KR20230125667A - A method for regulating expression of target gene using ultrasound inducible promoter - Google Patents

Abstract

The present invention relates to a method for controlling the expression of a target gene using an ultrasound-responsive promoter, and more specifically to a method for controlling the expression of a target gene and a use thereof, comprising a step of introducing the vector into which one or more promoter selected from the group consisting of MSLN, A1BG, LRATD2, and CITED4 promoters which induce expression of the target gene in response to ultrasound, and target gene are inserted into the cell, and applying ultrasound. By using the promoter of a specific gene which responds to the application of ultrasound according to the present invention, it is possible to artificially control the expression level of a desired target gene and control the expression of the target gene until a specific desired time.

Description

Method for regulating expression of target gene using ultrasound responsive promoter {A method for regulating expression of target gene using ultrasound inducible promoter}

The present invention relates to a method for regulating the expression of a target gene using an ultrasound-responsive promoter, and more particularly, to a method selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters that induce the expression of a target gene in response to ultrasound. It relates to a method for regulating the expression of a target gene, including introducing a vector into a cell into which one or more promoters and a target gene are inserted, and applying ultrasound waves, and a use thereof.

The most commonly used method for regulating gene expression is a method of expressing a target gene using a gene sequence called a promoter. A promoter refers to all DNA nucleotide sequence sites to which transcriptional regulators bind, and is generally located at the front of a DNA nucleotide sequence containing the genetic information of a gene to be transcriptionally regulated.

As a method of regulating the expression of a target gene using such a promoter sequence, a method of causing mutations in the promoter sequence or selecting a promoter sequence that expresses well and introducing the sequence in front of the target gene has been used. CMV promoter, EF1a promoter, PGK promoter, and U6 promoter sequences have been most commonly used as promoter sequences that are well expressed (Khan KH. "Gene Expression in Mammalian Cells and its Applications". Advanced Pharmaceutical Bulletin. 2013; 3( 2):257-263;Norrman K, Fischer Y, Bonnamy B, Wolfhagen Sand F, Ravassard P, et al. (2010) Quantitative Comparison of Constitutive Promoters in Human ES cells. PLoS ONE 5(8): e12413 et al.)

However, the gene overexpression method by introducing an overexpression promoter is not only impossible to control the on and off of gene expression, but also makes it impossible to control gene expression in vivo, and these problems are due to cell differentiation using the gene overexpression system. However, it is regarded as the biggest problem in using cell conversion technology and cell therapy. In order to solve these problems, a method using a promoter sequence activated by chemicals has been developed, but even this method has difficulties in delivering chemicals, conditions that do not react to the substance in vivo, or toxicity to the chemical. There are issues, etc., so it is used only extremely limitedly.

Under this background, the present inventors, at the end of studying a way to solve the above problems, discovered a promoter gene sequence that could be controlled by applying ultrasound, which had not been previously discovered, and by controlling the activity of this promoter gene sequence, the gene sequence was found. The present invention was completed by finding that the expression level can be controlled.

An object of the present invention is to obtain a cell prepared by introducing a vector into which a promoter and a target gene are inserted (a); and (b) applying ultrasonic waves to the cells obtained in step (a); To provide a method for regulating the expression of a target gene, including a.

Another object of the present invention is (a) obtaining a cell prepared by introducing a vector into which the promoter and the target gene are inserted; and (b) applying ultrasonic waves to the cells obtained in step (a); To provide a cell reprogramming method comprising a.

Another object of the present invention is to provide a cell prepared and differentiated by the above method.

Another object of the present invention is to provide an expression vector comprising at least one promoter selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters and a target gene whose expression is regulated by the promoter.

Another object of the present invention is one or more promoters selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters; And to provide a composition for inducing direct cross-differentiation into neurons, comprising an expression vector containing one or more target genes selected from the group consisting of Ascl1, Nurr1, Pitx3, and Lmx1a.

Another object of the present invention is (a) administering a vector into which a promoter and a target gene are inserted to a non-human mammal; and (b) applying ultrasound to the site where the vector was administered; To provide a method for treating neurodegenerative diseases of mammals other than humans, including a.

A detailed description of this is as follows. Meanwhile, each description and embodiment disclosed in the present invention may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed herein fall within the scope of the present invention. In addition, it cannot be seen that the scope of the present invention is limited by the specific descriptions described below.

In addition, those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Also, such equivalents are intended to be included in this invention.

In order to achieve the above object of the present invention, the present invention comprises the steps of (a) obtaining a cell prepared by introducing a vector into which a promoter and a target gene are inserted; and (b) applying ultrasonic waves to the cells obtained in step (a); Including, it provides a method for regulating the expression of the target gene.

In order to achieve another object of the present invention, the present invention provides (a) obtaining a cell prepared by introducing a vector into which a promoter and a target gene are inserted; and (b) applying ultrasonic waves to the cells obtained in step (a); Including, it provides a cell reprogramming method.

In order to achieve another object of the present invention, the present invention provides a cell prepared and differentiated by the above method.

In order to achieve another object of the present invention, the present invention provides an expression vector comprising at least one promoter selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters and a target gene whose expression is regulated by the promoter. .

In order to achieve another object of the present invention, the present invention is one or more promoters selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters; and an expression vector containing one or more target genes selected from the group consisting of Ascl1, Nurr1, Pitx3, and Lmx1a, and a composition for inducing direct cross-differentiation into neurons.

In order to achieve another object of the present invention, the present invention provides (a) administering a vector into which a promoter and a target gene are inserted to a non-human mammal; and (b) applying ultrasound to the site where the vector was administered; It provides a method for treating neurodegenerative diseases of non-human mammals, including a.

Hereinafter, the present invention will be described in detail.

The present invention comprises the steps of (a) obtaining a cell prepared by introducing a vector into which a promoter and a target gene are inserted; and (b) applying ultrasonic waves to the cells obtained in step (a); Including, it provides a method for regulating the expression of the target gene.

As used herein, the term "promoter" refers to a DNA region present near a transcription site of a target gene, including a site to which RNA polymerase or an enhancer binds, for the expression of a target gene to be ligated thereafter.

The promoter may be a MSLN, A1BG, LRATD2 or CITED4 promoter, and may specifically be a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 4, but is not limited thereto. As long as the polynucleotide containing the nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 4 is a sequence having the function of an ultrasonic responsive promoter, it is obvious that when some sequences are deleted, modified, substituted or added, they are also included within the scope of the present invention. do.

In the present invention, the MSLN promoter may include the nucleotide sequence of SEQ ID NO: 1, the A1BG promoter SEQ ID NO: 2, the LRATD2 promoter SEQ ID NO: 3, and the CITED4 promoter SEQ ID NO: 4.

[SEQ ID NO: 1]

CGCGTTTTCATCATTGTCCGCAGCTTGCAGTCGGCTGGTTCAGAGCTTAGCCGGGCACATGGGCCCCTCTGAGGCTCCTGTTCAGGGCTCAGCCGTGTCTACGGGGCCCTCCGAGCTCTTCCTGGACCCTCCTCGGCTCCTTCAGTTCAGGGCTCAGCTGGGCACGTGGGCGCCTCCTTGGCTCCTCCGGCTCAGGCCTCTCCTCGAGCTCTGGGCCCTGAGTATTCTGGGCTCCTTCC TTGGTTTCCTTTGGCCTTTGGCCGGGAAAGTTGTGGGTGTCCGTGGCAGCCTGGGCCACTTCACAGCCCCGCAGCCAACCTGCGGCTCCTTCAGAGCAAAGCTGTGTGGACACAAAGGGAACGCCACTCGGAGCTGGCCTCTCCCTTTACCTGTGAGTTCCCGCCCAAGCCGGCTGCCTTCTGTCCCCTCCCCAGAGCCCTTGGGTAACTGGTTTGCTACAAGAGTGTCTGGAATTTTT CAGTTGTTCTCTGCGGAAGGGAGTTTTTAAAAGGCCCTTAATCCCTTCTTGACATTTGTAAGTTGACGCTTACACCTGGCAGCCTTGCTGAATTCTGTGTGCGTGAAGGTCCGATTCCACCGCGAGTCACGATAGAAAACCCACTCTGTGGAGAGACCAGAGATGACCGCCGCGCACACCTCCGTTCAGCACAAAACTTTGCAGGTGTTCATAGCGGAGGCAGATCCGTACTGGGGATAAG AGCTCACGACATGCTGGGAGGGGTTTCAGGGGCAGGGAGGGGGCTTCTGTGGCCCCAGGTCAGGAGGAGCAGCTCTTCCATCAGCAGCAGGCAGCCAGCCCAGATGCGTAGGGAAGACAGCTCCCACTTCGCCAGGCCAGAGAGCGCCCGGGGGCAGCTCTGTTCCAGTCGACCCTGCGAGAAAGGGGTGTGCGTTGTGCCTGGAGCTGGGCCCCGTCCTGCCTCCCTGACCTGTGTGCTCCCAC AGCCCTGAGACGGACGGCTCACAGCCTTGCGAGGCCCACACTGCACTGGGGGTCAGGCTTGTGCTCCCGGGAGTCCTGTCTGGGCTGCGTGGCCACCATCCAGAGCCTGCTGACCTGCGACTGGGGGGGCCAGTGCTCCCTGGGTTTCAGCACCTGAGAATCAGAGTGGGATCCCGTGAAACCTGGGCCCAGGCTCCCACCCACGCCCCACACCCACCCAGGGAAGCCATGAAACCTGGGC CCGGGCTCCTACACATGCCCCACACCCACCCAGGGCAGCCGTGAAACCTGGGCCCGGGCTCCCACCCTCGCCCACCGAGGGCAGCTTTGCCTTCCTGGGCATCCCTCCTCCCCCAGGCCTGGCCCGCTGCCTGTCCAAGGCTCCTGTGCGGGGTCTCCACCCACACATTCCTGGGGCGTGAGGCGCCACCACTCCCTGCTGCCCCGGGCAAAGCCGTCATTTGTTCCCTTTGACGGCCCGGGA GGCTGCCAGGCTCTCCACCCCCACTTCCCAATTGAGGAAACCGAGGCAGAGGAGGCTCAGGTGTGGCCAATCACCCTGCACATCAGAGTTACCCTGGGCAGGGCCCACTGAGACCTGGGAGGGGCCACTCGGGACCTGGAGGGCTGGGGGCTGCCCGGGCGTTAGGGGTAAAGCTCCCTACCCAACTGCGCAGAAGGCCTCAGAGGCCTGGGGGCTGGGCTTCCCCTTTCACATCGCCCTTTAGAG GCCCACGTGTGGGCATTGGCCCGCGATCTGAAAGGGGCTGTCCTGTTCCTCATGGGCGCTGCCAGCGCCACGCACTCCTCTTTCTGCCTGGCCGGCCACTCCCGTCTGCTGTGACGCGCGGACAGAGAGCTACCGGTGGACCCACGGTGCCTCCCTC

[SEQ ID NO: 2]

GCGGTTGCCCTGGGCCCTCACACTCGTAGCGGAGCTAGGCTGGGACACCCAGGGTGGGGACCAGACCTCCCCGGGTGGGAATGACAGGATGTCCATGGAGGCTGAGTGTGAAAGCACCACGGTCTCACCCCTGTCCTGTTCCATCCCAACAGGCTGTGGTGAGGAGAGGGGGAGGCAGGGGAAGCGGGAGGCCTGGCCTCCAGGCAGCAGGCTATAGCCACATGAGTGACCACCAGCAGCT CAGGTAACTGAGCACATGTCACGGGTAGGCCTGGGAAGCGCAGGTCTCAGCTGAATGACCTGGGTGGAAATCCGACTCCAGAGCCGTGGTGGGTCACACCATGCAGAATGAACCAGTGATGGAGAAGGAACCACAGTCCTCAGGAAGAGTGAGGGTGCACCTCCAGACAGCCCATGTGAGGGCAACCGCAGAAAGTCTGAAAAGAGGTGAACCCCACCTTTGGTGTCACATGTGCAGTGTGGT GTGACAGGGAGGGGCTCGCTGGGCTTCAGCCCCGGCACTCTCCACTTGACCTCAGCAGCTCCAGGTAGAGTGGGGAGAACTCAGCGTCTCCTTCTAGAACAGGTTCTAGGATCCATCACTGAAATGAGGATGAGGTGGTTTTAACATCATTTTATCACTCTTGATTTAGTTTATTAATCATACATGATTATGATTATAATTGTTGCTGGGCATCCTGAGGCCTCAGAAGTTCACCCTTTGCCCTGACCCCATG GGGGCCCTGCCCCCGCCTTCCGGGAAGGACAAACACGGGAAGAGGTCAGTGCCCGAGCCACCCCACCGCCCTCCCTTGGGGCCTCATTGCTGCAGACGCTCACCCCAGACACTCACTGCACCGGAGTGAGCGCG

[SEQ ID NO: 3]

TCCAACGAACTGGTACCTCTCTGGAAATAACGGAGGTTATGAACTTTGTACTAACTTCCAGGGGTATCTAATAAACAGAGCGGTGGTCTTGGGACCCAGTCAGTGAATAAGTCTTCGTTCTGTTTTATACTGTTTCTTTTCTGCGATTTTCTTTTCTACCCCAAAGTTTCCCACTACTAACTCTGAAAACACCTCTAGGATGACGCACTCTTCGAGCTGTCCTGGTGAAGAATCCTTTCTTGTGACC TTTAGGGCAAGAAATATGTTCCAGGAAAGAAAAGAAACGACTGTTCCTCCTTCTCCAGGTACTCTGGGAAAAAACAGGTCAAAGGGAAAAGGCGCAAACACCAAACTCTCCTTCCCTTTCTCATTTCCACACTGGCAAGTTGTGTTTGCCTTCTAACTTGTCTCGGAAGGCAAGCAGAGCTCACAGCACCAGCCCCAGGCGGCGGGTGGATTATTTACAGGGGGATTTAAACCCGCTCCGGCGCGGGG GGGCGTGGCCGGGCGGAGTCCCGAGGCCCGAGTGGGCGGGGCGGGGGCGGGGCTCCCGGCCGCTCGGCGCAATGTGAAAAAGACCCGAGCTCGGGGAGTGAGCGCCTGTCTCTTTAAATGCCACGGGCTGCGCTCCCGCCCGGGAGCCCGGAGCCGGATCTACAATCCCGTCCCTCCAGCTCCGGTGCTTGTTGCTCGCCCGGCCCAAGCGGGAGCTGTTGCCGCCAGGCTGCGAGG CTGCCGTCCTCTCCTCCTCGCGCCCCACCTCCCCCGAGAGCTGGCTGAGGAGGGGCAGCAGCCCCAGCTGGCGGGAGGAAGCGCGGTGTGAACAGGGATTGCCCCCCGCCTTCAAGTATCGGGGCGCTACGCAGCCGCGGGGGAAAGACATGCCCCTAGTCTGCCCGCTGCGCTGCCCTCTGCCCAGCCTCGCTGCCGCCCGCGCCGGGAGAGGAGGGACTGCCGAGCCTACACCTTC AAACTCGCCCTAGAAGTCTCGGGGCGCGGCAGGGAGCCCTTCCCCAGGCCCCACGGCCTTCACCTCTCCGCGGGTGAGTTTTGCAGGTAACCCGAGCCTGAGGGCGGGCGCGGGGGAAGGGCGGGCGAGCCGGGAGGAGGTAGCGCTGCAGGTGAGCCAGGTAGGGT

[SEQ ID NO: 4]

AAGTCCCAAGGATGCCACAGGTCGGGGGAAGGTCAGAGAAGGGAGAGAGAGTGTCAAATGCGTGGAGGGTAAGGTTCTGGGAGGCTGTCTCCTGGCCACAGGAAAGACTCCAGTTGCCCTAAGGACTTGGAAAACACATGGCATTCACACGCTAACTCTGGCTGCCTGTGACCTCAGGACAGCCACTTTCTCTTTGTGTGCTTCTCCTTATCACTGAAATGGGGCTGATAATCCATGCCCTGCCCC CAACAAATACTTGTAGAATGTAAAGCACTTTAAAAGTCCAAGTTATTATTGCTGTTATCAAGAGAAGGCCCTTTGGGACAGAACTTAAATAGCCTTGGCCGGGCGCGGTGGCTCACGCCTGTAATTCCAGCACTTTGGGAGGCCGAGGCGGGCGGATCACGAGGTCAGCAGATCGAGACCATCCTGGCTAACACGGTGAAAACCCCGTCTCTACTAAAAATACAAAAAATTAGCCGGGCGT GGTAGCGGGCGCCTGTAGTCCCAGCTACTCGGGAGACTGAGGCAGGAGAATGGCGTGAACCCGGGAGGCGGAGCTTGCAGTGAGCCAAGACAGCGCCACTGCAGTCCAGCCTGGGCGAAAGAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAGAACTTAAATAGCCTTTCTTTCATCTAAGGGACACTTTTGAGCATCTACCACATACCAGGCACTGTGCTAGGCACTGTGCACACATGCCCTCACT TACCCCTCACAAAGGGTCAGTGCTGCTGTTCTTTACCTTTTACAGATGAAGAAACTGAGGCTCAGCTGAGAGTTGCAATTCATTCCATCATTAGTTCATTCACTCAGCTTTTACTAAAAGCCTGCTCTGGGCCAGGCTCTGGGCCAAGTGCTGAGAAGAAGAAGATGAACAAGTCCTTCAGGAGACGTGCCCATAAATTAATAACAACTAAGTACATGCTTCAACAGACAAGGTGCAGTGGGAACTAGAGGG GGAGCAACAGGCTCTCCTGGGGGTTATGGGAATGGACAGCTGACCTCCTGCGGGGACCCTGCACCGCTAAGGTGCATGCGCCCTGTGTAGCTGTGCAGTCTCACTTTGATCAAGGCTTTGCTGTGTATTTCCAGGAAGCCTCTTCCGCCACTGAGCCTCGGTCTCTACCTGGAAAGTTAAAAGGTTGCGTAGGCCTGACATCCTGCAGCTCTTGGGGGGCCTAAAACTCTGGCCCTCCCACCCC ACCTTCTGGTCAGTTCAAGCTCTACCCCAGCCAAGTCCGATTCCGAAGCCCTGAGGGCCAGACCGAATCCCTCCGAAAGTGCCAAATACCCCGCCCCAGGGCGGTGCTCAGAGCCTGGGGCGTGGCCGGAGTCCCAAGGGGCGGGGTTCCAGTGGGAGGGGCGGGGCCAAGACCTAGATGCAGGCGTGCGCGGCCCGCCCAGAAGCGTCTCGCCCAGCCAATGAGCGTCCGAGGGCGGG GAAGCCCCGCCTCTGGGTATAAGAATACGCCGAGCCCAGCT

As used herein, the term "target gene" is used interchangeably with "target gene" and "target gene", and refers to a gene whose expression is controlled by a promoter operably linked to a promoter sequence. Specifically, it refers to a gene whose expression is regulated by the ultrasonic responsive promoter, and is not particularly limited.

The term of the present invention, "operably linked" generally means that a nucleotide expression control sequence and a nucleotide sequence encoding a protein of interest are operably linked to perform a function, thereby affecting the expression of the encoding nucleotide sequence. can go crazy Operable linkage with the recombinant vector can be prepared using genetic recombination techniques known in the art, and site-specific DNA cutting and linking can be prepared using cutting and linking enzymes known in the art.

As used herein, "vector" refers to a genetic construct comprising essential regulatory elements operably linked to express a gene insert.

The vectors of the present invention include expression control elements such as promoters, operators, initiation codons, stop codons, polyadenylation signals, and enhancers, as well as signal sequences or leader sequences for membrane targeting or secretion, and can be prepared in various ways depending on the purpose. The vector may include a viral vector, an episomal vector, a plasmid vector, a cosmid vector, and the like, but is not limited thereto.

Specifically, the viral vector is a Lentivirus, a retrovirus, such as HIV (Human immunodeficiency virus), MLV (Murineleukemia virus), ASLV (Avian sarcoma / Leukosis), SNV (Spleen necrosis virus), Vectors derived from RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), adenovirus, adeno-associated virus, herpes simplex virus, etc. . In addition, it may be more specifically an RNA-based viral vector, but is not limited thereto.

The episomal vector of the present invention is a non-viral, non-insertable vector, and is known to have a characteristic capable of expressing a gene included in the vector without being inserted into a chromosome. Cells containing an episomal vector for the purpose of the present invention include cases in which the episomal vector is inserted into the genome or present in the cell without being inserted into the genome.

As used herein, the term "regulation of expression" means introducing a vector containing a target gene into a host cell so that the target gene can be expressed or stopped in the host cell, and includes "overexpression" of the target gene. (overexpression)". In particular, the method provided by the present invention is very advantageous in that it can easily and artificially control the expression level of a desired target gene inside and outside the cell through a change in the conditions for applying ultrasound, and control the expression of the target gene for a specific desired time. can be useful

The gene may be in the form of DNA or RNA, and as long as it can be expressed in a cell, it may be inserted into the chromosome of the cell or located outside the chromosome. In addition, the target gene may be introduced in any form as long as it can be introduced into cells and expressed. For example, the target gene may be introduced into a cell in the form of an expression cassette, which is a gene construct containing all necessary elements for self-expression. The expression cassette may include the promoter of the present invention, a transcription termination signal, a ribosome binding site, and a translation termination signal, which are usually operably linked to the target gene. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the target gene may be introduced into a cell in its own form and operably linked to a sequence required for expression in the cell, but is not limited thereto.

Depending on the type of target gene to be regulated in the cell of the present invention, a person skilled in the art can appropriately select it.

The "step of obtaining cells produced by introducing a vector" may be introducing the vector into isolated cells.

As a method of introducing the vector into cells, a transformation method may be used. "Transformation" refers to a phenomenon in which DNA is introduced into a host so that the DNA becomes replicable as a chromosomal factor or by completion of chromosomal integration, and artificially causes genetic change by introducing foreign DNA into a cell. Any transformation method can be used for the transformation method, and it can be easily performed according to a conventional method in the art. In general, transformation methods include the CaCl2 precipitation method, the Hanahan method with increased efficiency by using a reducing material called DMSO (dimethyl sulfoxide) in the CaCl2 method, the electroporation method, the calcium phosphate precipitation method, the protoplast fusion method, and the silicon carbide fiber. agitation method using agitation method, agrobacterium-mediated transformation method, transformation method using PEG, dextran sulfate, lipofectamine, and desiccation/inhibition-mediated transformation method. The method for transforming the pDZ-mqp of the present invention is not limited to the above examples, and transformation methods commonly used in the art may be used without limitation.

The term "isolated cell" of the present invention is not particularly limited, but may be a cell whose lineage has already been specified, such as a germ cell, a somatic cell, or a progenitor cell. For example, cells derived from humans may be used, but cells derived from various organisms also fall within the scope of the present invention.

In addition, the isolated cells of the present invention may include both in vivo and ex vivo cells, and specifically, may be cells isolated in vivo.

The "somatic cell" refers to all cells that have completed differentiation constituting animals and plants, excluding reproductive cells, and the "progenitor cell" expresses a differentiated trait when a cell corresponding to a progeny is found to express a specific differentiated trait. It refers to a parental cell that does not develop, but has that differentiation fate. For example, neuroblasts (neuron stem cells) correspond to precursor cells for nerve cells (neurons), and myoblasts correspond to precursor cells for myotube cells.

The target gene may be a gene used for cell conversion, specifically, the target gene may be a gene involved in cell fate conversion, more specifically, a factor capable of causing neuronal cell fate conversion, Specifically, it may be one or more selected from the group consisting of Ascl1, Brn2, Oct4, Sox2, Klf4, cMYC, GPx1, Nurr1, Pitx3, and Lmx1, but is not limited thereto.

"Ultrasound" of the present invention is a phenomenon in which sound energy with periodic frequency waves propagates into space, and the ultrasonic waves used in the present invention may include all forms of ultrasonic waves under LILF (Low intensity Low frequency) conditions. . For the purposes of the present invention, "ultrasound treatment" and "ultrasonic application or irradiation" may be used interchangeably.

In the present invention, the frequency of ultrasound may be 20 kHz to 10 MHz, preferably 50 kHz to 10 MHz, but is not limited thereto.

In the present invention, the intensity of ultrasound may be 1mW/cm ² to 100W/cm ² , preferably 5mW/cm ² to 1W/cm ² , but is not limited thereto.

The present invention also provides (a) obtaining a cell prepared by introducing a vector into which a promoter and a target gene are inserted; and (b) applying ultrasonic waves to the cells obtained in step (a); Including, it provides a cell reprogramming method.

The term "cell fate conversion" or "reprogramming" of the present invention refers to the process of converting a cell into a desired cell or changing the state of a cell by regulating the global gene expression pattern of a specific cell. means the way In other words, reprogramming in the present invention refers to a method of artificially manipulating the fate of a cell to convert it into a cell with completely different characteristics or to return the cell state to its original state, and for the purpose of the present invention, the reprogramming This may be performed by introducing a foreign gene or a vector containing other genes into cells. The reprogramming may mean cell differentiation, dedifferentiation, and direct reprogramming (direct conversion).

In the present invention, the term "direct reprogramming" is also called "direct conversion" and is differentiated from the technology of producing induced pluripotent stem cells with pluripotency through a reprogramming process. It is a technology that directly induces conversion into a desired target cell through culture. In order to produce target cells using existing induced pluripotent stem cell reprogramming technology, induced pluripotent stem cells must first be prepared from isolated somatic cells, and intermediate cells must be prepared depending on the target cells. Since such a complex production culture process must be sequentially performed, production efficiency is low and time and cost consumption are high. In addition, since it is naturally produced via pluripotent stem cells, there is a problem that it is necessary to verify whether undifferentiated cells remain and whether safety is secured. However, the present invention can provide an alternative that can overcome the problems of the above technology, such as production time, cost, efficiency, and safety, by directly producing target cells from initial cells through direct reprogramming technology. "Direct reprogramming" of the present invention may be used interchangeably with direct reverse differentiation, direct differentiation, direct conversion, direct cross-differentiation, cross-differentiation, and the like. The direct reprogramming may mean conversion to nerve cells in particular.

In one embodiment of the present invention, a vector containing the promoter of the present invention was constructed using Ascl1, Nurr1, Pitx3, and Lmx1 as target genes, and the vector was introduced into somatic cells and then irradiated with ultrasound to direct cross-differentiation into neurons confirmed.

The present invention also provides a differentiated cell prepared using the above method. The differentiated cells may be induced pluripotent stem cells or nerve cells, but are not limited thereto.

The present invention also provides an expression vector comprising at least one promoter selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters and a target gene whose expression is regulated by the promoter.

The expression vector is characterized in that expression of a target gene is induced by application of ultrasound after being introduced into a cell.

The present invention also provides one or more promoters selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters; and an expression vector containing one or more target genes selected from the group consisting of Ascl1, Nurr1, Pitx3, and Lmx1a, and a composition for inducing direct cross-differentiation into neurons.

The present invention also provides a pharmaceutical composition for preventing or treating brain diseases, neurological diseases or neurodegenerative diseases comprising the differentiated neurons.

The present invention also provides one or more promoters selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters; And it provides a pharmaceutical composition for preventing or treating neurodegenerative diseases, including an expression vector containing one or more target genes selected from the group consisting of Ascl1, Nurr1, Pitx3, and Lmx1a.

In the present invention, the brain disease, neurological disease or degenerative neurological disease is Alzheimer's disease, Parkinson's disease, progressive supranuclear palsy, multiple system atrophy, olive-pons-cerebellar atrophy (OPCA), Schei-Drager syndrome, striatal-substantia nigra degeneration , Huntington's disease, amyotrophic lateral sclerosis (ALS), essential tremor, cortico-basal ganglia degeneration, diffuse Lewy body disease, Parkinson's-ALS-dementia complex, Niemanpick's disease, Pick's disease, cerebral ischemia and cerebral infarction. It may be, but is not limited thereto.

The pharmaceutical composition according to the present invention may contain the cells alone or be formulated in a suitable form together with a pharmaceutically acceptable carrier, and may further contain an excipient or diluent. In the above, 'pharmaceutically acceptable' refers to a non-toxic composition that is physiologically acceptable and does not cause allergic reactions such as gastrointestinal disorders, dizziness, etc., or similar reactions when administered to humans.

A pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration.

Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like.

In addition, various drug delivery materials used for oral administration may be included. In addition, the carrier for parenteral administration may include water, suitable oil, saline, aqueous glucose and glycol, and the like, and may further include a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.

The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifier, a suspending agent, and the like in addition to the above components. Other pharmaceutically acceptable carriers and formulations may be referenced as described in the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

The composition of the present invention can be administered to mammals including humans by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual or rectal administration can be

The pharmaceutical composition of the present invention may be formulated into a formulation for oral administration or parenteral administration according to the administration route as described above.

In the case of preparations for oral administration, the composition of the present invention may be formulated into powders, granules, tablets, pills, dragees, capsules, solutions, gels, syrups, slurries, suspensions, etc. using a method known in the art. can For example, preparations for oral use may be obtained by combining the active ingredient with a solid excipient, which is then milled and, after adding suitable auxiliaries, processed into a mixture of granules to obtain tablets or dragees. Examples of suitable excipients include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, starches including corn starch, wheat starch, rice starch and potato starch, cellulose, Celluloses including methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose, and the like, fillers such as gelatin, polyvinylpyrrolidone, and the like may be included. In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant, if desired.

Furthermore, the pharmaceutical composition of the present invention may further include an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifier, and a preservative.

In the case of preparations for parenteral administration, they may be formulated in the form of injections, creams, lotions, external ointments, oils, moisturizers, gels, aerosols, and nasal inhalants by methods known in the art. These formulations are described in Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, PA, 1995, which is a generally known formula for all pharmaceutical chemistry.

The total effective amount of the composition of the present invention can be administered to the patient in a single dose or by a fractionated treatment protocol in which multiple doses are administered over a long period of time. The pharmaceutical composition of the present invention may vary the content of the active ingredient according to the severity of the disease. Preferably, the preferred total dose of the pharmaceutical composition of the present invention may be about 0.01 to 10,000 mg, most preferably 0.1 to 500 mg per patient body weight per day. However, the dosage of the pharmaceutical composition is determined by considering various factors such as the formulation method, administration route, and number of treatments as well as the patient's age, weight, health condition, sex, severity of disease, diet and excretion rate, etc. Therefore, considering this point, those skilled in the art will be able to determine an appropriate effective dosage of the composition of the present invention. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route and administration method as long as it exhibits the effects of the present invention.

The present invention also provides (a) administering a vector into which a promoter and a target gene are inserted to a non-human mammal; and (b) applying ultrasound to the site where the vector was administered; Including, it provides a bone disease treatment method.

By using the promoter of a specific gene that responds to the application of ultrasound according to the present invention, it is possible to artificially control the expression level of a desired target gene and control the expression of the target gene for a specific desired period of time.

In addition, it is possible to regulate the expression of a specific target gene in vivo or in vitro, and through this regulation of expression, differentiation and fate conversion into a desired cell can be realized, and this can be applied to cell therapy technology and cell therapy products.

When the expression control as described above is applied to cell therapy technology, since gene overexpression is induced non-invasively using physical ultrasound, it is possible to induce safe and efficient treatment with few side effects. In addition, since the transformation of cells can be artificially controlled up to the desired cell culture stage, even when the treatment is completed, the effect of cell therapy can be adjusted according to the degree of treatment by simply removing the ultrasonic treatment.

Figure 1 schematically shows the structure and activation of vectors containing the MSLN, A1BG, LRATD2 or CITED4 promoters by ultrasonic irradiation.
Figure 2 shows the result of fragmenting the MSLN, A1BG, LRATD2 or CITED4 promoter and using a restriction enzyme and cloning it into a vector (pCIG3) in which GFP is encoded.
Figure 3 is a confirmation result for the result of fragmenting the MSLN, A1BG, LRATD2 or CITED4 promoter and using a restriction enzyme and cloning it into a vector (pCIG3) in which GFP is encoded.
FIG. 4 shows the results of FACS analysis (flow cytometry) on cells into which vectors containing the GFP gene in the MSLN, A1BG, LRATD2 or CITED4 promoters were introduced (15 minutes).
Figure 5 shows the results of FACS analysis (flow cytometry) on cells into which vectors containing the GFP gene in the MSLN, A1BG, LRATD2 or CITED4 promoters were introduced (1 hour).
6 shows the results of immunostaining of cells into which a vector containing a GFP gene was introduced into a promoter of MSLN, A1BG, LRATD2 or CITED4. It was confirmed that GFP was expressed only when ultrasound was turned on (right batch).
Figure 7 shows the expression levels of TH, DAT Map2, and Synapsin, which are neural marker genes, according to the presence or absence of US (ultrasound) in cells transfected with vectors containing MSLN, A1BG, LRATD2, or CITED4 promoters and Ascl1, Nurr1, Pitx3, and Lmx1a genes by RT -This is the result of analysis by qPCR. (Left: sonication off, right: sonication on)
Figure 8 shows the expression levels of TH and DAT, which are neuromarker genes, according to US (ultrasonic wave) irradiation in cells introduced with vectors containing MSLN, A1BG, LRATD2 or CITED4 promoters and Ascl1, Nurr1, Pitx3 and Lmx1a genes by immunofluorescence staining method. is the result of the analysis.
9 is a result of analyzing the degree of GFP expression according to ultrasonic irradiation at different stimulation intensities in cells introduced with a vector containing an MSLN promoter and a GFP gene through a fluorescence microscope.
10 shows the cell anti-aging gene Gpx1 and aging markers P16ink41, Gamma-H2A.X, and P16 according to the presence or absence of US (ultrasonic wave) in cells introduced with vectors containing the MSLN promoter and Oct4, Sox2, Klf4, and cMYC genes. This is the result of analysis through RT-qPCR.
11 shows the results of analyzing the lifespan and body weight changes of mice according to the presence or absence of US (ultrasound) after injecting vectors containing the MSLN promoter and Oct4, Sox2, Klf4, and cMYC genes into the LMNA (-/-) Progeria mouse model. .

Hereinafter, the present invention will be described in more detail through Examples and Experimental Examples. However, these Examples and Experimental Examples are intended to illustrate the present invention, and the scope of the present invention is not limited to these Examples and Experimental Examples.

Example 1: Vector Construction

For use in the following examples, the promoters MSLN, A1BG, LRATD2 or CITED4 were each inserted into promoter-free vector constructs. As a vector construct without a promoter, the pGL3 luciferase vector was used. Vector backbone: (pGL3-Basic Vector, Backbone manufacturer: Promega, plasmid E1751)

The target gene used in each example was introduced into the vector construct to be influenced by each promoter. The shape of the vector produced is shown in Figure 1.

Example 2: Confirmation of GFP gene expression regulation using an ultrasonic responsive promoter

In order to confirm that the expression of each promoter is regulated by the application of ultrasound, whether or not the GFP gene is expressed was investigated. (Vector used as control: Vector backbone: pGL3-Basic Vector, Backbone manufacturer: Promega, plasmid E1751)

As the vector used, pCIG3 was used, which was shown in FIGS. 2 and 3, and cloning data was attached to FIG. 3.

Specifically, a vector was prepared using the GFP gene as a target gene in the same manner as in Example 1. After introducing the prepared vector into lentivirus, it was introduced into skin cells. DAPI staining was performed by counterstaining, and pGL3-Basic Vector was used as a control promoter. Ultrasound was applied to each cell at 50 mW/Cm ² at 1.5 MHz for 15 minutes. Thereafter, flow cytometry (FACS) analysis was performed and the experimental results are shown in FIG. 4 . As a result of the experiment, the cell population shifted to the GFP positive area was analyzed in the group treated with ultrasound in the vector using all corresponding promoters, and when the ultrasound operation switch was turned off, the cell population shifted to the GFP positive area was not analyzed. It was confirmed that the ultrasonic responsive promoter works correctly.

Additionally, even when ultrasound was applied and flow cytometry (FACS) analysis was performed with a GFP expression vector into which the responsive promoter was introduced for a long time (1.5 hours), the GFP shifted cell population increased compared to when ultrasound was not applied. could confirm that (FIG. 5)

Through this, it was found that (MSLN, A1BG, LRATD2 or CITED4 promoters) could be activated by the application of ultrasound.

In addition, GFP expression was analyzed through immunostaining analysis. As a result of the experiment, it was confirmed that GFP was expressed in the control group (experimental group using MSLN, A1BG, LRATD2, CITED4, or PEG10 promoters) while almost no GFP expression was observed.

Through this, it was found that (MSLN, A1BG, LRATD2 or CITED4 promoters) could be activated by the application of ultrasound (Fig. 6).

Example 3: Direct cross-differentiation into neurons using an ultrasonic responsive promoter

Example 3-1: Confirmation of production of nerve cells

As the target genes, Ascl1, Nurr1, Pitx3, and Lmx1a, which are genes that need to be overexpressed to induce cell fate conversion (reprogramming) from somatic cells to neurons, vectors were constructed in the same manner as in Example 1, and then skin-derived It was introduced into fibroblast cells. After applying ultrasound for 1.5 hours at a frequency and intensity of (1.5MHz, 50mW/Cm ² ), the expression of neuronal markers (TH, DAT) was evaluated through Rt-qPCR (Fig. 7) and immunostaining (Fig. 8) results. Confirmed. As a result of the experiment, it was confirmed through immunostaining that the expression of dopaminergic neuron markers TH and DAT appeared when ultrasound was applied (FIG. 7 and FIG. 8).

Through this, it was confirmed that nerve cells can be produced by regulating promoter activity by applying ultrasound to cause cell fate conversion.

Example 3-2: Measurement of optimal ultrasonic intensity

In order to determine the optimal ultrasound intensity for each gene of the MSLN, A1BG, LRATD2, CITED4, or PEG10 promoter, ultrasound was applied at various intensities and frequencies, and then the expression level of the target gene was examined. As a representative picture, an experiment using the MSLN_promo-GFP vector was performed.

Specifically. Vectors and somatic cells were prepared in the same manner as in Example 1, and then, while changing the frequency and intensity of ultrasound from 50kHz to 10MHz and 5mW/cm ² to 1W/cm ² , GFP expression changes according to ultrasound changes were detected using immunostaining. Observed.

As a result of immunostaining, it was confirmed that GFP protein was not expressed at all when ultrasound was not applied, but as the frequency of the exposed ultrasound increased to 50 kHz, 1.5 MHz, and 10 MHz, the signal of the corresponding GFP protein appeared stronger. In addition, it was confirmed that the intensity was also expressed at 5mW/cm ² to 1W/cm ² (FIG. 9).

Through this, it was confirmed that the operable frequency and intensity of ultrasonic waves applied to the ultrasonic responsive promoter were 50 kHz to 10 MHz and 5 mW/cm ² to 1 W/cm ² .

Example 3-3: Confirmation of operation of ultrasonic responsive promoter in vivo

The MSLN, A1BG, LRATD2, CITED4, or PEG10 promoters were irradiated with ultrasound to examine whether the ultrasound-responsive promoter works in vivo.

Specifically, the ultrasonic responsive promoter (MSLN_promo-OSKM) was introduced into two mouse models (Old mouse model, LMNA-/- Progeria model) through tail vein injection, and at an intensity of (1.5MHz, 50mW/Cm ² ) for 1.5 hours. /day ultrasound was applied. Thereafter, genetic changes in the old mouse model are shown in FIG. 10, and weight change and survival rate in the Progeria mouse model are shown in FIG. 11.

Referring to FIG. 10 in detail, it was shown that P16ink41, Gamma-H2A.X, and P16, which are genes that are increased in old mice, which are oxidative stress marker genes and indicators of cell death, were increased in old mice, and the three genes under ultrasound application showed a decrease. On the other hand, GPx1, an antioxidation related molecule, was rather reduced in old mice, and as a result of selectively expressing OSKM expression through ultrasound application, GPx1 was restored to a control level. Additionally, it was confirmed that the lifespan of the Progeria mouse model was also extended by selectively expressing OSKM using an ultrasonic responsive promoter.

It is known that the selective expression of OSKM increases the lifespan of progeria model mice and increases the gene expression of antioxidant molecules. The research team confirmed that this gene switch works in vitro as well as in vivo through a gene switch using an ultrasonic responsive promoter.

Through this, it was confirmed that the promoter of the present invention can be irradiated with ultrasound and used as a method for treatment or prevention in vivo.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without changing its technical spirit or essential features. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be construed as including all changes or modifications derived from the meaning and scope of the claims to be described later and equivalent concepts rather than the detailed description above are included in the scope of the present invention.

<110> Standup Science Co., Ltd. YOO, JUNSANG KANG, HOON <120> A method for regulating expression of target gene using ultrasound inducible promoter <130> NP22-0002 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 1853 <212> DNA <213> artificial sequence <220> <223> MSLN promoter <400> 1 cgcgttttca tcattgtccg cagcttgcag tcggctggtt cagagcttag ccgggcacat 60 gggcccctct gaggctcctg ttcagggctc agccgtgtct acggggccct ccgagctctt 120 cctggaccct cctcggctcc ttcagttcag ggctcagctg ggcacgtggg cgcctccttg 180 gctcctccgg ctcaggcctc tcctcgagct ctgggccctg agtattctgg gctccttcct 240 tggtttcctt tggcctttgg ccgggaaagt tgtgggtgtc cgtggcagcc tgggccactt 300 cacagccccg cagccaacct gcggctcctt cagagcaaag ctgtgtggac acaaagggaa 360 cgccactcgg agctggcctc tccctttacc tgtgagttcc cgcccaagcc ggctgccttc 420 tgtcccctcc ccagagccct tgggtaactg gtttgctaca agagtgtctg gaatttttca 480 540 ttgacgctta cacctggcag ccttgctgaa ttctgtgtgc gtgaaggtcc gattccaccg 600 cgagtcacga tagaaaaccc actctgtgga gagaccagag atgaccgccg cgcacacctc 660 cgttcagcac acaaaccttt gcaggtgttc atagcggagg cagattccgt actggggata 720 agagctcacg acatgctggg aggggtttca ggggcaggga gggggcttct gtggccccag 780 gtcaggagga gcagctcttc catcagcagc aggcagccag cccagatgcg tagggaagac 840 agctcccact tcgccaggcc agagagcgcc cgggggcagc tctgttccag tcgaccctgc 900 gagaaagggg tgtgcgtgtg cctggagctg ggccccgtcc tgcctccctg acctgtgtgc 960 tcccacagcc ctgagacgga cggctcacag ccttgcgagg cccacactgc actgggggtc 1020 aggcttgtgc tcccgggagt cctgtctggg ctgcgtggcc accatccaga gcctgctgac 1080 ctgcgactgg gggggccagt gctccctggg tttcagcacc tgagaatcag agtgggatcc 1140 cgtgaaacct gggcccaggc tcccacccac gccccacacc cacccaggga agccatgaaa 1200 cctgggcccg ggctcctaca catgccccac acccacccag ggcagccgtg aaacctgggc 1260 ccgggctccc accctcgccc accgagggca gctttgcctt cctgggcatc cctcctcccc 1320 caggcctggc ccgctgcctg tccaaggctc ctgtgcgggg tctccaccca cacattcctg 1380 gggcgtgagg cgccaccact ccctgctgcc ccgggcaaag ccgtcatttg ttccctttga 1440 cggcccggga ggctgccagg ctctccaccc ccacttccca attgaggaaa ccgaggcaga 1500 ggaggctcag gtgtggccaa tcaccctgca catcagagtt accctgggca gggcccactg 1560 agacctggga ggggccactc gggacctgga gggctggggg ctgcccgggc gttaggggta 1620 aagctcccta cccaactgcg cagaaggcct cagaggcctg ggggctgggc ttcccctttc 1680 acatcgccct ttagaggccc acgtgtgggc attggcccgc gatctgaaag gggctgtcct 1740 gttcctcatg ggcgctgcca gcgccacgca ctcctctttc tgcctggccg gccactcccg 1800 tctgctgtga cgcgcggaca gagagctacc ggtggaccca cggtgcctcc ctc 1853 <210> 2 <211> 872 <212> DNA <213> artificial sequence <220> <223> A1BG promoter <400> 2 gcggttgccc tgggccctca cactcgtagc ggagctaggc tgggacaccc agggtgggga 60 ccagacctcc ccgggtggga atgacaggat gtccatggag gctgagtgtg aaagcaccac 120 ggtctcaccc ctgtcctgtt ccatcccaac aggctgtggt gaggagaggg ggaggcaggg 180 gaagcgggag gcctggcctc caggcagcag gctatagcca catgagtgac caccagcagc 240 tcaggtaact gagcacatgt cacgggtagg cctgggaagc gcaggtctca gctgaatgac 300 ctgggtgggaa atccgactcc agagccgtgg tgggtcacac catgcagaat gaaccagtga 360 tggagaagga accacagtcc tcaggaagag tgagggtgca cctccagaca gcccatgtga 420 gggcaaccgc agaaagtctg aaaagaggtg aaccccacct ttggtgtcac atgtgcagtg 480 tggtgtgaca gggaggggct cgctgggctt cagccccggc actctccact tgacctcagc 540 agctccaggt agagtgggga gaactcagcg tctccttcta gaacaggttc taggatccat 600 cactgaaatg aggatgaggt ggttttaaca tcattttatc actcttgatt tagtttatta 660 atcatacatg attattgatt ataattgttg ctgggcatcc tgaggcctca gaagttcacc 720 780 aggtcagtgc ccgagccacc ccaccgccct cccttggggc ctcattgctg cagacgctca 840 ccccagacac tcactgcacc ggaggtgagcg cg 872 <210> 3 <211> 1136 <212> DNA <213> artificial sequence <220> <223> LRATD2 promoter <400> 3 tccaacgaac tggtacctct ctggaaataa cggaggttat gaactttgta ctaacttcca 60 ggggtatcta ataaacagag cggtggtctt gggacccagt cagtgaataa gtcttcgttc 120 tgttttatac tgtttctttt ctgcgatttt cttttctacc ccaaagtttc ccactactaa 180 ctctgaaaac acctctagga tgacgcactc ttcgagctgt cctggtgaag aatcctttct 240 tgtgaccttt agggcaagaa atatgttcca ggaaagaaaa gaaacgactg ttcctccttc 300 tccaggtact ctgggaaaaa acaggtcaaa gggaaaaggc gcaaacacca aactctcctt 360 ccctttctca tttccacact ggcaagttgt gtttgccttc taacttgtct cggaaggcaa 420 gcagagctca cagcaccagc cccaggcggc gggtggatta tttacagggg gatttaaacc 480 cgctccggcg cgggggcgtg gccgggcgga gtcccgaggc ccgagtgggc ggggcggggg 540 cggggctccc ggccgctcgg cgcaatgtga aaaagacccg agctcgggga gtgagcgcct 600 gtctctttaa atgccacggg ctgcgctccc gcccgggagc ccggagccgg atctacaatc 660 ccgtccctcc agctccggtg cttgttgctc gcccggccca agcgggagct gttgccgcca 720 ggctgcgagg ctgccgtcct ctcctcctcg cgccccacct cccccgagag ctggctgagg 780 aggggcagca gccccagctg gcgggaggaa gcgcggtgtg aacagggatt gccccccgcc 840 ttcaagtatc ggggcgctac gcagccgcgg gggaaagaca tgcccctagt ctgcccgctg 900 cgctgccctc tgcccagcct cgctgccgcc cgcgccggga gaggagggac tgccgagcct 960 acaccttcaa actcgcccta gaagtctcgg ggcgcggcag ggagcccttc cccaggcccc 1020 acggccttca cctctccgcg ggtgagtttg tgcaggtaac ccgagcctga gggcgggcgc 1080 gggggaaggg cgggcgagcc gggaggaggt agcgctgcag gtgagccagg tagggt 1136 <210> 4 <211> 1514 <212> DNA <213> artificial sequence <220> <223> CITED4 promoter <400> 4 aagtcccaag gatgccacag gtcgggggaa ggtcagagaa gggagagaga gtgtcaaatg 60 cgtggagggt aaggttctgg gaggctgtct cctggccaca ggaaagactc cagttgccct 120 aaggacttgg aaaacacatg gcattcacac gctaactctg gctgcctgtg acctcaggac 180 agccactttc tctttgtgtg cttctcctta tcactgaaat ggggctgata atccatgccc 240 tgcccccaac aaaatacttg tagaatgtaa agcactttaa aagtccaagt tattattgct 300 gttatcaaga gaaggccctt tgggacagaa cttaaatagc cttggccggg cgcggtggct 360 cacgcctgta attccagcac tttgggaggc cgaggcgggc ggatcacgag gtcagcagat 420 cgagaccatc ctggctaaca cggtgaaacc ccgtctctac taaaaataca aaaaaaatta 480 gccgggcgtg gtagcgggcg cctgtagtcc cagctactcg ggagactgag gcaggagaat 540 ggcgtgaacc cgggaggcgg agcttgcagt gagccaagac agcgccactg cagtccagcc 600 tgggcgaaag agcgagactc cgtctcaaaa aaaaaaaaaa aaagaactta aatagccttt 660 ctttcatcta agggacactt ttgagcatct accacatacc aggcactgtg ctaggcactg 720 tgcacacatg ccctcactta cccctcacaa agggtcagtg ctgctgttct ttacctttta 780 cagatgaaga aactgaggct cagctgagag ttgcaattca ttccatcatt agttcattca 840 ctcagctttt actaaaagcc tgctctgggc caggctctgg gccaagtgct gagaagaaga 900 agatgaacaa gtccttcagg agacgtgccc ataaattaat aacaactaag tacatgcttc 960 aacagacaag gtgcagtggg aactagaggg ggagcaacag gctctcctgg gggttatggg 1020 aatggacagc tgacctcctg cggggaccct gcaccgctaa ggtgcatgcg ccctgtgtag 1080 ctgtgcagtc tcactttgat caaggctttg ctgtgtattt ccaggaagcc tcttccgcca 1140 ctgagcctcg gtctctacct ggaaagttaa aaggttgcgt aggcctgaca tcctgcagct 1200 cttggggggc ctaaaactct ggccctccca ccccaccttc tggtcagttc aagctctacc 1260 ccagccaagt ccgattccga agccctgagg gccagaccga atccctccga aagtgccaaa 1320 taccccgccc cagggcggtg ctcagagcct ggggcgtggc cggagtccca aggggcgggg 1380 ttccagtggg aggggcgggg ccaagaccta gatgcaggcg tgcgcggccc gcccagaagc 1440 gtctcgccca gccaatgagc gtccgagggc ggggaagccc cgcctctggg tataagaata 1500 cgccgagccc agct 1514

Claims (17)

(a) obtaining a cell prepared by introducing a vector into which a promoter and a target gene are inserted; and
(b) applying ultrasound to the cells obtained in step (a); Including, a method for regulating the expression of a target gene.
The method of claim 1, wherein the promoter is selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters.
The method according to claim 1, wherein the MSLN promoter comprises the nucleotide sequences of SEQ ID NO: 1, the A1BG promoter SEQ ID NO: 2, the LRATD2 promoter SEQ ID NO: 3, and the CITED4 promoter SEQ ID NO: 4.
The method of claim 1, wherein the ultrasonic wave is applied at a frequency of 20 kHz to 10 MHz.
The method of claim 1, wherein the ultrasound is applied at an intensity of 1 mW/cm ² to 5 W/cm ² .
(a) obtaining a cell prepared by introducing a vector into which a promoter and a target gene are inserted; and
(b) applying ultrasound to the cells obtained in step (a);
Including, cell reprogramming method.
7. The method of claim 6, wherein the promoter is selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters.
The method of claim 6, wherein the target gene is one or more selected from the group consisting of Ascl1, Nurr1, Pitx3, and Lmx1a.
7. The method of claim 6, wherein the cell reprogramming is cell direct conversion.
An expression vector comprising at least one promoter selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters and a target gene whose expression is regulated by the promoter.
[Claim 9] The expression vector according to claim 8, wherein expression of a target gene is induced by application of ultrasound waves.
At least one promoter selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters; and an expression vector containing at least one target gene selected from the group consisting of Ascl1, Nurr1, Pitx3, and Lmx1a. A composition for inducing direct cross-differentiation into neurons.
At least one promoter selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters; And Ascl1, Nurr1, Pitx3 and Lmx1a selected from the group consisting of at least one target gene containing an expression vector containing, a pharmaceutical composition for preventing or treating neurodegenerative diseases.
The method of claim 13, wherein the neurological disease is Alzheimer's disease, Parkinson's disease, progressive supranuclear palsy, multiple system atrophy, olive-pons-cerebellar atrophy (OPCA), Schie-Drager syndrome, striatal-substantia nigra degeneration, Huntington's disease, At least one selected from the group consisting of amyotrophic lateral sclerosis (ALS), essential tremor, cortico-basal ganglia degeneration, diffuse Lewy body disease, Parkinson's-ALS-dementia complex, Niemanpick's disease, Pick's disease, cerebral ischemia and cerebral infarction characterized treatment methods.
(a) administering a vector into which a promoter and a target gene are inserted to a non-human mammal; and
(b) applying ultrasound to the site where the vector is administered; Containing, a method for treating neurodegenerative diseases of mammals other than humans.
16. The method of claim 15, wherein the promoter is selected from the group consisting of MSLN, A1BG, LRATD2 and CITED4 promoters.
The method of claim 15, wherein the target gene is at least one selected from the group consisting of Ascl1, Nurr1, Pitx3 and Lmx1a.