KR20230128740A - A marker composition for diagnosing tuberculous pulmonary fibrosis comprising miR-148a and a pharmaceutical composition for preventing or treating tuberculous pulmonary fibrosis comprising a mimic of miR-148a - Google Patents

Abstract

Introduction: Extracellular matrix production by pleural mesothelial cells in response to M. tuberculosis infiltration contributes to tuberculous fibrosis. NOX4 is involved in the pathogenesis of tuberculous fibrosis. In the present invention, we evaluated whether a microRNA targeting the NOX4 gene had a protective effect against tuberculous pleural fibrosis.
Methods: TargetScan prediction software was used to identify candidate microRNAs that bind to the 3' UTRs of the NOX4 gene, and microRNA-148a (miR-148a) was selected as the most likely candidate miRNA. To investigate the causal relationship between MiR-148a and NOX4, suppression and forced expression assays were performed in Met5A cells. A study on the role of miR-148a in tuberculous pleural fibrosis was performed using a BCG pleural infection mouse model.
Results: Heat-killed Mycobacterium tuberculosis (HKMT) induces NOX4 and POLDIP2 expression. The present invention shows the inhibitory effect of miR-148a on NOX4 and POLDIP2 expression. Increased expression of miR-148a inhibited HKMT-induced collagen-1 synthesis in PMC cells. In the BCG pleurisy model, miR-148a significantly reduces fibrosis and epithelial-mesenchymal transition.
CONCLUSIONS: The present invention suggests that miR-148a can prevent tuberculous pleural fibrosis by regulating NOX4 and POLDIP2.

Description

A marker composition for diagnosing tuberculous pulmonary fibrosis comprising miR-148a and a pharmaceutical composition for preventing or treating tuberculous pleural fibrosis comprising a miR-148a mimic {A marker composition for diagnosing tuberculous pulmonary fibrosis comprising miR-148a and a pharmaceutical composition for preventing or treating tuberculous pulmonary fibrosis comprising a mimic of miR-148a}

The present invention relates to a marker composition for diagnosing tuberculous pleural fibrosis containing miR-148a and a pharmaceutical composition for preventing or treating tuberculous pleural fibrosis containing miRNA mimics, and more particularly, in a tuberculous pleural fibrosis model, the expression of miR-148a is The present invention relates to a marker composition capable of diagnosing tuberculous pleural fibrosis using an increase in miR-148a expression, and a pharmaceutical composition capable of preventing or treating tuberculous pleural fibrosis by increasing the expression of miR-148a.

Tuberculosis (TB) is a public health problem causing 9.9 million cases worldwide. Tuberculosis mortality is declining and 85% (66 million cases) of treated cases survive with successful treatment [1]. However, up to half of tuberculosis survivors complain of chronic lung dysfunction and reduced quality of life despite microbiological treatment [2-4]. It is associated with excessive deposition of the extracellular matrix (ECM), stiffness, and parenchymal scarring in tuberculous fibrosis [5, 6]. Residual distortions in lung structure that lead to lung dysfunction depend on the degree of degradation in the ECM [7]. Investigating the underlying immune mechanisms involved in tuberculous fibrosis may help find therapeutic targets.

NADPH oxidase 4 (NOX4) is a major source of reactive oxygen species (ROS) and is upregulated in several lung diseases including idiopathic pulmonary fibrosis, bleomycin-induced lung injury and lung cancer [8-12]. We recently reported that NOX4 signaling contributes to tuberculous fibrosis by regulating ERK-ROS signaling and EMT pathways [13]. Antagonizing NOX4 expression restores impaired protective autophagy in tuberculous pleurisy.

MicroRNAs are short single-stranded noncoding RNA molecules consisting of about 19–24 nucleotides [14]. miRNAs can down-regulate target gene expression by primarily binding to consensus sequences of target mRNAs and inactivate target genes by transcription factor co-action [14-16]. The potential of miRNAs has attracted much attention as an alternative treatment for various diseases such as cancer, neurodegenerative diseases, cardiovascular diseases and infectious diseases [17]. Although some miRNAs have been reported to be involved in the pathogenesis of tuberculosis, few studies have explored the role of miRNAs in tuberculosis fibrosis [18].

Global tuberculosis report. Geneva, Switzerland, World Health Organization, 2021 Hnizdo E et al., EThorax 55:32-8, 2000 Pasipanodya JG et al., Chest 131:1817-24, 2007 Pasipanodya JG et al., Chest 132:1591-8, 2007 Lopez-Majano V, Respiration 30:48-63, 1973 Skoogh BE, Scand J Respir Dis 54:148-56, 1973 Dheda K et al., J Infect Dis 192:1201-9, 2005 Bocchino M et al., PLoS One 5:e14003, 2010 Hecker L et al., Nat Med 15:1077-81, 2009 Crestani B et al., Int J Biochem Cell Biol 43:1086-9, 2011 Amara N et al., Thorax 65:733-8, 2010 Zhang C et al., Oncotarget 5:4392-405, 2014 Kim Y et al., J Clin Med 8, 2019 Reinhart BJ et al., Nature 403:901-6, 2000 Garzon R et al., Trends Mol Med 12:580-7, 2006 Chen CY et al., BMC Bioinformatics 12 Suppl 1:S41, 2011 Li M et al., World J Surg 33:667-84, 2009 Sinigaglia A et al., Cells 9, 2020 Liu J et al., Cell Death Dis 9:322, 2018 Liu Z et al., JCI Insight 5, 2020 Light RW et al., Ann Intern Med 77:507-13, 1972 Manickam N et al., Am J Physiol Renal Physiol 307:F159-71, 2014 Cortez MA et al.. Nat Rev Clin Oncol 8:467-77, 2011 Tijsen AJ et al., Am J Physiol Heart Circ Physiol 303:H1085-95, 2012 Liu Z et al., Am J Physiol Cell Physiol 317:C177-C188, 2019 Usman K et al., Cells 10, 2021 Li J et al., Cell Physiol Biochem 37:1847-56, 2015 Xiong J et al., Int J Mol Med 46:1003-1012, 2020 Chen Y et al., PLoS One 12:e0171751, 2017 Miotto P et al., PLoS One 8:e80149, 2013 Chen F et al., Front Physiol 3:412, 2012 Anrather J et al., J Biol Chem 281:5657-67, 2006 Ryu J et al., Cardiovasc Res 75:555-65, 2007 Lu X et al., Am J Physiol Lung Cell Mol Physiol 299:L559-66, 2010 Woo SJ et al., Cancers (Basel) 13, 2021

An object of the present invention is to provide a diagnostic marker composition for tuberculous pleural fibrosis containing miR-148a.

Another object of the present invention is to provide a composition for diagnosing tuberculous pleural fibrosis comprising an agent for measuring the expression level of miR-148a.

Another object of the present invention is to provide a kit for diagnosing tuberculous pleural fibrosis comprising an agent for measuring the expression level of miR-148a.

Another object of the present invention is to provide an information providing method for diagnosing tuberculous pleural fibrosis, which includes a measurement step of measuring the expression level of miR-148a from a biological sample derived from a subject.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating tuberculous pleural fibrosis, comprising a miR-148a-encoding gene expression agent or a miR-148a activator.

In the present invention, we sought to find potential miRNAs that regulate NOX4 and identify new therapeutic targets in tuberculous fibrosis.

We report that overexpression of miR-148a reduced fibrosis by targeting NOX4 and POLDIP2 in tuberculous fibrosis. Interestingly, miR-148a and NOX4 constitute a mutually negative feedback loop. miR-148a reduced the expression of NF-kB, a transcription factor of NOX4, and NOX4/POLDIP2 directly decreased the transcription of miR-148a. Furthermore, we showed that tuberculous pleural effusions showed increased expression of miR-148a, supporting its potential role as a diagnostic marker.

In the present invention, miR-148a was identified as a new miRNA related to tuberculous fibrosis.

According to previous studies, our data show that NOX4 signaling contributes to tuberculous fibrosis and interacts with POLDIP2 [13,22]. In the present invention, we identified NOX4 as a potential target gene for miR-148a using bioinformatics analysis. We revealed that HKMT initially downregulated the expression of miR-148a and upregulated the expression of MiR-148a after prolonged exposure. Functionally, miR-148a mimics reverse HKMT-induced upregulation of NOX4, POLDIP2 and collagen 1A mRNAs. Similarly, in an in vivo model of BCG pleurisy, miR-148a mimics reduce the production of pro-inflammatory cytokines and ECM deposition by inhibiting NOX4. This protective role was confirmed in mice with upregulated expression of miR-148a. We can speculate that miR-148a can effectively inhibit fibrosis after tuberculosis infection. Furthermore, these results indicate that miR-148a upregulation in tuberculous pleural effusion is a protective mechanism or homeostatic response. Clinically, pleural miR-148a may be a potentially useful biomarker for the identification of tuberculous fibrosis. Recent studies have raised the possibility that miRNAs circulating in bodily fluids may contribute to early diagnosis and treatment response monitoring of various diseases [23, 24]. In addition, miRNAs are more stable and have higher sensitivity and specificity than protein biomarkers [25].

Some miRNAs have been suggested to be associated with ECM repair in chronic fibrotic lung disease or the clinical outcome of TB [18,26]. Little is known about the association of miR-148a with pulmonary fibrotic disease. It has been reported that miR-148a inhibits lung cancer and liver fibrosis [27,28]. MiR-148a inhibited the migration and invasion of NSCLC cells by targeting Wnt1 signaling [29]. Overexpression of miR-148a downregulates ERBB3, which is required for hepatic stellate cell activation and liver fibrosis [28].

Although we did not demonstrate direct binding of miR-148a to NOX4, our data suggest that miR-148a indirectly regulates NOX4. Several transcription factors such as NF-kB, SMAD2/3, E2F, HIF1α and Nrf2 have been reported to regulate NOX4 promoter activity [31]. NF-kB stimulates NADPH oxidase in human phagocytes and vascular smooth muscle cells [32,33]. Lu et al reported that hypoxia increased the binding of the NF-kB subunit, P65, to the NOX4 promoter and decreased its binding with PPARγ as a negative regulator [34]. In the present invention, miR-148a mimics down-regulated NOX4 levels by reducing the expression of NF-kB, a transcription factor for NOX4.

In addition, the ChIP analysis in the present invention showed that NOX4/POLDIP2 binds to a specific site in the miR-148a promoter and that the binding is enhanced by HKMT treatment. In addition to this, our data support the existence of an autoregulatory feedback between NOX4 and miR-148a as a microRNA/target protein network. Tuberculous fibrosis activates miR-148a to inhibit NOX4, and conversely, NOX4 inhibits miR-148a to provide an autoregulatory protective mechanism (Fig. 7).

In conclusion, the present invention shows that miR-148a can attenuate tuberculous fibrosis through inhibition of NOX4 by downregulating the transcription factor NF-kB. In particular, NOX4 downregulates miR-148a, forming a negative feedback loop. This suggests that miR-148a could be a therapeutic target for tuberculous fibrosis.

The present invention relates to a pharmaceutical composition for preventing or treating tuberculous pleural fibrosis containing miR-148a or a miR-148a mimic.

In addition, the present invention relates to a pharmaceutical composition for preventing or treating tuberculous pleural fibrosis, which has a sequence such as 5'-AAAGUUCUGAGACACUCCGACU-3', as an embodiment of the miR-148a mimic. miR-148a mimics can be easily prepared by those skilled in the art, the number of possible miRNA-148a mimics is not limited, and the above miRNA-148a mimics sequences are exemplary. It's just a description. It is made clear to those skilled in the art to which the present invention belongs.

In addition, the present invention relates to a pharmaceutical composition for preventing or treating tuberculous pleural fibrosis, characterized in that the pharmaceutical composition is combined with another pharmaceutical composition for preventing or treating tuberculous pleural fibrosis.

In addition, the present invention relates to a marker composition for diagnosis of tuberculous pleural fibrosis containing miR-148a.

In addition, the present invention relates to a composition for diagnosing tuberculous pleural fibrosis comprising an agent for measuring the expression level of miR-148a.

In addition, the present invention relates to a composition for diagnosing tuberculous pleural fibrosis, wherein the agent for measuring the expression level of miR-148a is a sense and antisense primer or probe that complementarily binds to the miRNA.

In addition, the present invention relates to a kit for diagnosing tuberculous pleural fibrosis comprising an agent for measuring the expression level of miR-148a.

In addition, the present invention relates to a method for providing information for diagnosing tuberculous pleural fibrosis, comprising a measuring step of measuring the expression level of miR-148a from a biological sample derived from a subject.

In addition, the present invention is a polymerase chain reaction (PCR), next generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real- It relates to an information providing method for diagnosing tuberculous pleural fibrosis, which is measured through one or more methods selected from the group consisting of time PCR) and microarray.

In addition, the present invention relates to a method for providing information for diagnosing tuberculous pleural fibrosis, wherein the biological sample is at least one selected from the group consisting of tissues and cells.

In addition, in the information providing method of the present invention, tuberculous pleural fibrosis is judged as tuberculous pleural fibrosis when the expression level of miR-148a in the subject sample is higher than the expression level of miR-148a in the normal subject sample in the measurement step. It relates to a method of providing information for diagnosis.

The composition for preventing or treating tuberculous pleural fibrosis containing miR-148a or a miR-148a mimic as an active ingredient of the present invention includes 0.0001 to 50% by weight of the active ingredient with respect to the total weight of the composition.

The composition of the present invention may contain one or more active ingredients exhibiting the same or similar functions in addition to the miR-148a or the miR-148a mimic. The composition of the present invention can be administered orally or parenterally during clinical administration and can be used in the form of general pharmaceutical preparations.

The composition of the present invention may be prepared by including one or more pharmaceutically acceptable carriers in addition to the above-described active ingredients for administration. A pharmaceutically acceptable carrier may be saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and a mixture of one or more of these components, and, if necessary, an antioxidant , buffers, bacteriostatic agents and other conventional additives may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate formulations for injection such as aqueous solutions, suspensions, emulsions, pills, capsules, granules, or tablets, and may act specifically on target organs. A target organ-specific antibody or other ligand may be combined with the carrier so as to be used. Furthermore, it can be preferably formulated according to each component using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA).

The compositions of the present invention may include lyophilized compositions, particularly for the formulation of isotonic sterile solutions or injectable solutions upon addition of sterile water or appropriate physiological saline. The dose of the active ingredient used varies depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of the disease, etc., and the daily dose is about 0.0001 to 100 mg. /kg, preferably 0.001 to 10 mg/kg, and may be divided and administered once or several times a day.

The composition of the present invention may be used alone or in combination with radiation therapy, chemotherapy, and methods using biological response modifiers.

The present invention relates to a marker composition for diagnosing tuberculous pleural fibrosis containing miR-148a and a pharmaceutical composition for preventing or treating tuberculous pleural fibrosis containing miR-148a or a miR-148a mimic, which is a model for inducing tuberculous pleural fibrosis. Tuberculosis pleural fibrosis can be diagnosed using the fact that miR-148a is significantly increased in the can

1a to 1d. NOX4 and POLDIP2 reciprocally mediate HKMT (Heat-killed Mycobacterium tuberculosis) induced collagen-1A synthesis.
Figure 1a: NOX4, POLDIP2 and Collagen-1A mRNA expression in Met5A cells over time after HKMT treatment,
Figure 1b: Expression of NOX4, POLDIP2 and collagen-1A mRNA in Met5A cells treated with HKMT in the presence of NOX4-targeting Si RNA (SiNOX4) and SiCtrl,
Figure 1c: Expression of NOX4, POLDIP2 and collagen-1A mRNA in Met5A cells treated with HKMT in the presence of SiRNA targeting POLDIP2 (SiPOLDIP2) and SiCtrl,
Figure 1d: Interaction between NOX4 and POLDIP2 in Met5A cells after HKMT treatment confirmed by western blot and immunoprecipitation.
2a to 2c show miRNA expression in mesothelial cells following HKMT treatment.
Figure 2a: miRNA expression in mPMC (Primary mouse pleural mesothelial cells) of wild-type mice and NOX4 KO mice (n = 3),
Figure 2b: miRNA expression in mPMC of wild-type mice and NOX4 KO mice with and without HKMT stimulation,
Figure 2c: miRNA expression in human Met5A cells transfected with SiCtrl or SiNOX4 with or without HKMT stimulation.
3(a) to 3(e) show that miR-148a decreased in the initial stage of HKMT stimulation but increased with increasing exposure time.
Figure 3a: NOX4, POLDIP2 mRNA expression in Met5A cells pre-incubated with HKMT (10 ng/mL) for the indicated times (n=3),
Figure 3b: miRNA expression was analyzed by qRT-PCR in Met5A cells pre-incubated with HKMT (10 ng/mL) for the indicated times (n=3). Results are expressed as mean ± standard deviation.
Figure 3c: NOX4, POLDIP2 mRNA expression in WT-mPMC pre-incubated with HKMT (10 ng/mL) for the indicated times (n=3).
Figure 3d: miRNA expression was analyzed by qRT-PCR in WT-mPMC pre-incubated with HKMT (10 ng/mL) for the indicated times (n=3). Results are expressed as mean ± SEM.
Figure 3e: Expression of circulating miRNA levels in tuberculous pleural effusions and filtrate.
4A to 4E show that miR-148a can reduce tuberculous collagen-1A expression by regulating NOX4.
Figure 4a: miR-148a levels of Met5A transfected with miR-148a mimics and miR-148 inhibitors with and without HKMT treatment,
Figure 4b: NOX4 mRNA, POLDIP2 mRNA and collagen-1A mRNA of Met5A transfected with Ctrl mimic and miR-148a with or without HKMT treatment,
Figure 4c: NOX4 mRNA, POLDIP2 mRNA and collagen-1A mRNA of Met5A transfected with Ctrl inhibitor and miR-148 inhibitor with or without HKMT treatment,
Figure 4d: Expression of NF-kB in Met5A transfected with miR-148a mimics with and without HKMT treatment,
Figure 4e: ChIP analysis of NF-kB binding at the miR-148a promoter. Met5A cells were treated with or without HKMT for 3 hours and chromatin was collected for immunoprecipitation with a specific anti-NOX4 antibody and a specific anti-POLDIP2 antibody. Quantitative data are presented as mean±standard deviation.
5A-5E show that miR-148a prevents pulmonary fibrosis in mice.
Figure 5a: schematic diagram of the experimental design;
Figure 5b: miR-148a expression,
Figure 5c: Immunoblot results showing reduction of epithelial-mesenchymal transition (EMT) markers, NOX4 and POLDIP2, in lung tissues post-treated with miR-148a mimics from BCG-treated mice.
Figure 5d: Total number of pleural cells in 4 groups,
Figure 5e: Micrograph of cytospins stained with Giemsa,
5F: Cytokine levels assessed in serum (IL-6, TNF-α and IFN-γ).
6A to 6D show that miR-148a post-treatment modulates NOX4 expression and inhibits collagen-1A infiltration in mouse lungs.
Figure 6a: H&E staining,
Figure 6b: Immunostaining of NOX4,
Figure 6c: Masson's Trichrome immunostaining in mouse lungs.
6D: Immunofluorescent staining of NOX4 and mesothelin (markers for mesothelial cells). The light yellow area represents the co-localization of NOX4 (green) and mesothelin (red). DAPI: 4',6-diamidino-2-phenylindole dihydrochloride.
Figure 7 shows the regulation of tuberculous fibrosis by miR-148a. Chronic HKMT exposure induces miR-148a expression. Mycobacterium tuberculosis initially downregulates miRNA 148a but later upregulates miR-148a. Overexpression of miR-148a in mesothelial cells blocks NOX4 and POLDIP2 expression, preventing ECM deposition and lung fibrosis. NOX4 can also suppress the expression of miR-148a providing a negative feedback mechanism.
8 is a prediction of potential miRNAs that bind to the 3' UTR of the mouse NOX4 gene. A target scan was used to search for miRNAs that could interact with the 3' UTR of the mouse NOX4 gene. miR-9-5p, miR-148-3p, miR-196-5p, miR-203-3p and miR-192-5p/215-5p were identified.
Figure 9 shows that the level of miR-148a in the lungs of mice peaked 2 days after intravenous injection of miR-148a mimic (20 nmol/kg).

In the following, the configuration of the present invention will be described in more detail with specific examples and experimental examples. However, it is apparent to those skilled in the art that the scope of the present invention is not limited only to the description of Examples and Experimental Examples.

cell lines and animals

The human mesothelial cell line Met5A was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Wild-type NOX4 (NOX4-WT) mice and knockout NOX4 (NOX4-KO) mice of the C57BL/6 strain were obtained from Professor Park (Yonsei University, Seoul). All animal experiments were approved by the Animal Research and Use Committee (IACUC), Hallym University (NO: Hallym 2020-21).

Isolation of mouse pleural mesothelial cells (mPMC)

Primary mouse pleural mesothelial cells (mPMC) were obtained from the thoracic diaphragmatic surface, heart and lung of NOX4-WT or NOX-KO mice (3-4 weeks old). Each tissue was separated and cultured for 1 hour in 0.25% trypsin-EDTA solution after washing with DPBS. After centrifugation at 1500 rpm for 3 minutes, the cell pellet was suspended in Dulbecco's modified Eagle medium (DMEM) medium (15% FBS, 1% penicillin/streptomycin) and cultured in a 5% CO ₂ incubator for one day. The next day, cells attached to the dish were washed with DPBS and grown in DMEM (15% FBS, 1% penicillin/streptomycin) for 2-3 days. Non-adherent cells were reattached to the plate and used after 2-3 days.

heat killed tuberculosis treatment

Heat-killed Mycobacterium tuberculosis (HKMT) (InvivoGen, San Diego, CA, USA) was used to study tuberculosis in Met5A and mPMC. Cells with 60-70% growth were transfected or not treated with 10 ng/mL HKMT for the indicated time period. siNOX4 (sense 5' CUGUUGUGGACCCAAUUCA 3' and antisense 5' UGAAUUGGGUCCACAACAG 3') and siPoldip2 (sense 5' CUCUUGUUCACUUUACCUU 3' and antisense 5' AAGGUAAAGUGAACAAG 3') were used to suppress endogenous gene expression. Scrambled siRNA (sense: 5'-GGTCAAGACACTATTAACA-3' and antisense: 5'-GGATTCCTAG TGT ATTTCA-3') was used as a control (SiCtrl). To determine the effect of miR-148a on tuberculosis in vitro, 200 pmol of miR-148a mimic (5' AAAGUUCUGAGACACUCCGACU 3') or miR-148a inhibitor (5, UCAGUGCACUACAGAACUUUGU 3'), control mimic and control inhibitor were used. were transfected with jet PRIME transfection reagent (PolyPlus Transfection, New York, NY).

Identification of potential miRNAs

The TargetScan program was used to identify putative miRNAs predicted to modulate gene expression by directly binding to the 3' untranslated region (3' UTR) region of NOX4 (Fig. 8).

Immunoblot and immunoprecipitation analysis

Immunoblot analysis and immunoprecipitation analysis were performed according to standard procedures. Briefly, cells were lysed in RIPA buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS and 1% Nonidet-P40). To perform immunoblots, protein lysates were mixed with 5X sample buffer, biliary lysis for 8 min, and 50 μg of protein was separated by 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and plated on a PVDF membrane. (Thermo Scientific, Waltham, MA, USA). Primary antibody to NOX4 (1:2000 dilution, Proteintech, Wuhan, China), primary antibody to POLDIP2 ZO-1 (1:1,000 dilution, Abcam, Cambridge, UK), primary antibody to Snail (1:1,000 dilution, Cell Signaling Technology, Danvers, MA, USA) followed by incubation with HRP-conjugated secondary antibody (1:1,000 dilution, Thermo Scientific, Waltham, MA, USA). The membrane was peeled off and reprobed with a primary antibody against β-actin (1:1,000 dilution; Cell Signaling Technology, Danvers, MA, USA).

For immunoprecipitation, cell lysates (500 μg) were immunoprecipitated overnight at 4° C. with each primary antibody (2 μg). 40 μl of Protein A/G PLUS-Agarose (Santa Cruz Biotechnology, Dallas, TX, USA) was added and incubated at 4° C. for 1 hour. After washing the beads 3 times with lysis buffer, 2X sample buffer was added. Samples were boiled for 8 minutes and analyzed by 10% SDS-PAGE followed by immunoprecipitation.

Quantitative real-time PCR (qRT-PCR)

Total RNA samples were extracted from Met5A and mPMC using easy-Blue reagent (iNtRON Biotechnology, Seoul, Korea). Stranded cDNA was synthesized using the Maxime RT PreMix Kit (iNtRON Biotechnology, Seoul, Korea). Total miRNA was extracted from frozen mouse lung tissue and Met5A or mPMC using the miRNeasy Mini Kit (Qiagen, Germantown, MD, USA), followed by reverse transcription using the miScript Transcription Kit (Qiagen, Germantown, MD, USA). For quantitative real-time PCR (qRT-PCR), Rotor-Gene Q (Qiagen) with SYBR Green PCR Kit (Qiagen, Germantown, MD, USA) was used. Primer sequences for qRT-PCR are presented in Tables 1 and 2.

ChIP assay (Chromatin Immunoprecipitation Assay)

ChIP assays were performed on cultured Met5A cells according to the manufacturer's instructions (Cell Signaling Technology, Danvers, MA, USA). Briefly, cells were cross-linked with 1% formaldehyde at 37°C for 10 minutes and lysed in SDS lysis buffer (1% SDS, 10 mM EDTA and 50 mM Tris-HCl, pH 8.1). Chromatin extracts were isolated and further fragmented by sonication on ice to shear DNA. Nuclear extracts were immunoprecipitated overnight at 4°C with anti-NOX4 antibody or anti-POLDIP2 antibody or rabbit IgG. Purified immunoprecipitated DNA/protein complexes were subjected to PCR. To confirm the binding site of the protein to the miR-148a promoter, three pairs of specific primers were synthesized to amplify a DNA fragment of about 150-200bp in the promoter region of miR-148. Primer sequences used for PCR are as follows. miR-148 promoter-1 sequence [5'-CAGCACGAGGAACTTGACCCA-3' (sense) and 5'-GCAAGGC ACTGCACACACTAAC-3' (antisense)], miR-148 promoter-2 sequence [5'- TGGAGGTTT GGGTTGGTGAG -3' (sense) ) and 5′-TACCAAGGGCTTCCCAGAGA-3′ (antisense)], miR-148 promoter-3 sequence [5′-GCAGTGCCTTGCAGGAATTT-3′ (sense) and 5′-ATCTCCACAGCCCAAAAGCA-3′ (antisense)]. IgG was used as a negative control.

ELISA (Enzyme-linked Immunosorbent Assay)

The expression of IL-6, TNF-α, and IFN-γ in mouse serum was measured using an ELISA Kit (Abbkine Wuhan, China).

Establishment of BCG-induced pleurisy and in vivo treatment of miRNA mimics

An animal model for BCG-induced pleurisy was prepared by injecting 100uL saline containing 10 ⁶ CFU BCG Pasteur into the pleural cavity on day 0 before miRNA 148a mimic treatment [13]. To confirm the effect of miR-148a on in vivo tuberculosis fibrosis, 100 ul of the control mimic or miR-148a mimic (20 nmol/kg) and in vivo-JetPEI (PolyPlus Transfection, New York, NY) transfection reagent were used. It was injected intravenously every other day from day 0 for a total of 14 days. On day 15 all mice were sacrificed and lung tissue and serum collected. The thoracic cavity was washed with 1 ml 2 mmol/L EDTA-PBS before sacrifice. Pleural effusions were centrifuged and cell pellets were reconstituted in 100uL PBS. Total cell counts and diff-Quick-stained cytospin were counted as in the prior art [13].

Histology, immunohistochemistry and immunofluorescence staining

Paraffin sections of lung tissue were stained with H&E to determine lung inflammation and fibrosis. After deparaffinization of sections, lung tissues were immunostained with NOX4 antibody (Cusabio, Wuhan, China) and the Masson Trichrome Stain Kit (IMEB Inc., Chicago, IL, USA) to stain collagen. For immunofluorescence staining, sections were prepared with an antibody to NOX4 (1:100 dilution, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and an antibody to mesothelin (1:100 dilution, Santa Cruz Biotechnology, Santa Cruz, CA, USA). ) and incubated overnight at 4°C. After washing with PBS, slides were stained with Alexa Fluor 546-conjugated goat anti-mouse IgG1, Alexa Fluor 488-conjugated goat anti-rabbit IgG secondary antibody and DAPI (Sigma, St Loise, MO, USA). cultured in the dark. All samples were examined under a fluorescence microscope (Olympus FV500; Olympus, Tokyo, Japan).

Patient and sample collection

Patient samples in this study were provided according to the research protocol approved by the Institutional Investigation Committee of Chuncheon Sacred Heart Hospital (IRB no.2012-27). All study participants gave written informed consent to participate in this study. The data did not contain any information that could identify the patient. Tuberculous pleural effusion (TPE) was defined by two criteria: a positive culture result on a pleural fluid specimen or a pleural biopsy with mycobacterial histology (n=3). Pleural fluid effusion was defined by Light's criteria (n = 3) [21]. Circulating miRNAs were extracted from the pleural effusion (n = 6) using the miRNeasy Serum/Plasma Advanced Kit (Qiagen, Germantown, MD, USA) according to the manufacturer's instructions, and the characteristics of the study subjects are shown in Table 3.

statistical analysis

Data are presented as mean±standard deviation. Statistical comparisons were performed with GraphPad Prism5 after two-way analysis of variance. Significance of differences between groups was determined using Student's unpaired t-test. A p value < 0.05 was considered significant.

Result 1: Expression of NOX4 and POLDIP2 in mesothelial cells is upregulated after HKMT treatment.

Our previous study showed that HKMT (heat killed Mycobacterium tuberculosis) treatment enhanced the expression of NOX4 along with POLDIP2 and collagen in mesothelial cells (Fig. 1a). HKMT treatment increased the expression of NOX4 and POLDIP2 in a mutually dependent manner. Downregulation of NOX4 reduced the expression of POLDIP2, whereas downregulation of POLDIP2 reduced the expression of NOX4 (Fig. 1b, 1c). Immunoprecipitation demonstrated a direct interaction between NOX4 and POLDIP2 (Fig. 1d).

Result 2: miR-148 was under-expressed in the early stage of exposure to Mycobacterium tuberculosis, but increased thereafter.

TargetScan prediction software revealed several widely conserved miRNAs among vertebrates presumably binding to sites in the untranslated region (3' UTR) of NOX4 mRNA (Fig. 8). We evaluated the expression of candidate miRNAs in mPMCs obtained from wild-type or NOX4 KO mice with or without HKMT treatment for 3 h (Fig. 2a). Among the candidate miRNAs, miR-9, miR-148a and miR-196 were higher in mPMC of NOX4 KO mice than in wild-type (WT) mice. Expressions of miR-9 and miR-148a were downregulated in both WT mouse PMCs and Met 5A cells after 3 h HKMT treatment (Fig. 2b, Fig. 2c). NOX4 knockout or siRNA NOX4 treatment did not restore the reduction of miR-9 and miR-148 induced by 3 h HKMT treatment.

We evaluated changes in miRNAs over time after HKMT treatment in human Met5A cells and mouse PMCs (Fig. 3a–d). In particular, miR-148a shows a distinct trend over time. miR-148a initially decreased after HKMT treatment, but tended to increase with prolonged exposure. The time-dependent expression of NOX4 and miR-148a showed a difference. According to the results of mouse PMC experiments, NOX4 increased at 24 hours and decreased at 72 hours of HKMT treatment, whereas miR-148a decreased at 24 hours and increased at 72 hours. By observing these changes in miR-148a, we selected miR-148a as a candidate sensitive to NOX4 regulation in tuberculous fibrosis. The binding site of miR-148a was predicted by computer in the 3' UTR of NOX4 mRNA (Table 4).

Tuberculous pleural effusion (TB-PE) represents a chronic condition following exposure to Mycobacterium tuberculosis. Consistent with Met5A exposed to long-term HKMT, circulating miR-148 expression was higher in tuberculous pleural effusion (TB-PE) than in transudate.

Result 3: MiR-148 regulates the expression of NOX4/POLDIP2 in Met5A cells.

To verify the correlation between NOX4 and miR-148a in tuberculous fibrosis, we investigated whether the expression level of miR-148a affects the expression level of NOX4 using synthetic miR-148a mimics and inhibitors. Met5A cells were transfected with miR-148 mimics or miR-148a inhibitors and treated with HKMT for 3 hours. Figure 4b shows that increasing miR-148a levels markedly reduced HKMT-induced transcription of NOX4, POLDIP2 and collagen 1A. Conversely, knockdown of miR-148a using a miR-148 inhibitor markedly increased the levels of NOX4, POLDIP2 and collagen 1A (Fig. 4c).

HKMT treatment up-regulated NF-kB, a known transcription factor of NOX4, and miR-148a mimic down-regulated HKMT-induced NF-kB (Fig. 4d). ChIP assay demonstrated that HKMT increased the binding of NOX4/POLDIP2 to the miR-148a promoter-1 sequence (Fig. 4e). These results suggest that NOX4 can mediate miR-148a downregulation in tuberculous fibrosis by directly regulating gene transcription. Taken together, it appears that there is a reciprocal inhibitory relationship between NOX4 and miR-148a.

Result 4: MiR-148 prevents experimental tuberculous fibrosis.

An increase in miR-148a was observed 2 days after miRNA tail vein injection compared to control mice (FIG. 9). To determine the potential role of miR-148a in the pathogenesis of tuberculous fibrosis, miR-148a mimics or control mimics (20 nmol/kg) were administered once every other day for 2 weeks after BCG injection (Fig. 5a). After 2 weeks, the expression of miR-148a in lung tissue was higher in the BCG + control group than in the PBS + control group, and was highest in the BCG + miR-148a mimic administration group among the four groups (Fig. 5b). Administration of miR-148a mimics significantly reduced the expression of BCG-induced NOX4, POLDIP2 and Snail proteins (Fig. 5c). To investigate the effects of miR-148a mimics in BCG-induced pleurisy, cell recruitment and cytokine accumulation were measured. On day 15 after infection, the total number of pleural cells was significantly increased (PBS + control: 21.3 x 10 ⁴ ±12.74 x 10 ⁴ /mL, BCG + control: 786.7 x 10 ⁴ ±369.5 x 10 ⁴ /mL, p = 0.023 ) (Fig. 5d). The total number of cells in mice treated with BCG + miR-148a mimic was lower than that in BCG + control group (BCG + miR-148a mimic: 232.8 x 10 ⁴ ±313.0 x 10 ⁴ /mL, p = 0.084). Microscopic analysis of pleural cells showed an increase in multinucleated giant macrophages in mice in the BCG + control group compared to the PBS + control group and the BCG + miR-148a mimic administration group (FIG. 5e). Similarly, concentrations of cytokines (IL-6, TNF-α and IFN-γ) measured in serum were higher in the BCG + control group than in the PBS + control group, and posttreatment with miR-148a mimics induced BCG-induced cytokinesis. decreased the expression of Cain (Fig. 5f). These results suggest that miR-148a regulates NOX4 levels and substantially modulates pleural inflammation and fibrosis in BCG pleurisy.

H&E staining showed amelioration of BCG-induced fibrosis in mice with increased miR-148a expression. Fifteen days after BCG infection, all mice in the BCG + control group had increased pleural hyperplasia and lung cell infiltration than the PBS + control group. Mice in the BCG + miR-148a mimic-treated group had reduced submesothelial, granuloma, and pleural proliferation compared to BCG + control mice (Fig. 6a). Mouse lung tissue immunostaining for NOX4 showed significantly stronger expression around infiltrates with thick septa in the BCG + control group, in contrast to the PBS + control group, which showed weak expression in epithelial bronchial cells. Mice in the BCG + miR-148a mimic administration group showed reduced NOX4 expression in lung tissue (FIG. 6b). Although the pleural sections of BCG + control mice also showed collagen deposition, mice in the BCG + miR-148a mimic administration group showed less collagen deposition compared to BCG + control mice (Fig. 6c). The in vivo inhibitory effect of miR-148a on NOX4 was confirmed by immunofluorescence staining (Fig. 6d). We found that the level of NOX4 colocalized with mesothelin, a marker of mesothelial cells, was increased in the BCG + control group than in the PBS + control group. Administration of miR-148a mimics blocked BCG-induced mesothelin and NOX4 expression.

<110> Industry Academic Cooperation Foundation, Hallym University <120> A marker composition for diagnosing tuberculous pulmonary fibrosis comprising miR-148a and a pharmaceutical composition for preventing or treating tuberculous pulmonary fibrosis comprising a mimic of miR-148a <130> HallymU-JYHONG-miR148a <160> 38 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> RNA <213> artificial sequence <220> <223> primer <400> 1 cuguugugga cccaauuca 19 <210> 2 <211> 19 <212> RNA <213> artificial sequence <220> <223> primer <400> 2 ugaauugggu ccacaacag 19 <210> 3 <211> 19 <212> RNA <213> artificial sequence <220> <223> primer <400> 3 cucuuguuca cuuuaccuu 19 <210> 4 <211> 17 <212> RNA <213> artificial sequence <220> <223> primer <400> 4 aagguaaagu gaacaag 17 <210> 5 <211> 19 <212> DNA <213> artificial sequence <220> <223> primer <400> 5 ggtcaagaca ctattaaca 19 <210> 6 <211> 19 <212> DNA <213> artificial sequence <220> <223> primer <400> 6 ggattcctag tgtatttca 19 <210> 7 <211> 22 <212> RNA <213> artificial sequence <220> <223> a miR-148a mimic <400> 7 aaaguucuga gacacuccga cu 22 <210> 8 <211> 22 <212> RNA <213> artificial sequence <220> <223> a miR-148a inhibitor <400> 8 ucagugcacu acagaacuu gu 22 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 9 ccggctgcat cagtcttaac 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 10 tcggcacagt acaggcacaa 20 <210> 11 <211> 28 <212> DNA <213> artificial sequence <220> <223> primer <400> 11 caaaacagaa tggaaaatat gagaccgg 28 <210> 12 <211> 23 <212> DNA <213> artificial sequence <220> <223> primer <400> 12 tgattgatgc tcgtgactgc cca 23 <210> 13 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 13 actggtgaga cctgcgtgta 20 <210> 14 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 14 aatccatcgg tcatgctctc 20 <210> 15 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 15 gtgctatccc tgtacgcctc 20 <210> 16 <211> 19 <212> DNA <213> artificial sequence <220> <223> primer <400> 16 ggccatctct tgctcgaag 19 <210> 17 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 17 atgacctatg aattgacaga c 21 <210> 18 <211> 23 <212> DNA <213> artificial sequence <220> <223> primer <400> 18 tctttggtta tctagctgta tga 23 <210> 19 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 19 taggtagttt cctgttgttg gg 22 <210> 20 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 20 gtgaaatgtt taggaccact ag 22 <210> 21 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 21 aaagttctga gacactccga ct 22 <210> 22 <211> 17 <212> DNA <213> artificial sequence <220> <223> primer <400> 22 ctcgcttcgg cagcaca 17 <210> 23 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 23 atgacctatg atttgacaga c 21 <210> 24 <211> 23 <212> DNA <213> artificial sequence <220> <223> primer <400> 24 tctttggtta tctagctgta tga 23 <210> 25 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 25 taggtagttt cctgttgttg gg 22 <210> 26 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 26 gtgaaatgtt taggaccact ag 22 <210> 27 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 27 tcagtgcact acagaacttt gt 22 <210> 28 <211> 25 <212> DNA <213> artificial sequence <220> <223> primer <400> 28 gcttcggcag cacatatact aaaat 25 <210> 29 <211> 22 <212> RNA <213> Homo sapiens <400> 29 aacagcugug cuaugccaaa ga 22 <210> 30 <211> 7 <212> RNA <213> artificial sequence <220> <223> miRNA-9 <400> 30 gguuucu 7 <210> 31 <211> 23 <212> RNA <213> Homo sapiens <400> 31 agcuuauccu uaaaaaccaa aga 23 <210> 32 <211> 23 <212> RNA <213> artificial sequence <220> <223> miRNAs <400> 32 aguaugucga ucuauugguu ucu 23 <210> 33 <211> 23 <212> RNA <213> Homo sapiens <400> 33 ucagaaggaa aauuuacuac cuu 23 <210> 34 <211> 22 <212> RNA <213> artificial sequence <220> <223> miR-196b <400> 34 ggguuguugu ccuuugaugg au 22 <210> 35 <211> 23 <212> RNA <213> Homo sapiens <400> 35 cacuaauauu auuuuugcac ugu 23 <210> 36 <211> 22 <212> RNA <213> artificial sequence <220> <223> miR-148a <400> 36 uguuucaaga caucacguga cu 22 <210> 37 <211> 23 <212> RNA <213> Homo sapiens <400> 37 acauuucaaa aauucagguc aaa 23 <210> 38 <211> 21 <212> RNA <213> artificial sequence <220> <223> miR-215 <400> 38 cagacaguuu aguauccagu a 21

Claims (11)

A pharmaceutical composition for preventing or treating tuberculous pleural fibrosis comprising miR-148a or a miR-148a mimic.
The method of claim 1,
The miR-148a mimic is 5'-AAAGUUCUGAGACACUCCGACU-3', a pharmaceutical composition for preventing or treating tuberculous pleural fibrosis.
The method of claim 1,
The pharmaceutical composition is combined with other pharmaceutical compositions for preventing or treating tuberculous pleural fibrosis, a pharmaceutical composition for preventing or treating tuberculous pleural fibrosis.
A marker composition for diagnosis of tuberculous pleural fibrosis comprising miR-148a.
A composition for diagnosing tuberculous pleural fibrosis comprising an agent for measuring the expression level of miR-148a.
The method of claim 5,
An agent for measuring the expression level of miR-148a is a sense and antisense primer or probe that binds complementary to the miRNA, a composition for diagnosing tuberculous pleural fibrosis.
A kit for diagnosing tuberculous pleural fibrosis comprising an agent for measuring the expression level of miR-148a.
An information providing method for diagnosing tuberculous pleural fibrosis comprising a measurement step of measuring the expression level of miR-148a from a biological sample derived from a subject.
The method of claim 8,
The expression level of miR-148a was determined by polymerase chain reaction (PCR), next generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real-time PCR) and A method for providing information for diagnosing tuberculous pleural fibrosis, which is measured through one or more methods selected from the group consisting of microarray.
The method of claim 8,
The biological sample is at least one selected from the group consisting of tissues and cells, an information providing method for diagnosing tuberculous pleural fibrosis.
The method of claim 8,
The information provision method provides information for the diagnosis of tuberculous pleural fibrosis, in which the expression level of miR-148a in the subject sample is higher than the expression level of miR-148a in the normal subject sample in the measurement step. method.