KR20230142207A - Monascus ruber having attenuated or deleted MpigI or MpigI' gene, composition and method for increasing monascus pigment production comprising the same - Google Patents

Abstract

The present invention relates to Monascus ruber in which the MpigI (Monascus pigment I) or MpigI' (Monascus pigment I') gene is attenuated or deleted. When using the Monascus louver of the present invention or a composition containing it, the production of Monascus pigments suitable for use in food can be increased without causing overexpression of genes, and this can be used in the food industry.

Description

Monascus ruber having attenuated or deleted MpigI or MpigI' gene, composition and method for increasing monascus pigment production comprising the same}

The present invention relates to a Monascus ruber in which the MpigI or MpigI' gene is attenuated or deleted, and a composition and method for increasing Monascus pigment production including the same.

Monascus pigment is a polyketide component and structurally belongs to the azaphilone family, which is a compound with an oxygenated bicyclic nucleus and a quaternary center. Monascus pigment is known to be produced by Monascus ruber . Main pigments include yellow, orange, and red, and their main components include monacin and ankaflavin, which are yellow pigments, monascorubrin, which is an orange pigment, and Monascorubra, which is a red pigment. Monascorubramine, rubropunctamine, etc. are known. Monascus pigment is not only used as a natural food coloring, but also has several biological functions leading to antioxidant, antitumor, antibacterial, antimutagenic properties and potential anti-obesity activity.

Conventionally, attempts have been made to obtain useful products by genetically manipulating specific target sites using the CRISPR/Cas9 system. For example, the production of bicarberine, a fungal red pigment with antibacterial and antitumor activity, was engineered in Fusarium oxysporum using the CRISPR/Cas9 system.

In order to increase the productivity of conventional Monascus pigments, experiments such as strain improvement and nutritional substrate changes have been conducted. Accordingly, there is an urgent need to develop a method to increase the production of Monascus pigments suitable for use in food without causing gene overexpression through gene editing.

Korean Patent No. 0973690

The purpose of the present invention is to increase the production of Monascus pigments suitable for use in foods without causing overexpression of genes.

1. Monascus ruber in which the MpigI (Monascus pigment I) or MpigI' (Monascus pigment I') gene is attenuated or deleted.

2. In 1 above, at least one mutation of insertion, substitution, or deletion is included in at least one of the MpigI locus represented by SEQ ID NO: 1 or the MpigI' locus represented by SEQ ID NO: 2. Monascus ruber .

3. In item 1 above, it contains at least one mutation among insertion, substitution, or deletion at positions 969 to 1452 of the MpigI locus represented by SEQ ID NO: 1;

Monascus ruber, comprising at least one mutation of insertion, substitution, or deletion at positions 132 to 539 of the MpigI' locus shown in SEQ ID NO: 2.

4. In 1 above, at least one base is deleted from positions 972 to 1452 in the MpigI locus shown in SEQ ID NO: 1, or at least one base is deleted from positions 986 to 1446 in the MpigI locus shown in SEQ ID NO: 1. One base is substituted; or

At least one base is deleted from positions 150 to 534 in the MpigI' locus shown in SEQ ID NO: 2, or at least one base is deleted between positions 148 and 149 in the MpigI' locus shown in SEQ ID NO: 28. sequence inserted; Monascus Louver.

5. A composition for producing Monascus pigment containing the Monascus ruber of any one of 1 to 4 above.

6. A method of increasing Monascus pigment production comprising the step of attenuating or deleting the MpigI (Monascus pigment I) or MpigI' (Monascus pigment I') gene in Monascus ruber .

7. A method of producing a Monascus pigment comprising culturing the Monascus ruber of any one of 1 to 4 above.

When using the Monascus louver of the present invention or a composition containing it, the production of Monascus pigments suitable for use in food can be increased without causing overexpression of genes, and this can be used in the food industry.

MpigI16-7,

MpigI16-15,

MpigI16-17,

MpigI16-22,

MpigI'14-5 및

MpigI'14-7의 서열 분석.
도 3a는 야생형 M. ruber의 콜로니 지름(녹색선),

MpigI16-7(황색 선),

MpigI16-15(파란색 선),

MpigI16-17(주황색 선),

MpigI16-22(진회색 선),

MpigI'14-5(카키색 선) 및 MpigI'14-7(밝은 회색 선).
각 플롯은 삼중 반복의 평균을 나타내고 오차 막대는 표준 편차를 나타낸다.
도 3b는 야생형의 콜로니 형태,

MpigI16-7,

MpigI16-15,

MpigI16-17,

MpigI16-22,

MpigI'14-5 및

MpigI'14-7. 측정은 세 번 수행되었으며 그림은 이러한 측정 중 하나를 나타낸다.
도 3c는 야생형 M. ruber(녹색 선),

MpigI16-7(황색 선),

MpigI16-15(파란색 선),

MpigI16-17(주황색 선),

MpigI16-22(진회색 선),

MpigI'14-5(카키색 선) 및

MpigI'14-7(밝은 회색 선)의 황색 색소의 색소 생산을 나타낸다.
도 3d는 야생형 M. ruber(녹색 선),

MpigI16-7(황색 선),

MpigI16-15(파란색 선),

MpigI16-17(주황색 선),

MpigI16-22(진회색 선),

MpigI '14-5(카키색 선) 및

MpigI'14-7(밝은 회색 선)의 주황색 색소의 색소 생산을 나타낸다.
도 3e는 야생형 M. ruber(녹색 선),

MpigI16-7(황색 선),

MpigI16-15(파란색 선),

MpigI16-17(주황색 선),

MpigI16-22(진회색 선),

MpigI '14-5(카키색 선) 및

MpigI'14-7(밝은 회색 선)의 적색 색소의 색소 생산을 나타낸다. 각 플롯은 삼중 반복의 평균을 나타내고 오차 막대는 표준 편차를 나타낸다.
도 3f는 야생형,

MpigI16-7,

MpigI16-15,

MpigI16-17,

MpigI16-22,

MpigI'14-5 및

MpigI'14-7의 색소 분석을 나타낸다. 측정은 세 번 수행되었으며 그림은 이러한 측정 중 하나를 나타낸다.
도 4a는 표준 시트리닌 100㎍/mL(분홍색 선)과 비교한 야생형 M. ruber 및 돌연변이 균주(갈색 선) 및 M. purpureus BCRC 31541 균주(파란색 선)의 HPLC-FLD 크로마토그램을 나타낸다. 체류 시간: 9.746분 시트리닌 측정은 3회 수행되었으며 그림은 이러한 측정 중 하나를 나타낸다.
도 4b는 야생형 및 돌연변이체의 모나콜린 K 분석. 총 모나콜린 K는 HPLC-UV 검출기를 통해 측정하였다. 각 막대 그림은 삼중 반복의 평균을 나타내고 오차 막대는 표준 편차를 나타낸다.
도 4c는 모나스커스 색소와 관련된 유전자 발현의 RT-PCR 분석을 나타낸다.Figure 1A shows a comparison of M. ruber and M. purpureus YY-1 genome positions. The left side of the outer ring represents the contig number of M. ruber, and the right side of the outer ring represents the chromosome number of M. purpureus YY-1. Internal ribbons of different colors connect regions of homologous sequence shared between the two strains.
Figure 1B is a schematic representation of the citrinin gene cluster of Monascus spp. (He & Cox, 2016) and represents the citrinin gene cluster of M. ruber.
Figure 1c shows HPLC results of M. ruber wild-type and mutant strains (brown lines) and M. purpureus BCRC 31541 strain (blue line). Each plot represents the mean of triplicate replicates and error bars represent standard deviation.
Figure 1d shows the biosynthetic pathway of Monascus pigment constructed according to the entire genome sequence. The orange pigment is produced by the esterification reaction of polyketide chromophore and β-keoic acid. Red pigment is formed by the amination reaction of orange pigment, and yellow pigment is formed by reduction of orange pigment.
Figure 1e shows the biosynthetic pathway of monacolin K constructed according to the entire genome sequence. Once monacolin J is synthesized, 2-methylbutanoic acid binds to monacolin J to form monacolin K.
Figure 2A is a schematic representation of the gene clusters of Monascus pigments and dual targeting sites at the MpigI locus (Locus_001524-RA) and MpigI' locus (Locus_001525-RA). Cas9-mediated cleavage of MpigI and MpigI' combined with dual sgRNA.
Figure 2B shows PCR amplification of the target region at the MpigI (left panel) and MpigI' (right panel) loci using primers adjacent to the cut site. Lane 1: HO; Lane 2: wild type; Lanes 3-12: Transformants.
Figure 2C, Figure 2D and Figure 2E are mutant

MpigI16-7;

MpigI16-15,

MpigI16-17;

MpigI16-22,

MpigI'14-5 and

Sequence analysis of MpigI'14-7.
Figure 3a shows colony diameter (green line) of wild-type M. ruber;

MpigI16-7 (yellow line);

MpigI16-15 (blue line);

MpigI16-17 (orange line);

MpigI16-22 (dark gray line);

MpigI'14-5 (khaki line) and MpigI'14-7 (light gray line).
Each plot represents the mean of triplicate replicates and error bars represent standard deviation.
Figure 3b shows the colony morphology of the wild type;

MpigI16-7;

MpigI16-15,

MpigI16-17;

MpigI16-22,

MpigI'14-5 and

MpigI'14-7. Measurements were performed in triplicate and the figure represents one of these measurements.
Figure 3C shows wild-type M. ruber (green line);

MpigI16-7 (yellow line);

MpigI16-15 (blue line);

MpigI16-17 (orange line);

MpigI16-22 (dark gray line);

MpigI'14-5 (khaki line) and

Indicates pigment production of the yellow pigment of MpigI'14-7 (light gray line).
Figure 3d shows wild type M. ruber (green line);

MpigI16-7 (yellow line);

MpigI16-15 (blue line);

MpigI16-17 (orange line);

MpigI16-22 (dark gray line);

MpigI '14-5 (khaki line) and

Indicates pigment production of the orange pigment of MpigI'14-7 (light gray line).
Figure 3e shows wild-type M. ruber (green line);

MpigI16-7 (yellow line);

MpigI16-15 (blue line);

MpigI16-17 (orange line);

MpigI16-22 (dark gray line);

MpigI '14-5 (khaki line) and

Indicates pigment production of the red pigment of MpigI'14-7 (light gray line). Each plot represents the mean of triplicate replicates and error bars represent standard deviation.
Figure 3f is wild type,

MpigI16-7;

MpigI16-15;

MpigI16-17;

MpigI16-22,

MpigI'14-5 and

Chromogenic analysis of MpigI'14-7 is shown. Measurements were performed in triplicate and the figure represents one of these measurements.
Figure 4A shows HPLC-FLD chromatograms of wild-type M. ruber and mutant strains (brown line) and M. purpureus BCRC 31541 strain (blue line) compared to standard citrinin 100 μg/mL (pink line). Retention time: 9.746 minutes Citrinin measurements were performed in triplicate and the figure represents one of these measurements.
Figure 4b: Monacolin K analysis of wild type and mutants. Total monacolin K was measured using HPLC-UV detector. Each bar plot represents the mean of triplicate replicates and error bars represent standard deviation.
Figure 4c shows RT-PCR analysis of gene expression associated with Monascus pigment.

Hereinafter, the present invention will be described in detail.

The present invention relates to Monascus ruber in which the MpigI (Monascus pigment I) or MpigI' (Monascus pigment I') gene is attenuated or deleted.

“Attenuation” may indicate a decrease in the expression of the gene of interest, and “deletion” may indicate loss of expression of the gene of interest. Attenuation or deletion may result from a mutation in the gene sequence, for example, a modification of the locus (e.g., substitution, deletion, insertion, or combination thereof). The attenuation or deletion may occur due to a mutation in the sequence of the gene regulatory portion (eg, substitution, deletion, insertion, or a combination thereof).

“Locus” or “loci” includes a specific location(s) of a gene (or key sequence), DNA sequence, polypeptide-coding sequence, or location on a chromosome of the genome of an organism. For example, “MpigI locus” may refer to a specific location in the MpigI gene, a MpigI DNA sequence, a MpigI-coding sequence, or a MpigI locus on a chromosome in the genome of an organism where such sequences have been identified. The MpigI locus is , but is not limited to regulatory elements of the MpigI gene, including enhancers, promoters, 5' and/or 3' UTRs, or combinations thereof. Those skilled in the art will recognize that in some embodiments, the chromosomes have hundreds or It will be appreciated that they may even contain thousands of genes and that comparisons between different species may demonstrate physical co-localization of similar loci.

MpigI and MpigI have the same phenotype, but are separate genes with different sequences. The MpigI locus is the sequence represented by SEQ ID NO: 1, and the Mpig I' locus is the sequence represented by SEQ ID NO: 2.

SEQ ID NO: 1: ATGTGGATTGGCCTGCTCTTCGGCGTGATGTGCCTGGGCGCTGCTTTTCAGCGCCAGCGGTCGTCGCAGATGCCCGACCCGCAGCAGCTGGTCCGTCTGTACCGGGAGAGGATCATCCAGTGCCTGGTCGTGGGGAAATACGCCAAATGCGCGCCGTACACGCTCGAGACGCTGCTGCTCTACCTGAACATCGAGTCCCTGCAGAGCGAGGACACCCGCGTCGAGACCTGGATCCTGCT GGGCGTCATCGTGCGCCTGGCGCTGCGCATGGGCTACCACCGCGATGCCAGCCACTTCCCGCACATCTCCCCCTTCGCGGCCGAGATGCGCCGGCGCGTCTGGGCTCTCATCGTCCAGTTC

GACTGTCTGACATCTGCCCAGGTCGGGCTGCCGCGCATGATCCGCGACTCGCAGTCGGACACGGCGGAGCCGCGCAACCTGCTCGACGAAGACTTCGACGAGGACAGCACTGCCCTGCCGCTGCCCCAGCCCAGCACGGTGCAGACGCCGGTGCAGTATATCGTGGCGAAGAACCGCATTGTCGCGGTCTTCGGCCGCATCTGCGACCTGATCACATCCAGCAGAGCGCCCTCCTACACCGAAGTGATGCAGCTG GACGAAACCCTACATGAGACCTACCGCTGCGTGCCGGGGGGCCTGCAGATGCGGCCGATGACCAGATCGCTCACGGACGGGGCGACGGTTATCCTGCGCCGGATGTACATTGTCCTGCTCTACCACAAGGCCGTCTGCATGCTGCACCACCGCTACATGGTCCCGGCCCGGACGGACGGGCGTTATGCCTACTCCCGCTCGACCTGTGTTGCGGCCGCTCTGCAGATCGTCTCGCACCAGTGGACGCTGCATAA TGAAGCCCAGCCGGGAGGCCGTCTGTACGAAGAGCGCTGGAAGGTCTCATCGCTCGTCAAGAGCACCTTCTTCCTGGGCACTACGATCCTGTGCGCAGAACTCGACTGCTCCCTCCACAAGGAGCCCGCCGACGCCGAGCAATCGCCGGCCGAGACAGGCCTGCGGCAGCAGGTCATCCAGGCTCTGCATAATTCGCACACGATCTGGCGG

CAGGCTAGTGACTCCTCGCGCGAGGCCAGGCTTGCGGCTGATGTGTCCGGTCTGCTTCTCACCCGGGCACAGAGGAAATGGAAGCTAGAGATGCGGCAAGCCGGAAACATGGGTGTGTATTCTCTCTCTGTCTGTCTCCGTCTGCCTCTGACTCTTGCACCTCGACTGAGATACTGTTCACATAGGCATGTCGTCGGAAACCCCCTTCATGGGAGTGTCAATCCCGCCACAGAGCACTACAAATGGCTGCTGCC GCCGTTGCACAGCCGCTGAGCATGCCGCAGCTGCTGCAGTTCAATACCGCGGCGCACATAGACTATAGCGATGTCGGTGCGGAGCCGTTGGGTCTTGTAAGCGCACCTCTGGGCTACGGCTGA

SEQ ID NO: 2: TCAAGTCAGCCGGCGGGGGATCATGGCTGCCACGGCCGCAGAAACTGCCTCACCAGGGGGCGATGTCTTTGTTGATGAAATACTCGGTCACCAGTCGGTCGACCAGCGGCCGCGGGAGCATCGCCGACAGGATCTCCTCCCTGCTCACACAACGGTAGCTCCCGAACAGGATATCGGGCTCGTCGGGCTCTGTAGGCTCTGCCGCAGCTCCTGGCCCTTGGAAGGGCGCGCTGTCGACC GGATTCTGCTCCTCGCGGAAGTGGTCCCGGAGCTCTGCAATCTGGGACAGCGTGCTGGTCAGCCAAGGATCAAGCCGGGGGAGGGGGGGCGGCCACATTACCCCGTCCAAGATGGCCGTCCAGTGCGTACTCTCGACGTAGGCAGTCTCCATCTTCTCGATCTTGATGCGACCGAAGCGGTCCGACAGCTGCGGTGCCTCCTCCCTAGCCGCCGAGTCGGCCGCATTGACGGCCTCGCCAGGCGCCGTGGCGGGAG CGGCAGCGCCAGCGGCAGCAGCAGCTCCTTCAAAGCCAGCTGCGGTCGAGTCGGACGGCATGGGCTCTTTGGCGGATGGCGTTCTGCCCGCGTGGACCGTGTCCATCAACGTGGTGATCAGCCGCTCCAGCTGGCCGATCCGCTCCGGCAGGTTTTCAACGCCCGCCGGACGGCCCTGGGCGCGGTCGATGCGCTCGGGCGCTGCACTGGGAGGGCGGACATAGGTGCACGACAGCGAAAGGCCGCGGCGGACACACACA CACGTTTCGCATGGCTGGCGGCGGTCACATCGGAGCCTGGCAGGTCAGTGAGATGGGCATCCGCGCATCCGGGCAT

Monascus ruber ( M. ruber ) is a species classified as a Monascus strain and is known to produce Monascus pigment. Monascus pigment is used as a natural food coloring and has antioxidant, antitumor, antibacterial, and antimutagenic properties.

Monascus louver is useful because it has lost most of the gene cluster for citrinin biosynthesis and does not produce citrinin, a known fungal toxin.

In general, wild-type Monascus ruber mainly produced yellow pigment, and red and orange pigment production was reduced. In contrast, Monascus ruber with the MpigI gene attenuated or deleted can gain the ability to produce red and orange pigments along with increased yellow pigment.

In addition, even if the MpigI or MpigI' gene is attenuated or deleted, there is no problem with the growth of Monascus ruber, and it still does not produce citrinin, so it does not cause toxicity problems.

Therefore, if the MpigI or MpigI' gene is attenuated or deleted in Monascus ruber, Monascus pigment production can be increased. In particular, attenuation or deletion of the MpigI or MpigI' gene can increase the product without overexpressing the gene, and the pigment has no toxicity problems, making it suitable and useful for use in foods.

Attenuation or deletion of the MpigI (Monascus pigment I) gene is caused by a mutation in the gene sequence at the MpigI locus represented by SEQ ID NO: 1 and/or the MpigI locus represented by SEQ ID NO: 2, such as substitution, deletion, insertion, or a combination thereof. It may occur due to

The location of attenuation or deletion of the MpigI or Mpig I' gene is not limited within the MpigI or Mpig I' locus as long as the MpigI or Mpig I' gene can be inactivated.

Monascus ruber of the present invention may include at least one mutation among insertion, substitution, or deletion at the MpigI locus represented by SEQ ID NO: 1. Specifically, the Monascus ruber of the present invention may include at least one mutation among insertions, substitutions, or deletions at positions 969 to 1452 of the MpigI locus represented by SEQ ID NO: 1.

For example, the Monascus ruber of the present invention has at least one base deleted at positions 972 to 1452 in the MpigI locus shown in SEQ ID NO: 1, or at positions 986 to 1446 in the MpigI locus shown in SEQ ID NO: 1. At least one base among the bases may be substituted.

According to one embodiment, the Monascus ruber of the present invention may have the base at positions 986 to 1452 in the MpigI locus represented by SEQ ID NO: 1 deleted. The Monascus ruber of the present invention may be one in which the base at positions 986 to 1446 in the MpigI locus represented by SEQ ID NO: 1 has been deleted.

According to another example, the Monascus ruber of the present invention may have the base at positions 972 to 1452 in the MpigI locus represented by SEQ ID NO: 1 deleted. Monascus ruber of the present invention may have the base at positions 972 to 1448 deleted from the MpigI locus shown in SEQ ID NO: 1.

According to another embodiment, the Monascus ruber of the present invention has positions 986, 988, 991 to 992, 994 to 995, 1425 to 1429, and 1431 to 1433 at the MpigI locus represented by SEQ ID NO: 1. The bases at positions 1437 to 1438, 1440 to 1441, 1444, and 1446 may be substituted.

According to another embodiment, the Monascus ruber of the present invention has positions 986, 988, 991 to 992, 994 to 995, 1425 to 1435, and 1437 to 1439 at the MpigI locus represented by SEQ ID NO: 1. The bases at positions 1441 to 1442 and 1445 may be substituted.

Monascus ruber of the present invention may contain at least one mutation among insertion, substitution, or deletion at the MpigI' locus represented by SEQ ID NO: 2. Specifically, the Monascus ruber of the present invention may include at least one mutation among insertions, substitutions, or deletions at positions 132 to 539 of the MpigI' locus shown in SEQ ID NO: 2.

For example, the Monascus ruber of the present invention has at least one base deleted at positions 150 to 534 in the MpigI' locus shown in SEQ ID NO: 2, or at position 148 in the MpigI' locus shown in SEQ ID NO: 2 and An insertion may have occurred between positions 149.

According to one embodiment, the Monascus ruber of the present invention may be one in which the base at positions 150 to 534 in the MpigI' locus represented by SEQ ID NO: 2 has been deleted.

According to another example, the Monascus ruber of the present invention may have the sequence shown in SEQ ID NO: 28 inserted between positions 148 and 149 in the MpigI' locus shown in SEQ ID NO: 2. SEQ ID NO: 28: TAATACGACTCACTATAGGAGCTCCTTCAAAGCCAGCTGGCTTTAGAGC.

Attenuation or deletion of the MpigI or MpigI' gene can be performed by methods known in the art, such as transfer-DNA (T-DNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), and microRNA (miRNA). , ribozyme, PNA (peptide nucleic acids), or CRISPR/Cas9 nuclease (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated sequences9 nuclease).

For example, when using CRISPR/Cas9 nuclease, certain sequences located in or adjacent to the PAM (Proto-spacer-adjacent Motif) sequence included in the MpigI locus are cut to delete, insert, or Substitution mutations can occur and, as a result, the function of the MpigI (Monascus pigment I) gene can be inhibited.

For example, attenuation or deletion of the MpigI gene may occur by including at least one mutation among insertion, substitution, or deletion at positions 969 to 1452 of the MpigI locus shown in SEQ ID NO: 1.

For example, attenuation or deletion of the MpigI gene may occur by including at least one mutation among insertion, substitution, or deletion at positions 132 to 539 of the MpigI locus shown in SEQ ID NO: 2.

Additionally, the present invention relates to a composition for producing Monascus pigment.

The composition of the present invention includes the Monascus ruber described above.

The composition of the present invention may contain as active ingredients the shattered cell wall fraction, live cells, dead cells, dried cells or cultures of Monascus ruber in which the MpigI or Mpig I' gene is attenuated or deleted. The culture may include the culture itself obtained by culturing the red aspergillus variant of the present invention on a liquid medium or solid medium, a filtrate obtained by filtering or centrifuging the culture to remove the strain (centrifuged supernatant), etc.

Additionally, the composition may further include carriers, excipients, or diluents known in the art, if necessary. Specifically, examples of carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, and methyl. It may contain cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In addition, the composition may further include fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives, if necessary.

The present invention also relates to a method of increasing Monascus pigment production.

The method of the present invention includes the step of attenuating or deleting the MpigI (Monascus pigment I) or Mpig I' (Monascus pigment I') gene in Monascus ruber.

Attenuation or deletion of the MpigI or Mpig I' gene can be performed by methods known in the art. For example, this can be achieved by the CRISPR/Cas system, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, or any combination thereof.

According to one embodiment, the CRISPR/Cas9 system can be used to genetically manipulate a specific target site of the MpigI or Mpig I' gene.

In the CRISPR/Cas9 system, the target site of the MpigI or Mpig I' gene can be specified by “gRNA (guide RNA).” gRNA is an RNA that acts as a guide to guide which part of DNA to modify, and is capable of complementary binding to the target sequence, so CRISPR can utilize this characteristic of gRNA to bind to the target sequence. Meanwhile, gRNA can be produced from a target sequence by a known method.

According to one embodiment, the sgRNA may be a dual sgRNA. When dual sgRNA is used instead of single sgRNA, large indels may be detected in the target region, so dual sgRNA may be useful for inactivation of target genes.

“CRISPR/Cas9” is a type of third-generation genetic scissors and consists of “gRNA” and “Cas9,” an enzyme that cuts DNA. CRISPR is a DNA sequence found in the genomes of prokaryotic organisms such as bacteria and archaea. Cas9 is an enzyme that uses the CRISPR sequence as a guide to recognize and cleave specific strands of DNA that are complementary to the CRISPR sequence. Here, gRNA forms a complex with Cas9, a restriction enzyme that cuts the double helix of DNA. When this enzyme is placed in the part where the gene is to be manipulated, the target DNA sequence is found and Cas9 cuts the DNA. Cells have the ability to repair DNA when it is broken. If this process is repeated, a “recovery error” appears and several bases differ from the original sequence. When this difference occurs, CRISPR stops working, and the sequence changed due to a repair error cannot perform its original function.

In this way, it becomes possible to accurately find and knock out the gene to be cut, and by using this technology, not only can the gene be cut, but also the gene can be added to the desired location.

As a result, CRISPR/Cas9 can generate randomly formed insertions or deletions (indels) at the target site, resulting in gene knockout.

For example, when gRNA targeting the MpigI (Monascus pigment I) gene and CRISPR/Cas9 are used, insertion or deletion occurs in the MpigI gene by CRISPR/Cas9 guided to the MpigI gene by gRNA, resulting in knockout of the MpigI gene. and, accordingly, the production of Monascus pigment can be increased.

According to one embodiment, the first PAM sequence present at positions 989 to 991 of the MpigI locus shown in SEQ ID NO: 1 and positions 1450 to 1452 of the MpigI locus shown in SEQ ID NO: 1 using the CRISPR/Cas9 system. Mutation of the MpigI locus represented by SEQ ID NO: 1 can be caused by recognizing the second PAM sequence present at the position.

According to one embodiment, using the CRISPR/Cas9 system, a first PAM sequence present at positions 152 to 154 of the MpigI' locus shown in SEQ ID NO: 2 and positions 537 to 537 of the MpigI' locus shown in SEQ ID NO: 2 By recognizing the second PAM sequence present at position 539, mutation of the MpigI locus represented by SEQ ID NO: 2 can be caused.

The present invention also relates to a method for producing a Monascus pigment comprising culturing the Monascus ruber described above or the Monascus ruber in the composition described above.

Monascus ruber with attenuated or deleted MpigI (Monascus pigment I) or Mpig I' (Monascus pigment I') gene and a composition containing the same are as described above.

The method for cultivating the Monascus louver of the present invention may be a conventional culturing method of fungal microorganisms of the Monascus genus. For example, a liquid medium or solid medium composed of a carbon source, a nitrogen source, and trace elements essential for bacterial growth can be used as the culture medium.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and the present invention is not limited thereto.

Example

1. Materials and Methods

(1) Strains and plasmids

Escherichia coli TOP10 strain (Invitrogen Co, Carlsbad, CA, USA) was used as a general cloning host. The plasmid was propagated in Luria-Bertani (LB) medium (0.5% [w/v] yeast extract, 1% [w/v] tryptone, 1% [w/v] NaCl) at 37°C with 50 μg/ml ampicillin. has grown Strain M. ruber was isolated from Korean traditional fermented food, and strain M. purpureus BCRC 31541 was purchased from BCRC (Bioresources Collection and Research Center) in Taiwan. Both strains were cultured at 30°C in PDA medium for mycelial collection. For protoplast regeneration and transformation resistance, molten regeneration medium (0.1% [w/v] yeast extract, 0.1% [w/v] casein enzyme hydrolyzate, 1 M) with 200 μg/ml hygromycin B. Sucrose, 1.6% [w/v] Agar) was prepared for selection. Plasmid pFC 332 (#87845) containing the Cas9 expression cassette was purchased from Addgene Inc (Watertown, MA, USA). Primer synthesis was performed at Bioneer (Daejeon, Korea), and the primers used in the present invention are listed in Table 1.

order
number primer Sequence (5' → 3') explanation 3 F_ M. ruber CTCAATGCTGGTCGTCTCG random PCR of
M. ruber 4 R_ M. ruber TGACTACCTCTCTCCGGGAA 5 F_cas9pFC332 GAAGTATAGCATCGGGCTGG flanking regions of cas9 6 R_cas9pFC332 TGACTAAGGTCGATACGGGT 7 F_MpigI TCAGCCGTAGCCCAGAGGTG amplification of MpigI 8 R_MpigI ATGTGGATTGGCCTGCTCTTCG 9 F_MpigI ' GCAGAAACTGCCTCACCAGG amplification of MpigI' 10 R_MpigI ' ATCTCACTGACCTGCCAGGC 11 F_sgRNA 1 TAATACGACTCACTATAGGACTCGACTGCTCCCTCCACAGTTTTAGAGCTAGAA in vitro transcription of sgRNA 12 F_sgRNA 2 TAATACGACTCACTATAGGGTAAGCGCACCTCTGGGCTAGTTTTAGAGCTAGAA 13 F_sgRNA 3 TAATACGACTCACTATAGGTCTCCTCCCTGCTCACACAAGTTTTAGAGCTAGAA 14 F_sgRNA 4 TAATACGACTCACTATAGGAGCTCCTTCAAAGCCAGCTGGTTTTAGAGCTAGAA 15 R_sgRNA AGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC 16 F_MpigI_del TTCAGGTAGAGCAGCAGCGT flanking regions of MpigI 17 R_MpigI_del GGGCAGATTGATCGTCCGAT 18 F_ MpigI' _del TGGCCGCTGCGAAGGGAATA flanking regions of MpigI' 19 R_ MpigI' _del ATCGTGCACAGCGTGGCATTC 20 GAPDH_F GAGATCAAGCAGGCCATCAAG RT-PCR analysis of GAPDH 21 GAPDH_R GTAACCCCACTCGTTGTCGT 22 F_MpigI_RT AGACGCTGCTGCTCTACCT RT-PCR analysis of MpigI 23 R_MpigI_RT CAGACAGTCGAACTGGACGA 24 F_ MpigI' _RT GGCGGACATAGGTGCACG RT-PCR analysis of MpigI' 25 R_ MpigI' _RT CAGCAGCAGCTCCTTCAAAAG 26 F_MpigA_RT CCTGAATGGGTGCAACGAGTAC RT-PCR analysis of MpigA 27 R_MpigA_RT TATGTACCGCCTCTGCACTG

(2) Fungal DNA extraction and whole genome sequencing

Genomic DNA of M. ruber was previously extracted using a slightly modified glass beads method (Aamir, 2015). The fungal mass obtained from PDA was placed in a 2 mL tube containing sterile glass beads and lysis buffer (100 mM Tris HCl pH 8.0, 50 mM EDTA, 3% [w/v] SDS). The tube containing the fungal mass was vortexed vigorously for 20 minutes. After the homogenization process, RNase A was added and incubated at 37°C for 15 minutes. Next, an equal amount of phenol:chloroform:isoamyl alcohol (25:24:1) was added to the supernatant and centrifuged at 12,000 rpm for 10 minutes. The upper aqueous layer was taken and then an equal volume of 100% ethanol was added. The mixture was kept at -20°C for 30 minutes and centrifuged at 12,000 rpm for 10 minutes. The precipitated DNA pellet was washed twice with 70% ethanol, air dried, and dissolved in TE buffer. The quantity and purity of DNA were determined using a NanoVue Plus Spectrophotometer (GE Health Care Co., Nordrhein-Westfalen, Germany) and an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

Samples were prepared according to the protocol for sequencing on the PacBio Sequel system. DNA templates were sequenced using a PacBio RS II sequencer. De novo assembly was performed using FALCON and CANU (v1.7) software. This was accomplished by mapping single pass reads to seed reads representing the longest part of the read length distribution. Afterwards, a consensus sequence of mapped reads was generated, resulting in a long, highly accurate fragment of the target genome. Next, the reads were corrected and filtered because some reads did not provide additional information about the genome organization. Additionally, reads with too high or too low overlap were filtered out. Since the overlapping data contains information about each contig, higher quality contigs were constructed through a self-mapping step. After the complete genome was assembled, the locations of protein coding sequences and genes were identified. Next, I annotated the function. Maker (v.2.31.8) was used to predict positions, and Protein BLAST+ was performed with UniProt Swiss-Prot (201806).

(3) Analysis method

Citrinin was analyzed via HPLC. The supernatant was centrifuged at 12,000 rpm for 10 minutes and then filtered through a 0.22㎛ membrane filter. HPLC was performed on an UltiMate 3000 BioRS system (Thermo Fisher Scientific, Walthan, MA, USA), and an inertsil ODS-3 column (4.6 mm × 250 mm, i.d., 5 μm) was used as the stationary phase. A mixture of ACN, water, and 0.5% orthophosphoric acid in a ratio of 70:25.5:4.5 (v/v/v) was used as the mobile phase at a flow rate of 0.8 mL/min. The injection volume was 10 μL, and the column temperature was set at 30°C.

Citrinin content was monitored with a fluorescence detector at 331 nm excitation wavelength and 500 nm emission wavelength. The supernatant was removed through centrifugation, and fermentation samples were collected every two days. After filtration, the absorbance of three Monascus pigments (yellow, orange, and red) was measured using a UV-1800 spectrophotometer (Shimadzu Co., Kyoto, Japan). The pigment yield was determined by measuring optical density (OD) values at 410, 465, and 505 nm. Prior to monacolin K analysis, monacolin K was extracted according to the reported method with slight modifications. Wild type and mutants were inoculated into PDB for 14 days. The mycelium was dried by heating in an oven at 60°C and finely ground to powder. Approximately 0.1 g of the preparation was extracted with 4 mL of 75% ethanol for 10 minutes in an ultrasonic bath and then centrifuged at 4200 rpm for 10 minutes. The supernatant was filtered through a 0.22 μm membrane filter. Monacolin K was analyzed via HPLC as previously described. HPLC was performed on an UltiMate 3000 BioRS system (Thermo Fisher Scientific, Walthan, MA, USA), and an inertsil ODS-3 column (4.6 mm × 250 mm, i.d., 5 μm) was used as the stationary phase. A mixture of ACN, water, and 0.5% orthophosphoric acid in a ratio of 60:37:3 (v/v/v/) was used as the mobile phase at a flow rate of 1.0 mL/min. The injection volume was 20 μL and the column temperature was set at 25°C. Monacolin K content was monitored with a DAD detector at 237 nm.

(4) Genetic methods

To efficiently inactivate the target gene, a dual sgRNA was designed to induce Cas9 to simultaneously cleave two sites located 438 bp away from MpigI and 362 bp away from MpigI'. The PAM sequence must be present at the 3' end of the target DNA sequence. Twenty nucleotides upstream of the PAM sequence (5'-20NGG-3') in MpigI and MpigI' were designed with the SnapGene tool. The sgRNA DNA template was assembled and transcribed using the MEGAscript T7 kit (Thermo Fisher Scientific, Walthan, MA, USA) according to the manufacturer's protocol. After in vitro transcription, the enzymatic reaction was purified with the MEGAclaer kit (Thermo Fisher Scientific, Walthan, MA, USA). The amount and purity of sgRNA were measured using a NanoVue Plus Spectrophotometer (GE Health Care Co., Nordrhein-Westfalen, Germany). The purified sgRNA was stored at -80°C, and 100 μg of the synthesized sgRNA fragment was transformed into a Cas9 expression transformant.

The transformation method using PEG was followed with some modifications. The wild-type M. ruber strain was inoculated onto PDA and cultured at 30°C for 7 days. Asexual spores (conidia) on the plate were harvested by gently scraping the agar with sterile distilled water. After filtering the spores through a 40 ㎛ nylon filter, the filtered spore suspension was inoculated into 100 mL of PDB at 30°C for 18 hours. The mycelium was then collected and washed with sterile 0.7M NaCl. Afterwards, the mycelium was suspended in 10 mL of enzyme solution and incubated at 30°C for 2 hours. Protoplast release was confirmed every 30 minutes by microscopic observation. The released protoplasts were carefully filtered twice, first using sterilized Miracloth and then using a 40 μm nylon filter. Next, the protoplasts were washed three times with STC buffer (1M sucrose, 50mM Tris-HCl, and 50mM CaCl ₂ pH 8.0). Finally, the protoplasts were resuspended in 500 μL STC buffer and the density was adjusted to approximately 107-108. Approximately 10 μg of linearized plasmid DNA and 100 μg of sgRNA were added to 100 μl of protoplast suspension and incubated on ice for 20 minutes. Then, freshly prepared PEG buffer (40% [w/v] PEG 4000, 50mM Tris-HCl, and 50mM CaCl ₂ pH 8.0) was added. After transformation, protoplasts were incubated in molten regeneration medium at 30°C for 3-5 days. Finally, transformants were randomly selected and cultured on PDA for genomic DNA extraction and further analysis.

Genomic DNA was extracted as described above. To confirm the integration of Cas9, PCR amplification was performed using AccuPower Taq PCR premix (Bioneer Co., Daejeon, Korea) and evaluated through gel electrophoresis. Gene disruption in individual transformants was confirmed by Sanger sequencing.

(5) RNA extraction and RT-PCR analysis

Mycelia of wild-type M. ruber strains and mutants from 7-day-old cultures were homogenized in liquid nitrogen and ground to powder in a precooled mortar and pestle. Then, it was processed with the Universal RNA extraction kit (Bioneer Co., Ltd., Daejeon, South Korea) according to the manufacturer's protocol. The amount and purity of RNA samples were measured using a NanoVue Plus Spectrophotometer (GE Health Care Co., Nordrhein-Westfalen, Germany), and cDNA was synthesized using an AccuPower RT premix kit (Bioneer Co., Daejeon, Korea). For cDNA synthesis, 1 μg of RNA was reverse transcribed in a 20 μL reaction. GAPDH was used as an internal control, and the band intensity of the PCR product was compared with GAPDH. cDNA synthesis and PCR amplification were performed with the following thermal cycling conditions: cDNA synthesis at 42°C for 60 min, reverse transcriptase inactivation at 94°C for 5 min, and 95°C for 20 s, 60°C for 20 s, and 60°C for 20 s. Amplification of cDNA with 24 cycles at 72°C. As before, PCR amplification was performed using AccuPower Taq PCR premix and appropriate primers (Table 1) and evaluated through gel electrophoresis.

2. Experimental results

(1) Whole genome sequencing and assembly

The complete genome sequence of M. ruber was generated using a PacBio RSII sequencer (Pacific Biosciences, Menlo Park, CA, USA), and de novo genome assembly was performed using CANU (v1.7) software. The general characteristics of the entire genome sequence of M. ruber are listed in Table 2. Table 2: General features of the M. ruber genome.

characteristic value Total length (Mb) 25.9 GC content (%) 48.84 gene count 9,639 DNA contig 13 Contig N50 (bp) 3,185,132 Average contig length (bp) 1,993,001 Maximum contig length (bp) 3,583,328 Minimum contig length (bp) 21,886

PacBio SMRT long-read sequencing after filtering yielded 737,395 reads with an N50 value of 14.9 kb. Duplicate reads originating from the same region of the genome can be linked together to form contigs. As a result, a total length of 25.9 Mb was generated from 13 contigs, and the GC content was 48.84%. The N50 value increased from 14.9 kb to 3.1Mb. The maximum contig length is approximately 3.6 Mb and the average contig length is approximately 2.0 Mb. As a result, a higher quality consensus sequence was generated and a nearly complete sequence of M. ruber strains was achieved. After analyzing the genome, the locations of protein genes were predicted and their functions were annotated. Protein BLAST+ (v2.6.0) was performed with UniProt Swiss-Prot (201806), while position prediction was performed using Maker (v2.31.8). A total of 9,639 genes were predicted and annotated. For RNA, 154 tRNAs and 41 rRNAs were predicted.

The publicly available complete genome sequence of Monascus spp. was obtained from NGS in a previous study. According to a previous study, M. purpureus YY-1 has been widely used as food coloring in China, and the genome size of this strain was reported to be 24.1 Mb, including 7,491 genes. Figure 1A shows a comparison of M. ruber and M. purpureus YY-1 genome positions. The genome information of M. Pilosus NBRC4520, M. purpureus NBRC4478, and M. ruber NCBR4485 were also reported with limited information using the Illumina Miseq platform. The genome size of M. pilosus NBRC4520, M. purpureus NBRC4478, and M. ruber NCBR4485 was approximately 24 Mb and contained approximately 8,600 to 8,900 genes. Accordingly, among the publicly available whole genome sequences of Monascus spp., the isolated M. ruber strains possessed more genes and showed increased genome size.

(2) Identification of secondary metabolite gene clusters in fungal genomes

Gene clusters involved in the biosynthesis of secondary metabolites were identified in the genome of M. ruber (Table 3).

All genes related to monacolin K and monascus pigment biosynthesis were located in contig 2. The results of gene annotation found two different MpigI loci, showing that two different MpigIs exist in M. ruber. While the gene clusters for Monascus pigment and monacolin k are present, the gene cluster for citrinin is almost lost, suggesting that M. ruber could be a promising industrial strain without citrinin production. According to previous studies, citrinin production was controlled by optimization of culture conditions or application of genetic engineering. Optimization of culture conditions is a traditional strategy to control citrinin levels, and it is difficult to completely block citrin production. Therefore, manipulation of citrinin biosynthesis-related genes can be a more practical way to eliminate citrinin concentration by applying genetic engineering. Table 3: Gene annotation information

For engineering approaches, the genome of M. ruber strains was investigated in detail. The citrinin gene cluster of M. ruber strains isolated from Monascus spp. is shown in Figure 1b. Most of the citrinin gene cluster of M. ruber, including ctnA, was lost (Fig. 1b). Disruption of the ctnA gene in M. purpureus reduced citrinin production to barely detectable levels. Therefore, M. ruber may not be able to produce citrinin during liquid fermentation. To verify this, HPLC analysis was performed to detect citrinin, and M. purpureus strain was used as a control strain. M. purpureus BCRC 31541 produced approximately 238.26 ± 15 μg/mL of citrinin on day 18 of culture, but M. ruber wild type and CRISPR mutant strains were unable to produce citrinin (Figure 1c). There was no significant difference in growth between the M. ruber strain and the M. purpureus BCRC 31541 strain. Taken together, the results of the genome sequence and HPLC analysis both showed that the ability of M. ruber to produce the nephrotoxin citrinin was disrupted and that this strain could serve as a promising industrial strain.

A gene involved in monacolin K biosynthesis was found in the genome of the M. ruber strain (Figure 1d). The putative mokA (LOCUS_001578) appears to function as a monacolin k nonaketide synthetase, and the putative mokB (LOCUS_001587) appears to be responsible for the biosynthesis of the side chain diketide moiety. mokH (LOCUS_001585) may act as a transcription factor regulating genes involved in monacolin K biosynthesis (Table 3). In addition to these genes, a putative mokE (LOCUS_001582) encoding a dehydrogenase, a putative acyltransferase mokF (LOCUS_001583), and two mokCs (LOCUS_001576 and LOCUS_001577) encoding a dihydromonacolin L monooxygenase are known to be monooxygenacolin. There was a possibility of constructing a K biosynthetic pathway.

The schematic pathway of Monascus pigment biosynthesis is shown in Figure 1e. Based on the genome sequence, the biosynthesis of the Monascus pigment appears to begin with the condensation of Acetyl-CoA and Malonyl-CoA, leading to the formation of a hexaketide chromophore by a putative polyketide synthase (MpgiA, LOCUS_001533) (Table 3). Monascus pigment synthesis requires a chemical reaction by esterification of a polyketide chromophore and β-keto acid. In the genome of M. ruber strains, the putative amine oxidase MpigF (LOCUS_001528) and the putative fatty acid synthase subunit alpha MpigJ (LOCUS_001523) are likely to be involved in this process. MpigD (LOCUS_001530), encoding 3-O-ethyltransferase, can induce the formation of an orange pigment by esterification. Transcriptional regulation of Monascus pigments appears to be controlled by a transcriptional activator (MpigB, LOCUS_001532) and two negative regulators (MpigI, LOCUS_001524 and LOCUS_001525).

In general, it is known that the reduction reaction of an orange pigment forms a yellow pigment, while the amination reaction of an orange pigment forms a red pigment. Several studies have been conducted on the gene cluster of Monascus pigment biosynthesis, and it has been found that MpigA encodes a polyketide synthase and catalyzes the biosynthesis of the major aromatic ring intermediate. Therefore, inactivation of MpigA, a homolog of MpKS5, abolished pigmentation and displayed an albino phenotype in M. purpureus mutant W 13, confirming that MpigA was involved in pigment production.

(3) Construction of CRISPR/Cas9 system for M. ruber strain

To construct a CRISPR/Cas9 system, the cas9 gene must be successfully integrated into an organism. To obtain stable Cas9 expression transformants, plasmid pFC 332 containing the cas9 gene with SV40 nuclear localization signal (NLS) under the control of the tef1 promoter and terminator of Aspergillus nidulans was transformed through PEG-mediated transformation. Since the formation of stable and viable protoplasts is the most important factor in PEG-mediated transformation, the yield of protoplasts was frequently observed under the microscope. A series of hygromycin-resistant transformants of M. ruber were generated. Because plasmid pFC 332 lacks a fungal replication origin, integration of the plasmid into the genome may result in excision in the cas9 coding region. To confirm that the cas9 coding region was correctly inserted into the hygromycin-resistant transformants, genomic PCR was performed using primers adjacent to the cas9 coding sequence. Eleven of the 15 transformants were confirmed to have the 4.1 kb cas9 gene correctly integrated into the genome.

In the CRISPR/Cas9 system, sgRNA can be delivered via plasmids or as synthetic oligonucleotides. However, vector-based sgRNA systems can be difficult to assemble because they require the construction of multiple vectors with different sgRNAs for different target genes. In the present invention, in vitro synthesized sgRNA was adopted for transformation of Cas9 transformants to inactivate MpigI and MpigI'. As previously mentioned, MpigI was speculated to be a negative transcriptional regulator in previous studies. Although increased production of Monascus pigments has been studied to a limited extent in Monascus spp., it was hypothesized that inactivation of negative regulators could inhibit production of Monascus pigments. To confirm the above hypothesis, we performed inactivation of MpigI and MpigI' via the CRISPR/Cas9 system. The efficiency of inducing mutations using the CRISPR/Cas9 system mainly depended on the induction of double-strand breaks (DSBs) at selected target sites. To efficiently knock out the selected target site, dual sgRNA was designed to guide Cas9 to simultaneously cleave both sites at an interval of 438 bp for MpigI and 362 bp for MpigI'. Figure 2a illustrates the location of the dual target sites of each locus of targets 1 and 2 of MpigI (middle) and targets 3 and 4 of MpigI' (bottom). In Figure 2a, the Locus 001524 sequence of MpigI is the sequence of SEQ ID NO: 1, and the Locus 001525 sequence of MpigI' is the sequence of SEQ ID NO: 2. Transformation using dual sgRNA is expected to generate DSBs at both target sites, resulting in insertion and deletion (InDel), which can be easily detected through PCR amplicons. Therefore, the production of InDel with two sgRNAs will knock out the function of the gene and then inactivate the inhibition of pigment production.

(4) Sequencing analysis of CRISPR mutations

The introduced DSBs led to random mutations due to the error-prone repair mechanism of the NHEJ system. Putative transformants were genotyped by PCR amplification of the MpigI and MpigI' coding sequences from genomic DNA using primers flanking both upstream and downstream cleavage sites, with an expected size of 1.9 kb for MpigI and 1.4 kb for MpigI'. It is kb. As shown in Figure 2B, the resulting PCR amplicons of some transformants showed shorter lengths than expected, suggesting that some DNA fragments may be deleted in the target region. Distinguishing the size of PCR products from wild type and mutants with indels in the CRISPR target gene can be detected by PCR genotyping. Additional sequencing analysis was necessary to confirm mutations in the MpigI and MpigI' genes by CRISPR/Cas9 because some substitutions could generate PCR products of similar size from the transformants. To examine the PCR amplicons in more detail, PCR products from transformants harboring mutations at the putative MpigI and MpigI' loci were purified and then sequenced.

MpigI16-7,

MpigI16-15,

MpigI16-17,

MpigI16-22,

MpigI'14-5, 및

MpigI'14-7.

MpigI16-7 및

MpigI16-15의 PCR 유전자형 분석 결과는 야생형 PCR 앰플리콘(amplicon)과 거의 동일하였다. 그러나, 시퀀싱을 했을 때 MpigI의 두 표적 부위 사이에서 뉴클레오타이드 치환이 동시에 일어났고, 이러한 뉴클레오타이드 치환은 야생형 서열과 비교했을 때 하나의 뉴클레오타이드 삽입을 일으켰다(도 2c, 도 2d 및 도 2e).

MpigI16-17,

MpigI16-22 및

MpigI'14-7의 PCR 유전자형 분석은 더 짧은 앰플리콘을 생성하여 표적 영역에서 결실이 발생했음을 나타낸다. 시퀀싱 결과

MpigI16-17에서 461bp 결실,

MpigI'16-22에서 477bp 결실,

MpigI'14-7에서 385bp 결실이 나타났다(도 2c, 도 2d 및 도 2e).

MpigI'14-5의 PCR 산물은 야생형 균주보다 약간 길었고, 이는 일부 DNA 단편이 표적 부위에 삽입될 수 있음을 시사한다. 시퀀싱 결과 표적에 48 bp 삽입이 도입된 것으로 나타났다(도 2c, 도 2d 및 도 2e).

MpigI'14-5의 MpigI' 서열에 어떤 DNA 단편이 삽입되었는지 확인하기 위해 서열을 추가로 분석하였다. 흥미롭게도, 삽입된 서열은 T7 프로모터 및 tracrRNA의 서열을 포함하는 sgRNA 4로 특성화되었다. 따라서, MpigI' 프로토스페이서(protospacer) 4의 sgRNA는 실제로 sgRNA MpigI' 프로토스페이서 3의 표적 부위에 삽입되었다(도 2a). 돌연변이의 시퀀싱 데이터는 MpigI 및 MpigI' 둘 다의 표적 부위 사이에 큰 인델의 검출을 보여주었다. 그러나, 표적 부위에서 다양한 작은 인델, 단일 뉴클레오타이드 인델 또는 치환은 이때 관찰되지 않았다. 듀얼 sgRNA 시스템이 Cas9가 각 표적 부위를 절단하도록 안내하기 위해 사용되었기 때문에, 이 시점에서 두 표적 부위 사이의 DNA 서열의 큰 결실이 검출된 것으로 보였다. 표적 부위에 단일 sgRNA를 적용하는 대신, 듀얼 sgRNA를 전달하면 큰 인델이 검출될 수 있으므로 듀얼 sgRNA는 표적 유전자의 비활성화에 유용할 수 있다.Thirty-five transformants were generated using dual sgRNA. According to gel electrophoresis and sequencing results, six putative mutations were obtained:

MpigI16-7;

MpigI16-15,

MpigI16-17;

MpigI16-22,

MpigI'14-5, and

MpigI'14-7.

MpigI16-7 and

The results of PCR genotyping of MpigI16-15 were almost identical to the wild-type PCR amplicon. However, when sequenced, nucleotide substitutions occurred simultaneously between the two target sites of MpigI, and these nucleotide substitutions resulted in a single nucleotide insertion compared to the wild-type sequence (Figures 2C, 2D, and 2E).

MpigI16-17;

MpigI16-22 and

PCR genotyping of MpigI'14-7 produced a shorter amplicon, indicating that a deletion occurred in the target region. Sequencing results

461bp deletion in MpigI16-17;

477bp deletion in MpigI'16-22;

A 385 bp deletion was seen in MpigI'14-7 (Figure 2C, Figure 2D and Figure 2E).

The PCR product of MpigI'14-5 was slightly longer than that of the wild-type strain, suggesting that some DNA fragments may be inserted into the target site. Sequencing results showed that a 48 bp insertion was introduced into the target (Figure 2C, Figure 2D and Figure 2E).

The sequence was further analyzed to confirm which DNA fragment was inserted into the MpigI' sequence of MpigI'14-5. Interestingly, the inserted sequence was characterized as sgRNA 4, which contains the sequences of the T7 promoter and tracrRNA. Therefore, the sgRNA of MpigI' protospacer 4 was actually inserted into the target site of sgRNA MpigI' protospacer 3 (Figure 2a). Sequencing data of the mutants showed detection of a large indel between the target sites of both MpigI and MpigI'. However, various small indels, single nucleotide indels or substitutions at the target site were not observed at this time. Because a dual sgRNA system was used to guide Cas9 to cleave each target site, large deletions of DNA sequence between the two target sites appeared to be detected at this point. Instead of applying a single sgRNA to the target site, delivering dual sgRNAs allows for the detection of large indels, so dual sgRNAs may be useful for inactivation of target genes.

(5) Characterization of CRISPR mutations

MpigI16-15와

MpigI16-22는 약간 작은 콜로니 직경을 보였다. 두 돌연변이를 제외한 다른 돌연변이는 야생형 M. ruber 균주와 유사한 콜로니 직경을 나타내어 MpigI 또는 MpigI' 유전자좌의 파괴가 성장에 큰 영향을 미치지 않았음을 나타낸다. Colony diameter is a reliable indicator of mold growth. To determine whether disruption of the MpigI or MpigI' loci led to abnormal growth, individual colonies of wild-type M. ruber and mutants growing on PDA were measured at 2-day intervals for 14 days ( Fig. 3A ). During mutation

With MpigI16-15

MpigI16-22 showed slightly smaller colony diameters. All but two mutants showed similar colony diameters to the wild-type M. ruber strain, indicating that disruption of the MpigI or MpigI' loci did not significantly affect growth.

To investigate the resulting mutant phenotypes, the colony morphology of the wild-type M. ruber strain and the mutants was monitored at 4-day intervals for 12 days. The colony phenotype of the mutants for PDA was different when compared to that of wild-type M. ruber ( Fig. 3B ). As previously mentioned, disruption of this gene can disable pigment production inhibition when the Cas9 endonuclease and sgRNA are appropriately applied to M. ruber against the target genome. According to the hypothesis, Cas9-mediated cleavage of MpigI and MpigI' led the mutant to produce more pigment. These results may occur due to inactivation of negative regulators involved in gene repression in Monascus pigment production. To investigate Monascus pigments in more detail, the three main Monascus pigments (yellow, orange, and red) were analyzed using UV-vis spectrophotometry. Monascus pigment production of wild type and mutants was detected in liquid phase fermentation. The three major Monascus pigments (Figure 3(c) yellow, (d) orange, and (e) red pigment) of wild type and mutant were measured every 2 days for 14 days.

MpigI 및

MpigI' 돌연변이 중

MpigI'14-5(황색 선)는 액체 상태 발효에서 다른 돌연변이보다 주황색과 적색에서 훨씬 적은 색소를 생성하였다. 다른 돌연변이와 달리 Cas9 매개 절단은

MpigI'14-5의 단일 표적 부위에 작은 삽입을 초래하여 색소 억제가 완전히 방해받지 않았다. 듀얼 sgRNA로 확립된 다른 돌연변이는 야생형 M. ruber보다 훨씬 더 많은 색소를 생성하였다. 이들 돌연변이 중

MpigI16-17(주황색 선)은 다른 돌연변이보다 가장 많은 색소를 생산하였으며,

MpigI16-17의 콜로니 형태는 맑은 적색 원의 표현형을 입증하였다. 돌연변이의 겉보기 색상은 더 복잡했지만 모나스커스 색소의 생산은 야생형 균주보다 유의하게 증가하였다(도 3f). 전체적으로 Cas9 매개 절단에 의해 유전자의 기능이 파괴되었고 MpigI 및 MpigI'에 의한 색소 억제가 억제된 것으로 나타났다. Wild-type M. ruber mainly produced yellow pigment, and red and orange pigment production was reduced. However, the mutant gained the ability to produce red and orange pigments along with increased yellow pigment. Cas9-mediated disruption of MpigI and MpigI' was shown to cause the mutant to produce more pigment. Clearly, the results of pigment production in liquid phase fermentation were consistent with the results of colony morphology.

MpigI and

Among MpigI' mutations

MpigI'14-5 (yellow line) produced significantly less pigment in orange and red than the other mutants in liquid phase fermentation. Unlike other mutations, Cas9-mediated cleavage

A small insertion into the single target site of MpigI'14-5 resulted in pigment inhibition being completely undisturbed. Other mutants established with dual sgRNA produced significantly more pigment than wild-type M. ruber. Among these mutations

MpigI16-17 (orange line) produced the most pigment than other mutants;

Colony morphology of MpigI16-17 demonstrated a clear red circle phenotype. Although the apparent color of the mutant was more complex, the production of Monascus pigment was significantly increased compared to the wild-type strain (Figure 3f). Overall, the function of the gene was disrupted by Cas9-mediated cleavage, and pigmentation inhibition by MpigI and MpigI' was suppressed.

To determine whether Cas9-mediated cleavage of MpigI and MpigI' could affect citrinin production, citrinin production was analyzed using HPLC-FLD detector. As previously mentioned, PacBio SMRT sequencing results concluded that the gene cluster of citrinin biosynthesis was largely lost in M. ruber. Although the wild-type M. ruber strain failed to produce citrinin, it was necessary to reconfirm citrinin production in the CRISPR mutant. As shown in Figure 4a, wild-type M. ruber did not produce citrinin, while M. purpureus BCRC 31541 produced 115.6 ± 10.8 μg/mL of citrinin. Additionally, none of the mutants grown under identical conditions produced citrinin. Therefore, Cas9-mediated cleavage of MpigI and MpigI' did not appear to affect citrinin biosynthesis. After 14 days of culture, monacolin K was extracted and analyzed using an HPLC-UV detector.

MpigI16-22 및

MpigI'14-5는 야생형 M. ruber 균주에 비해 유의하게 증가된 양의 모나콜린 K를 생성하였다. 돌연변이

MpigI16-17은 야생형 균주와 비교하여 모나콜린 K의 양의 감소를 보였다. 돌연변이

MpigI16-17은 붉은색과 오렌지색 색소를 현저하게 생산했기 때문에 모나콜린 K 생산을 줄일 수 있다. 모나스커스 색소와 모나콜린 K는 빌딩 블록으로 malonyl-CoA와 acetyl-CoA를 필요로 하므로 하나의 과잉 생산이 다른 것을 감소시킬 수 있다. 다른 돌연변이 균주에서는 CRISPR/Cas9 기술에 의한 MpigI 및 MpigI'의 비활성화 효과가 무시할 수 있는 것으로 간주된다. 전체적으로 MpigI 및 MpigI'의 Cas9 매개 절단은 모나콜린 K 생합성에 어떤 상관관계도 나타내지 않았다.Both lactone and acid forms of monacolin K were found in wild type and mutant. Figure 4b shows the total amount of both forms of monacolin K. The wild-type M. ruber strain produced 3.52 ± 0.37 μg/mL of total monacolin K. mutation

MpigI16-22 and

MpigI'14-5 produced a significantly increased amount of monacolin K compared to the wild-type M. ruber strain. mutation

MpigI16-17 showed a decrease in the amount of monacolin K compared to the wild-type strain. mutation

MpigI16-17 can reduce monacolin K production because it significantly produced red and orange pigments. Monascus pigment and monacolin K require malonyl-CoA and acetyl-CoA as building blocks, so overproduction of one can reduce the other. In other mutant strains, the effect of inactivation of MpigI and MpigI' by CRISPR/Cas9 technology is considered negligible. Overall, Cas9-mediated cleavage of MpigI and MpigI' did not show any correlation to monacolin K biosynthesis.

(6) RT-PCR analysis of CRISPR mutations

MpigI 및

MpigI'의 돌연변이를 oligo-dT 프라이머를 사용하여 추출하고 cDNA로 합성하였다(표 1). 7일 된 배양액에서 추출한 총 RNA를 RT-PCR의 주형으로 사용하였다. 역전사 단계가 생략된 경우 증폭된 산물이 검출되지 않아 게놈 DNA 오염이 배제되었다. RT-PCR 증폭의 겔 이미지는 내부 대조군으로서 MpigA(폴리케타이드 합성효소), MpigI, MpigI' 및 GAPDH(glyceraldehyde 3-phosphate dehydrogenase)의 특정 증폭을 초래하였다(도 4c). 도 4c에 도시된 바와 같이, 유전자의 발현은 겔 이미지를 이용하여 정량화하였다. 모나스커스 색소 생산과 관련된 유전자 중 MpigI의 Cas9 매개 절단은 야생형 균주와 비교하여 돌연변이(

MpigI16-7,

MpigI16-15,

MpigI16-17,

MpigI16-22)의 하향 조절을 유도하였다. 또한 MpigI'의 Cas9 매개 절단은 MpigI'14-7의 상당한 하향 조절을 유도하였다. 그러나 MpigI'14-5에서는 MpigI' 유전자 발현의 유의한 하향 조절이 발견되지 않았다. 이는 돌연변이 균주가 삽입 후에도 전사체의 발현이 여전히 유지되었지만 음성 조절인 MpigI'의 기능이 손상되었음을 나타내었다. 모나스커스 색소 생합성에 관여하는 MpigA 유전자의 전사체 수준은 야생형 균주에 비해 CRISPR 매개 돌연변이 균주에서 증가하였다. 이는 음성 조절자(MpigI 및 MpigI')의 비활성화로 인한 것으로 보인다. 전체적으로 모나스커스 색소 경로의 탈억제(derepression)는 음성 조절자의 비활성화에 의해 유도되어 모나스커스 색소의 생산을 증가시켰다.To investigate the expression of MpigI and MpigI', total RNA of wild-type M. ruber strain and

MpigI and

Mutations in MpigI' were extracted using oligo-dT primers and synthesized into cDNA (Table 1). Total RNA extracted from 7-day-old culture was used as a template for RT-PCR. If the reverse transcription step was omitted, no amplified product was detected, ruling out genomic DNA contamination. Gel images of RT-PCR amplification resulted in specific amplification of MpigA (polyketide synthase), MpigI, MpigI′, and GAPDH (glyceraldehyde 3-phosphate dehydrogenase) as internal controls ( Fig. 4C ). As shown in Figure 4c, gene expression was quantified using gel images. Among the genes involved in Monascus pigment production, Cas9-mediated cleavage of MpigI was observed in mutant (

MpigI16-7;

MpigI16-15,

MpigI16-17;

Downregulation of MpigI16-22) was induced. Additionally, Cas9-mediated cleavage of MpigI' led to significant downregulation of MpigI'14-7. However, no significant down-regulation of MpigI' gene expression was found in MpigI'14-5. This indicated that although the expression of the transcript was still maintained in the mutant strain after insertion, the function of the negative regulator MpigI' was impaired. The transcript level of the MpigA gene, which is involved in Monascus pigment biosynthesis, was increased in the CRISPR-mediated mutant strain compared to the wild-type strain. This appears to be due to inactivation of negative regulators (MpigI and MpigI'). Overall, derepression of the Monascus pigment pathway was induced by inactivation of negative regulators, resulting in increased production of Monascus pigment.

The entire genome of M. ruber was found to have a total length of 25.9 Mb in 13 contigs with 9,639 genes. Among the Monascus pigment gene clusters in the genome, two genes (MpigI and MpigI') were manipulated by CRISPR/Cas9 technology. The CRISPR-engineered mutant clearly showed increased production of Monascus pigment. The present invention will provide valuable information for genome-based microbial engineering of natural food coloring production.

<110> SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION <120> Monascus ruber having attenuated or deleted MpigI or MpigI' gene, composition and method for increasing monascus pigment production comprising the same <130> 21P08035 <160> 28 <170> KoPatentIn 3.0 <210> 1 <211> 1456 <212> DNA <213> Unknown <220> <223> Monascus ruber <400> 1 atgtggattg gcctgctctt cggcgtgatg tgcctgggcg ctgcttttca gcgccagcgg 60 tcgtcgcaga tgcccgaccc gcagcagctg gtccgtctgt accgggagag gatcatccag 120 tgcctggtcg tggggaaata cgccaaatgc gcgccgtaca cgctcgagac gctgctgctc 180 tacctgaaca tcgagtccct gcagagcgag gacacccgcg tcgagacctg gatcctgctg 240 ggcgtcatcg tgcgcctggc gctgcgcatg ggctaccacc gcgatgccag ccacttccccg 300 cacatctccc ccttcgcggc cgagatgcgc cggcgcgtct gggctctcat cgtccagttc 360 gactgtctga catctgccca ggtcgggctg ccgcgcatga tccgcgactc gcagtcggac 420 acggcggagc cgcgcaacct gctcgacgaa gacttcgacg aggacagcac tgccctgccg 480 ctgccccagc ccagcacggt gcagacgccg gtgcagtata tcgtggcgaa gaaccgcatt 540 gtcgcggtct tcggccgcat ctgcgacctg atcacatcca gcagagcgcc ctcctacacc 600 gaagtgatgc agctggacga aaccctacat gagacctacc gctgcgtgcc ggggggcctg 660 cagatgcggc cgatgaccag atcgctcacg gacggggcga cggttatcct gcgccggatg 720 tacattgtcc tgctctacca caaggccgtc tgcatgctgc accaccgcta catggtcccg 780 gcccggacgg acgggcgtta tgcctactcc cgctcgacct gtgttgcggc cgctctgcag 840 atcgtctcgc accagtggac gctgcataat gaagcccagc cgggaggccg tctgtacgaa 900 gagcgctgga aggtctcatc gctcgtcaag agcaccttct tcctgggcac tacgatcctg 960 tgcgcagaac tcgactgctc cctccacaag gagcccgccg acgccgagca atcgccggcc 1020 gagacaggcc tgcggcagca ggtcatccag gctctgcata attcgcacac gatctggcgg 1080 caggctagtg actcctcgcg cgaggccagg cttgcggctg atgtgtccgg tctgcttctc 1140 acccgggcac agaggaaatg gaagctagag atgcggcaag ccggaaaacat gggtgtgtat 1200 tctctctctg tctgtctccg tctgcctctg actcttgcac ctcgactgag atactgttca 1260 cataggcatg tcgtcggaaaa cccccttcat gggagtgtca atcccgccac agagcactac 1320 aatggctgct gccgccgttg cacagccgct gagcatgccg cagctgctgc agttcaatac 1380 cgcggcgcac atagactata gcgatgtcgg tgcggagccg ttgggtcttg taagcgcacc 1440 tctgggctac ggctga 1456 <210> 2 <211> 824 <212> DNA <213> Unknown <220> <223> Monascus ruber <400> 2 tcaagtcagc cggcggggga tcatggctgc cacggccgca gaaactgcct caccaggggc 60 gatgtctttg ttgatgaaat actcggtcac cagtcggtcg accagcggcc gcgggagcat 120 cgccgacagg atctcctccc tgctcacaca acggtagctc ccgaacagga tatcgggctc 180 gtcgggctct gtaggctctg ccgcagctcc tggcccttgg aagggcgcgc tgtcgaccgg 240 attctgctcc tcgcggaagt ggtcccggag ctctgcaatc tgggacagcg tgctggtcag 300 ccaagggatca agccggggga gggggggcgg ccacattacc ccgtccaaga tggccgtcca 360 gtgcgtactc tcgacgtagg cagtctccat cttctcgatc ttgatgcgac cgaagcggtc 420 cgacagctgc ggtgcctcct ccctagccgc cgagtcggcc gcattgacgg cctcgccagg 480 cgccgtggcg ggagcggcag cgccagcggc agcagcagct ccttcaaagc cagctgcggt 540 cgagtcggac ggcatgggct ctttggcgga tggcgttctg cccgcgtgga ccgtgtccat 600 caacgtggtg atcagccgct ccagctggcc gatccgctcc ggcaggtttt caacgcccgc 660 cggacggccc tgggcgcggt cgatgcgctc gggcgctgca ctgggagggc ggacataggt 720 gcacgacagc gaaaggccgc ggcggacaca cgtttcgcat ggctggcggc ggtcacatcg 780 gagcctggca ggtcagtgag atgggcatcc gcgcatccgg gcat 824 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Monascus ruber_forward primer <400> 3 ctcaatgctt ggtcgtctcg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Monascus ruber_reverse primer <400> 4 tgactacctc tctccgggaa 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> cas9 pFC332_forward primer <400> 5 gaagtatagc atcgggctgg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> cas9 pFC332_reverse primer <400> 6 tgactaaggt cgatacgggt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MpigI_forward primer <400> 7 tcagccgtag cccagaggtg 20 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MpigI_reverse primer <400> 8 atgtggattg gcctgctctt cg 22 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MpigI'_forward primer <400> 9 gcagaaactg cctcaccagg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MpigI'_reverse primer <400> 10 atctcactga cctgccaggc 20 <210> 11 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> F_sgRNA 1 <400> 11 taatacgact cactatagga ctcgactgct ccctccacag ttttagagct agaa 54 <210> 12 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> F_sgRNA 2 <400> 12 taatacgact cactataggg taagcgcacc tctgggctag ttttagagct agaa 54 <210> 13 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> F_sgRNA 3 <400> 13 taatacgact cactataggt ctcctccctg ctcacacaag ttttagagct agaa 54 <210> 14 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> F_sgRNA 4 <400> 14 taatacgact cactatagga gctccttcaa agccagctgg ttttagagct agaa 54 <210> 15 <211> 77 <212> DNA <213> Artificial Sequence <220> <223> R_sgRNA <400> 15 agcaccgact cggtgccact ttttcaagtt gataacggac tagccttatt ttaacttgct 60 atttctagct ctaaaac 77 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F_MpigI_del <400> 16 ttcaggtaga gcagcagcgt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> R_MpigI_del <400> 17 gggcagattg atcgtccgat 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F_MpigI'_del <400> 18 tggccgctgc gaaggggaata 20 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> R_MpigI'_del <400> 19 atcgtgcaca gcgtggcatt c 21 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 20 gagatcaagc aggccatcaa g 21 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 21 gtaaccccac tcgttgtcgt 20 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> F_MpigI_RT <400> 22 agacgctgct gctctacct 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> R_MpigI_RT <400> 23 cagacagtcg aactggacga 20 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> F_MpigI'_RT <400> 24 ggcggacata ggtgcacg 18 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> R_MpigI'_RT <400> 25 cagcagcagc tccttcaaag 20 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> F_MpigA_RT <400> 26 cctgaatggg tgcaacgagt ac 22 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> R_MpigA_RT <400> 27 tatgtaccgc ctctgcactg 20 <210> 28 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> 14-5 insertion <400> 28 taatacgact cactatagga gctccttcaa agccagctgg ctttagagc 49

Claims (7)

Monascus ruber in which the MpigI (Monascus pigment I) or MpigI' (Monascus pigment I') gene is attenuated or deleted.
The method of claim 1, comprising at least one mutation of insertion, substitution, or deletion in at least one of the MpigI locus represented by SEQ ID NO: 1 or the MpigI' locus represented by SEQ ID NO: 2. Monascus ruber .
The method according to claim 1, comprising at least one mutation of insertion, substitution, or deletion at positions 969 to 1452 of the MpigI locus represented by SEQ ID NO: 1;
Monascus ruber, comprising at least one mutation of insertion, substitution, or deletion at positions 132 to 539 of the MpigI locus shown in SEQ ID NO: 2.
The method of claim 1, wherein at least one base is deleted at positions 972 to 1452 in the MpigI locus represented by SEQ ID NO: 1, or at least one base is deleted at positions 986 to 1446 in the MpigI locus represented by SEQ ID NO: 1. base is substituted; or
At least one base is deleted from positions 150 to 534 in the MpigI locus shown in SEQ ID NO: 2, or the sequence shown in SEQ ID NO: 28 between positions 148 and 149 in the MpigI locus shown in SEQ ID NO: 2 This is inserted; Monascus Louver.
A composition for producing Monascus pigment containing the Monascus ruber of any one of claims 1 to 4.
A method of increasing Monascus pigment production comprising the step of attenuating or deleting the MpigI (Monascus pigment I) or MpigI' (Monascus pigment I') gene in Monascus ruber .
A method for producing a Monascus pigment comprising culturing the Monascus ruber of any one of claims 1 to 4.