffold refers to a nucleic acid that combines two or more molecules to bind the molecules into a functional unit and can specifically and strongly bind to a specific molecule. In one embodiment of the present invention, also called a peptide-supported aptamer scaffold, it has a virus neutralizing function by combining with a hotspot-derived peptide, and the hybrid molecule of the peptide and the aptamer scaffold can bind to the spike protein.

In the present invention, the coronavirus is human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), severe acute respiratory syndrome coronavirus (SARS-CoV), human coronavirus NL63 (HCoV-NL63, New Haven coronavirus), human coronavirus HKU1, Middle East respiratory syndrome coronavirus (MERS-CoV), severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2), and variants thereof. In addition, the variant of SARS-Cov-2 may be any one selected from the group consisting of alpha (α), beta (β), gamma (γ), delta (δ), and omicron (ο) variants. Not limited.

In the present invention, “coronavirus” corresponds to a species of the virus genus included in the Nidovirus order, Coronaviridae, Coronaviridae, or Torovirinae. Coronaviruses are viruses enveloped in +ssRNA and a helical symmetric nucleopeside. Additionally, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the seventh coronavirus to infect humans so far, the others being human coronavirus 229E (HCoV-229E) and human coronavirus OC43 (HCoV-OC43). , severe acute respiratory syndrome coronavirus (SARS-CoV), human coronavirus NL63 (HCoV-NL63, New Haven coronavirus), human coronavirus HKU1, and Middle East respiratory syndrome coronavirus (MERS-CoV). The proteins that contribute to the overall structure of coronaviruses are the spike, envelope, and nucleocapsid. In the case of the SARS coronavirus, a defined binding receptor domain on the spike (S) mediates attachment of the virus to its cellular receptor, angiotensin-converting enzyme 2 (ACE2). Some coronaviruses (particularly members of the betacoronavirus subgroup) also have short spike-like proteins called antibody esterases. Coronaviruses can cause viral pneumonia or secondary bacterial pneumonia, and can also cause direct viral bronchitis or secondary bacterial bronchitis. The human coronavirus discovered in 2003 is severe acute respiratory syndrome coronavirus (SARS-CoV), which causes upper and lower respiratory tract infections.

Additionally, in the present invention, the term "SARS-CoV-2" used refers to a new coronavirus, which is an RNA virus and represents a variant of SARS and MERS. SARS-CoV-2 shares approximately 79.7% sequence identity with SARS and approximately 50% with MERS. However, in contrast to SARS and MERS, the spike glycoprotein of 2019-nCoV forms a structure with one RBD domain protruding upward, which causes it to interact with the target receptor, ACE2 (angiotensin). It exhibits a binding force that is 100 to 1,000 times stronger. This strong binding force makes it easier to penetrate into cells and increases infectiousness.

) 변이종은 2021년 11월 다수 국가에서 발견된 것으로, 계통 분류체계는 B.1.1.529이다.Additionally, in the present invention, the variant of severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2) has the same meaning as the variant COVID-19 virus. The above mutant viruses are divided into major mutant viruses (VOC, Variant of Concern) and other mutant viruses (VOI, Variant of Interest), and to prevent the use of names of regional origin and to facilitate communication, the Greek alphabet (alpha, beta, Mutant viruses are named (gamma, etc.). The above-mentioned major mutant viruses refer to mutant viruses that have been confirmed to have increased transmissibility or negative epidemiological changes, increased pathogenicity or clinically confirmed changes in disease severity, or reduced effectiveness of diagnostics, vaccines, and treatments. Currently, VOC is an omicron variant, and in the past, there were alpha, beta, gamma, and delta variants. Specifically, the alpha (α) variant of SARS-Cov-2 was discovered in the UK in September 2020, and its classification system is B.1.1.7. In addition, the beta (β) variant of SARS-Cov-2 was discovered in South Africa in May 2020, and its classification system is B.1.351. In addition, the gamma (γ) variant of SARS-Cov-2 was discovered in Brazil in November 2020, and its classification system is P.1. In addition, the delta (δ) variant of SARS-Cov-2 was discovered in India in October 2020, and its classification system is B.1.617.2. In addition, the omicron of SARS-Cov-2 (

) The variant was discovered in multiple countries in November 2021, and its lineage classification system is B.1.1.529.

In the present invention, the coronavirus infection may be a coronavirus respiratory infection disease. The above viral respiratory infectious diseases include coughing, sneezing, headache, nasal congestion, sore throat, diarrhea, discoloration of fingers or toes, conjunctivitis, high fever, wheezing, bronchitis, bronchiolitis, pneumonia, asthma, loss of smell and taste, and respiratory failure. Symptoms may appear. If the coronavirus is Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-Cov-2), the main symptoms are fever and respiratory symptoms (cough, sore throat, difficulty breathing), along with headache, muscle pain, hemoptysis, and nausea. Symptoms may include chills, chest pain, and diarrhea. Additionally, the coronavirus infection may be coronavirus disease 19 (COVID-19).

The present invention provides a composition for preventing or treating coronavirus infection, comprising a peptide-nucleic acid hybrid molecule prepared by a method comprising the following steps:

(a) preparing a peptide-nucleic acid hybrid by site-specific combining a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15 and a random nucleic acid library;

(b) mixing and cultivating the target protein-coated magnetic beads and the peptide-nucleic acid hybrid of step (a); and

(c) Selecting peptide-nucleic acid hybrid molecules that bind to the target protein using a magnet.

In the present invention, the method may further include, but is not limited to, the following steps:

(d) selectively amplifying and replicating the nucleic acid portion of the peptide-nucleic acid hybrid molecule selected in step (c);

(e) purifying the double-stranded DNA produced in step (d) into single-stranded DNA using nucleic acid hydrolase; and

(f) preparing a new random nucleic acid library composed of the single-stranded DNA of step (e) and repeating the selection, amplification, and purification processes of steps (a) to (f).

In the present invention, the method may further include the step of inducing 3D folding of the nucleic acid by heat denaturing and cooling the peptide-nucleic acid hybrid after step (a). Through this step, the hotspot peptide can be placed in the correct position and orientation, and a stable 3D aptamer scaffold can be fabricated that can maintain binding properties similar to or stronger than those of the receptor.

The step (a) is a step of preparing a peptide-nucleic acid hybrid, and the hotspot-derived peptide may be a peptide in which all functional groups that can be used in a click chemical reaction are bound to the C-terminus or N-terminus of the isolated hotspot-derived peptide, For example, Azido lysine, Azidobutanoic acid, and Azinoacetic acid, azide, hexynyl, 5-octadiynyl (5- It may be a peptide to which one or more functional groups selected from the group consisting of octadiynyl) and alkyne are bound, and preferably, it may be a peptide to which azide is bound (tagged) to the C-terminus or N-terminus, and more preferably, It may be, but is not limited to, an azide-tagged LGKGDFR (L351 to R357, SEQ ID NO: 15) peptide.

The random nucleic acid library in step (a) may be a nucleic acid in which all functional groups that can be used in click chemistry are bound to the 5' end, for example, hexynyl, 5-octadiynyl, ), alkyne, Azido lysine, Azidobutanoic acid, and Azinoacetic acid, and at least one functional group selected from the group consisting of azide is combined It includes a single-stranded nucleic acid, preferably a nucleic acid with hexynyl bound to the 5' end, but is not limited thereto. Additionally, the hotspot-derived peptide and the functional group bound to the nucleic acid library can be interchanged. Additionally, the random nucleic acid library may be characterized as containing random nucleic acids having the following structure:

5'-functional group-forward primer-[N _x ]-reverse primer-3',

The functional groups include hexynyl, 5-octadiynyl, alkyne, Azido lysine, Azidobutanoic acid, Azinoacetic acid, And selected from the group consisting of azide,

where N is A, T, C or G, and x is an integer from 25 to 100.

The length of the random nucleic acid library is minimized to precisely bind to a target protein with a diameter of 10 nm meters or less, and may be a length that satisfies the appropriateness for maximizing the diversity of the library, but specifically, the bases of the random nucleic acid library The sequence numbers are 55 to 130, 55 to 110, 55 to 90, 55 to 80, 60 to 130, 60 to 110, 60 to 90, 60 to 80, 65 to 130, 65 to 110, 65 to 90, 65 to 80. , may be 65 to 75, or 70, but is not limited thereto.

In addition, x is 25 to 100, 25 to 80, 25 to 60, 25 to 50, 30 to 100, 30 to 80, 30 to 60, 30 to 50, 35 to 100, 35 to 80, 35 to 60, 35 It may be from 50 to 50, 35 to 45, or 40, but is not limited thereto.

In a preferred embodiment of the present invention, the forward primer represented by SEQ ID NO: 1 and the reverse primer represented by SEQ ID NO: 2 were used, and the random nucleic acid library includes random nucleic acids with the following structural formula: GGAAGAGATGGCGAC-N ₄₀ - AGCTGATCTGATGG.

Selective amplification of the nucleic acid portion in step (d) is performed by adding at least one functional group selected from the group consisting of hexynyl, 5-octadiynyl, and alkyne to the 5' end. Amplification may be performed using a forward primer, but is not limited thereto. Since a functional group is attached to the forward primer, all amplified PCR products can be produced with a functional group attached to the 5' end, which allows site-specific binding through a click reaction, but is not limited to this. .

In the present invention, the hotspot-derived peptide and the single-stranded nucleic acid may be site-specifically bound by a click reaction, but are not limited thereto. The click reaction may be, but is not limited to, a reaction in which the functional group of a hotspot-derived peptide and the functional group of a nucleic acid are combined within a short period of time by chemical cross-linking or copper-catalyzed cycloaddition.

The pharmaceutical composition according to the present invention may further include appropriate carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions. The excipient may be, for example, one or more selected from the group consisting of diluents, binders, disintegrants, lubricants, adsorbents, humectants, film-coating materials, and controlled-release additives.

The pharmaceutical composition according to the present invention can be prepared as powder, granules, sustained-release granules, enteric-coated granules, solutions, eye drops, ellipsis, emulsions, suspensions, spirits, troches, perfumes, and limonadese according to conventional methods. , tablets, sustained-release tablets, enteric-coated tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric-coated capsules, pills, tinctures, soft extracts, dry extracts, liquid extracts, injections, capsules, perfusate, It can be formulated and used in the form of external preparations such as warning agents, lotions, pasta preparations, sprays, inhalants, patches, sterilized injection solutions, or aerosols, and the external preparations include creams, gels, patches, sprays, ointments, and warning agents. , it may have a dosage form such as lotion, liniment, pasta, or cataplasma.

Carriers, excipients, and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, and calcium. These include phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Additives to tablets, powders, granules, capsules, pills, and troches according to the present invention include corn starch, potato starch, wheat starch, lactose, white sugar, glucose, fructose, di-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, and phosphoric acid. Calcium monohydrogen, calcium sulfate, sodium chloride, sodium bicarbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methylcellulose, sodium carboxymethylcellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropylmethyl. Excipients such as cellulose (HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, and Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose acetate phthalate, carboxymethyl cellulose, calcium carboxymethyl cellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethyl cellulose, sodium methyl cellulose, methyl cellulose, microcrystalline cellulose, dextrin. , hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, refined shellac, starch, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl alcohol, polyvinylpyrrolidone, etc. binders can be used, Hydroxypropyl methyl cellulose, corn starch, agar powder, methyl cellulose, bentonite, hydroxypropyl starch, sodium carboxymethyl cellulose, sodium alginate, calcium carboxymethyl cellulose, calcium citrate, sodium lauryl sulfate, silicic acid anhydride, 1-hydroxy Propylcellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde-treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, Disintegrants such as amylopectin, pectin, sodium polyphosphate, ethyl cellulose, white sugar, magnesium aluminum silicate, di-sorbitol solution, light anhydrous silicic acid; Calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopodium, kaolin, petrolatum, sodium stearate, cocoa fat, sodium salicylate, magnesium salicylate, polyethylene glycol 4000, polyethylene glycol 6000, liquid paraffin, hydrogenated soybean oil. (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, Macrogol, synthetic aluminum silicate, silicic anhydride, higher fatty acids, higher alcohol, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, starch, Lubricants such as sodium chloride, sodium acetate, sodium oleate, dl-leucine, and light anhydrous silicic acid may be used.

Additives for the liquid according to the present invention include water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, sucrose monostearate, polyoxyethylene sorbitol fatty acid esters (twin esters), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, etc. can be used.

A solution of white sugar, other sugars, or sweeteners, etc. may be used in the syrup according to the present invention, and if necessary, flavoring agents, colorants, preservatives, stabilizers, suspending agents, emulsifiers, thickening agents, etc. may be used.

Purified water can be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. can be used as needed.

The suspension according to the present invention may include acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose, HPMC 1828, HPMC 2906, and HPMC 2910. Surfactants, preservatives, stabilizers, colorants, and fragrances may be used as needed.

Injections according to the present invention include distilled water for injection, 0.9% sodium chloride injection, IV solution, dextrose injection, dextrose + sodium chloride injection, PEG, lactated IV solution, ethanol, propylene glycol, non-volatile oil - sesame oil. solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristic acid, and benzene benzoate; Solubilizers such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, Tween, nicotinic acid amide, hexamine, and dimethylacetamide; Weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, and buffering agents such as gums; Isotonic agents such as sodium chloride; Stabilizers such as sodium bisulfite (NaHSO ₃ ), carbon dioxide gas, sodium metabisulfite (Na ₂ S ₂ O ₅ ), sodium sulfite (Na ₂ SO ₃ ), nitrogen gas (N ₂ ), and ethylenediaminetetraacetic acid; Sulfurizing agents such as sodium bisulfide 0.1%, sodium formaldehyde sulfoxylate, thiourea, disodium ethylenediaminetetraacetate, and acetone sodium bisulfite; Analgesics such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; It may contain suspending agents such as CM sodium, sodium alginate, Tween 80, and aluminum monostearate.

Suppositories according to the present invention include cacao oil, lanolin, witepsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, lecithin, Lanet wax, glycerol monostearate, Tween or Span, Imhausen, monolene (propylene glycol monostearate), glycerin, Adeps solidus, Buytyrum Tego -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydrocote SP, S-70-XXA, S-70-XX75(S-70-XX95), Hydro Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Massaupol, Masupol-15, Neosupostal-N, Paramound-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), suppositories type IV (AB, B, A, BC, BBG, E, BGF, C, D, 299), Supostal (N, Es), Wecobi (W, R, S, M, Fs), Tegestor triglyceride base (TG-95, MA, 57) and The same mechanism can be used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations include the extract with at least one excipient, such as starch, calcium carbonate, and sucrose. ) or prepared by mixing lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium styrate talc are also used.

Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat the disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and It can be determined based on factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the medical field.

The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art to which the present invention pertains.

The pharmaceutical composition of the present invention can be administered to an individual through various routes. All modes of administration are contemplated, including oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, intrarectal injection, vaginal injection. It can be administered by internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, etc.

The pharmaceutical composition of the present invention is determined depending on the type of drug as the active ingredient along with various related factors such as the disease to be treated, the route of administration, the patient's age, gender, weight, and severity of the disease.

In the present invention, “individual” refers to a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, cows, etc. refers to mammals of

In the present invention, “administration” means providing a given composition of the present invention to an individual by any appropriate method. In the present invention, “prevention” refers to any action that suppresses or delays the onset of the desired disease, and “treatment” refers to the improvement or improvement of the desired disease and its associated metabolic abnormalities by administration of the pharmaceutical composition according to the present invention. It refers to all actions that are beneficially changed, and “improvement” refers to all actions that reduce parameters related to the target disease, such as the degree of symptoms, by administering the composition according to the present invention.

The present invention is a quasi-drug composition for preventing or suppressing coronavirus infection, comprising a peptide-nucleic acid hybrid molecule,

The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,

The nucleic acid provides a quasi-drug composition for preventing or suppressing coronavirus infection, wherein the nucleic acid includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.

Additionally, the quasi-drugs may include external skin preparations and personal hygiene products. For example, it may be a disinfectant cleaner, shower foam, garnish, wet tissue, detergent soap, hand wash, or ointment, but is not limited thereto.

When using the quasi-drug composition according to the present invention as a quasi-drug additive, the composition can be added as is or used together with other quasi-drugs or quasi-drug components, and can be used appropriately according to conventional methods. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use.

For example, the quasi-drug composition of the present invention may be manufactured in the form of a general emulsified formulation or solubilized formulation. For example, it may have a formulation such as lotion, cream, ointment, spray, oil gel, gel, oil, aerosol, or smoke screen, but can be used without limitation as long as it exhibits the pest control inducing effect of the present invention. . In addition, the above-mentioned quasi-drug compositions are appropriately mixed with oil, water, surfactants, moisturizers, lower alcohols with 1 to 4 carbon atoms, thickeners, chelating agents, colorants, preservatives or fragrances, etc., which are generally mixed in quasi-drug compositions, in each dosage form as needed. You can use it.

The present invention is an antiviral composition against coronavirus, comprising a peptide-nucleic acid hybrid molecule,

The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,

The nucleic acid provides an antiviral composition against coronavirus, wherein the nucleic acid includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.

In the present invention, “antiviral” means suppressing the proliferation of viruses in the body to weaken or eliminate the action of viruses that have invaded the body. More specifically, it refers to the nucleic acid synthesis process, gene expression process, or It means suppressing the proliferation of viruses by inhibiting the viral replication process, etc., and the present invention targets coronaviruses.

In the present invention, the antiviral composition is human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), severe acute respiratory syndrome coronavirus (SARS-CoV), and human coronavirus NL63 (HCoV- Antiviral against human coronavirus HKU1 (NL63, New Haven coronavirus), Middle East respiratory syndrome coronavirus (MERS-CoV), and severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2 or 2019 novel coronavirus or 2019-nCoV) It can be active.

The present invention is a composition for neutralizing coronaviruses, comprising a peptide-nucleic acid hybrid molecule,

The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,

The nucleic acid provides a composition for neutralizing coronavirus, wherein the nucleic acid includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.

Hereinafter, the description of the quasi-drug composition for preventing or suppressing coronavirus infection, the antiviral composition for coronavirus, and the composition for neutralizing coronavirus can be applied in the same way as the content described in the composition for preventing or treating coronavirus infection described above. In order to avoid complexity in the description of the specification, duplicate descriptions are omitted.

It was confirmed that the in vitro evolution-based hotspot-derived peptide-nucleic acid hybrid molecule produced through the production method of the present invention has high binding affinity to the RBD of SARS-CoV-2 VOC (alpha, beta, gamma, delta, and omicron). In particular, it was confirmed that Omicron, which had the greatest variation, showed the greatest binding resistance. In addition, it was confirmed that the hybrid molecule had high RBD binding affinity even in competition with RBD-binding nucleic acid aptamers, macrocyclic peptides, and monoclonal antibodies. In addition, it showed excellent nuclease resistance and serum stability, showing excellent potential as a virus neutralizing agent not only for SARS-CoV-2.

Figure 1a shows the role of the nucleic acid scaffold in inducing stable binding between the hotspot peptide and the viral RBD.
Figure 1b shows a schematic diagram of the in vitro evolution of a receptor-mimicking hybrid ligand composed of a hotspot peptide and an aptamer scaffold.
Figure 2a shows the results of analyzing contact residues between the hACE2 receptor and SARS-CoV-2 RBD.
Figure 2b shows the N501Y mutation in RBD resulting in higher binding affinity to hACE2.
Figure 2c shows the results of quantitative evaluation of RBD binding of hotspot peptide-bound Round 7 (R7) pools (random DNA library combined with hotspot peptides (light gray), R7 ssDNA pool without hotspot peptides (dark gray), and R7 ssDNA pool combined with hotspot peptide (green).
Figure 3a shows the results of comparing the RBD binding fractions of R7-01, R7-02, R7-03, and hybrid random libraries.
Figure 3b shows the results of analyzing the RBD binding affinity characteristics of R7-02 (RBD and serum albumin coated beads (green and gray, respectively), bare beads (black)).
Figure 3c shows the results of analyzing the RBD binding affinity characteristics (K _d value) of R7-01 and R7-03.
Figure 3d shows the energy-minimized structure of R7-02 bound to RBD through molecular docking simulation (LGKGDFR peptide (red), hACE2 (white), RBD (blue), aptamer scaffold (green)).
Figures 3e and 3f show hybrid ligands co-conjugated with RBD-binding nucleic acid aptamers (CoV2-RBD-1C, CoV2-6C3, Aptamer-1), macrocyclic peptides (Peptide 4), or monoclonal antibodies (P05Dhu, AM122). The results of culturing and competitive binding analysis are shown.
Figure 3g shows the equilibrium dissociation constant K _d values of RBD-binding nucleic acid aptamers (CoV2-RBD-1C, CoV2-6C3, Aptamer-1), macrocyclic peptides (Peptide 4), or monoclonal antibodies (P05Dhu, AM122). It shows the results of the analysis.
Figure 4A shows a schematic diagram and listing of alpha, beta, gamma, delta, and omicron variants of concern (VOC).
Figure 4b shows the results of analyzing K _d values for alpha, beta, gamma, delta, and omicron VOCs of R7-02.
Figure 4c shows the results of analyzing the RBD binding fraction of R7-02 and several types of RBD binders (Aptamer-1, Peptide 4, P05DHu, and AM122) for wild type and omicron VOC.
Figure 4d shows the results of analyzing the binding fraction of R7-02 and several types of RBD binders (Aptamer-1, Peptide 4, P05DHu, and AM122) to wild-type and omicron VOCs through flow cytometry.
Figure 5a shows the inhibitory effect of RBD-hACE2 binding through ELISA (enzyme-linked immunosorbent assay) of R7-02.
Figure 5b shows the results confirming the inhibition rate of RBD-hACE2 interaction of LGKGDFR peptide, R7-02 DNA domain, R7-02, random DNA library, and hACE2.
Figure 5c shows a schematic diagram of the pseudotyped SARS-CoV-2 based neutralization assay.
Figures 5d and 5f show the results of confocal microscopy observation of pseudotype SARS-CoV-2 infected hACE2-293T (Figure 5d: LGKGDFR peptide, R7-02 DNA domain, R7-02; Figure 5f: CoV2-RBD -1C, CoV2-6C3, Aptamer-1, Peptide 4, P05Dhu, AM122).
Figures 5E and 5G show the percentage of GFP-expressing pseudotype SARS-CoV-2 infected cells relative to total hACE2-293T cells (Figure 5E: LGKGDFR peptide, R7-02 DNA domain, R7-02; Figure 5G: CoV2 -RBD-1C, CoV2-6C3, Aptamer-1, Peptide 4, P05Dhu, AM122).
Figure 5h shows the results of analyzing the nuclease stability of R7-02.

Below, preferred embodiments are presented to aid understanding of the present invention. However, the following examples are provided only to make the present invention easier to understand, and the content of the present invention is not limited by the following examples.

[Experimental method]

1. Experimental materials

DNA oligonucleotides were synthesized and purified by Bioneer (Korea). The sequences of all oligonucleotides used in the present invention are shown in Table 1 below. C-terminally-(4-azidobutanoyl(lysine))-tagged LGKGDFR peptide (with and without N-terminal FITC modification) was synthesized and purified by Peptron (Korea). EDC (1-ethyl-3-(3-365 dimethylaminopropyl) carbodiimide hydrochloride), NHS (N-hydroxysuccinimide), 1M magnesium chloride solution, human angiotensin-converting enzyme 2 (hACE2), bovine serum albumin ( bovine serum albumin (BSA), high glucose DMEM, Tween-20, dimethyl sulfoxide (DMSO), tris(3-hydroxypropyl-triazolylmethyl)amine (THPTA), and copper(II) sulfate pentahydrate were from Sigma-Aldrich. Purchased. L-Ascorbic acid sodium salt was purchased from Alfa Aesar. Lambda exonuclease enzyme and 10x Lambda exonuclease buffer were purchased from Thermo Fisher Scientific. 1M Tris-HCl (pH 7.4) was purchased from Bioneer (Korea). 10x PBS, 8M urea solution, 10x TBE, and nuclease-free purified water were purchased from T&I (Korea). 1×PBSMT was used as binding buffer (consisting of 1×PBS containing 2.5mM MgCl ₂ and 0.02% Tween-20 (v/v), pH 7.4). The SARS-CoV-2 RBDs of wild type, alpha (B.1.1.7), beta (B.1.351), gamma (P.1), and delta (B.1.617.2) were expressed and purified. SARS-CoV-2 RBD from Omicron (B.1.1.529) was purchased from Abbexa (UK). Alexa-488 labeled monoclonal RBD-binding antibody (P05DHu) and Alexa Fluor 488 microscale protein labeling kit were purchased from Invitrogen. Monoclonal RBD-binding antibody (AM122) was purchased from ACROBiosystems. A macrocyclic peptide (Peptide 4) with N-terminal chloroacetyl-modified D-tyrosine was linearly synthesized by Peptron (Korea). 1 mg of linear peptide 4 was cyclized by dissolving in 86 μL of DMSO with 3 μL of N, N-diisopropylethylamine and incubated at 60°C for 24 hours.

ID Sequence (5' → 3') sequence number Forward primer [Hexynyl]GGAAGAGAATGGCGAC One Reverse primer [Phosphate]CCATCAGGATCAGCT 2 Random library [Hexynyl]GGAAGAGATGGGCGAC-N40-AGCTGATCCTGATGG 3 (HTS sequencing) forward primer AATGATACGGCGACCACCGAGATCTACACTTGGTGAGACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNGGAAGAGATGGCGAC 4 (HTS sequencing) reverse primer CAAGCAGAAGACGGCATACGAGATGTTCAGGTCTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNCCATCAGGATCAGCT 5 R7-01
DNA domain [Hexynyl]GGAAGAGATGGCGACCTCCACAACCGCTGATCGACGCAGATCTTGTGGGTAGCTGATCCTGATGG[FAM] 6 R7-02DNA domain [Hexynyl]GGAAGAGATGGCGACACGCAATCGTGGGTTGGGGATATAATGGTA AGCTGATCCTGATGG[FAM] 7 R7-02 (TAMRA)
DNA domain [Hexynyl]GGAAGAGATGGCGACACGCAATCGTGGGTTGGGGATATAATGGTA AGCTGATCCTGATGG[TAMRA] 8 R7-03
DNA domain [Hexynyl]GGAAGAGATGGCGACCACACCAAATCTGAGTCTACCCCATGAAGGAGCTGATCCTGATGG[FAM] 9 CoV2-RBD-1C [TAMRA]CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGGCTTAATGGACA 10 CoV2-6C3 [TAMRA]CGCAGCACCCAAGAACAAGGACTGCTTAGGATTGCGATAGGTTCGG 11 Aptamer-1 core [TAMRA]TCGAGTGGCTTGTTTGTAATGTAGGGTTCCGGTCGTGGGT 12 2'-O-Methyl, 2'-F
modified R7-02 [Hexynyl]G(2'-OMe(G))(2'-OMe-(A))(2'-OMe(A))(2'-OMe(G))AGATGGCGACA CGCAATCGTGGGTTGGGGATATAATGGTAAGCTGATCCT(2'-OMe-( G))
(2'-OMe(A))(2'OMe(T))(2'-F(G))G[FAM] 13 Phosphorothioate (*)
modified R7-02 [Hexynyl]G*G*A*A*GAGATGGCGACACGCAATCGTGGGTTGGGGATATAATGGTA AGCTGATCCTG*A*T*G*G[FAM] 14

2. Azide -tag hotspot peptide ( azide -tagged hotspot peptide) and hexynyl transform ssDNA site-specific binding between

For ultra-high efficiency copper-catalyzed alkyne-azide cycloaddition, 1 μL of a 50mM copper(II) sulfate aqueous solution and 1.67 μL of a 150mM THPTA aqueous solution were mixed in advance 10 minutes before conjugation. 3 µL DMSO, 1 µL 10x PBS, 3 µL 0.1 mM aqueous hexynyl-modified ssDNA solution, 1 µL 2.5 mM azide-tagged LGKGDFR peptide, 2.67 µL premix (copper(II) sulfate and THPTA), and 500 mM aqueous sodium ascorbate solution. 1 μL (freshly prepared) was added sequentially and mixed thoroughly. The solution was shaken overnight at room temperature and purified by ethanol precipitation.

3. peptide - ssDNA Combination hybrid Check your library

The formation of the peptide-ssDNA junction was confirmed through fluorescence after conjugation with the FITC-modified-azide-tagged LGKGDFR peptide. 1 μL of reaction product (~50 ng), 7 μL of 8 M urea and 1 μL of 6x loading dye were mixed and heat denatured at 95 °C for 10 min. Denatured products were analyzed by electrophoresis on a 10% urea polyacrylamide gel at 300 V for 40 min in 1x TBE buffer and imaged with an Azure C600 (Azure Biosystems). Equal amounts of unconjugated hexynyl-modified ssDNA libraries were stained with 10,000x SYBR gold stain (Invitrogen) and imaged simultaneously.

4. HOLD (Hotspot-Oriented) Ligand Display)

The peptide-nucleic acid hybrid library was heat denatured at 95°C for 10 min and then rapidly cooled on ice to ensure the formation of the most stable 3D structure. Afterwards, the heat-treated hybrid library was incubated with RBD-coated beads for 1 hour at room temperature with gentle rotation. When preparing RBD-coated beads, the target RBD was immobilized on Dynabeads M-270 carboxylic acid (Invitrogen) via the EDC-NHS coupling process using the manufacturer's protocol, and then quantified with the NanoOrange protein quantification kit (Thermo Fisher Scientific). . After incubation, magnetic beads were washed thoroughly with 1×PBSMT to remove unbound hybrid molecules, and magnetic bead-bound hybrid ligands were selectively separated with a DynaMag-2 magnet (Invitrogen). Only the DNA domain of the isolated hybrid ligand candidate was PCR amplified using a 5'-hexinyl-modified forward primer and a 5'-phosphorylated reverse primer (Table 1 above). The optimal number of PCR cycles was determined by a pilot PCR process. The PCR-amplified dsDNA was purified using the QIAquick PCR purification kit (Qiagen) and then digested with Lambda exonuclease to generate a hexynyl-modified ssDNA pool for the next HOLD round. ssDNA was purified by phenol/chloroform extraction and ethanol precipitation and quantified by UV-vis measurement at 260 nm. To provide a hybrid library pool of the same format for each HOLD round, the click reaction between the azide-tagged LGKGDFR peptide and the purified hexynyl-modified ssDNA pool was repeated for each round of HOLD.

5. Volume dilution challenge

The volume dilution challenge (VDC) technique was used to remove unbound hybrid molecules very efficiently. After 1 hour incubation and subsequent washing of the bead-bound hybrid libraries, they were immediately diluted in increased volumes (100-500x) of 1x PBSMT and incubated for an additional 30 min, resulting in high rate dissociation constant (k _off ) values. Hybrid molecules that were easily separated during the process were removed. After VDC, beads were collected and washed three times with 200 μL 1x PBSMT.

6. High affinity hybrid DNA domain amplification to enrich for ligands

The 100 μL PCR reaction mixture contained 5 units of Taq polymerase (T&I, Korea), 0.5 μL of 0.1 mM 5'-hexynyl-modified forward primer and 5'-phosphorylated reverse primer, and 8 μL of 10 mM dNTP ( T&I, Korea), 2 μL of 10x PCR buffer (T&I, Korea), 10 μL of collected hybrid ligand, and additional nuclease-free purified water (up to 100 μL). The PCR reaction mixture was pre-denatured at 95°C for 600 seconds, followed by repeated cycles of denaturation at 95°C for 30 seconds, annealing at 51°C for 30 seconds, and extension at 72°C for 60 seconds. 5 μL of PCR mixture was collected and resolved on a 10% polyacrylamide gel to determine the optimal number of PCR amplification cycles with minimal by-products (pilot PCR). The DNA domains of the hybrid ligands collected from all rounds of HOLD were PCR amplified with an optimized number of cycles.

7. ssDNA produce

After PCR amplification, hexynyl-modified double-stranded DNAs (dsDNAs) were purified using the QIAquick PCR purification kit (Qiagen), and 2.5 μg of purified dsDNA was incubated with 5 units of lambda nuclease in 50 μL. (Thermo Fisher Scientific). After incubating the mixture for 10 min at 37 °C and 10 min at 80 °C, hexynyl-modified ssDNA was purified by phenol/chloroform extraction and ethanol precipitation and quantified by UV-vis measurement at 260 nm.

8. Relative binding analysis of the R7 pool

After 7 rounds of HOLD, the relative binding abilities of the hybrid ligand pools were compared. Equal amounts of the peptide-nucleic acid hybrid library coupled with the hotspot peptide, the R7 ssDNA pool without the hotspot peptide, and the R7 ssDNA pool coupled with the hotspot peptide were heat denatured at 95°C for 10 minutes and then rapidly cooled on ice. After heat denaturation, the beads were challenged with RBD-coated magnetic beads for 1 hour at room temperature, followed by washing three times with 1×PBSMT. The amount of RBD binding was analyzed by quantitative PCR (LightCycler 480, Roche). Each PCR reaction contained 10 μL of Light cycler 480 SYBR green I master (Roche), 0.1 μL of 0.1mM forward and reverse primers, 2 μL of RBD binding ligand, and 7 μL of nuclease-free purified water. Based on the previously obtained standard curve, the threshold period was estimated as the amount of RBD-bound ligand.

9. High-throughput sequencing

After seven rounds of selection, the enriched pool was PCR amplified with forward and reverse primers containing adapter sequences, and the optimized number of PCR cycles was determined by pilot PCR. These PCR products were purified using a gel extraction kit (Qiagen) and then sequenced by Illumina MiSeq Next Generation Sequencing at SYSGENLAB (Korea). Sequencing libraries were analyzed in 101-bp paired-end (PE) sequencing mode on an Illumina Novaseq6000 platform. Sequencing read quality was measured with the FastQC tool, and adapter sequences were removed with cutadapt trimmer with the -e 0.1 -j 20 options. Only matched-paired reads were used for further analysis. High-quality sequencing reads passed the fastq_quality_filter (≥Q30) of the FASTX toolkit (RRID:SCR_005534).

10. hybrid Affinity and specificity analysis of ligands

To assess the binding affinity of the hybrid ligands to wild-type RBD and its variants, the DNA sequence of R7-02 was quantified with a 5′-hexynyl group for hotspot peptide conjugation and 3′-FAM for flow cytometry-based binding assays. synthesized. FAM labeled R7-02 in 1x PBSMT was heat denatured and rapidly cooled. After heat denaturation, various concentrations of R7-02 were challenged with RBD-coated beads with gentle rotation for 1 h at room temperature. Beads were washed twice with 1×PBSMT to exclude non-specific binding, and then bead-bound R7-02 was collected with a DynaMag-2 magnet (Invitrogen). The collected beads were resuspended in 1x PBSMT and analyzed by measuring the average fluorescence of the beads using CytoFLEX S (Beckman Coulter). For each measurement, 15,000 cases were analyzed. Finally, K _d was calculated using nonlinear regression analysis (Prism software, GraphPad Prism version 9.3.1). To confirm their binding specificity, a similar characterization process was performed simultaneously on BSA-coated and uncoated beads (bare beads). When preparing uncoated beads, Dynabeads M-270 carboxylic acid beads were Tris-blocked in 50mM Tris·HCl (pH 7.4) for 15 min at room temperature. A similar characterization process was performed for the dense sequence families (R7-01 and R7-03) and reported RBD-binding affinity reagents; Aptamer-1, CoV2-RBD-1C, CoV2-6C3, Peptide 4, P05DHu and AM122.

11. RBD and Molecular docking simulation of R7-02 in complex

To analyze the high binding affinity of R7-02 to RBD, the molecular structure of R7-02 in complex with RBD was constructed using molecular docking simulation. The crystal structures of the hACE2-derived hotspot peptide, LGKGDFR, and the single RBD of the SARS-CoV-2 spike protein were obtained from the RCSB PDB databank (PDB ID: 6M0J) with a single site mutation (N501Y) in the RBD. The secondary structure of the aptamer scaffold in R7-02 (Table 1) was predicted using the mfold web server, which was fed into RNAcomposer for 3D structure. The peptide-nucleic acid hybrid structure of R7-02 was constructed by attaching a triazole-modified linker residue between the hexynyl-modified 5' end of the folded DNA and the butanamide-modified lysine C-terminus of the hotspot peptide. Molecular docking simulations were subsequently performed to find the best fit of the hotspot peptide-binding aptamer scaffold to the RBD, constraining the hotspot peptide and RBD to determined positions. The resulting structure was energy minimized using the AMBER14 force field utilizing the molecular dynamics simulation package OpenMM version 7.4.

12. Reported RBD -Competitive binding using binding affinity reagents analyze

For competitive binding assays, R7-02 and the reported RBD-binding aptamers were modified with FAM and TAMRA, respectively. Specifically, after heat denaturation and rapid cooling, they were co-incubated with 5 nM RBD beads (final volume: 100 μL) with gentle rotation for 1 h at room temperature. The beads were washed three times, and after signal compensation, they were resuspended in 100 μL of 1x PBSMT for analysis with CytoFLEX S (Beckman Coulter). The competitive RBD-bound fraction was calculated as the ratio of the average fluorescence intensity with competition to the average fluorescence intensity without competition (free binding). For competitive binding with reported RBD-binding cyclic peptides and antibodies, TAMRA-modified R7-02 was co-incubated with FAM-modified peptide or Alexa-488 modified RBD-antibody and analyzed in the same manner.

13. Wild type Omicron RBD Comparison of combined fractions between

To analyze the binding resistance to SARS-CoV-2 variants on selected RBD binders (Aptamer-1, Peptide 4, P05DHu and AM122), the binding fractions to wild-type and Omicron RBD were mixed with 10 nM of R7-02 and antibodies (P05DHu and AM122); and quantitatively measured at 100 nM of aptamer (Aptamer-1) and cyclic peptide (peptide 4). After incubating RBD-coated magnetic beads with the respective binders with gentle rotation at room temperature for 1 h, the beads were washed three times and resuspended in 100 μL of 1x PBSMT. The binding fraction of each binder to wild type and Omicron RBD was measured directly with CytoFLEX S (Beckman Coulter).

14. ELISA-based RBD - hACE2 Binding inhibition test

To characterize the inhibition efficiency, the SARS-CoV-2 Inhibitor Screening Kit (ACROBiosystems) was used according to the manufacturer's protocol. Microplates were pre-coated with hACE2, after which various concentrations of R7-02 (1 pM to 1 μM) were added to the plates. HRP-conjugated SARS-CoV-2 wild type RBD was added immediately. After 1 hour of incubation at room temperature, the wells were washed three times and substrate was added to quantify RBD-hACE2 binding. The reaction was terminated by adding a stop solution, and the absorbance was measured at 450 nm with a microplate reader (Tecan). The half-maximal inhibitory concentration (IC ₅₀ ) value for R7-02-derived inhibition of RBD-hACE2 binding was calculated as a function of the hybrid ligand concentration using sigmoid dose-response nonlinear regression analysis (Prism software, GraphPad Prism version 9.3.1). Determination was made after log transformation. In the same way, 3 μM of individual ligands (LGKGDFR peptide, DNA domain of R7-02, and R7-02) were added to analyze the synergistic interaction between hotspot peptide and aptamer scaffold in inhibiting RBD-hACE2 interaction. Afterwards, RBD-hACE2 inhibition was compared.

15. Cell culture and sample preparation

The hACE2-293T cell line was obtained from Takara (Japan). hACE2-293T cells were cultured in high-glucose DMEM (Sigma Aldrich) supplemented with 10% fetal bovine serum (Gibco) and 1% sodium pyruvate (Sigma Aldrich) at 37°C in a 5% CO ₂ atmosphere. Afterwards, passages 5-15 of hACE2-293T were used in the pseudotype SARS-CoV-2 neutralization assay.

16. pseudo Type SARS- CoV Neutralization assay of -2

To confirm the neutralization ability of R7-02, a neutralization analysis of pseudotype SARS-CoV-2 was performed. hACE2-293T cells (~4Х10 ³ ) were pre-seeded in 96-well plates and cultured overnight. After 24 hours, 5 μL of GFP-reporting pseudotype SARS-CoV-2 (4Х10 ⁵ transduction units per mL, BPS bioscience) was incubated with 3 μM of R7-02 in 1x PBSM (1x PBS with 2.5mM magnesium). Pre-incubate for 30 minutes at room temperature. Cell culture medium was removed from pre-seeded hACE2-293T cells, and cells were washed twice with pre-warmed 1x PBSM. After washing, a mixture of pseudovirus and R7-02 was added to the cells and infected at 37°C for 6 hours. After infection, 1X PBSM was replaced with fresh cell culture medium, and cells were cultured for another 48 hours at 37°C. Finally, GFP fluorescence images and bright field images were observed using a confocal microscope (Leica DMi8, source wavelength: 488 nm). The percentage of GFP-expressing infected cells relative to total hACE2-293T cells was computationally analyzed with CellProfiler version 4.2.1. The neutralization efficacy of other RBD binding ligands (aptamer-1, CoV2-RBD-1C, CoV2-6C3, P05DHu, AM122, and peptide 4) was analyzed using the same method.

17. Serum stability analysis

To characterize serum stability, FAM-labeled R7-02 was allowed to be digested by nucleases for up to 24 hours in 10% fetal bovine serum at 37°C. For comparison, R7-02 with phosphorothioate backbone introduction and other modifications such as 2'-O-methyl and 2'-F modifications; and other unmodified single-stranded DNA were tested together. 4 μL of 10 μM sample was mixed with 10x PBS (4 μL), fetal bovine serum (4 μL), and nuclease-free water (28 μL). After 0, 0.5, 2, 4, 8, 18, and 24 h of incubation at 37°C, 5 μL of each aliquot from the different mixtures was immediately treated at 90°C for 5 min and stored on ice prior to analysis. Aliquots were analyzed by electrophoresis on 10% urea polyacrylamide gels in 1x TBE buffer, stained with 10,000x SYBR gold stain (Invitrogen), and imaged by Azure C600 (Azure Biosystems).

[ Example ]

Example 1. Receptor-mimicry hybrid Ligand and hotspot Derived in vitro selection

Through proper folding, nucleic acids can provide a highly stable and water-soluble 3D scaffold capable of positioning hotspot peptides in the correct position and orientation, thereby maintaining receptor-like binding properties. This process is shown in Figure 1a. For specific RBD-hACE2 interactions, several hotspot peptides have been reported to be approximately 30 amino acids or less in length, but apart from the insoluble hACE2 transmembrane receptor, flexible motifs are present on the hotspot surface of the receptor-binding domain (RBD). cannot be strongly combined. It is well known that, with negligible immunogenicity, nucleic acids are exceptionally hydrophilic due to the polar nature of the phosphate backbone. Moreover, systematically designed iterative cycles of selection and amplification can lead to in vitro selection of unique nucleic acids capable of structurally stabilizing hACE2-derived RBD binding peptides. Without large amounts of insoluble domains, compact, highly soluble peptide stabilizers allow for high-dose intravenous administration for virus neutralization. Moreover, the role of nucleic acids can be further expanded as hotspot binding enhancers that allow them to cooperatively interact with target RBDs. In other words, there may be additional aptamer-like interactions centered on the monovalent peptide bond, which may further improve the hotspot binding ability of the hACE2-mimetic hybrid ligand.

Hotspot peptide-supported aptamer scaffolds can be isolated in vitro by repeated cycles of selection and amplification from a large number of different nucleic acids (~10 ¹⁴ ) site-specifically linked to hotspot peptides. This is shown in Figure 1b.

As shown in Figure 1b, initially, the azide-tagged C-terminus of the peptide was site-specifically linked to the 5'-hexynyl terminus of a single-stranded DNA (ssDNA) library by high-efficiency copper-catalyzed cycloaddition. It can be conjugated (step 1 in Figure 1b). After purification and heat denaturation, the peptide-nucleic acid hybrid library was rapidly cooled for unique 3D folding of individual ssDNAs. Upon introduction of RBD-coated magnetic beads, the RBD surface attracted the hotspot interactions of the hybrid ligand candidates, and magnetic separation led to the systematic separation of unbound peptide-DNA conjugates (steps 2–3 in Figure 1b). Afterwards, the DNA domain of the bead-bound hybrid ligand was selectively amplified by PCR using a 5′-hexinyl-modified forward primer and a 5′-phosphorylated reverse primer (Figure 1B, step 4). Using lambda nuclease, 5'-hexynyl-modified ssDNA was generated, and click reaction with azide-tagged hotspot peptide again provided a pool of hybrid libraries of the same format for the next round of the evolved HOLD process. (Figure 1b, step 5).

Example 2.SARS- CoV -2 RBD Combination hotspot peptide , and hACE2 mimic manufacturing

Among the RBD contact residues of hACE2, a 7 amino acid fragment from L351 to R357 (LGKGDFR, SEQ ID NO: 15) was selected for fusion with a random DNA library due to its strong hotspot interaction with the RBD of SARS-CoV-2. Within the short, continuous chain, four amino acids (K353, G354, D355, and R357) were confirmed to be in direct contact with the RBD surface by cryo-electron microscopy (cryo-EM) observation (Figure 2a). It is important to note that the hotspot region is related to the binding affinity of SARS-CoV-2 variants of concern (VOC). Due to the N501Y mutation in the RBD, VOC binds to hACE2 more tightly and strongly because K353 of hACE2, the central amino acid of the selected hotspot peptide, makes an unexpected hydrophobic interaction with the substituted tyrosine (Figure 2b). Additionally, this LGKGDFR peptide contains two hydrophobic and two positively charged amino acids, which cannot provide the properties of fully hydrophilic and negatively charged DNA. Therefore, the hotspot peptide-nucleic acid hybrid library will provide a wide variety of electrostatic interactions in the process of evolving to have high affinity for the RBD of SARS-CoV-2.

In seven rounds of in vitro selection with progressively increased stringency, the hybrid ligand pool was successfully enriched to have strong binding affinity to the RBD due to the synergistic effect between the hotspot peptide and the aptamer scaffold. The results are shown in Figure 2c. Additionally, the parameters in HOLD for each round are shown in Table 2 below.

Round Input
hybrid ligand RBD
concentration Stringency condition One 4ug
(200 pmol) 200nM Washing (200 uL, 3 times) 2 2ug(100pmol) 100nM Washing (200 uL, 3 times) + VDC (100x dilution, 20 min) 3 2ug(100pmol) 40nM Washing (200 uL, 3 times) + VDC (500x dilution, 30 min)
+ Washing (200 uL, 3 times) 4 1ug(50pmol) 40nM Washing (200 uL, 3 times) + VDC (500x dilution, 30 min)
+ Washing (200 uL, 3 times) 5 1ug(50pmol) 40nM Washing (200 uL, 3 times) + VDC (500x dilution, 30 min)
+ Washing (200 uL, 3 times) 6 1ug(50pmol) 40nM Washing (200 uL, 3 times) + VDC (500x dilution, 30 min, 2 times) + Washing (200 uL, 3 times) 7 1ug(50pmol) 20nM Washing (200 uL, 3 times) + VDC (500x dilution, 30 min, 2 times) + Washing (200 uL, 3 times)

As shown in Figure 2C, RBD binding of the hotspot peptide-linked round 7 (R7) pool was quantitatively assessed in a relative binding assay. Despite ligation of hotspot peptides, random DNA libraries showed significantly lower levels of RBD binding. When the peptide-nucleic acid hybrid library (hybrid random library) was challenged with RBD-coated magnetic beads, the binding fraction was only 0.38%, indicating that the hotspot peptide cannot bind strongly to the RBD without a stable scaffold. In the absence of the LGKGDFR peptide, the R7 pool slightly increased RBD binding, resulting in a binding fraction of 5.74%, which is likely due to its own aptamer binding effect. On the other hand, the peptide-supported R7 pool dramatically improved its affinity for RBD, and its binding fraction (22.6%) was 59.37- and 3.94-fold more than that of the random DNA-peptide conjugate and the peptide-deficient R7 pool, respectively. This significant improvement in RBD binding is due to the synergistic interaction between the hotspot peptide and the newly evolved aptamer scaffold.

Example 3. peptide -support Aptamer of scaffold Identification and characterization

The most optimal peptide-supported aptamer scaffold was identified in the R7 hybrid ligand pool using high-throughput sequencing and flow cytometry-based binding analysis. When more than 4 million DNAs were sequenced from the R7 pool, the three most abundant sequence families were found to occupy a high share (>18%). This is shown in Table 3 below (SEQ ID NOs: 16 to 22). Among the three sequence families, the most representative DNA sequence was synthesized with a 5'-hexynyl group for site-specific peptide binding and a 3'-FAM dye for flow cytometry-based binding analysis. For the 5'-linked hotspot peptides, the second most abundant DNA sequence (DNA domain of R7-02) was the strongest for RBD binding. In relative binding assays, the RBD binding fraction of R7-02 was approximately 5- and 8-fold greater than that of R7-01 and R7-03, respectively (Figure 3A).

Copy
rank Sequences (5'→3') sequence number Number of
sequences Percentage of
the sequence family One CTCCACAACCGCTGATCGACGCAGATCTTGTGGGT 16 483,860 14.416% CTCCACAACCGCTGATCGACGCAGATCTTGTGTGGT 17 16,249 2 ACGCAATCGTGGGGTTGGGGATATAATGGTA 18 35,997 1.834% ACGCAATCGTGGGGTTGGGGACATAATGGTA 19 13,909 ACGCAATCGTGGGTTGGGATATAATGGTA 20 13,703 3 CACACCAAATCTGAGTCTACCCCATGAAGG 21 30,943 1.769% CACACCAAATCTGAGTCTACCCTATGAAGG 22 30,433

To serve as an hACE2 mimetic, the most potent hybrid ligand, R7-02, showed high affinity and specificity for the RBD at the correct position for hACE2 to bind. When the K _d of R7-02 was quantitatively measured, it was 5.702 nM for RBD (Figure 3b, green), and the K _d values of R7-01 (27.01 nM) and R7-03 (93.8 nM) were lower than those of R7-02. was much higher (Figure 3c).

Additionally, molecular docking simulation was performed, and the results are shown in Figure 3d.

As shown in Figure 3d, it was predicted that the high binding affinity of R7-02 to RBD indeed influences the cooperative binding effect. In energy minimization simulation snapshots, the LGKGDFR peptide (red) is positioned precisely at the binding hotspot of native hACE2 (white) and RBD (blue), and the binding is effectively stabilized by the conjugated aptamer scaffold (green). DNA folding at the 3' end provides an additional binding motif in the loop structure (A475-N487) of the RBD (yellow arrow), leading to strong and specific binding of R7-02 to the RBD. The precise location of R7-02 at the interface between RBD and hACE2 demonstrates its SARS-CoV-2 neutralization potential at low nanomolar concentrations in physiological body fluids.

Even in competition with previously known RBD binding affinity reagents, R7-02 exhibited sustained and sustained binding to the target surface of the RBD (Figures 3e and 3f). To induce competition for RBD binding, hybrid ligands of hotspot peptides and aptamer scaffolds were synthesized with RBD-binding nucleic acid aptamers (CoV2-RBD-1C, CoV2-6C3, Aptamer-1), macrocyclic peptides (Peptide 4), or co-incubated with monoclonal antibodies (P05DHu and AM122). Most of these are known to block the binding interface between RBD and hACE2 (Figure 3e). Additionally, the K _d values of various RBD binders were confirmed under the same conditions for R7-02 (Figure 3g).

To assess competitive binding, we measured the RBD binding fraction of R7-02 with and without potential binding competitors, and quantitatively compared the reduction in RBD binding with that of other affinity reagents (Figure 3f). Even after co-incubation with RBD-binding aptamers or cyclic peptides for 1 hour, R7-02 was able to maintain RBD binding, and the ratio of competitive binding to free binding was reduced to a low level (about 6.8%). Meanwhile, the RBD binding of all other aptamers and cyclic peptides was significantly inhibited with a maximum decrease of 77.2% in the ratio between competitive binding and free binding, which indicates that the binding of monomeric aptamers to cyclic peptides is similar to that of cooperative hybrid ligands. This means that it is relatively weak to occupy the limited RBD binding site against competition. Additionally, due to the different binding sites, competition between R7-02 and the P05DHu and AM122 antibodies was insignificant.

Example 4.SARS- CoV -2 VOC (variants of concern) About hACE2 mimetic combined resistance

The hotspot peptide-nucleic acid hybrid molecule (R7-02) was confirmed to strongly bind to all reported VOCs of SARS-CoV-2 due to its high variant resistance in binding. Although it initially evolved to bind to the wild-type RBD through the HOLD process, the binding ability of the hybrid ligand also allows recognition of the highly mutated RBD of VOC. This allows powerful interaction with RBD's hotspot interface. VOC was found to have several key mutations, including N501Y, which results in a high interaction with the lysine of the LGKGDFR peptide in the hybrid ligand, thereby improving binding to the hACE2 receptor and transduction into host cells (Figure 4A).

When quantitatively evaluating the binding of R7-02 to five VOCs, the K _d values of R7-02 (alpha, beta, gamma, delta, and omicron; 5.486 nM, 3.376 nM, 1.614 nM, 2.757 nM, and 1.209 nM) was lower than that of wild-type RBD (5.702nM), confirming the binding resistance of R7-02 to all variants (Figure 4b). Interestingly, Omicron with the highest number of RBD mutations was recognized most strongly by R7-02, whereas several types of selected RBD binders (Aptamer-1, Peptide 4, P05DHu and AM122) lost their RBD binding ability by severe mutations. (Figures 4c and 4d).

Through this, it was confirmed that the binding resistance of R7-02 to SARS-CoV-2 VOC was significantly excellent. Additionally, this suggests that hotspot peptide-derived RBD binding may be affected by the improved hACE2 recognition mechanism by SARS-COV-2 VOC.

Example 5. RBD - hACE2 interaction inhibition and pseudo Type SARS- CoV -2 neutralize

Due to its strong binding to the RBD, the hotspot peptide-nucleic acid hybrid molecule efficiently inhibited the interaction between the RBD of SARS-CoV-2 and the hACE2 receptor even at nanomolar concentrations. To characterize the inhibition efficiency, enzyme-linked immunosorbent assay (ELISA) was performed by varying the concentration of R7-02 from 1 pM to 1 μM, and R7-02 showed a half-maximal inhibitory concentration of 138.9 nM for inhibition of RBD-hACE2 binding. (half-maximal inhibitory concentration, IC ₅₀ ) was shown (Figure 5a).

Meanwhile, RBD inhibition of R7-02 was guided by the synergistic effect of the systemically coupled hotspot peptide and the in vitro evolved aptamer scaffold; The LGKGDFR peptide and aptamer scaffold, which are individual components of R7-02, showed an inhibition rate of RBD-hACE2 interaction of 11.69% and 26.82%, respectively, at a concentration of 3 μM, while the overall structure of R7-02 showed an inhibition rate of 89.60%. As evidence of aptameric behavior, the DNA scaffold alone experimental group showed better inhibition efficiency compared to the random DNA library (inhibition rate 3.77%) (Figure 5b).

Previously, several RBD-binding affinity reagents did not effectively inhibit RBD-hACE2 interaction because they were unable to block the precise hACE2 contact residues on the RBD surface. In contrast, hotspot-derived RBD binding of R7-02 demonstrated efficient inhibition of RBD in hACE2 binding, indicating great potential for SARS-CoV-2 neutralization.

Accordingly, the SARS-CoV-2 neutralizing ability of the hotspot peptide-nucleic acid hybrid molecule was further confirmed. For neutralization analysis, a pseudotype SARS-CoV-2 expressing both the SARS-CoV-2 spike protein and green fluorescent protein (GFP) but lacking the self-replication function was prepared. The neutralization efficiency of R7-02 was analyzed by fluorescence by measuring the fluorescence intensity of GFP expressed only in cells infected by pseudotype SARS-CoV-2 (Figure 5c). Briefly, hACE2-overexpressing HEK-293T cell line (hACE2-293T) was pre-inoculated into microplates overnight and then challenged with pseudotyped SARS-CoV-2 (0.5 multiplicity of infection, MOI) for 6 h for viral infection. The results are shown in Figures 5d and 5e.

As shown in Figures 5D and 5E, in the absence of RBD inhibitor, hACE2-293T was infected with pseudotype SARS-CoV-2, and quantitatively, 58.4% of total cells emitted strong green fluorescence as evidence of successful virus infection. . Meanwhile, in the presence of the hotspot peptide or aptamer scaffold constituting R7-02, the level of RBD binding was limited, and the infection rate of pseudotype SARS-CoV-2 was reduced to 22.0% and 12.6%, respectively. Additionally, R7-02, a hotspot peptide-supported aptamer scaffold, showed negligible green fluorescence and a significantly lower percentage of infected cells (1.9%).

Compared to the viral infection rates of many different RBD binders, the viral infection rate of R7-02 was found to be significantly lower or similar (Figures 5f and 5g). Meanwhile, it should be considered that, unlike the most commonly used neutralizing antibodies, the hybrid ligand of the present invention is completely synthetic. In other words, the present invention can confirm the effect of efficient infection inhibition even though it has a low molecular weight (20 kDa), which is one-tenth of that of a monoclonal antibody. Additionally, the chimeric structure of the peptide-aptamer hybrid ligand without additional modifications provides good new oligonucleotide modifications compared to well-known oligonucleotide modifications (e.g., phosphorothioate backbone, 2′-O-methyl, and 2′-F modifications) (Figure 5h). It showed clease resistance and serum stability, and showed great potential as a SARS-CoV-2 neutralizer.

The description of the present invention described above is for illustrative purposes, and those skilled in the art will understand that the present invention can be easily modified into other specific forms without changing the technical idea or essential features of the present invention. will be. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

Claims (21)

A composition for preventing or treating coronavirus infection, comprising a peptide-nucleic acid hybrid molecule,
The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,
A composition for preventing or treating coronavirus infection, wherein the nucleic acid includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.
According to paragraph 1,
A composition, characterized in that the peptide-nucleic acid hybrid molecule is prepared through the following method:
(a) preparing a peptide-nucleic acid hybrid by site-specific combining a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15 and a random nucleic acid library;
(b) mixing and cultivating the target protein-coated magnetic beads and the peptide-nucleic acid hybrid of step (a); and
(c) Selecting peptide-nucleic acid hybrid molecules that bind to the target protein using a magnet.
According to paragraph 2,
The composition, characterized in that the method further comprises the following steps:
(d) selectively amplifying and replicating the nucleic acid portion of the peptide-nucleic acid hybrid molecule selected in step (c);
(e) purifying the double-stranded DNA produced in step (d) into single-stranded DNA using nucleic acid hydrolase; and
(f) preparing a new random nucleic acid library composed of the single-stranded DNA of step (e) and repeating the selection, amplification, and purification processes of steps (a) to (f).
According to paragraph 1,
A composition wherein the peptide-nucleic acid hybrid molecule binds to the receptor binding domain (RBD) of the spike protein of the coronavirus.
According to paragraph 4,
A composition, characterized in that the RBD is wild type or mutant type.
According to clause 5,
The mutation includes one or more selected from the group consisting of N501Y, E484K, K417N, K417T, T478K, L452R, E484A, G339D, S371L, S373P, S375F, N440K, S477N, G446S, Q493R, G496S, Q498R, and Y505H. doing A composition, characterized in that.
According to paragraph 1,
A composition characterized in that the peptide-nucleic acid hybrid molecule neutralizes the coronavirus.
According to paragraph 1,
A composition wherein the peptide-nucleic acid hybrid molecule inhibits the interaction between the RBD of the coronavirus and the hACE2 (human angiotensin-converting enzyme 2) receptor.
According to paragraph 1,
A composition wherein the nucleic acid increases the binding force and water solubility of the spike protein to the RBD.
According to paragraph 1,
A composition characterized in that the peptide-nucleic acid hybrid molecule satisfies any one of the following characteristics:
(a) Nuclease resistance; and
(b) Serum stability.
According to paragraph 1,
A composition wherein the peptide-nucleic acid hybrid molecule is for intravenous or respiratory administration.
According to paragraph 1,
The coronaviruses include human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), severe acute respiratory syndrome coronavirus (SARS-CoV), and human coronavirus NL63 (HCoV-NL63, New Haven coronavirus). , a composition characterized by one or more selected from the group consisting of human coronavirus HKU1, Middle East respiratory syndrome coronavirus (MERS-CoV), severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2), and variants thereof.
A composition for preventing or treating coronavirus infection, comprising a peptide-nucleic acid hybrid molecule prepared by a method comprising the following steps:
(a) preparing a peptide-nucleic acid hybrid by site-specific combining a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15 and a random nucleic acid library;
(b) mixing and cultivating the target protein-coated magnetic beads and the peptide-nucleic acid hybrid of step (a); and
(c) Selecting peptide-nucleic acid hybrid molecules that bind to the target protein using a magnet.
According to clause 13,
The composition, characterized in that the method further comprises the following steps:
(d) selectively amplifying and replicating the nucleic acid portion of the peptide-nucleic acid hybrid molecule selected in step (c);
(e) purifying the double-stranded DNA produced in step (d) into single-stranded DNA using nucleic acid hydrolase; and
(f) preparing a new random nucleic acid library composed of the single-stranded DNA of step (e) and repeating the selection, amplification, and purification processes of steps (a) to (f).
According to clause 13,
The method further comprises the step of inducing 3D folding of the nucleic acid by heat denaturing and cooling the peptide-nucleic acid hybrid after step (a).
According to clause 13,
The hotspot-derived peptide in step (a) consists of azido lysine, Azidobutanoic acid, Azinoacetic acid, and azide at the C-terminus or N-terminus. It is a peptide to which one or more functional groups selected from the group are bound,
The random nucleic acid library in step (a) is a single strand with one or more functional groups selected from the group consisting of hexynyl, 5-octadiynyl, and alkyne bound to the 5' end. Contains nucleic acids,
A composition characterized in that the hotspot-derived peptide and the single-stranded nucleic acid are site-specifically bound by a click reaction.
According to clause 13,
The hotspot-derived peptide in step (a) has at least one functional group selected from the group consisting of hexynyl, 5-octadiynyl, and alkyne bound to the C-terminus or N-terminus. It is a peptide,
The random nucleic acid library in step (a) is from the group consisting of Azido lysine, Azidobutanoic acid, Azinoacetic acid, and azide at the 5' end. It contains a single-stranded nucleic acid to which one or more selected functional groups are bound,
A composition characterized in that the hotspot-derived peptide and the single-stranded nucleic acid are site-specifically bound by a click reaction.
According to clause 13,
A composition wherein the random nucleic acid library has the following structure:
5'-functional group-forward primer-[N _x ]-reverse primer-3',
The functional groups include hexynyl, 5-octadiynyl, alkyne, Azido lysine, Azidobutanoic acid, Azinoacetic acid, And selected from the group consisting of azide,
where N is A, T, C or G, and x is an integer from 25 to 100.
A quasi-drug composition for preventing or suppressing coronavirus infection, comprising a peptide-nucleic acid hybrid molecule,
The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,
A quasi-drug composition for preventing or suppressing coronavirus infection, wherein the nucleic acid includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.
An antiviral composition against coronavirus, comprising a peptide-nucleic acid hybrid molecule,
The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,
An antiviral composition against coronavirus, wherein the nucleic acid includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.
A composition for neutralizing coronaviruses, comprising a peptide-nucleic acid hybrid molecule,
The peptide is a hotspot-derived peptide consisting of the amino acid sequence of SEQ ID NO: 15,
A composition for neutralizing coronavirus, wherein the nucleic acid includes one base sequence selected from the group consisting of SEQ ID NOs: 7, 8, 18, 19, and 20.