KR20230123453A - Novel variant of transporter and method for preparing L-aromatic amino acid using the same - Google Patents

Abstract

The present invention relates to a novel variant of transport protein and a method for producing L-aromatic amino acids using the same, wherein the transport protein variant is obtained by substituting at least one amino acid in the amino acid sequence constituting ammonium transport protein, adenine transport protein or FMN/FAD transport protein. As the protein activity is changed, recombinant microorganisms containing the same can efficiently produce L-aromatic amino acids.

Description

Novel variant of transporter and method for preparing L-aromatic amino acid using the same}

The present invention relates to a novel variant of transport protein and a method for producing L-aromatic amino acids using the same.

Amino acids are classified into hydrophobic, hydrophilic, basic and acidic amino acids according to the nature of their side chains, and among them, amino acids having a benzene ring are called aromatic amino acids. Aromatic amino acids include phenylalanine, tyrosine, and tryptophan, and phenylalanine and tryptophan are essential amino acids that are not synthesized in vivo and correspond to high value-added industries that form a market worth $300 billion annually worldwide.

For the production of aromatic amino acids, a wild-type strain obtained in nature or a mutant strain modified to improve its amino acid production ability may be used. Recently, in order to improve the production efficiency of aromatic amino acids, genetic recombination technology is applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of useful substances such as L-amino acids, to produce excellent L-aromatic amino acids. Various recombinant strains or mutant strains and L-aromatic amino acid production methods using the same are being developed. In particular, attempts have been made to increase the production of the amino acid by targeting genes involved in the biosynthetic pathway of L-aromatic amino acids, such as enzymes, transcription factors, and transport proteins, or by inducing mutations in promoters that control their expression. However, since there are dozens of types of proteins such as enzymes, transcription factors, and transport proteins directly or indirectly related to L-aromatic amino acid production, there are still many studies on whether the L-aromatic amino acid production ability increases due to changes in the activity of these proteins. It is necessary.

Korean Patent Registration No. 10-1830002

The present invention aims to provide novel transport protein variants.

In addition, the present invention provides a polynucleotide encoding the variant.

In addition, the present invention provides a transformant comprising the variant or polynucleotide.

In addition, an object of the present invention is to provide a method for producing L-aromatic amino acids using the transformant.

One aspect of the present invention is an ammonium transport protein variant consisting of the amino acid sequence of SEQ ID NO: 1, in which glycine at position 363 in the amino acid sequence of SEQ ID NO: 3 is substituted with aspartic acid; an adenine transport protein variant consisting of the amino acid sequence of SEQ ID NO: 5, in which tryptophan at position 136 in the amino acid sequence of SEQ ID NO: 7 is substituted with a stop codon; And it provides a variant selected from the group consisting of a FMN/FAD transport protein variant consisting of the amino acid sequence of SEQ ID NO: 9 in which glycine at position 272 in the amino acid sequence of SEQ ID NO: 11 is substituted with glutamine.

As used in the present invention, "transporter" is a general term for proteins responsible for the movement of various substances such as ions, chemicals, and proteins through cell membranes, and transport proteins have specificity for transported substances. These transport proteins are broadly divided into a channel protein, which becomes a passage for substances by forming holes penetrating the inside and outside of the membrane, and a carrier protein, such as a transporter, which moves the binding site of a transport substance across a membrane through structural transformation of the protein. Separated.

"AmmoH transport protein", "adenine transport protein" and "FMN/FAD transport protein" used in the present invention all correspond to carrier proteins, and are respectively ammonium, adenine and FMN (flavin mononucleotide) / FAD (flavin adenine dinucleotide) ) has the characteristic of specifically discharging only to the outside.

The transport protein may be a gene encoding each transport protein or a sequence having substantial identity thereto. Here, "substantial identity" means that each gene sequence, that is, a nucleotide sequence or nucleotide sequence, and any other nucleotide sequence are aligned and analyzed to maximize correspondence, and any other nucleotide sequence is at least 70% or 80% of each nucleotide sequence It means having a sequence homology of at least 90% or more or 98% or more.

The ammonium transport protein in the present invention is encoded by the amtB gene and includes the amino acid sequence of SEQ ID NO: 3.

According to one embodiment of the present invention, the amino acid sequence of SEQ ID NO: 3 may be derived from wild-type E. coli.

The adenine transport protein in the present invention is encoded by the yicO gene and includes the amino acid sequence of SEQ ID NO: 7.

According to one embodiment of the present invention, the amino acid sequence of SEQ ID NO: 7 may be derived from wild-type E. coli.

The FMN/FAD transport protein in the present invention is encoded by the yeeO gene and includes the amino acid sequence of SEQ ID NO: 11.

According to one embodiment of the present invention, the amino acid sequence of SEQ ID NO: 11 may be derived from wild-type E. coli.

As used in the present invention, “variant” refers to a variation of the variant by conservative substitution and/or modification of one or more amino acids at the N-terminus, C-terminus, and/or within the amino acid sequence of a specific gene. A polypeptide that differs from the full amino acid sequence but retains functions or properties. As used herein, "conservative substitution" means substitution of one amino acid with another amino acid having similar structural and/or chemical properties, and may have little or no effect on the activity of a protein or polypeptide. Variants also include those in which one or more portions are removed, such as the N-terminal leader sequence or transmembrane domain, or portions are removed from the N- and/or C-terminus of the mature protein. . Such variants may have increased, unchanged, or reduced abilities relative to the polypeptide before the mutation. In the present invention, variants may be mixed with variants, variants, variant polypeptides, mutated proteins, and variants.

The variant in the present invention is an ammonium transport protein mutant in which glycine, the 363rd position amino acid in the amino acid sequence of SEQ ID NO: 3, is substituted with aspartic acid, and may be composed of the amino acid sequence of SEQ ID NO: 1.

In addition, the variant in the present invention may be an adenine transport protein variant in which tryptophan, an amino acid located at position 136 in the amino acid sequence of SEQ ID NO: 7, is substituted with a stop codon, and may be composed of the amino acid sequence of SEQ ID NO: 5.

In addition, the variant in the present invention may be an FMN/FAD transport protein variant in which glutamine is substituted for glycine, which is the 272nd amino acid in the amino acid sequence of SEQ ID NO: 11, and may consist of the amino acid sequence of SEQ ID NO: 9.

Another aspect of the present invention provides a polynucleotide encoding the ammonium transport protein variant, adenine transport protein variant or FMN/FAD transport protein variant.

As used in the present invention, "polynucleotide" is a polymer of nucleotides in which nucleotide monomers are connected in a long chain shape by covalent bonds, and is a DNA or RNA strand of a certain length or more, more specifically, the variant It means a polynucleotide fragment that encodes.

The polynucleotide may include a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1, 5 or 9.

According to one embodiment of the present invention, the polynucleotide may include a nucleotide sequence represented by SEQ ID NO: 2, 6 or 10.

More specifically, the polynucleotide encoding the ammonium transport protein variant comprises the nucleotide sequence represented by SEQ ID NO: 2, and the polynucleotide encoding the adenine transport protein variant comprises the nucleotide sequence represented by SEQ ID NO: 6, The polynucleotide encoding the FMN/FAD transport protein variant includes the nucleotide sequence represented by SEQ ID NO: 10.

Another aspect of the present invention provides a vector comprising a polynucleotide encoding the ammonium transport protein variant, adenine transport protein variant or FMN/FAD transport protein variant.

In addition, another aspect of the present invention provides a transformant comprising the ammonium transport protein variant, adenine transport protein variant or FMN/FAD transport protein variant, or a polynucleotide thereof.

The term "vector" used in the present invention refers to any type of nucleic acid sequence delivery structure used as a means for transferring and expressing a gene of interest in a host cell. Unless otherwise specified, the vector may refer to a carrier nucleic acid sequence inserted into the genome of a host cell to be expressed and/or independently expressed. Such a vector contains essential regulatory elements operably linked to express the gene insert, and "operably linked" means that a target gene and its regulatory sequence are linked in such a way as to enable gene expression by being functionally linked to each other. It means that, "regulatory element" includes a promoter for performing transcription, an arbitrary operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating termination of transcription and translation.

The vector used in the present invention is not particularly limited as long as it can be replicated in a host cell, and any vector known in the art can be used. Examples of the vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR, pUC, pBluescriptII, There are pGEM-based, pTZ-based, pCL-based and pET-based, etc., but are not limited thereto.

The vector may typically be constructed as a vector for cloning or as a vector for expression. Vectors for expression may be conventional ones used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.

Recombinant vectors can be constructed using prokaryotic or eukaryotic cells as hosts. For example, when the vector used is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter); It is common to include a ribosome binding site for initiation of translation and a transcription/translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origins included in the vector include the f1 origin of replication, the SV40 origin of replication, the pMB1 origin of replication, the adeno origin of replication, the AAV origin of replication, and the BBV origin of replication. It is not limited. In addition, promoters derived from the genome of mammalian cells (eg, metallotionine promoter) or promoters derived from mammalian viruses (eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter) , the tk promoter of HSV) can be used, and usually has a polyadenylation sequence as a transcription termination sequence.

The recombinant vector may include a selection marker. The selection marker is for selecting a transformant (host cell) transformed with the vector and expresses the selection marker in a medium treated with the selection marker. Since only cells are viable, selection of transformed cells is possible. Representative examples of the selectable marker include kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.

A transformant may be produced by inserting the recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into an appropriate host cell. The host cell is a cell capable of stably and continuously cloning or expressing the expression vector, and any host cell known in the art may be used.

When transforming prokaryotic cells to prepare recombinant microorganisms, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli X 1776, E. coli as host cells. Escherichia coli W3110, E. coli XL1-Blue, Bacillus subtilis, Bacillus thuringiensis, and various intestinal bacteria and strains, such as Salmonella typhimurium, Serratia marcessons, and Pseudomonas species. It may be used, but is not limited thereto.

When transforming eukaryotic cells to produce recombinant microorganisms, yeast (eg, Saccharomyces cerevisiae), insect cells, plant cells and animal cells, such as Sp2/0 and CHO K1 as host cells , CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc. may be used, but are not limited thereto.

As used in the present invention, “transformation” refers to a phenomenon in which external DNA is introduced into a host cell to artificially cause genetic changes, and “transformat” refers to the introduction of external DNA into a target gene. It refers to a host cell that stably maintains expression.

In the transformation, a suitable vector introduction technique is selected according to the host cell, and the target gene or a recombinant vector containing the same can be expressed in the host cell. For example, vector introduction can be performed by electroporation, heat-shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE- It may be performed by a dextran method, a cationic liposome method, a lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether it is inserted into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell.

The transformant includes cells transfected, transformed, or infected with the recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

According to one embodiment of the present invention, the transformant may be an Escherichia genus strain.

The Escherichia genus strains include Escherichia coli , Escherichia albertii, Escherichia blattae , Escherichia fergusonii , Escherichia hermann Ni ( Escherichia hermannii ), Escherichia vulneris ( Escherichia vulneris ), etc., but are not limited thereto.

The transformant in the present invention includes the above-described transport protein variant or a polynucleotide encoding the same, or a strain containing a vector containing the same, a strain expressing the transport protein variant or polynucleotide, or the transport protein variant It may be a strain having activity against, but is not limited thereto.

According to one embodiment of the present invention, the transformant may have the ability to produce L-aromatic amino acids.

The transformant may naturally have the ability to produce L-aromatic amino acids or may be artificially endowed with the ability to produce L-aromatic amino acids.

According to one embodiment of the present invention, the transformant may be an ammonium transport protein variant, an adenine transport protein variant, or an L-aromatic amino acid production ability improved by changing the activity of FMN/FAD transport protein.

“Improved productivity” used in the present invention means increased productivity of L-aromatic amino acids compared to the parent strain. The parent strain refers to a wild-type or mutant strain subject to mutation, and includes a subject subject to direct mutation or transformed into a recombinant vector. In the present invention, the parent strain may be a wild-type strain of Escherichia genus or a strain of the genus Escherichia mutated from the wild-type strain.

In the transformant according to the present invention, the activity of each transport protein is changed by introducing an ammonium transport protein variant, an adenine transport protein variant, or an FMN / FAD transport protein variant, thereby increasing L-aromatic amino acid production ability compared to the parent strain. In particular, the production of L-aromatic amino acids is increased by 10% or more, specifically 10 to 80% (preferably 15 to 60%) compared to the parent strain, so that 3.5 to 20 g of L-aromatic amino acids per liter of strain culture can be produced. there is.

Another aspect of the present invention is culturing the transformant in a medium; and recovering L-aromatic amino acids from the transformants or the medium in which the transformants are cultured.

The culture may be performed according to appropriate media and culture conditions known in the art, and those skilled in the art can easily adjust and use the media and culture conditions. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination culture thereof, but is not limited thereto.

According to one embodiment of the present invention, the medium must meet the requirements of a particular strain in an appropriate way, and can be appropriately modified by a person skilled in the art. Culture medium for strains of the genus Escherichia may refer to known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981), but is not limited thereto.

According to one embodiment of the present invention, various carbon sources, nitrogen sources, and trace element components may be included in the medium. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, These include fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts. In addition, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto. In addition, essential growth substances such as amino acids and vitamins may be included. Precursors suitable for the culture medium may also be used. The medium or individual components may be added in a batchwise or continuous manner by a method suitable for the culture medium during the culture process, but is not limited thereto.

According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. In addition, the formation of bubbles can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Additionally, in order to maintain the aerobic state of the culture medium, oxygen or oxygen-containing gas (eg, air) may be injected into the culture medium. The temperature of the culture medium may be usually 20 ° C to 45 ° C, for example, 25 ° C to 40 ° C. The culturing period may be continued until useful substances are obtained in a desired yield, and may be, for example, 10 to 160 hours.

According to one embodiment of the present invention, the step of recovering L-aromatic amino acids from the cultured transformants or the medium in which the transformants are cultured is produced from the medium using a suitable method known in the art according to the culture method. L-aromatic amino acids can be collected or recovered. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractionation (eg ammonium sulfate precipitation), chromatography (eg ion exchange, affinity, hydrophobicity and Size exclusion) may be used, but is not limited thereto.

According to one embodiment of the present invention, in the step of recovering the L-aromatic amino acid, the culture medium is centrifuged at low speed to remove biomass, and the obtained supernatant may be separated through ion exchange chromatography.

According to one embodiment of the present invention, the step of recovering the L-aromatic amino acid may include a step of purifying the L-aromatic amino acid.

According to one embodiment of the present invention, the L- aromatic amino acid may be at least one selected from the group consisting of L-tryptophan, L-phenylalanine and L-tyrosine.

In the transport protein variant according to the present invention, the protein activity is changed by substituting one or more amino acids in the amino acid sequence constituting the ammonium transport protein, adenine transport protein, or FMN/FAD transport protein, and the recombinant microorganisms containing the same have L-aromatic amino acids. can be produced efficiently.

1 shows the structure of a plasmid pDSG according to an embodiment of the present invention.
Figure 2 shows the structure of plasmid pDS9 according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail. However, these descriptions are merely presented as examples to aid understanding of the present invention, and the scope of the present invention is not limited by these exemplary descriptions.

Example 1. Construction of strains expressing ammonium transport protein variants

In order to confirm the effect of a variant in which glycine at position 363 of the amino acid sequence (SEQ ID NO: 3) of the ammonium transport protein is substituted with aspartic acid on the production of L-aromatic amino acids, a vector expressing the ammonium transport protein variant and the vector The introduced strain was prepared. For gene insertion of the ammonium transport protein variant in the strain, it was constructed as follows using plasmids pDSG and pDS9.

Here, the plasmid pDSG has an origin of replication that works only in E. coli, and has an ampicillin resistance gene and a guide RNA (gRNA) expression mechanism. Plasmid pDS9 has an origin of replication that works only in E. coli, and has kanamycin resistance genes, λ Red genes (exo, bet, and gam), and a mechanism for expressing CAS9 derived from Streptococcus pyogenes .

1-1. Construction of vector pDSG-amtB (Gly363Asp) for transformation

Using Escherichia coli MG1655 (KCTC14419BP) gDNA as a template, a primer pair of primers 7 and 9, and a primer pair of primers 8 and 10, an upstream fragment of amino acid mutation 363 of the amtB gene of E. coli encoding an ammonium transport protein And, using a primer pair of primers 11 and 13 and a primer pair of primers 12 and 14, the downstream fragment of the amino acid mutation at position 363 of the E. coli amtB gene was obtained through PCR, respectively. At this time, each upstream and downstream fragment contained a sequence that changes glycine (Gly), the 363rd amino acid residue of the amtB gene, to aspartic acid (Asp). Here, Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification conditions were repeated 30 times: denaturation at 95 ° C for 10 seconds, annealing at 57 ° C for 15 seconds, and polymerization for 10 seconds at 72 ° C.

PCR was performed on four pDSG gene fragments using the plasmid pDSG as a template, using primer pairs of primers 3 and 5, primer pairs of primers 4 and 6, primers 15 and 1, and primers 16 and 2, respectively. was obtained through At this time, each gene fragment contained a gRNA sequence targeting the 363rd Gly of the amtB gene. The gRNA was selected as 20 mer in front of NGG of the sequence to induce mutation. Here, Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification conditions were performed by repeating 30 times of denaturation at 95 ° C for 10 seconds, annealing at 57 ° C for 15 seconds, and polymerization at 72 ° C for 15 seconds.

The obtained recombinant plasmid was obtained by cloning upstream and downstream of amino acid 363 of the amtB gene and four pDSG gene fragments using a self-assembly cloning method (BioTechniques 51:55-56 (July 2011)), -amtB (Gly363Asp) was named.

1-2. Production of L-tryptophan or L-phenylalanine-producing strain introduced with amtB (Gly363Asp), an ammonium transport protein variant

E. coli KFCC11660P and KCCM10016 were used as parent strains to prepare L-tryptophan-producing strains and L-phenylalanine-producing strains.

KFCC11660P strain or KCCM10016 strain was first transformed with plasmid pDS9, cultured in LB-Km (LB liquid medium containing 25 g/L and kanamycin 50 mg/L) solid medium, and then colonies having kanamycin resistance were selected. Secondary transformation of the pDSG-amtB (Gly363Asp) plasmid was performed on the selected colonies, followed by culturing in LB-Amp&Km (LB liquid medium containing 25 g/L, ampicillin 100 mg/L and kanamycin 50 mg/L) solid medium, followed by ampicillin and kanamycin After selecting resistant colonies, a gene fragment was obtained through PCR using a primer pair of primers 17 and 18. Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification conditions were performed by repeating 30 cycles of denaturation at 95°C for 10 seconds, annealing at 57°C for 10 seconds, and polymerization at 72°C for 15 seconds. Macrogen was entrusted with confirming the sequence of the obtained gene fragment using the primer pair of primer 17 and primer 18.

The selected secondary transformants were subcultured 7 times in LB liquid medium, and colonies were selected in LB solid medium. Each colony was selectively cultured on LB, LB-Amp and LB-Km solid media, respectively. Colonies that did not grow on LB-Amp and LB-Km solid media were selected while growing on LB solid medium. The strains prepared in this way were named KFCC11660P_pDSG-amtB (Gly363Asp) and KCCM10016_pDSG-amtB (Gly363Asp), respectively.

Primer sequences used in Example 1 are shown in Table 1 below.

Primer name sequence number Primer sequence (5'-3') primer 1 13 CAATTTTATTATAGTAATTGACTATTATAC Primer 2 14 CCACGCCGCCCAATTTTATTATAGTAATTGACTATTATAC Primer 3 15 GGCGGCGTGGGCTTCGCTGAGTTTTAGAGCTAGAAATAGC primer 4 16 GCTTCGCTGAGTTTTAGAGCTAGAAATAGC Primer 5 17 GAGCCTGTCGGCCTACCTGCT primer 6 18 CGGCCGGCATGAGCCTGTCG primer 7 19 ATGCCGGCCGTCGGTTGGTTTGGCTTTAAC Primer 8 20 TCGGTTGGTTTGGCTTTAAC Primer 9 21 CAGCGAGCTGGCGGCAAAAA Primer 10 22 CCACGCCGCCCAGCGAGCTGGCGGCAAAAA Primer 11 23 GGCGGCGTGGACTTCGCTGAAGGTGTGACG Primer 12 24 ACTTCGCTGAAGGTGTGACG Primer 13 25 GTGAGTTTTATACCCAAGAC Primer 14 26 TTTGTGCGCGGTGAGTTTTTA Primer 15 27 CGCGCACAAAGAGCTCCTGAAAATCTCGATAAC Primer 16 28 GAGCTCTGAAAATCTCGATAAC Primer 17 29 TGGCACCGTGGTGCACATTA Primer 18 30 AGCCGCACGGCATCGGTTTT

Experimental Example 1. Evaluation of L-aromatic amino acid production ability of mutants introduced with ammonium transport protein variants

The L-tryptophan or L-phenylalanine production abilities of the parent strains (KFCC11660P and KCCM10016) and mutant strains introduced with ammonium transport protein variants (KFCC11660P_amtB (Gly363Asp) and KCCM10016_amtB (Gly363Asp)) were compared.

Each strain (parent strain or mutant strain) was inoculated by 1% by volume in a 100 mL flask containing 10 mL of the medium for the production of tryptophan or the medium for the production of phenylalanine in Table 2 below, and cultured with shaking for 72 hours at 37 ° C. and 200 rpm. did After completion of the culture, the concentration of L-tryptophan or L-phenylalanine in the medium was measured using HPLC (Agilent), and the results are shown in Tables 3 and 4, respectively.

Medium for tryptophan production Medium for the production of phenylalanine Furtherance content Furtherance content Glucose 80.0 g/L Glucose 80.0 g/L (NH ₄ ) ₂ SO ₄ 20.0 g/L (NH ₄ ) ₂ SO ₄ 20.0 g/L K ₂ HPO ₄ 0.8 g/L K ₂ HPO ₄ 1.0 g/L K ₂ SO ₄ 0.4g/L KH ₂ PO ₄ 1.0 g/L MgCl ₂ 0.8g/L K ₂ SO ₄ 0.4g/L Fumaric acid 1.0 g/L MgCl ₂ 1.0 g/L Yeast extract 1.0 g/L Fumaric acid 0.5 g/L (NH ₄ ) ₆ Mo ₇ O ₂₄ 0.12 ppm Yeast extract 1.0 g/L H ₃ B O ₃ 0.01ppm Glutamic acid 0.5 g/L _CuSO4 0.01ppm CaCl ₂ 5.00 ppm MnCl ₂ 2.00 ppm MnCl ₂ 2.00 ppm ZnSO ₄ 0.01ppm ZnSO ₄ 1.00 ppm CoCl ₂ 0.10 ppm CoCl ₂ 0.10 ppm FeCl ₂ 10.00 ppm FeCl ₂ 10.00 ppm Thiamine_HCl 20.00 ppm Thiamine_HCl 20.00 ppm L-Tyrosine 200.00 ppm L-Tyrosine 200.00 ppm L-phenylalanine 300.00 ppm CaCO ₃ 3% CaCO ₃ 3% - - pH 7.0 with NaOH (33%) pH 7.0 with NaOH (33%)

strain L-tryptophan concentration
(g/L) L-tryptophan concentration increase rate
(%) KFCC11660P 4.12 - KFCC11660P_amtB(Gly363Asp) 4.89 18.7

strain L-phenylalanine concentration
(g/L) Increase rate of L-phenylalanine concentration
(%) KCCM10016 3.40 - KCCM10016_amtB(Gly363Asp) 4.52 32.9

As shown in Tables 3 and 4, the mutant strains KFCC11660P_amtB (Gly363Asp) and KCCM10016_amtB (Gly363Asp) into which ammonium transport protein variants were introduced produced L-tryptophan and L-phenylalanine production of about 19% and 33, respectively, compared to the parent strains KFCC11660P and KCCM10016 % improvement was found.

Example 2. Construction of strains expressing variants of adenine transport protein

A vector expressing the adenine transport protein variant and the vector in order to confirm the effect of a variant in which tryptophan at position 136 in the amino acid sequence (SEQ ID NO: 7) of the adenine transport protein is substituted with a stop codon affects the production of L-aromatic amino acids. The introduced strain was prepared. For genetic insertion of adenine transport protein mutants into strains, the plasmids pDSG and pDS9 of Example 1 were used and constructed as follows.

2-1. Construction of vector pDSG-yicO (Trp136Stop) for transformation

Using Escherichia coli MG1655 (KCTC14419BP) gDNA as a template, a primer pair of primers 7 and 9, and a primer pair of primers 8 and 10, an upstream fragment of amino acid mutation 136 of E. coli yicO gene encoding an adenine transport protein And, using a primer pair of primers 11 and 13 and a primer pair of primers 12 and 14, the downstream fragment of the amino acid mutation at position 136 of the E. coli yicO gene was obtained through PCR, respectively. At this time, each upstream and downstream fragment contained a sequence that changes the 136th amino acid residue of the yicO gene, tryptophan (Trp), to a stop codon (Stop). Here, Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification conditions were performed by repeating 30 cycles of denaturation at 95°C for 10 seconds, annealing at 57°C for 15 seconds, and polymerization at 72°C for 10 seconds.

PCR was performed on four pDSG gene fragments using the plasmid pDSG as a template, using primer pairs of primers 3 and 5, primer pairs of primers 4 and 6, primers 15 and 1, and primers 16 and 2, respectively. was obtained through At this time, each gene fragment contained a gRNA sequence targeting the 136th Trp of the yicO gene. The gRNA was selected as 20 mer in front of NGG of the sequence to induce mutation. Here, Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification conditions were performed by repeating 30 times of denaturation at 95 ° C for 10 seconds, annealing at 57 ° C for 15 seconds, and polymerization at 72 ° C for 15 seconds.

Recombinant plasmids were obtained by cloning upstream and downstream of amino acid 136 of the obtained yicO gene and four pDSG gene fragments using the self-assembly cloning method (BioTechniques 51:55-56 (July 2011)), which was -yicO (Trp136Stop) was named.

2-2. Production of strains producing L-tryptophan or L-phenylalanine into which adenine transport protein variant yicO (Trp136Stop) was introduced

E. coli KFCC11660P and KCCM10016 were used as parent strains to prepare L-tryptophan-producing strains and L-phenylalanine-producing strains.

KFCC11660P strain or KCCM10016 strain was first transformed with plasmid pDS9, cultured in LB-Km (LB liquid medium containing 25 g/L and kanamycin 50 mg/L) solid medium, and then colonies having kanamycin resistance were selected. Secondary transformation of the pDSG-yicO (Trp136Stop) plasmid was performed on the selected colonies, followed by culturing in LB-Amp&Km (LB liquid medium 25 g/L, ampicillin 100 mg/L and kanamycin 50 mg/L) solid medium, followed by ampicillin and kanamycin After selecting resistant colonies, a gene fragment was obtained through PCR using a primer pair of primers 17 and 18. Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification conditions were performed by repeating 30 cycles of denaturation at 95°C for 10 seconds, annealing at 57°C for 10 seconds, and polymerization at 72°C for 15 seconds. Macrogen was entrusted with confirming the sequence of the obtained gene fragment using the primer pair of primer 17 and primer 18.

The selected secondary transformants were subcultured 7 times in LB liquid medium, and colonies were selected in LB solid medium. Each colony was selectively cultured on LB, LB-Amp and LB-Km solid media, respectively. Colonies that did not grow on LB-Amp and LB-Km solid media were selected while growing on LB solid medium. The strains prepared in this way were named KFCC11660P_yicO (Trp136Stop) and KCCM10016_yicO (Trp136Stop), respectively.

Primer sequences used in Example 2 are shown in Table 5 below.

Primer name sequence number Primer sequence (5'-3') primer 1 13 CAATTTTATTATAGTAATTGACTATTATAC Primer 2 31 CGTGACGTTCCAATTTTATTATAGTAATTGACTATTATAC Primer 3 32 GAACGTCACGACCTTCGTCAGTTTTAGAGCTAGAAATAGC primer 4 33 ACCTTCGTCAGTTTTAGAGCTAGAAATAGC Primer 5 17 GAGCCTGTCGGCCTACCTGCT primer 6 18 CGGCCGGCATGAGCCTGTCG primer 7 34 ATGCCGGCCGCGGCCGGGTAGATACCCAGAG Primer 8 35 CGGCCGGGTAGATACCCAGAG Primer 9 36 TCTGCTGTTCGTTGACAACA Primer 10 37 GTCGTGACGTTCTGCTGTTC Primer 11 38 ACGTCACGACTTTCGTCACGGAATTTCTCA Primer 12 39 TTTCGTCACGGAATTTCTCA Primer 13 40 TCCGTTCGCTAAGGGCGGTA Primer 14 41 ACCTGATGTGTCCGTTCGCT Primer 15 42 CACATCAGGTGAGCTCCTGAAAATCTCGATAAC Primer 16 28 GAGCTCTGAAAATCTCGATAAC Primer 17 43 TCCGTTCGCTAAGGGCGGTA Primer 18 44 ACCTGATGTGTCCGTTCGCT

Experimental Example 2. Evaluation of L-aromatic amino acid production ability of a mutant strain into which an adenine transport protein variant was introduced

The L-tryptophan or L-phenylalanine production abilities of the parent strains (KFCC11660P and KCCM10016) and mutants introduced with adenine transport protein variants (KFCC11660P_yicO(Trp136Stop) and KCCM10016_yicO(Trp136Stop)) were compared. The concentrations of L-tryptophan and L-phenylalanine were measured in the same manner as in Experimental Example 1, and the results are shown in Tables 6 and 7, respectively.

strain L-tryptophan concentration
(g/L) L-tryptophan concentration increase rate
(%) KFCC11660P 4.15 - KFCC11660P_yicO(Trp136Stop) 5.22 25.7

strain L-phenylalanine concentration
(g/L) Increase rate of L-phenylalanine concentration
(%) KCCM10016 3.23 - KCCM10016_yicO(Trp136Stop) 3.85 19.1

As shown in Tables 6 and 7, the mutant strains KFCC11660P_yicO (Trp136Stop) and KCCM10016_yicO (Trp136Stop) into which adenine transport protein variants were introduced showed L-tryptophan and L-phenylalanine production of about 26% and 19%, respectively, compared to the parent strains KFCC11660P and KCCM10016. % improvement was found.

Example 3. Construction of strains expressing FMN/FAD transport protein variants

A vector expressing the FMN/FAD transport protein variant in order to determine the effect of a variant in which glutamine is substituted for glycine at position 272 of the amino acid sequence (SEQ ID NO: 11) of the FMN/FAD transport protein on the production of L-aromatic amino acids, and A strain into which the vector was introduced was constructed. For gene insertion of the FMN/FAD transport protein variant in the strain, it was prepared as follows using plasmids pDSG and pDS9 in the same manner as in Example 1.

3-1. Construction of vector pDSG-yeeO (Gly272Glu) for transformation

Using Escherichia coli MG1655 (KCTC14419BP) gDNA as a template, primer pairs of primers 7 and 9, and primer pairs of primers 8 and 10, the mutation of amino acid 272 of the E. coli yeeO gene encoding the FMN/FAD transport protein Using the upstream fragment, the primer pair of primers 11 and 13, and the primer pair of primers 12 and 14, the downstream fragment of the 272 amino acid mutation of the E. coli yeeO gene was obtained through PCR, respectively. At this time, each upstream and downstream fragment contained a sequence that changes glycine (Gly), the 272nd amino acid residue of the yeeO gene, to glutamine (Glu). Here, Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification conditions were repeated 30 times: denaturation at 95 ° C for 10 seconds, annealing at 57 ° C for 15 seconds, and polymerization for 10 seconds at 72 ° C.

PCR was performed on four pDSG gene fragments using the plasmid pDSG as a template, using primer pairs of primers 3 and 5, primer pairs of primers 4 and 6, primers 15 and 1, and primers 16 and 2, respectively. was obtained through At this time, each gene fragment contained a gRNA sequence targeting the 272nd Gly of the yeeO gene. The gRNA was selected as 20 mer in front of NGG of the sequence to induce mutation. Here, Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification conditions were performed by repeating 30 times of denaturation at 95 ° C for 10 seconds, annealing at 57 ° C for 15 seconds, and polymerization at 72 ° C for 15 seconds.

A recombinant plasmid was obtained by cloning upstream and downstream of amino acid 272 of the obtained yeeO gene and four pDSG gene fragments using the self-assembly cloning method (BioTechniques 51:55-56 (July 2011)), which was -yeeO (Gly272Glu) was named.

3-2. Production of L-tryptophan or L-phenylalanine-producing strain introduced with FMN/FAD transport protein variant yeeO (Gly272Glu)

E. coli KFCC11660P and KCCM10016 were used as parent strains to prepare L-tryptophan-producing strains and L-phenylalanine-producing strains.

KFCC11660P strain or KCCM10016 strain was first transformed with plasmid pDS9, cultured in LB-Km (LB liquid medium containing 25 g/L and kanamycin 50 mg/L) solid medium, and then colonies having kanamycin resistance were selected. Secondary transformation of the pDSG-yeeO (Gly272Glu) plasmid was performed on the selected colonies, followed by culturing in LB-Amp&Km (LB liquid medium 25 g/L, ampicillin 100 mg/L and kanamycin 50 mg/L) solid medium, followed by ampicillin and kanamycin After selecting resistant colonies, a gene fragment was obtained through PCR using a primer pair of primers 17 and 18. Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification conditions were performed by repeating 30 cycles of denaturation at 95°C for 10 seconds, annealing at 57°C for 10 seconds, and polymerization at 72°C for 15 seconds. Macrogen was entrusted with confirming the sequence of the obtained gene fragment using the primer pair of primer 17 and primer 18.

The selected secondary transformants were subcultured 7 times in LB liquid medium, and colonies were selected in LB solid medium. Each colony was selectively cultured on LB, LB-Amp and LB-Km solid media, respectively. Colonies that did not grow on LB-Amp and LB-Km solid media were selected while growing on LB solid medium. The strains prepared in this way were named KFCC11660P_yeeO (Gly272Glu) and KCCM10016_yeeO (Gly272Glu), respectively.

Primer sequences used in Example 3 are shown in Table 8 below.

Primer name sequence number Primer sequence (5'-3') primer 1 13 CAATTTTATTATAGTAATTGACTATTATAC Primer 2 45 AGGAGAAAAGCAATTTTATTATAGTAATTGACTATTATAC Primer 3 46 CTTTTCTCCTGGCCGGGACTGTTTTAGAGCTAGAAATAGC primer 4 47 GGCCGGGACTGTTTTAGAGCTAGAAATAGC Primer 5 17 GAGCCTGTCGGCCTACCTGCT primer 6 18 CGGCCGGCATGAGCCTGTCG primer 7 48 ATGCCGGCCGTTTAGTCTCGGTAAGCGGGA Primer 8 49 TTTAGTCTCGGTAAGCGGGA Primer 9 50 GAAAAGGCCGTAAATCAATATGCCG Primer 10 51 CCGGCCAGGAGAAAAGGCCGTAAAT Primer 11 52 TCCTGGCCGGAACTGGGATTTGTCGGGGCA Primer 12 53 AACTGGGATTTGTCGGGGCA Primer 13 54 GCAGAGCCGAGCGCACTTCC Primer 14 55 GATCGTAGAAGCAGAGCCGA Primer 15 56 TTCTACGATCGAGCTCCTGAAAATCTCGATAAC Primer 16 28 GAGCTCTGAAAATCTCGATAAC Primer 17 57 CTTTTCTGGTCAGCTGGCTG Primer 18 58 TTAGCCAGGCGATGGCCGTT

Experimental Example 3. Evaluation of L-aromatic amino acid production ability of the mutant strain into which the FMN / FAD transport protein variant was introduced

The L-tryptophan or L-phenylalanine production abilities of the parent strains (KFCC11660P and KCCM10016) and the mutant strains introduced with FMN/FAD transport protein variants (KFCC11660P_yeeO(Gly272Glu) and KCCM10016_yeeO(Gly272Glu)) were compared. The concentrations of L-tryptophan and L-phenylalanine were measured in the same manner as in Experimental Example 1, and the results are shown in Tables 9 and 10, respectively.

strain L-tryptophan concentration
(g/L) L-tryptophan concentration increase rate
(%) KFCC11660P 4.15 - KFCC11660P_yeeO(Gly272Glu) 5.04 21.4

strain L-phenylalanine concentration
(g/L) Increase rate of L-phenylalanine concentration
(%) KCCM10016 3.41 - KCCM10016_yeeO(Gly272Glu) 4.87 42.8

As shown in Tables 9 and 10, the mutant strains KFCC11660P_yeeO (Gly272Glu) and KCCM10016_yeeO (Gly272Glu) into which the FMN/FAD transport protein variants were introduced showed about 21% L-tryptophan and L-phenylalanine production, respectively, compared to the parent strains KFCC11660P and KCCM10016. and 43% improvement.

So far, the present invention has been looked at with respect to its preferred embodiments. Those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent scope will be construed as being included in the present invention.

Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC) KCTC14419BP 20201228 Korea Center for Microbial Conservation (KCCM) KFCC11660P 20160512 Korea Center for Microbial Conservation (KCCM) KCCM10016 19921022

<110> DAESANG CORPORATION <120> Novel variant of transporter and method for preparing L-aromatic amino acid using the same <130> BPN221015D2 <160> 60 <170> KoPatentIn 3.0 <210> 1 <211> 428 <212> PRT < 213> Artificial Sequence <220> <223> amtB (G363D) variant <400> 1 Met Lys Ile Ala Thr Ile Lys Thr Gly Leu Ala Ser Leu Ala Met Leu 1 5 10 15 Pro Gly Leu Val Met Ala Ala Pro Ala Val Ala Asp Lys Ala Asp Asn 20 25 30 Ala Phe Met Met Ile Cys Thr Ala Leu Val Leu Phe Met Thr Ile Pro 35 40 45 Gly Ile Ala Leu Phe Tyr Gly Gly Leu Ile Arg Gly Lys Asn Val Leu 50 55 60 Ser Met Leu Thr Gln Val Thr Val Thr Phe Ala Leu Val Cys Ile Leu 65 70 75 80 Trp Val Val Tyr Gly Tyr Ser Leu Ala Phe Gly Glu Gly Asn Asn Phe 85 90 95 Phe Gly Asn Ile Asn Trp Leu Met Leu Lys Asn Ile Glu Leu Thr Ala 100 105 110 Val Met Gly Ser Ile Tyr Gln Tyr Ile His Val Ala Phe Gln Gly Ser 115 120 125 Phe Ala Cys Ile Thr Val Gly Leu Ile Val Gly Ala Leu Ala Glu Arg 130 135 140 Ile Arg Phe Ser Ala Val Leu Ile Phe Val Val Val Trp Leu Thr Leu 145 150 155 160 Ser Tyr Ile Pro Ile Ala His Met Val Trp Gly Gly Gly Leu Leu Ala 165 170 175 Ser His Gly Ala Leu Asp Phe Ala Gly Gly Thr Val Val His Ile Asn 180 185 190 Ala Ala Ile Ala Gly Leu Val Gly Ala Tyr Leu Ile Gly Lys Arg Val 195 200 205 Gly Phe Gly Lys Glu Ala Phe Lys Pro His Asn Leu Pro Met Val Phe 210 215 220 Thr Gly Thr Ala Ile Leu Tyr Ile Gly Trp Phe Gly Phe Asn Ala Gly 225 230 235 240 Ser Ala Gly Thr Ala Asn Glu Ile Ala Ala Leu Ala Phe Val Asn Thr 245 250 255 Val Val Ala Thr Ala Ala Ala Ile Leu Gly Trp Ile Phe Gly Glu Trp 260 265 270 Ala Leu Arg Gly Lys Pro Ser Leu Leu Gly Ala Cys Ser Gly Ala Ile 275 280 285 Ala Gly Leu Val Gly Val Thr Pro Ala Cys Gly Tyr Ile Gly Val Gly 290 295 300 Gly Ala Leu Ile Ile Gly Val Val Ala Gly Leu Ala Gly Leu Trp Gly 305 310 315 320 Val Thr Met Leu Lys Arg Leu Leu Arg Val Asp Asp Pro Cys Asp Val 325 330 335 Phe Gly Val His Gly Val Cys Gly Ile Val Gly Cys Ile Met Thr Gly 340 345 350 Ile Phe Ala Ala Ser Ser Ser Leu Gly Gly Val Asp Phe Ala Glu Gly Val 355 360 365 Thr Met Gly His Gln Leu Leu Val Gln Leu Glu Ser Ile Ala Ile Thr 370 375 380 Ile Val Trp Ser Gly Val Val Ala Phe Ile Gly Tyr Lys Leu Ala Asp 385 390 395 400 Leu Thr Val Gly Leu Arg Val Pro Glu Glu Gln Glu Arg Glu Gly Leu 405 410 415 Asp Val Asn Ser His Gly Glu Asn Ala Tyr Asn Ala 420 425 <210> 2 <211> 1287 <212> DNA <213> Artificial Sequence <220> <223> amtB (G363D) variant <400> 2 atgaagatag cgacgataaa aactgggctt gcttcactgg cgatgcttcc gggactggta 60 atggctgcac ctgcggtggc cgataaagcc gacaatgcgt ttatgatgat ttgtactgcg 120 ctggtgctgt ttatg actat tccggggatt gccctgtttt acggtgggtt gattcgcggc 180 aaaaacgtgc tgtcgatgct gacgcaggtg acggtgacat ttgcactggt ctgtattctc 240 tgggtggttt acggttactc gctggcgttt ggtgagggca acaacttctt cggcaacatt 300 aactggttga tgctgaaaaa catcgaactg acggcggtga tgggcagcat ttatcagtat 360 atccacgtgg cgtttcaggg atcgtttgcc tgcattaccg tcggcttgat agttggggcg 420 ctggcggaac gaatccgctt ctcagctgtg ttgattttcg tggt ggtatg gctgacgctc 480 tcttacattc cgattgcgca tatggtgtgg ggcggtggtt tgctggcttc tcacggtgcg 540 ctggatttcg cgggtggcac cgtggtgcac attaacgccg caatcgccgg tctggtgggc 600 gcgtatctga taggaaaacg cgt gggcttc ggtaaagagg cgtttaaacc gcacaacctg 660 ccgatggtct tcaccgggac tgccattctc tatatcggtt ggtttggctt taacgccggg 720 tcagcgggca cggcgaatga aatcgcggca ctggcatttg tgaatactgt ggtcgcaacg 780 gcggcggcaa ttcttggctg gatcttcggt gaatgggcgc tgcgtggtaa gccttcactg 840 ctgggggcgt gttctggcgc gattgccggt ctggtcggcg tgacgcc ctgtatcat g accgggattt ttgccgccag ctcgctgggc 1080 ggcgtggact tcgctgaagg tgtgacgatg ggccatcagt tgctggtaca gctggaaagc 1140 atcgccatta cgatcgtctg gtccggtgtt gtggcattta tcggctacaa attggcggat 1200 ctgacggttg gtctgcgtgt accggaagag caggagcgag aagggctgga tgtcaacagc 1260 cacggcgaga atgcctataa cgcgtaa 1287 <210> 3 <211> 428 <212> 213> Artificial Sequence <220> <223> amtB <400> 3 Met Lys Ile Ala Thr Ile Lys Thr Gly Leu Ala Ser Leu Ala Met Leu 1 5 10 15 Pro Gly Leu Val Met Ala Ala Pro Ala Val Ala Asp Lys Ala Asp Asn 20 25 30 Ala Phe Met Met Ile Cys Thr Ala Leu Val Leu Phe Met Thr Ile Pro 35 40 45 Gly Ile Ala Leu Phe Tyr Gly Gly Leu Ile Arg Gly Lys Asn Val Leu 50 55 60 Ser Met Leu Thr Gln Val Thr Val Thr Phe Ala Leu Val Cys Ile Leu 65 70 75 80 Trp Val Val Tyr Gly Tyr Ser Leu Ala Phe Gly Glu Gly Asn Asn Phe 85 90 95 Phe Gly Asn Ile Asn Trp Leu Met Leu Lys Asn Ile Glu Leu Thr Ala 100 105 110 Val Met Gly Ser Ile Tyr Gln Tyr Ile His Val Ala Phe Gln Gly Ser 115 120 125 Phe Ala Cys Ile Thr Val Gly Leu Ile Val Gly Ala Leu Ala Glu Arg 130 135 140 Ile Arg Phe Ser Ala Val Leu Ile Phe Val Val Val Trp Leu Thr Leu 145 150 155 160 Ser Tyr Ile Pro Ile Ala His Met Val Trp Gly Gly Gly Leu Leu Ala 165 170 175 Ser His Gly Ala Leu Asp Phe Ala Gly Gly Thr Val Val His Ile Asn 180 185 190 Ala Ala Ile Ala Gly Leu Val Gly Ala Tyr Leu Ile Gly Lys Arg Val 195 200 205 Gly Phe Gly Lys Glu Ala Phe Lys Pro His Asn Leu Pro Met Val Phe 210 215 220 Thr Gly Thr Ala Ile Leu Tyr Ile Gly Trp Phe Gly Phe Asn Ala Gly 225 230 235 240 Ser Ala Gly Thr Ala Asn Glu Ile Ala Ala Leu Ala Phe Val Asn Thr 245 250 255 Val Val Ala Thr Ala Ala Ala Ile Leu Gly Trp Ile Phe Gly Glu Trp 260 265 270 Ala Leu Arg Gly Lys Pro Ser Leu Leu Gly Ala Cys Ser Gly Ala Ile 275 280 285 Ala Gly Leu Val Gly Val Thr Pro Ala Cys Gly Tyr Ile Gly Val Gly 290 295 300 Gly Ala Leu Ile Ile Gly Val Val Ala Gly Leu Ala Gly Leu Trp Gly 305 310 315 320 Val Thr Met Leu Lys Arg Leu Leu Arg Val Asp Asp Pro Cys Asp Val 325 330 335 Phe Gly Val His Gly Val Cys Gly Ile Val Gly Cys Ile Met Thr Gly 340 345 350 Ile Phe Ala Ala Ser Ser Leu Gly Gly Val Gly Phe Ala Glu Gly Val 355 360 365 Thr Met Gly His Gln Leu Leu Val Gln Leu Glu Ser Ile Ala Ile Thr 370 375 380 Ile Val Trp Ser Gly Val Val Ala Phe Ile Gly Tyr Lys Leu Ala Asp 385 390 395 400 Leu Thr Val Gly Leu Arg Val Pro Glu Glu Gln Glu Arg Glu Gly Leu 405 410 415 Asp Val Asn Ser His Gly Glu Asn Ala Tyr Asn Ala 420 425 <210> 4 <211> 1287 <212> DNA <213> Artificial Sequence <220> <223> amtB <400> 4 atgaagatag cgacgataaa aactgggctt gcttcactgg cgatgcttcc gggactggta 60 atggctgcac ctgcggtggc cgataaagcc gacaatgcgt ttatgatgat ttgtactgcg 120 ctggtgctgt ttatgactat tccggggatt gccctgtttt acggtgggtt gattcgcggc 180 aaaaacgtgc tgtcgatgct gacgcaggtg acggtgacat ttgcactggt ctgtattctc 240 tgggtggttt acggttactc gctggcgttt ggtgagggca acaacttctt ttgatt ttcg tggtggtatg gctgacgctc 480 tcttacattc cgattgcgca tatggtgtgg ggcggtggtt tgctggcttc tcacggtgcg 540 ctggatttcg cgggtggcac cgtggtgcac attaacgccg caatcgccgg tctggtgggc 600 gcgtatctga taggaaaacg cgtgggcttc ggtaaagagg cgtttaaacc gcacaacctg 660 ccgatggtct tcaccgggac tgccattctc tatatcggtt ggtttggctt taacgccggg 720 tcagcgggca cggcgaatga aatcgcggca ctggcatttg tgaatactgt ggtcgcaacg 780 gcggcggcaa ttcttggctg gatcttcggt gaatgggcgc tgcgtggtaa gccttcactg 840 ctgggggcgt gttctggcgc gattgccggt ctggt cggcg tgacgccagc ctgcggctac 900 attggggttg gcggcgcgtt gattatcggc gtggtagctg gtctggcggg cttgtggggc 960 gttaccatgc tcaaacgctt gctgcgggtg gatgatccct gcgatgtctt cggtgtgcac 1020 ggcgtttgtg gcattgtcgg ctgtatcatg accgggattt ttgccgccag ctcgctgggc 1080 ggcgtgggct tcgctgaagg tgtgacgatg ggccatcagt tgctggtaca gctggaaagc 5 < 211> 444 <212> PRT < 213> Artificial Sequence <220> <223> yicO (TRP136Stop) variant <400> 5 Met Asn Asn Asp Asn Thr Asp Tyr Val Ser Asn Glu Ser Gly Thr Leu 1 5 10 15 Ser Arg Leu Phe Lys Leu Pro Gln His Gly Thr Thr Val Arg Thr Glu 20 25 30 Leu Ile Ala Gly Met Thr Thr Phe Leu Thr Met Val Tyr Ile Val Phe 35 40 45 Val Asn Pro Gln Ile Leu Gly Ala Ala Gln Met Asp Pro Lys Val Val 50 55 60 Phe Val Thr Thr Thr Cys Leu Ile Ala Gly Ile Gly Ser Ile Ala Met Gly 65 70 75 80 Ile Phe Ala Asn Leu Pro Val Ala Leu Ala Pro Ala Met Gly Leu Asn 85 90 95 Ala Phe Phe Ala Phe Val Val Val Gly Ala Met Gly Ile Ser Trp Gln 100 105 110 Thr Gly Met Gly Ala Ile Phe Trp Gly Ala Val Gly Leu Phe Leu Leu 115 120 125 Thr Leu Phe Arg Ile Arg Tyr *** Met Ile Ser Asn Ile Pro Leu Ser 130 135 140 Leu Arg Ile Gly Ile Thr Ser Gly Ile Gly Leu Phe Ile Ala Leu Met 145 150 155 160 Gly Leu Lys Asn Thr Gly Val Ile Val Ala Asn Lys Asp Thr Leu Val 165 170 175 Met Ile Gly Asp Leu Ser Ser His Gly Val Leu Leu Gly Ile Leu Gly 180 185 190 Phe Phe Ile Ile Thr Val Leu Ser Ser Arg His Phe His Ala Ala Val 195 200 205 Leu Val Ser Ile Val Val Thr Ser Cys Cys Gly Leu Phe Phe Gly Asp 210 215 220 Val His Phe Ser Gly Val Tyr Ser Ile Pro Pro Asp Ile Ser Gly Val 225 230 235 240 Ile Gly Glu Val Asp Leu Ser Gly Ala Leu Thr Leu Glu Leu Ala Gly 245 250 255 Ile Ile Phe Ser Phe Met Leu Ile Asn Leu Phe Asp Ser Ser Gly Thr 260 265 270 Leu Ile Gly Val Thr Asp Lys Ala Gly Leu Ile Asp Gly Asn Gly Lys 275 280 285 Phe Pro Asn Met Asn Lys Ala Leu Tyr Val Asp Ser Val Ser Ser Val 290 295 300 Ala Gly Ala Phe Ile Gly Thr Ser Ser Val Thr Ala Tyr Ile Glu Ser 305 310 315 320 Thr Ser Gly Val Ala Val Gly Gly Arg Thr Gly Leu Thr Ala Val Val 325 330 335 Val Gly Val Met Phe Leu Leu Val Met Phe Phe Ser Pro Leu Val Ala 340 345 350 Ile Val Pro Pro Tyr Ala Thr Ala Gly Ala Leu Ile Phe Val Gly Val 355 360 365 Leu Met Thr Ser Ser Leu Ala Arg Val Asn Trp Asp Asp Phe Thr Glu 370 375 380 Ser Val Pro Ala Phe Ile Thr Thr Thr Val Met Met Pro Phe Thr Phe Ser 385 390 395 400 Ile Thr Glu Gly Ile Ala Leu Gly Phe Met Ser Tyr Cys Ile Met Lys 405 410 415 Val Cys Thr Gly Arg Trp Arg Asp Leu Asn Leu Cys Val Val Val Val 420 425 430 Ala Ala Leu Phe Ala Leu Lys Ile Ile Leu Val Asp 435 440 <210> 6 <211> 1335 <212> DNA <213> Artificial Sequence <220> <223> yicO (TRP136Stop) variant <400> 6 atgaataatg acaataccga ttacgtgagt aatgaatcag ggacgctttc gcgattattt 60 aaactacctc agcat gggac caccgtccgc acagaattga ttgcggggat gaccactttt 120 ttaaccatgg tgtacatcgt ttttgtgaac ccgcaaatcc tcggcgcggc acaaatggac 180 ccgaaagtgg tgtttgttac cacctgtttg attgccggta tcggcagtat tgcgatgggg 240 atatttgcta acttacccgt ggcgctggct ccggcaatgg ggctgaac gc cttctttgcc 300 ttcgtggtcg tgggggcgat gggcatctcc tggcagaccg ggatgggcgc aatattctgg 360 ggcgcagttg gactattttt gctcacgctg tttcgtatcc ggtactgaat gatctccaac 420 attcccttaa gtttacgtat tggtatca cc agcggaattg gattatttat cgccttaatg 480 ggattaaaaa atactggcgt tattgtcgcc aataaagaca cgctggtgat gattggcgat 540 ttaagttctc acggcgtgtt gttaggtatt ttagggtttt ttattataac cgtgttgtca 600 tcacgtcatt ttcatgccgc ggtgctggtt tctattgtgg tgacgtcttg ctgtggatta 660 tttttcggtg atgttcattt tagcggcgtc tattccattc cgcctgatat tagcggcgtc 720 attggtgaag tagatttgag cggcgcgtta acacttgaac tcgccggtat cattttctcc 780 tttatgctga tcaacctatt tgattcatca ggaacattaa ttggtgtaac tgataaagcg 840 ggcttaatag atggtaacgg taaattcccc aatatgaata aggcgctgta tgttgatagc 900 gtcagttcgg tggcgggtgc gtttatcggc acctcgtctg ttactgccta tattgaaagt 960 acttctggtg tggcagtcgg tggccgcacg gggctgactg cggttgtggt tggcgttatg 1020 ttcctgttgg ttatgttctt ctcaccgctg gtggcgatag ttcctcctta cgcaaccgcc 1080 ggagcgttaa tctttgttgg cgtgctgatg acttcgagcc tggcgcgcgt taactggga t 1140 gattttaccg aatcggtgcc tgcgtttatt accacggtga tgatgccctt tactttctcg 1200 atcaccgaag ggattgcact cggctttatg tcgtactgca tcatgaaagt atgcaccggg 1260 cgctggcgcg atctgaacct gtgtgtggtg gtggtcgcag ctctgtttgc actgaagatt 1320 attctggtgg attag 1335 <210> 7 <211> 444 <212> PRT <213> Artificial Sequence <220> <223> yicO <400> 7 Met Asn Asn Asp Asn Thr Asp Tyr Val Ser Asn Glu Ser Gly Thr Leu 1 5 10 15 Ser Arg Leu Phe Lys Leu Pro Gln His Gly Thr Thr Val Arg Thr Glu 20 25 30 Leu Ile Ala Gly Met Thr Thr Phe Leu Thr Met Val Tyr Ile Val Phe 35 40 45 Val Asn Pro Gln Ile Leu Gly Ala Ala Gln Met Asp Pro Lys Val Val 50 55 60 Phe Val Thr Thr Cys Leu Ile Ala Gly Ile Gly Ser Ile Ala Met Gly 65 70 75 80 Ile Phe Ala Asn Leu Pro Val Ala Leu Ala Pro Ala Met Gly Leu Asn 85 90 95 Ala Phe Phe Ala Phe Val Val Val Gly Ala Met Gly Ile Ser Trp Gln 100 105 110 Thr Gly Met Gly Ala Ile Phe Trp Gly Ala Val Gly Leu Phe Leu Leu 115 120 125 Thr Leu Phe Arg Ile Arg Tyr Trp Met Ile Ser Asn Ile Pro Leu Ser 130 135 140 Leu Arg Ile Gly Ile Thr Ser Gly Ile Gly Leu Phe Ile Ala Leu Met 145 150 155 160 Gly Leu Lys Asn Thr Gly Val Ile Val Ala Asn Lys Asp Thr Leu Val 165 170 175 Met Ile Gly Asp Leu Ser Ser His Gly Val Leu Leu Gly Ile Leu Gly 180 185 190 Phe Phe Ile Ile Thr Val Leu Ser Ser Arg His Phe His Ala Ala Val 195 200 205 Leu Val Ser Ile Val Val Thr Ser Cys Cys Gly Leu Phe Phe Gly Asp 210 215 220 Val His Phe Ser Gly Val Tyr Ser Ile Pro Pro Asp Ile Ser Gly Val 225 230 235 240 Ile Gly Glu Val Asp Leu Ser Gly Ala Leu Thr Leu Glu Leu Ala Gly 245 250 255 Ile Ile Phe Ser Phe Met Leu Ile Asn Leu Phe Asp Ser Ser Gly Thr 260 265 270 Leu Ile Gly Val Thr Asp Lys Ala Gly Leu Ile Asp Gly Asn Gly Lys 275 280 285 Phe Pro Asn Met Asn Lys Ala Leu Tyr Val Asp Ser Val Ser Ser Val 290 295 300 Ala Gly Ala Phe Ile Gly Thr Ser Ser Val Thr Ala Tyr Ile Glu Ser 305 310 315 320 Thr Ser Gly Val Ala Val Gly Gly Arg Thr Gly Leu Thr Ala Val Val 325 330 335 Val Gly Val Met Phe Leu Leu Val Met Phe Phe Ser Pro Leu Val Ala 340 345 350 Ile Val Pro Pro Tyr Ala Thr Ala Gly Ala Leu Ile Phe Val Gly Val 355 360 365 Leu Met Thr Ser Ser Leu Ala Arg Val Asn Trp Asp Asp Phe Thr Glu 370 375 380 Ser Val Pro Ala Phe Ile Thr Thr Val Met Met Pro Phe Thr Phe Ser 385 390 395 400 Ile Thr Glu Gly Ile Ala Leu Gly Phe Met Ser Tyr Cys Ile Met Lys 405 410 415 Val Cys Thr Gly Arg Trp Arg Asp Leu Asn Leu Cys Val Val Val Val 420 425 430 Ala Ala Leu Phe Ala Leu Lys Ile Ile Leu Val Asp 435 440 <210> 8 <211> 1335 <212> DNA <213> Artificial Sequence <220> <223> yicO <400> 8 atgaataatg acaataccga ttacgtgagt aatgaatcag ggacgctttc gcgattattt 60 aaactacctc agcatgggac caccgtccgc acagaattga ttgcggggat gaccactttt 120 ttaaccatgg tgtacatcgt ttttgtgaac ccgcaaatcc tcggcgcggc acaaatgg ac 180 ccgaaagtgg tgtttgttac cacctgtttg attgccggta tcggcagtat tgcgatgggg 240 atatttgcta acttacccgt ggcgctggct ccggcaatgg ggctgaacgc cttctttgcc 300 ttcgtggtcg tgggggcgat gggcatctcc tggcagacc g ggatgggcgc aatattctgg 360 ggcgcagttg gactattttt gctcacgctg tttcgtatcc ggtactggat gatctccaac 420 attcccttaa gtttacgtat tggtatcacc agcggaattg gattatttat cgccttaatg 480 ggattaaaaa atactggcgt tattgtcgcc aataaagaca cgctggtgat gattggcgat 540 ttaagttctc acggcgtgtt gttaggtatt ttagggtttt ttattataac cgtgttgtca 600 tcacgtcat t ttcatgccgc ggtgctggtt tctattgtgg tgacgtcttg ctgtggatta 660 tttttcggtg atgttcattt tagcggcgtc tattccattc cgcctgatat tagcggcgtc 720 attggtgaag tagatttgag cggcgcgtta acacttgaac tcgccggtat cattttctcc 780 tttatgctga tcaacctatt tgattcatca ggaacattaa ttggtgtaac tgataaagcg 840 ggcttaatag atggtaacgg taaattcccc aatatgaata aggcgctgta tgttgatagc 900 gtcagttcgg tggcgggtgc gtttatcggc acctcgtctg ttaactgccta tattgaaagt 960 acttctggtg tggcagtcgg tggccgcacg gggctgactg cggttgtggt tggcgttatg 1020 t tcctgttgg ttatgttctt ctcaccgctg gtggcgatag ttcctcctta cgcaaccgcc 1080 ggagcgttaa tctttgttgg cgtgctgatg acttcgagcc tggcgcgcgt taactgggat 1140 gattttaccg aatcggtgcc tgcgtttatt accacggtga tgatgcc ctt tactttctcg 1200 atcaccgaag ggattgcact cggctttatg tcgtactgca tcatgaaagt atgcaccggg 1260 cgctggcgcg atctgaacct gtgtgtggtg gtggtcgcag ctctgtttgc actgaagatt 1320 attctggtgg attag 1335 <210> 9 <211> 547 <212> PRT <213> Artificial Sequence <220> <223> yeeO (G272E) variant <400> 9 Met Leu Arg His Ile Leu Thr Ala Lys Asn Leu Leu Ser Asn Pro Ile 1 5 10 15 Phe Lys Phe Pro Asn Cys Leu Pro Phe Leu Ser Thr Val Cys Cys Ile 20 25 30 Cys Arg Gln Phe Val Gly Glu Asn Leu Cys Ser Phe Ala Asp Ser Pro 35 40 45 Ser Leu Phe Glu Met Trp Phe His Phe Leu Gln Leu Arg Ser Ala Leu 50 55 60 Asn Ile Ser Ser Ala Leu Arg Gln Val Val His Gly Thr Arg Trp His 65 70 75 80 Ala Lys Arg Lys Ser Tyr Lys Val Leu Phe Trp Arg Glu Ile Thr Pro 85 90 95 Leu Ala Val Pro Ile Phe Met Glu Asn Ala Cys Val Leu Leu Met Gly 100 105 110 Val Leu Ser Thr Phe Leu Val Ser Trp Leu Gly Lys Asp Ala Met Ala 115 120 125 Gly Val Gly Leu Ala Asp Ser Phe Asn Met Val Ile Met Ala Phe Phe 130 135 140 Ala Ala Ile Asp Leu Gly Thr Thr Val Val Val Ala Phe Ser Leu Gly 145 150 155 160 Lys Arg Asp Arg Arg Arg Ala Arg Val Ala Thr Arg Gln Ser Leu Val 165 170 175 Ile Met Thr Leu Phe Ala Val Leu Leu Ala Thr Leu Ile His His Phe 180 185 190 Gly Glu Gln Ile Ile Asp Phe Val Ala Gly Asp Ala Thr Thr Glu Val 195 200 205 Lys Ala Leu Ala Leu Thr Tyr Leu Glu Leu Thr Val Leu Ser Tyr Pro 210 215 220 Ala Ala Ala Ile Thr Leu Ile Gly Ser Gly Ala Leu Arg Gly Ala Gly 225 230 235 240 Asn Thr Lys Ile Pro Leu Leu Ile Asn Gly Ser Leu Asn Ile Leu Asn 245 250 255 Ile Ile Ile Ser Gly Ile Leu Ile Tyr Gly Leu Phe Ser Trp Pro Glu 260 265 270 Leu Gly Phe Val Gly Ala Gly Leu Gly Leu Thr Ile Ser Arg Tyr Ile 275 280 285 Gly Ala Val Ala Ile Leu Trp Val Leu Ala Ile Gly Phe Asn Pro Ala 290 295 300 Leu Arg Ile Ser Leu Lys Ser Tyr Phe Lys Pro Leu Asn Phe Ser Ile 305 310 315 320 Ile Trp Glu Val Met Gly Ile Gly Ile Pro Ala Ser Val Glu Ser Val 325 330 335 Leu Phe Thr Ser Gly Arg Leu Leu Thr Gln Met Phe Val Ala Gly Met 340 345 350 Gly Thr Ser Val Ile Ala Gly Asn Phe Ile Ala Phe Ser Ile Ala Ala 355 360 365 Leu Ile Asn Leu Pro Gly Ser Ala Leu Gly Ser Ala Ser Thr Ile Ile 370 375 380 Thr Gly Arg Arg Leu Gly Val Gly Gln Ile Ala Gln Ala Glu Ile Gln 385 390 395 400 Leu Arg His Val Phe Trp Leu Ser Thr Leu Gly Leu Thr Ala Ile Ala 405 410 415 Trp Leu Thr Ala Pro Phe Ala Gly Val Met Ala Ser Phe Tyr Thr Gln 420 425 430 Asp Pro Gln Val Lys His Val Val Val Ile Leu Ile Trp Leu Asn Ala 435 440 445 Leu Phe Met Pro Ile Trp Ser Ala Ser Trp Val Leu Pro Ala Gly Phe 450 455 460 Lys Gly Ala Arg Asp Ala Arg Tyr Ala Met Trp Val Ser Met Leu Ser 465 470 475 480 Met Trp Gly Cys Arg Val Val Val Gly Tyr Val Leu Gly Ile Met Leu 485 490 495 Gly Trp Gly Val Val Gly Val Trp Met Gly Met Phe Ala Asp Trp Ala 500 505 510 Val Arg Ala Val Leu Phe Tyr Trp Arg Met Val Thr Gly Arg Trp Leu 515 520 525 Trp Lys Tyr Pro Arg Pro Glu Pro Gln Lys Cys Glu Lys Lys Pro Val 530 535 540 Val Ser Glu 545 <210> 10 <211> 1644 <212> DNA <213> Artificial Sequence <220> <223> yeeO (G272E) variant <400> 10 ttgttgaggc acatcttaac ggcgaaaaat cttttgtcaa acccgatttt taaattcccc 60 aactgtttgc cgtttctatc aacagtttgt tgcat ttgca gacaatttgt tggcgaaaat 120 ctttgcagct ttgctgattc tccctcatta tttgaaatgt ggtttcactt tctgcaatta 180 aggtcggctt tgaatatctc ctctgcttta cgccaggttg ttcacggcac tcgctggcac 240 gctaaacgca agagctacaa agtgttgttc tggcgcgaga taaccccgct tgctgttcct 300 atcttcatgg agaatgcctg tgtcctgttg atgggggttc tgagcacttt t ctggtcagc 360 tggctgggaa aagatgcgat ggccggcgtg ggattggcgg acagcttcaa tatggtcatt 420 atggcttttt ttgctgctat cgatcttggt actactgtcg ttgtggcatt tagtctcggt 480 aagcgggatc gacgacgagc gagggtggcg acgcggca gt cattggtgat catgacgttg 540 tttgccgtac tgttggcaac gcttattcat cattttggcg aacaaattat tgatttcgtc 600 gcgggtgatg ccacgacaga agttaaagca ctggcgttga cttatctgga gctgacggta 660 ctcagttatc cagcagctgc catcactctt attggtagcg gggcacttcg tggtgcaggg 720 aatacgaaaa taccgctatt gattaacggt agcctgaata ttcttaatat tattattagc 780 ggcatattga tttac ggcct tttctcctgg ccggaactgg gatttgtcgg ggcagggctg 840 ggtttaacca tttctcgtta tattggcgca gttgcaattt tgtgggtgct ggcgattggt 900 tttaatcctg cgctaaggat ttcgttaaag agctatttta aaccgctgaa ttttagcatt 9 60 atctgggaag tcatggggat tggtattccc gcgagtgtcg aatcagtgtt atttaccagt 1020 ggtcggttat taacccaaat gttcgttgcc gggatgggga ccagtgttat tgccggaaat 1080 tttatcgcgt tttcaattgc ggctcttatc aacttacccg gaagtgcgct cggctctgct 1140 tctacgatca ttacaggccg aaggttgggg gtagggcaga tagcgcaagc agagattcag 1200 ttgcggcatg tgttctggct ttccactctt ggattaacgg ccatcgcctg gctaacggct 1260 ccctttgccg gggttatggc atcgttttac acccaggatc cacaggttaa acatgtcgtt 1320 gtgattctga tttggctaaa tgctttattt atgcctattt ggtccgcctc atgggtgcta 1 380 cccgctggat ttaaaggtgc tcgtgatgcc cgttacgcca tgtgggtttc gatgttgagc 1440 atgtggggtt gtcgggttgt agtcggttat gtgctgggaa tcatgcttgg ctggggtgtg 1500 gttggtgtct ggatgggaat gtttgccgac tgggctgtgc gggccgtgct gttttactgg 1560 cgaatggtta ctggacgttg gctatggaaa taccctcgac ccgagccgca aaagtgtgaa 1620 aaaaagccag ttgtgtc gga ataa 1644 <210> 11 <211> 547 <212> PRT <213> Artificial Sequence <220> <223> yeeO <400> 11 Met Leu Arg His Ile Leu Thr Ala Lys Asn Leu Leu Ser Asn Pro Ile 1 5 10 15 Phe Lys Phe Pro Asn Cys Leu Pro Phe Leu Ser Thr Val Cys Cys Ile 20 25 30 Cys Arg Gln Phe Val Gly Glu Asn Leu Cys Ser Phe Ala Asp Ser Pro 35 40 45 Ser Leu Phe Glu Met Trp Phe His Phe Leu Gln Leu Arg Ser Ala Leu 50 55 60 Asn Ile Ser Ser Ala Leu Arg Gln Val Val His Gly Thr Arg Trp His 65 70 75 80 Ala Lys Arg Lys Ser Tyr Lys Val Leu Phe Trp Arg Glu Ile Thr Pro 85 90 95 Leu Ala Val Pro Ile Phe Met Glu Asn Ala Cys Val Leu Leu Met Gly 100 105 110 Val Leu Ser Thr Phe Leu Val Ser Trp Leu Gly Lys Asp Ala Met Ala 115 120 125 Gly Val Gly Leu Ala Asp Ser Phe Asn Met Val Ile Met Ala Phe Phe 130 135 140 Ala Ala Ile Asp Leu Gly Thr Thr Val Val Val Ala Phe Ser Leu Gly 145 150 155 160 Lys Arg Asp Arg Arg Arg Arg Ala Arg Val Ala Thr Arg Gln Ser Leu Val 165 170 175 Ile Met Thr Leu Phe Ala Val Leu Leu Ala Thr Leu Ile His His Phe 180 185 190 Gly Glu Gln Ile Ile Asp Phe Val Ala Gly Asp Ala Thr Thr Glu Val 195 200 205 Lys Ala Leu Ala Leu Thr Tyr Leu Glu Leu Thr Val Leu Ser Tyr Pro 210 215 220 Ala Ala Ala Ile Thr Leu Ile Gly Ser Gly Ala Leu Arg Gly Ala Gly 225 230 235 240 Asn Thr Lys Ile Pro Leu Leu Ile Asn Gly Ser Leu Asn Ile Leu Asn 245 250 255 Ile Ile Ile Ser Gly Ile Leu Ile Tyr Gly Leu Phe Ser Trp Pro Gly 260 265 270 Leu Gly Phe Val Gly Ala Gly Leu Gly Leu Gly Leu Thr Ile Ser Arg Tyr Ile 275 280 285 Gly Ala Val Ala Ile Leu Trp Val Leu Ala Ile Gly Phe Asn Pro Ala 290 295 300 Leu Arg Ile Ser Leu Lys Ser Tyr Phe Lys Pro Leu Asn Phe Ser Ile 305 310 315 320 Ile Trp Glu Val Met Gly Ile Gly Ile Pro Ala Ser Val Glu Ser Val 325 330 335 Leu Phe Thr Ser Gly Arg Leu Leu Thr Gln Met Phe Val Ala Gly Met 340 345 350 Gly Thr Ser Val Ile Ala Gly Asn Phe Ile Ala Phe Ser Ile Ala Ala 355 360 365 Leu Ile Asn Leu Pro Gly Ser Ala Leu Gly Ser Ala Ser Thr Ile Ile 370 375 380 Thr Gly Arg Arg Leu Gly Val Gly Gln Ile Ala Gln Ala Glu Ile Gln 385 390 395 400 Leu Arg His Val Phe Trp Leu Ser Thr Leu Gly Leu Thr Ala Ile Ala 405 410 415 Trp Leu Thr Ala Pro Phe Ala Gly Val Met Ala Ser Phe Tyr Thr Gln 420 425 430 Asp Pro Gln Val Lys His Val Val Val Ile Leu Ile Trp Leu Asn Ala 435 440 445 Leu Phe Met Pro Ile Trp Ser Ala Ser Trp Val Leu Pro Ala Gly Phe 450 455 460 Lys Gly Ala Arg Asp Ala Arg Tyr Ala Met Trp Val Ser Met Leu Ser 465 470 475 480 Met Trp Gly Cys Arg Val Val Val Val Gly Tyr Val Leu Gly Ile Met Leu 485 490 495 Gly Trp Gly Val Val Gly Val Trp Met Gly Met Phe Ala Asp Trp Ala 500 505 510 Val Arg Ala Val Leu Phe Tyr Trp Arg Met Val Thr Gly Arg Trp Leu 515 520 525 Trp Lys Tyr Pro Arg Pro Glu Pro Gln Lys Cys Glu Lys Lys Pro Val 530 535 540 Val Ser Glu 545 <210> 12 <211> 1644 <212> DNA <213> Artificial Sequence <220> <223> yeeO <400> 12 ttgttgaggc acatcttaac ggcgaaaaat cttttgtcaa acccgatttt taaattcccc 60 aactgtttgc cgt ttctatc aacagtttgt tgcatttgca gacaatttgt tggcgaaaat 120 ctttgcagct ttgctgattc tccctcatta tttgaaatgt ggtttcactt tctgcaatta 180 aggtcggctt tgaatatctc ctctgcttta cgccaggttg ttcacggcac tcgctggcac 240 gctaaacgca agagctacaa agtgttgttc tggcgcgaga taaccccgct tgctgttcct 300 atcttcatgg agaatgcctg tgtcctgttg atgggggttc tgagcacttt tctggtcagc 360 tggctgggaa aagatgcgat ggccggcgtg ggattggcgg acagcttcaa tatggtcatt 420 atggcttttt ttgctgctat cgatcttggt actactgtcg tt gtggcatt tagtctcggt 480 aagcgggatc gacgacgagc gagggtggcg acgcggcagt cattggtgat catgacgttg 540 tttgccgtac tgttggcaac gcttattcat cattttggcg aacaaattat tgatttcgtc 600 gcgggtgatg ccacgacaga agttaaagca ctggcgttga cttatctgga gctgacggta 660 ctcagttatc cagcagctgc catcactctt attggtagcg gggcacttcg tggtgcaggg 720 aatacgaaaa taccgctatt gattaacggt agcctgaata ttcttaatat tattattagc 780 ggcatattga tttacggcct tttctcctgg ccgggactgg gatttgtcgg ggcagggctg 840 ggtttaacca tttctcgtta tattggcgca gttgcaattt tgtgggtgct ggcgattggt 900 tttaatcct g cgctaaggat ttcgttaaag agctatttta aaccgctgaa ttttagcatt 960 atctgggaag tcatggggat tggtattccc gcgagtgtcg aatcagtgtt atttaccagt 1020 ggtcggttat taacccaaat gttcgttgcc gggatgggga ccagtgttat tgccggaaat 1080 tttatcgcgt tttcaattgc ggctcttatc aacttacccg gaagtgcgct cggctctgct 1140 tctacgatca ttacaggcc g aaggttgggg gtagggcaga tagcgcaagc agagattcag 1200 ttgcggcatg tgttctggct ttccactctt ggattaacgg ccatcgcctg gctaacggct 1260 ccctttgccg gggttatggc atcgttttac acccaggatc cacaggttaa acatgtcgtt 1320 gtgattctga t ttggctaaa tgctttattt atgcctattt ggtccgcctc atgggtgcta 1380 cccgctggat ttaaaggtgc tcgtgatgcc cgttacgcca tgtgggtttc gatgttgagc 1440 atgtggggtt gtcgggttgt agtcggttat gtgctgggaa tcatgcttgg ctggggtgtg 1500 gttggtgtct ggatgggaat gtttgccgac tgggctgtgc gggccgtgct gttttactgg 1560 cgaatggtta ctggacgttg gctatggaaa taccctcgac ccgagccgca aaagtgtgaa 1620 aaaaagccag ttgtgtcgga ataa 1644 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer 1 <400> 13 caattattatt atagtaattg actattatac 30 <210> 14 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Primer 2 <400> 14 ccacgccgcc caattattatt atagtaattg actattatac 40 <210> 15 <211 > 40 <212> DNA <213> Artificial Sequence <220> <223> Primer 3 <400> 15 ggcggcgtgg gcttcgctga gttttagagc tagaaatagc 40 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <220> <223 > Primer 4 <400> 16 gcttcgctga gttttagagc tagaaatagc 30 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer 5 <400> 17 gagcctgtcg gcctacctgc t 21 <210> 18 <211 > 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 6 <400> 18 cggccggcat gagcctgtcg 20 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer 7 <400> 19 ATGCGCGCGTGTTTTTAAC 30 <210> 20 <211> 20 <212> DNA <213> Artificial sequence 1 <211> 20 < 212> DNA <213> Artificial Sequence <220> <223> Primer 9 <400> 21 cagcgagctg gcggcaaaaa 20 <210> 22 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer 10 <400 > 22 ccacgccgcc cagcgagctg gcggcaaaaa 30 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer 11 <400> 23 ggcggcgtgg acttcgctga aggtgtgacg 30 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 12 <400> 24 acttcgctga aggtgtgacg 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 13 <400> 25 gtgagtttta tacccaagac 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 14 <400> 26 tttgtgcgcg gtgagtttta 20 <210> 27 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primer 15 <400> 27 cgcgcacaaa gagctcctga aaatctcgat aac 33 <210> 28 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer 16 <400> 28 gagctcctga aaatctcgat aac 23 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 17 <400> 29 tggcaccgtg gtgcacatta 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 18 <400> 30 agccgcacgg catcggtttt 20 <210> 31 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Primer 2 <400> 31 cgtgacgttc caattttatt atagtaattg actattatac 40 <210> 32 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Primer 3 <400> 32 gaacgtcacg accttcgtca gttttagagc tagaaatagc 40 <210> 33 <211> 30 <212> DNA Artificial Sequence <220> <223> Primer 4 <400> 33 accttcgtca gttttagagc tagaaatagc 30 <210> 34 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer 7 <400> 34 atgccggccg cggccgggta gatacccaga g 31 <210> 35 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer 8 <400> 35 cggccgggta gatacccaga g 21 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 9 <400> 36 tctgctgttc gttgacaaca 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 10 <400> 37 gtcgtgacgt tctgctgttc 20 <210> 38 <211> 30 <212> DNA <213> Artificial Sequence < 220> <223> Primer 11 <400> 38 acgtcacgac tttcgtcacg gaatttctca 30 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 12 <400> 39 tttcgtcacg gaatttctca 20 <21 0> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 13 <400> 40 tccgttcgct aagggcggta 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> < 223> PRIMER 14 <400> 41 Acctgtg TCCGTTCGCT 20 <210> 42 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Primer 15 <400> 42 TCGAT AAC 33 <210> 43 < 211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 17 <400> 43 tccgttcgct aagggcggta 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 18 <400> 44 acctgatgtg tccgttcgct 20 <210> 45 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Primer 2 <400> 45 aggagaaaag caattttatt atagtaattg actattatac 40 <210> 46 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Primer 3 <400> 46 cttttctcct ggccgggact gttttagagc tagaaatagc 40 <210> 47 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer 4 <400> 47 GGCCGGACT GTTTTAGAGC 30 <210> 48 <211> 30 <212> DNA <213> Artificial sequence GTAAGCGGA 30 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 8 <400> 49 tttagtctcg gtaagcggga 20 <210> 50 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer 9 <400> 50 gaaaaggccg taaatcaata tgccg 25 <210> 51 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer 10 <400> 51 ccggccagga gaaaaggccg taaat 25 <210> 52 <211> 30 < 212> DNA <213> Artificial Sequence <220> <223> Primer 11 <400> 52 tcctggccgg aactgggatt tgtcggggca 30 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 12 < 400> 53 aactgggatt tgtcggggca 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 13 <400> 54 gcagagccga gcgcacttcc 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 14 <400> 55 gatcgtagaa gcagagccga 20 <210> 56 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primer 15 <400> 56 ttctacgatc gagctcctga aaatctcgat aac 33 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer 17 <400> 57 cttttctggt cagctggctg 20 <210> 58 <211> 20 <212> DNA <213 > Artificial Sequence <220> <223> Primer 18 <400> 58 ttagccaggc gatggccgtt 20 <210> 59 <211> 3234 <212> DNA <213> Artificial Sequence <220> <223> pDSG <400> 59 tttccatagg ctccgccccc ctgacgagca tca caaaaat cgacgctcaa gtcagaggtg 60 gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg 120 ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag 180 cgtggcgctt tctcatagct cacgctg tag gtatctcagt tcggtgtagg tcgttcgctc 240 caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa 300 ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg 360 taggacat agca gagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc 420 taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac 480 cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg 540 tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt 600 gatcttttct acggggtctg acgctcagt g gaacgaaaac tcacgttaag ggattttggt 660 catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa 720 atcaatctaa agtatatatg agtaaacttg gtctgacagt taaaagatg acagtataat 780 agtcaattac tataataaaa tt gatgcgca ggtgaaacac ctgctgcagt tttagagcta 840 gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg 900 gtgctttttt tcgtttttccg ggacgccctc gcggacgtgc tcatagtcca cgacgcccgt 960 gattttgtag ccctggccga cggccagcag gtaggccgac aggctcatgc cggccggagc 1020 tcctgaaaat ctcgataact caaaaaatac gcccggtagt gatcttattt cattatggtg 1080 aaagttggaa cctcttagga tcctctagat ttaagaagga gatatacata aaactccttc 1140 tgagctagtt ctctagcatt ctattatttt gattcgacac cttaataata gcagaaggag 1200 tttttacctg tcaaagaacc atcaaaccct tga tacacaa ggctttgacc taattttgaa 1260 aaatgatgtt gtttctatat agtatcaaga taagaaagaa aaggattttt cgctacgctc 1320 aaatcctttc ccgtcacggg cttctcaggg cgttttatgg cgggtctgct atgtggtgct 1380 atctgacttt ttgctgttca gcagttcctg ccctctgatt ttccagtctg accacttcgg 1440 attatcccgt gacaggtcat tcagactggc taatgcaccc agtaaggcag c ggtatcatc 1500 aacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 1560 atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 1620 aagtatatat gagtaaactt ggtctgacag ttacca atgc ttaatcagtg aggcacctat 1680 ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac 1740 tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg 1800 ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag 1860 tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt 1920 aag tagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt 1980 gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt 2040 tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcc tc cgatcgttgt 2100 cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct 2160 tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt 2220 ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac gggataatac 2280 cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa 2340 act ctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa 2400 ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca 2460 aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct 2520 ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga 2580 atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc 2640 aaaaaaacac aaaagaccac attttttaat gtggtcttta ttcttcaact aaagcaccca 2700 ttagttcaac aaacgaaaat tggataaagt gggatatttt taaaatatat atttatgtta 2760 cagtaagctg cct cgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc 2820 cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg 2880 cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg 2940 gagtgtatac tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat 3000 gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc 3060 ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca 3120 ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg 3180 agcaaaaggc cagcaaa agg ccaggaaccg taaaaaggcc gcgttgctgg cgtt 3234 <210> 60 <211> 9656 <212> DNA <213> Artificial Sequence <220> <223> pDS9 <400 > 60 aaagccatga caaaaacgcg taacaaaagt gtctataatc acggcagaaa agtccacatt 60 gattatttgc acggcgtcac actttgctat gccatagcat ttttatccat aagattagcg 120 gatcctacct gacgcttttt atcgcaactc tctactgttt ctccataccc gttt ttttgg 180 gaattcgagc tctaaggagg ttataaaaaa tggatattaa tactgaaact gagatcaagc 240 aaaagcattc actaaccccc tttcctgttt tcctaatcag cccggcattt cgcgggcgat 300 attttcacag ctatttcagg agttcagcca tgaac gctta ttacattcag gatcgtcttg 360 aggctcagag ctgggcgcgt cactaccagc agctcgcccg tgaagagaaa gaggcagaac 540 agtttcagga gcgcatggca gaacacatcc ggtacatgg cga tgcgcag ttcatcgcat tactgatcgt 780 tgccaaccag tacggcctta atccgtggac gaaagaaatt tacgcctttc ctgataagca 840 gaatggcatc gttccggtgg tgggcgttga tggctggtcc cgcatcatca atgaaaacca 900 gcagtttgat ggcatggact ttgagcagga caatgaatcc tgtacatgcc ggatttaccg 960 caaggaccgt aatcatccga tctgcgttac cgaatggatg gatgaatgcc gccgcga acc 1020 attcaaaact cgcgaaggca gagaaatcac ggggccgtgg cagtcgcatc ccaaacggat 1080 gttacgtcat aaagccatga ttcagtgtgc ccgtctggcc ttcggatttg ctggtatcta 1140 tgacaaggat gaagccgagc gcattgtcga aaatactgca tac actgcag aacgtcagcc 1200 ggaacgcgac atcactccgg ttaacgatga aaccatgcag gagattaaca ctctgctgat 1260 cgccctggat aaaacatggg atgacgactt attgccgctc tgttcccaga tatttcgccg 1320 cgacattcgt gcatcgtcag aactgacca ggccgaagca gtaaaagctc ttggattcct 1380 gaaacagaaa gccgcagagc agaaggtggc agcatgacac cggacattat cctgcagcgt 1 440 accgggatcg atgtgagagc tgtcgaacag ggggatgatg cgtggcacaa attacggctc 1500 ggcgtcatca ccgcttcaga agttcacaac gtgatagcaa aaccccgctc cggaaagaag 1560 tggcctgaca tgaaaatgtc ctacttccac accctgcttg ctgaggttt g caccggtgtg 1620 gctccggaag ttaacgctaa agcactggcc tggggaaaac agtacgagaa cgacgccaga 1680 accctgtttg aattcacttc cggcgtgaat gttactgaat ccccgatcat ctatcgcgac 1740 gaaagtatgc gtaccgcctg ctctcccgat ggtttatgca gtgacggcaa cggccttgaa 1800 ctgaaatgcc cgtttacctc ccgggatttc atgaagttcc ggctcggtgg tttcgaggcc 18 60 ataaagtcag cttacatggc ccaggtgcag tacagcatgt gggtgacgcg aaaaaatgcc 1920 tggtactttg ccaactatga cccgcgtatg aagcgtgaag gcctgcatta tgtcgtgatt 1980 gagcgggatg aaaagtacat ggcgagtttt gacgagatcg tgcc ggagtt catcgaaaaa 2040 atggacgagg cactggctga aattggtttt gtatttgggg agcaatggcg atgagatcta 2100 aagaggagaa aggatctatg gataagaaat actcaatagg cttagatatc ggcacaaata 2160 gcgtcggatg ggcggtgatc actgatgaat ataaggttcc gtctaaaaag ttcaaggttc 2220 tgggaaatac agaccgccac agtatcaaaa aaaatcttat aggggctctt ttatttgaca 2280 gtggagagac agc ggaagcg actcgtctca aacggacagc tcgtagaagg tatacacgtc 2340 ggaagaatcg tatttgttat ctacaggaga ttttttcaaa tgagatggcg aaagtagatg 2400 atagtttctt tcatcgactt gaagagtctt ttttggtgga agaagacaag aagcatgaac 24 60 gtcatcctat ttttggaaat atagtagatg aagttgctta tcatgagaaa tatccaacta 2520 tctatcatct gcgaaaaaaa ttggtagatt ctactgataa agcggatttg cgcttaatct 2580 atttggcctt agcgcatatg attaagtttc gtggtcattt tttgattgag ggagatttaa 2640 atcctgataa tagtgatgtg gacaaactat ttatccagtt ggtacaaacc tacaatcaat 2700 tatttgaaga aaaccctatt aacgca agtg gagtagatgc taaagcgatt ctttctgcac 2760 gattgagtaa atcaagacga ttagaaaatc tcattgctca gctccccggt gagaagaaaa 2820 atggcttatt tgggaatctc attgctttgt cattgggttt gacccctaat tttaaatcaa 2880 attttgattt ggca gaagat gctaaattac agctttcaaa agatacttac gatgatgatt 2940 tagataattt attggcgcaa attggagatc aatatgctga tttgtttttg gcagctaaga 3000 atttatcaga tgctatttta ctttcagata tcctaagagt aaatactgaa ataactaagg 3060 ctcccctatc agcttcaatg attaaacgct acgatgaaca tcatcaagac ttgactcttt 3120 taaaagcttt agttcgacaa caacttccag aaaagtata a agaaatcttt tttgatcaat 3180 caaaaaacgg atatgcaggt tatattgatg ggggagctag ccaagaagaa ttttataaat 3240 ttatcaaacc aattttagaa aaaatggatg gtactgagga attattggtg aaactaaatc 3300 gtgaagattt gctgcgcaag caac ggacct ttgacaacgg ctctattccc catcaaattc 3360 acttgggtga gctgcatgct attttgagaa gacaagaaga cttttatcca tttttaaaag 3420 acaatcgtga gaagattgaa aaaatcttga cttttcgaat tccttattat gttggtccat 3480 tggcgcgtgg caatagtcgt tttgcatgga tgactcggaa gtctgaagaa acaattaccc 3540 catggaattt tgaagaagtt gtcgataaag gtgcttcag c tcaatcattt attgaacgca 3600 tgacaaactt tgataaaaat cttccaaatg aaaaagtact accaaaacat agtttgcttt 3660 atgagtattt tacggtttat aacgaattga caaaggtcaa atatgttact gaaggaatgc 3720 gaaaaccagc atttctttca ggtgaacaga agaaagccat tgttgattta ctcttcaaaa 3780 caaatcgaaa agtaaccgtt aagcaattaa aagaagatta tttcaaaaaa atagaatgtt 3840 ttgatagtgt tgaaatttca ggagttgaag atagatttaa tgcttcatta ggtacctacc 3900 atgatttgct aaaaattatt aaagataaag attttttgga taatgaagaa aatgaagata 3960 tcttagagga tattgtttta acattgacct tatttgaaga tagggagatg attgaggaaa 40 20 gacttaaaac atatgctcac ctctttgatg ataaggtgat gaaacagctt aaacgtcgcc 4080 gttatactgg ttggggacgt ttgtctcgaa aattgattaa tggtattagg gataagcaat 4140 ctggcaaaac aatattagat tttttgaaat cagatggttt tgccaatc gc aattttatgc 4200 agctgatcca tgatgatagt ttgacattta aagaagacat tcaaaaagca caagtgtctg 4260 gacaaggcga tagtttacat gaacatattg caaatttagc tggtagccct gctattaaaa 4320 aaggtatttt acagactgta aaagttgttg atgaattggt caaagtaatg gggcggcata 4380 agccagaaaa tatcgttatt gaaatggcac gtgaaaatca gacaactcaa aagggccaga 4440 aaaattc gcg agagcgtatg aaacgaatcg aagaaggtat caaagaatta ggaagtcaga 4500 ttcttaaaga gcatcctgtt gaaaatactc aattgcaaaa tgaaaagctc tatctctatt 4560 atctccaaaa tggaagagac atgtatgtgg accaagaatt agatattaat cgtttaagtg 4620 attatgatgt cgatcacatt gttccacaaa gtttccttaa agacgattca atagacaata 4680 aggtcttaac gcgttctgat aaaaatcgtg gtaaatcgga taacgttcca agtgaagaag 4740 tagtcaaaaa gatgaaaaac tattggagac aacttctaaa cgccaagtta atcactcaac 4800 gtaagtttga taatttaacg aaagctgaac gtggaggttt gagtgaactt gataaagctg 4860 gttttatca a acgccaattg gttgaaactc gccaaatcac taagcatgtg gcacaaattt 4920 tggatagtcg catgaatact aaatacgatg aaaatgataa acttattcga gaggttaaag 4980 tgattacctt aaaatctaaa ttagtttctg acttccgaaa agatttccaa ttctataaag 50 40 tacgtgagat taacaattac catcatgccc atgatgcgta tctaaatgcc gtcgttggaa 5100 ctgctttgat taagaaatat ccaaaacttg aatcggagtt tgtctatggt gattataaag 5160 tttatgatgt tcgtaaaatg attgctaagt ctgagcaaga aataggcaaa gcaaccgcaa 5220 aatatttctt ttactctaat atcatgaact tcttcaaaac agaaattaca cttgcaaatg 5280 gagagattcg caa acgccct ctaatcgaaa ctaatgggga aactggagaa attgtctggg 5340 ataaagggcg agattttgcc acagtgcgca aagtattgtc catgccccaa gtcaatattg 5400 tcaagaaaac agaagtacag acaggcggat tctccaagga gtcaatttta ccaaaaagaa 5460 attc ggacaa gcttattgct cgtaaaaaag actgggatcc aaaaaaatat ggtggttttg 5520 atagtccaac ggtagcttat tcagtcctag tggttgctaa ggtggaaaaa gggaaatcga 5580 agaagttaaa atccgttaaa gagttactag ggatcacaat tatggaaaga agttcctttg 5640 aaaaaaatcc gattgacttt ttagaagcta aaggatataa ggaagttaaa aaagacttaa 5700 tcattaaact acctaaatat agtcttt ttg agttagaaaa cggtcgtaaa cggatgctgg 5760 ctagtgccgg agaattacaa aaaggaaatg agctggctct gccaagcaaa tatgtgaatt 5820 ttttatattt agctagtcat tatgaaaagt tgaagggtag tccagaagat aacgaacaaa 5880 aacaattgtt tgtggag cag cataagcatt atttagatga gattattgag caaatcagtg 5940 aattttctaa gcgtgttatt ttagcagatg ccaatttaga taaagttctt agtgcatata 6000 acaaacatag agacaaacca atacgtgaac aagcagaaaa tattattcat ttatttacgt 6060 tgacgaatct tggagctccc gctgctttta aatattttga tacaacaatt gatcgtaaac 6120 gatatacgtc tacaaaagaa gttttagatg ccactcttat ccatcaatcc at cactggtc 6180 tttatgaaac acgcattgat ttgagtcagc taggaggtga ctaacgcatc ctcacgataa 6240 tatccgggta ggcgcaatca ctttcgtcta ctccgttaca aagcgaggct gggtatttcc 6300 cggcctttct gttatccgaa atccactgaa agcacagcgg ctggctgagg agataaataa 6360 taaacgaggg gctgtatgca caaagcatct tctgttgagt taagaacgag tatcgagatg 6420 gcacatagcc ttgctcaaat tggaatcagg tttgtgccaa taccagtaga aacagacgaa 6480 gaatccatgg gtatggacag ttttcccttt gatatgtaac ggtgaacagt tgttctactt 6540 ttgtttgtta gtcttgatgc ttcactgata gatacaaga g ccaaatctag taatatttta 6600 tctgattaat aagatgatct tcttgagatc gtttggtct gcgcgtaatc tcttgctctg 6660 aaaacgaaaa aaccgccttg cagggcggtt tttcgaaggt tctctgagct accaactctt 6720 tgaaccgagg taactgg ctt ggaggagcgc agtcaccaaa acttgtcctt tcagtttagc 6780 cttaaccggc gcatgacttc aagactaact cctctaaatc aattaccagt ggctgctgcc 6840 agtggtgctt ttgcatgtct ttccgggttg gactcaagac gatagttacc ggataaggcg 6900 cagcggtcgg actgaacggg gggttcgtgc atacagtcca gcttggagcg aactgcctac 6960 ccggaactga gtgtcaggcg tggaatgaga caaacgcggc cataacagcg gaatgacacc 7020 ggtaaaccga aaggcaggaa caggagagcg cacgagggag ccgccagggg gaaacgcctg 7080 gtatctttat agtcctgtcg ggtttcgcca ccactgattt gagcgtcaga tttcgtgatg 7140 cttgtcaggg gggcggagcc tatggaa aaa cggctttgcc gcggccccgc tgaatattcc 7200 ttttgtctcc gaccatcagg cacctgagtc gctgtctttt tcgtgacatt cagttcgctg 7260 cgctcacggc tctggcagtg aatgggggta aatggcacta caggcgcctt ttatggattc 7320 atgcaaggaa actacccata atacaagaaa agatgtggtc tttattcttc aactaaagca 7380 cccattagtt caacaaacga aaattggata aagtgggata tttttaaaat atatatttat 7440 gtta cctggc agagcctgta ctttttacag tcggttttct aatgtcacta acctgccccg 7500 ttagtcgcca tttgcatcga tttattatga caacttgacg gctacatcat tcactttttc 7560 ttcacaaccg gcacggaact cgctcgggct ggccccggtg catttt ttaa atacccgcga 7620 gaaatagagt tgatcgtcaa aaccaacatt gcgaccgacg gtggcgatag gcatccgggt 7680 ggtgctcaaa agcagcttcg cctggctgat acgttggtcc tcgcgccagc ttaagacgct 7740 aatccctaac tgctggcgga aaagatgtga cagacgcgac ggcgacaagc aaacatgctg 7800 tgcgacgctg gcgatatcaa aattgctgtc tgccaggtga tcgctgatgt actgacaagc 7 860 ctcgcgtacc cgattatcca tcggtggatg gagcgactcg ttaatcgctt ccatgcgccg 7920 cagtaacaat tgctcaagca gatttatcgc cagcagctcc gaatagcgcc cttccccttg 7980 cccggcgtta atgatttgcc caaacaggtc gctgaaatgc ggctggtgcg cttcatccgg 8040 gcgaaagaac cccgtattgg caaatattga cggccagtta agccattcat gccagtaggc 8100 gcgcggacga aagtaaaccc actggtgata ccattcgcga gcctccggat gacgaccgta 8160 gtgatgaatc tctcctggcg ggaacagcaa aatatcaccc ggtcggcaaa caaattctcg 8220 tccctgattt ttcaccaccc cctgaccgcg aatggtgaga ttgagaatat aacctttcat 8280 tcccagcggt cggtcgataa aaaaatcgag ataaccgttg gcctcaatcg gcgttaaacc 8340 cgccaccaga tgggcattaa acgagtatcc cggcagcagg ggatcatttt gcgcttcagc 8400 catacttttc atactcccgc cattcagaga agaaaccaat tgtccatatt gcatcagaca 8460 ttgccgtcac tgcgtctttt actggctctt ctcgctaacc aaaccggtaa ccccgcttat 8520 taaaagcatt ctgtaacaaa gcgggaccag taatagaaag tgagggagcc acggttgatg 8580 agagctttgt tgtaggtgga ccagttggtg attttgaact tttgctttgc cacggaacgg 8640 tctgcgttgt cgggaagatg cgtgatctga tccttcaact cagcaaaagt tcgatttatt 8700 caacaaagcc acgttgtgtc tcaaaatctc tgatgttaca ttgcacaaga taaaaatata 8760 tcatcatgaa caataaaact gtctgcttac ataaacagta atacaagggg tgttatgagc 8820 catattcaac gggaaacgtc ttgctcgagg ccgcgattaa attccaacat ggatgctgat cg gaatttat gcctcttccg 9060 accatcaagc attttatccg tactcctgat gatgcatggt tactcaccac tgcgatcccc 9120 gggaaaacag cattccaggt attagaagaa tatcctgatt caggtgaaaa tattgttgat 9180 gcgctggcag tgttcctgcg ccggttgcat tcgattcctg tttgtaattg tccttttaac 9240 agcgatcgcg tatttcgtct cgctcaggcg caatcacgaa tgaataacgg ttt ggttgat 9300 gcgagtgatt ttgatgacga gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg 9360 cataagcttt tgccattctc accggattca gtcgtcactc atggtgattt ctcacttgat 9420 aaccttattt ttgacgaggg gaaattaata ggtt gtattg atgttggacg agtcggaatc 9480 gcagaccgat accaggatct tgccatccta tggaactgcc tcggtgagtt ttctccttca 9540 ttacagaaac ggctttttca aaaatatggt attgataatc ctgatatgaa taaattgcag 9600tttcatttga tgctcgatga gtttttctaa tcagaattgg ttaattggtt gtaaca 9656

Claims (7)

An FMN/FAD transport protein variant consisting of the amino acid sequence of SEQ ID NO: 9 in which glycine at position 272 in the amino acid sequence of SEQ ID NO: 11 is substituted with glutamine. A polynucleotide encoding the variant of claim 1. A transformant comprising the variant of claim 1 or the polynucleotide of claim 2. The method of claim 3,
The transformant is Escherichia ( Escherichia ) A transformant of the genus strain. The method of claim 3,
The transformant is a transformant having the ability to produce L- aromatic amino acids. Culturing the transformant of claim 3 in a medium; and
A method for producing L-aromatic amino acids comprising the step of recovering L-aromatic amino acids from the transformants or the medium in which the transformants are cultured. The method of claim 6,
Wherein the L- aromatic amino acid is at least one selected from the group consisting of L- tryptophan, L- phenylalanine and L- tyrosine.