KR20230121616A - Lipid Compounds and Lipid Nanoparticle Compositions - Google Patents

Abstract

Combination with other lipid components, such as neutral lipids, cholesterol and polymer conjugated lipids, to form lipid nanoparticles for delivery of therapeutic agents ( eg, nucleic acid molecules) for therapeutic or prophylactic purposes, including vaccination. Lipid compounds that can be used in such a way are provided herein. A lipid nanoparticle composition comprising the lipid compound is also provided herein.

Description

Lipid Compounds and Lipid Nanoparticle Compositions

1. Sequence Listing

This application is filed as a computer readable form (CRF) copy of the sequence listing. 14639-019-146 The CRF titled SeqListing ST25.txt was created on December 20, 2021 and is 627 bytes in size, which is incorporated herein by reference in its entirety.

2. field

The present disclosure generally relates to therapeutic or prophylactic purposes, including vaccination, both in vitro and in vivo , therapeutic agents ( e.g., nucleic acid mimetics such as locked nucleic acids (LNA), peptide nucleic acids (PNA), and nucleic acid molecules including morpholinos) that can be used in combination with other lipid components, such as neutral lipids, cholesterol and polymer conjugated lipids, to form lipid nanoparticles.

3. Background

Therapeutic nucleic acids have the potential to revolutionize vaccination, gene therapy, protein replacement therapy, and other treatments of genetic diseases. Since the inception of the first clinical studies of therapeutic nucleic acids in the 2000's, significant progress has been made through the design of nucleic acid molecules and methods of their delivery. However, nucleic acid therapeutics still face several problems including low cell permeability and high susceptibility to degradation of certain nucleic acid molecules, including RNA. Thus, there is a need to develop new nucleic acid molecules, as well as related methods and compositions that facilitate their delivery in vitro or in vivo for therapeutic and/or prophylactic purposes. Lipid compounds that can be used in combination with other lipid components, such as neutral lipids, cholesterol and polymer conjugated lipids, to form lipid nanoparticles for the delivery of therapeutic agents. New lipid compounds that provide efficient delivery of the therapeutic agent, sufficient activity of the therapeutic agent ( eg , expression of mRNA after delivery), optimal pharmacokinetics, and/or other suitable physiological, biological and/or therapeutic properties ( eg, , cationic lipid compounds) need to be developed.

4. Overview

In one embodiment, it is used alone to form lipid nanoparticles for delivery of therapeutic agents (e.g. , nucleic acid mimetics such as locked nucleic acids (LNA), peptide nucleic acids (PNA), and nucleic acid molecules including morpholino)). or other lipid components such as neutral lipids, charged lipids, steroids (including, for example, all sterols) and/or their analogues, and/or polymer conjugated lipids and/or polymers. Lipid compounds, including acceptable salts, prodrugs or stereoisomers, are provided herein. In some cases, lipid nanoparticles are used to deliver nucleic acids such as antisense and/or messenger RNA. Methods of using such lipid nanoparticles are also provided for the treatment of various diseases or conditions, such as those caused by infectious entities and/or deficiencies of proteins.

In one embodiment, a compound of Formula (I):

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein G ¹ , G ² , G ³ , L ¹ , L ² , R ³ , R ⁴ , n, and m are provided herein or As defined elsewhere.

In one embodiment, provided herein are nanoparticle compositions comprising a compound provided herein, and a therapeutic or prophylactic agent. In one embodiment, the therapeutic or prophylactic agent comprises at least one mRNA encoding an antigen or fragment or epitope thereof.

Additional attributes of the present disclosure will become apparent to those skilled in the art upon consideration of the following detailed description of specific embodiments.

5. Detailed description

5.1 common technique

Techniques and procedures described or referenced herein may be based on conventional methodologies by those skilled in the art, such as, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (3d ed. 2001); Including those that are generally well understood and/or commonly used using the widely utilized methodology described in Current Protocols in Molecular Biology (Ausubel et al. eds., 2003).

5.2 Terminology

Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For purposes of interpreting this specification, the following description of terms will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa . All patents, applications, published applications, and other publications are incorporated by reference in their entirety. In the event that any recitation of a suggested term conflicts with any document incorporated herein by reference, the recitation of a suggested term below shall take precedence.

As used herein, and unless otherwise specified, the term "lipid" includes, but is not limited to, esters of fatty acids and is poorly soluble in water, but is generally characterized as being soluble in many non-polar organic solvents. refers to a group of A specific category of lipids ( e.g., lipids modified by polar groups, e.g., DMG-PEG2000) which lipids generally have poor solubility in water, but have limited aqueous solubility and are soluble in water under certain conditions. there is Known types of lipids include biological molecules such as fatty acids, waxes, sterols, fat soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids. Lipids can be divided into at least three classes: (1) "simple lipids", which include fats and oils as well as waxes; (2) "complex lipids", including phospholipids and glycolipids ( eg, DMPE-PEG2000); and (3) “derived lipids” such as steroids. Additionally, when used herein, lipid also encompasses lipidoid compounds. The term "lipidoid compound", also simply "lipidoid", refers to lipid-like compounds ( eg, amphiphilic compounds with lipid-like physical properties).

The term "lipid nanoparticle" or "LNP" refers to a particle having at least one dimension in nanometers (nm) ( eg, 1 to 1,000 nm) containing one or more types of lipid molecules. . LNPs provided herein may further contain at least one non-lipid payload molecule ( eg, one or more nucleic acid molecules). In some embodiments, an LNP comprises a non-lipid payload molecule either partially or fully encapsulated within a lipid shell. In particular, in some embodiments, wherein the payload is a negatively charged molecule ( eg, an mRNA encoding a viral protein) and the lipid component of the LNP comprises at least one cationic lipid. Without being bound by theory, it is contemplated that cationic lipids can interact with negatively charged payload molecules and promote incorporation and/or encapsulation of the payload into the LNP during LNP formation. Other lipids that may form part of an LNP when provided herein include, but are not limited to, neutral lipids and charged lipids such as steroids, polymer conjugated lipids, and various zwitterionic lipids. In certain embodiments, LNPs according to the present disclosure include one or more lipids of Formula (I) (and sub-formulas thereof) when described herein.

The term "cationic lipid" refers to either being positively charged at any pH value or proton activity of its environment, or responsive to the pH value or proton activity of its environment ( eg, the environment of its intended use). refers to lipids that can be positively charged. Thus, the term "cationic" encompasses both "permanently cationic" and "cationizable". In certain embodiments, the positive charge in cationic lipids results from the presence of a quaternary nitrogen atom. In certain embodiments, cationic lipids include zwitterionic lipids that assume a positive charge in the environment of their intended use ( eg, at physiological pH). In certain embodiments, the cationic lipid is one or more lipids of Formula (I) (and sub-formulas thereof) when described herein.

The term "polymer conjugated lipid" refers to a molecule comprising both a lipid segment and a polymer segment. An example of a polymer conjugated lipid is a pegylated lipid (PEG-lipid), wherein the polymer portion comprises polyethylene glycol.

The term "neutral lipid" encompasses any lipid molecule that exists in uncharged or neutral zwitterionic form at or within a selected pH range. In some embodiments, a selected useful pH value or range corresponds to pH conditions, such as physiological pH, in the environment of the lipid's intended use. By way of non-limiting example, neutral lipids that may be used in connection with the present disclosure include, but are not limited to, phosphotidylcholine such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) , 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl -2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), phophatidylethanolamine such as 1, 2-Dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 2-((2,3-bis(oleoyloxy)propyl)dimethylammonio)ethyl hydrogen phosphate (DOCP), sphingo myelin (SM), ceramides, steroids such as sterols and their derivatives. Neutral lipids when provided herein may be synthetic or derived (isolated or modified) from natural sources or compounds.

The term “charged lipid” encompasses any lipid molecule present in either positively or negatively charged form at or within a selected pH range. In some embodiments, the selected pH value or range corresponds to pH conditions, such as physiological pH, in the environment of the lipid's intended use. By way of non-limiting example, charged lipids that may be used in connection with the present disclosure include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyl trimethylarmonium-propane. ( eg DOTAP, DOTMA), dialkyl dimethylaminopropane, ethyl phosphocholine, dimethylaminoethane carbamoyl sterol ( eg DC-Chol), 1,2-dioleoyl-sn-glycero- 3-phospho-L-serine sodium salt (DOPS-Na), 1,2-dioleoyl-sn-glycero-3-phospho-(1′-rac-glycerol) sodium salt (DOPG-Na), and 1,2-dioleoyl-sn-glycero-3-phosphate sodium salt (DOPA-Na). Charged lipids when provided herein may be synthetic or derived (isolated or modified) from natural sources or compounds.

As used herein, and unless otherwise specified, the term "alkyl" refers to a saturated, straight or branched hydrocarbon chain radical consisting exclusively of carbon and hydrogen atoms. In one embodiment, an alkyl group is, for example, 1 to 24 carbon atoms (C ₁ -C ₂₄ alkyl), 4 to 20 carbon atoms (C ₄ -C ₂₀ alkyl), 6 to 16 carbon atoms (C ₆ -C ₁₆ alkyl), 6 to 9 carbon atoms (C ₆ -C ₉ alkyl), 1 to 15 carbon atoms (C ₁ -C ₁₅ alkyl), 1 to 12 carbon atoms (C ₁ -C ₁₂ alkyl) ), has 1 to 8 carbon atoms (C ₁ -C ₈ alkyl) or 1 to 6 carbon atoms (C ₁ -C ₆ alkyl) and is attached to the rest of the molecule by a single bond. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 3-methyl hexyl, 2-methylhexyl, and the like. Unless otherwise specified, an alkyl group is optionally substituted.

As used herein, and unless otherwise specified, the term "alkenyl" refers to a straight or branched hydrocarbon chain radical consisting exclusively of carbon and hydrogen atoms, containing at least one carbon-carbon double bond. The term "alkenyl " also encompasses radicals having the "cis " and " trans " structures, or, alternatively, the "E" and "Z" structures, as understood by one skilled in the art. . In one embodiment, an alkenyl group is, for example, 2 to 24 carbon atoms (C ₂ -C ₂₄ alkenyl), 4 to 20 carbon atoms (C ₄ -C ₂₀ alkenyl), 6 to 16 carbon atoms. Carbon atoms (C ₆ -C ₁₆ alkenyl), 6 to 9 carbon atoms (C ₆ -C ₉ alkenyl), 2 to 15 carbon atoms (C ₂ -C ₁₅ alkenyl), 2 to 12 carbon atoms (C ₂ -C ₁₂ alkenyl), has 2 to 8 carbon atoms (C ₂ -C ₈ alkenyl) or 2 to 6 carbon atoms (C ₂ -C ₆ alkenyl) and is attached to the rest of the molecule by a single bond attached to Examples of alkenyl groups include, but are not limited to, ethenyl, prop-1-enyl, but-1-enyl, pent-1-enyl, penta-1,4-dienyl, and the like. Unless otherwise specified, an alkenyl group is optionally substituted.

As used herein, and unless otherwise specified, the term "alkynyl" refers to a straight or branched hydrocarbon chain radical consisting exclusively of carbon and hydrogen atoms, containing at least one carbon-carbon triple bond. In one embodiment, an alkynyl group is, for example, 2 to 24 carbon atoms (C ₂ -C ₂₄ alkynyl), 4 to 20 carbon atoms (C ₄ -C ₂₀ alkynyl), 6 to 16 carbon atoms. atoms (C ₆ -C ₁₆ alkynyl), 6 to 9 carbon atoms (C ₆ -C ₉ alkynyl), 2 to 15 carbon atoms (C ₂ -C ₁₅ alkynyl), 2 to 12 carbon atoms ( C ₂ -C ₁₂ alkynyl), has 2 to 8 carbon atoms (C ₂ -C ₈ alkynyl) or 2 to 6 carbon atoms (C ₂ -C ₆ alkynyl) and is attached to the rest of the molecule by a single bond attached Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, and the like. Unless otherwise specified, an alkynyl group is optionally substituted.

As used herein, and unless otherwise specified, the term "alkylene" or "alkylene chain" refers to a saturated, radical group (or groups) consisting exclusively of carbon and hydrogen that attaches the remainder of the molecule to Refers to a straight or branched multivalent ( eg , divalent or trivalent) hydrocarbon chain. In one embodiment, an alkylene is, for example, 1 to 24 carbon atoms (C ₁ -C ₂₄ alkylene), 1 to 15 carbon atoms (C ₁ -C ₁₅ alkylene), 1 to 12 carbon atoms. atoms (C ₁ -C ₁₂ alkylene), 1 to 8 carbon atoms (C ₁ -C ₈ alkylene), 1 to 6 carbon atoms (C ₁ -C ₆ alkylene), 2 to 4 carbon atoms ( C ₂ -C ₄ alkylene), and has 1 to 2 carbon atoms (C ₁ -C ₂ alkylene). Examples of alkylene groups include, but are not limited to, methylene, ethylene, propylene, n-butylene, and the like. The alkylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkylene chain to the rest of the molecule and to the radical group(s) can be through one carbon or any two (or more) carbons within the chain. Unless otherwise specified, the alkylene chain is optionally substituted.

As used herein, and unless otherwise specified, the term "alkenylene" refers to a radical group (or groups) containing one or more carbon-carbon double bonds, consisting exclusively of carbon and hydrogen, which is attached to the remainder of the molecule. Refers to a straight or branched multivalent ( eg , divalent or trivalent) hydrocarbon chain linking. In one embodiment, alkenylene is, for example, 2 to 24 carbon atoms (C ₂ -C ₂₄ alkenylene), 2 to 15 carbon atoms (C ₂ -C ₁₅ alkenylene), 2 to 12 carbon atoms atoms (C ₂ -C ₁₂ alkenylene), 2 to 8 carbon atoms (C ₂ -C ₈ alkenylene), 2 to 6 carbon atoms (C ₂ -C ₆ alkenylene) or 2 to 4 carbon atoms ( C ₂ -C ₄ alkenylene). Examples of alkenylene include, but are not limited to, ethenylene, propenylene, n-butenylene, and the like. The alkenylene is attached to the rest of the molecule through a single or double bond and to the radical group through a single or double bond. The point of attachment of the alkenylene to the rest of the molecule and to the radical group(s) can be through one carbon or any two (or more) carbons in the chain. Unless otherwise specified, alkenylene is optionally substituted.

As used herein, and unless otherwise specified, the term "cycloalkyl" refers to a saturated, non-aromatic monocyclic or polycyclic hydrocarbon radical consisting exclusively of carbon and hydrogen atoms. Cycloalkyl groups can include fused or bridged ring systems. In one embodiment, a cycloalkyl is, for example, 3 to 15 ring carbon atoms (C ₃ -C ₁₅ cycloalkyl), 3 to 10 ring carbon atoms (C 3 -C 10 cycloalkyl), or 3 to 10 ring carbon atoms (C ₃ -C ₁₀ cycloalkyl). may contain 8 ring carbon atoms (C ₃ -C ₈ cycloalkyl). A cycloalkyl is attached to the rest of the molecule by a single bond. Examples of monocyclic cycloalkyl radicals include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic cycloalkyl radicals include, but are not limited to, adamantyl, norbornyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like. Unless otherwise specified, a cycloalkyl group is optionally substituted.

As used herein, and unless otherwise specified, the term "cycloalkylene" is a multivalent ( eg , divalent or trivalent) cycloalkyl group. Unless otherwise specified, a cycloalkylene group is optionally substituted.

As used herein, and unless otherwise specified, the term "cycloalkenyl" means a non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms and containing at least one carbon-carbon double bond. refers to Cycloalkenyls can include fused or bridged ring systems. In one embodiment, a cycloalkenyl is, for example, 3 to 15 ring carbon atoms (C ₃ -C ₁₅ cycloalkenyl), 3 to 10 ring carbon atoms (C ₃ -C ₁₀ cycloalkenyl), or 3 to 8 ring carbon atoms (C ₃ -C ₈ cycloalkenyl). The cycloalkenyl is attached to the rest of the molecule by a single bond. Examples of monocyclic cycloalkenyl radicals include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like. Unless otherwise specified, a cycloalkenyl group is optionally substituted.

As used herein, and unless otherwise specified, the term "cycloalkenylene" is a multivalent ( eg , divalent or trivalent) cycloalkenyl group. Unless otherwise specified, a cycloalkenylene group is optionally substituted.

As used herein, and unless otherwise specified, the term "heterocyclyl" refers to one or more ( e.g., one, one or two, one or more independently selected from nitrogen, oxygen, phosphorus, and sulfur). to 3, or 1 to 4) heteroatoms. A heterocyclyl can be attached to the main structure at any heteroatom or carbon atom. A heterocyclyl group can be a monocyclic, bicyclic, tricyclic, tetracyclic, or other multicyclic ring system, where the multicyclic ring system can be a fused, bridged or spiro ring system. Heterocyclyl polycyclic ring systems can contain one or more heteroatoms in one or more rings. Heterocyclyl groups can be saturated or partially unsaturated. A saturated heterocycloalkyl group may be termed “heterocycloalkyl”. A partially unsaturated heterocycloalkyl group may be termed "heterocycloalkenyl" if the heterocyclyl contains at least one double bond, or "heterocycloalkynyl" if the heterocyclyl contains at least one triple bond. there is. In one embodiment, a heterocyclyl is, for example, 3 to 18 ring atoms (3- to 18-membered heterocyclyl), 4 to 18 ring atoms (4- to 18-membered heterocyclyl), 5 to 18 ring atoms (3- to 18-membered heterocyclyl), 4 to 8 ring atoms (4- to 8-membered heterocyclyl), or 5 to 8 ring atoms (5- to 8-membered heterocyclyl) heterocyclyl). Whenever it appears herein, a numerical range such as “3 to 18” refers to each integer in the given range; For example, “3 to 18 ring atoms” means that a heterocyclyl group has 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, including up to 18 ring atoms. atom, 8 ring atoms, 9 ring atoms, 10 ring atoms, etc. Examples of heterocyclyl groups include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl , isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl. Unless otherwise specified, a heterocyclyl group is optionally substituted.

As used herein, and unless otherwise specified, the term "heterocyclylene" is a multivalent ( eg , divalent or trivalent) heterocyclyl group. Unless otherwise specified, a heterocyclylene group is optionally substituted.

As used herein, and unless otherwise specified, the term “aryl” refers to monocyclic aromatic groups and/or polycyclic monovalent aromatic groups containing at least one aromatic hydrocarbon ring. In certain embodiments, an aryl is 6 to 18 ring carbon atoms (C ₆ -C ₁₈ aryl), 6 to 14 ring carbon atoms (C ₆ -C ₁₄ aryl), or 6 to 10 ring carbon atoms (C ₆ -C ₁₀ aryl). Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthryl, phenanthryl, pyrenyl, biphenyl, and terphenyl. The term “aryl” also refers to a bicyclic, tricyclic, or other polycyclic hydrocarbon ring wherein at least one of the rings is aromatic and the others of which may be saturated, partially unsaturated, or aromatic, e.g. For example, dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl (tetralinyl). Unless otherwise specified, an aryl group is optionally substituted.

As used herein, and unless otherwise specified, the term "arylene" is a multivalent ( eg , divalent or trivalent) aryl group. Unless otherwise specified, an arylene group is optionally substituted.

As used herein, and unless otherwise specified, the term "heteroaryl" refers to a monocyclic aromatic group and/or a polycyclic aromatic group containing at least one aromatic ring, wherein at least one aromatic ring is O , S, and N ( eg, 1, 1 or 2, 1-3, or 1-4) heteroatoms independently selected from. A heteroaryl can be attached to the main structure at any heteroatom or carbon atom. In certain embodiments, a heteroaryl has 5 to 20, 5 to 15, or 5 to 10 ring atoms. The term “heteroaryl” also refers to a bicyclic, tricyclic, or other polycyclic ring wherein at least one of the rings is aromatic and the others of which may be saturated, partially unsaturated, or aromatic and , wherein at least one aromatic ring contains one or more heteroatoms independently selected from O, S, and N. Examples of monocyclic heteroaryl groups include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thienyl , oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl. Examples of bicyclic heteroaryl groups include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyra Nil, indolizinil, benzofuranil, isobenzofuranil, chromonyl, coumarinyl, cinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridinyl, furopyridinyl, thienopyridinyl, di hydroisoindolyl, and tetrahydroquinolinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, and xanthenyl. Unless otherwise specified, a heteroaryl group is optionally substituted.

As used herein, and unless otherwise specified, the term "heteroarylene" is a multivalent ( eg , divalent or trivalent) heteroaryl group. Unless otherwise specified, a heteroarylene group is optionally substituted.

When groups described herein are referred to as "substituted", they may be substituted with any suitable substituent or substituents. Illustrative examples of substituents include, but are not limited to, those found in the exemplary compounds and embodiments provided herein, as well as: a halogen atom such as F, CI, Br, or I; cyano; oxo (=0); hydroxyl (-OH); alkyl; alkenyl; alkynyl; cycloalkyl; aryl; -(C=O)OR';-O(C=O)R';-C(=O)R';-OR'; -S(O) _x R';-S-SR';-C(=O)SR';-SC(=0)R';-NR'R';-NR'C(=0)R';-C(=O)NR'R';-NR'C(=O)NR'R';-OC(=O)NR'R';-NR'C(=O)OR';-NR'S(O) _x NR'R';-NR'S(O) _x R'; and -S(O) _x NR'R', wherein: R', at each occurrence, is independently H, C ₁ -C ₁₅ alkyl or cycloalkyl, and x is 0, 1 or 2. In some embodiments the substituent is a C ₁ -C ₁₂ alkyl group. In other embodiments, the substituent is a cycloalkyl group. In other embodiments, the substituent is a halo group, such as fluoro. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group (-OR'). In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR'R').

As used herein, and unless otherwise specified, the terms “optional” or “optionally” ( eg, optionally substituted) mean that an event in the circumstances described later may or may not occur and that the description It means that the case where the event or situation occurs and the case where it does not occur. For example, "optionally substituted alkyl" means that the alkyl radical may or may not be substituted and that the description includes both substituted and unsubstituted alkyl radicals.

As used herein, and unless otherwise specified, the term "prodrug" of a biologically active compound refers to a compound that can be converted under physiological conditions or by solvolysis to a biologically active compound. In one embodiment, the term “prodrug” refers to a pharmaceutically acceptable metabolic precursor of a biologically active compound. A prodrug may be inactive when administered to a subject in need of treatment, but is converted in vivo to a biologically active compound. Prodrugs are typically rapidly transformed in vivo to yield the parent biologically active compound, for example by hydrolysis in blood. Prodrug compounds often offer the advantages of solubility, histocompatibility or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs (1985), pp. 7-9, 21-24 (Elsevier, Amsterdam)). . A discussion of prodrugs can be found in Higuchi, T., et al., ACS Symposium Series, Vol. 14, and in Bioreversible Carriers in Drug Design, Ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.

In one embodiment, the term “prodrug” is also meant to include any covalently linked carrier that will release the active compound in vivo when such prodrug is administered to a mammalian subject. A prodrug of a compound can be prepared by modifying a functional group present in the compound in such a way that the transformation is cleaved into the parent compound either in routine manipulation or in vivo . Prodrugs include compounds in which a hydroxyl, amino or mercapto group is bonded to any group that, when the prodrug of the compound is administered to a mammalian subject, is cleaved to form a free hydroxyl, free amino or free mercapto group, respectively.

Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohols or amide derivatives of amine functional groups in the compounds provided herein.

As used herein, and unless otherwise specified, the term "pharmaceutically acceptable salt" includes both acid and base addition salts.

Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid , alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid , dodecylsulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glut Taric acid, 2-oxo-glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, slime acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, palmic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid, and the like.

Examples of pharmaceutically acceptable base addition salts include, but are not limited to, salts prepared from the addition of an inorganic or organic base to a free acid compound. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. In one embodiment, the inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins such as ammonia, isopropylamine, trimethylamine, Diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, theanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine , hydrabamine, choline, betaine, benetamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purine, piperazine, piperidine, N-ethylpiperidine, salts of polyamine resins and the like. In one embodiment, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine.

Compounds provided herein may contain one or more asymmetric centers and so are enantiomers, diastereomers, and, in terms of absolute stereochemistry, either as (R)- or (S)- or, in the case of amino acids, (D)- or other stereoisomeric forms which may be defined as (L)-. Unless otherwise specified, compounds provided herein are meant to include all such possible isomers, as well as their racemic and optically pure forms. The optically active (+) and (−), (R)- and (S)-, or (D)- and (L)-isomers can be prepared using chiral synthons or chiral reagents or can be prepared using conventional techniques, such as For example, it can be resolved using chromatography and fractional crystallization. Conventional techniques for the preparation/isolation of individual enantiomers include chiral synthesis from suitable optically pure precursors or racemates (or racemates of salts or derivatives) using, for example, chiral high pressure liquid chromatography (HPLC). includes the decomposition of When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry, and unless otherwise specified, it is intended that the compounds include both E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included.

As used herein, and unless specified otherwise, the term “isomers” refers to different compounds having the same molecular formula. "Stereoisomers" are isomers that differ only in the way their atoms are arranged in space. “Atropisomers” are stereoisomers resulting from atropism about a single bond. "Enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any proportion may be known as a “racemic” mixture. “Diastereomers” are stereoisomers that have at least two asymmetric atoms, but are not mirror images of one another.

“Stereoisomers” may also include E and Z isomers, or mixtures thereof, and cis and trans isomers or mixtures thereof. In certain embodiments, the compounds described herein are isolated as either E or Z isomer. In another embodiment, the compounds described herein are mixtures of E and Z isomers.

“Tautomers” refer to isomeric forms of a compound that are in equilibrium with each other. The concentration of the isomeric form will depend on the environment in which the compound is found and may differ, for example, depending on whether the compound is a solid or an organic or aqueous solution.

It should also be noted that the compounds described herein may contain unnatural fractions of atomic isotopes at one or more of their atoms. For example, a compound may be radiolabeled with a radioactive isotope such as, for example, tritium ( ³ H), iodine-125 ( ¹²⁵ I), sulfur-35 ( ³⁵ S), or carbon-14 ( ¹⁴ C). or may be isotopically enriched, such as with deuterium ( ² H), carbon-13 ( ¹³ C), or nitrogen-15 ( ¹⁵ N). As used herein, an "isotopolog" is an isotopically enriched compound. The term “isotopically enriched” refers to an atom that has an isotopic composition other than that atom's natural isotopic composition. "Isotopically enriched" can also refer to a compound containing at least one atom that has an isotopic composition other than the natural isotopic composition of that atom. The term “isotopic composition” refers to the amount of each isotope present for a given atom. Radiolabeled and isotopically enriched compounds are useful as therapeutics, such as cancer treatments, research reagents, such as binding assay reagents, and diagnostic agents , such as in vivo imaging agents. All isotopic forms of the compounds described herein, whether radioactive or not, are intended to be encompassed within the scope of the embodiments provided herein. In some embodiments, isotopologs of compounds described herein are provided, eg, isotopologs enriched in deuterium, carbon-13, and/or nitrogen-15. As used herein, "deuterated" means a compound in which at least one hydrogen (H) has been replaced by a deuterium (represented by D or ² H), i.e., the compound is enriched with deuterium at least one position. means that

It should be noted that if there is a discrepancy between a depicted structure and a name for that structure, more weight is given to the depicted structure.

As used herein, and unless otherwise specified, the term “pharmaceutically acceptable carrier, diluent, or excipient” is approved by, without limitation, the Food and Drug Administration (FDA) as acceptable for human or veterinary use. any adjuvant, carrier, excipient, lubricant, sweetening agent, diluent, preservative, dye/colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent or emulsifier .

The term "composition" is intended to encompass products containing specified components ( eg, mRNA molecules provided herein), optionally in specified amounts.

The terms "polynucleotide" or "nucleic acid" when used interchangeably herein refer to polymers of nucleotides of any length and include, for example , DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogues, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. Polynucleotides can include modified nucleotides, such as methylated nucleotides and their analogs. Nucleic acids may be in either single- or double-stranded form. As used herein and unless otherwise specified, “nucleic acid” also includes nucleic acid mimics such as locked nucleic acids (LNA), peptide nucleic acids (PNA), and morpholinos. "Oligonucleotide", as used herein, generally, but not necessarily, refers to short synthetic polynucleotides of less than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The above description of polynucleotides is equally and fully applicable to oligonucleotides. Unless otherwise specified, the left end of any single-stranded polynucleotide sequence disclosed herein is the 5'end; The left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5' direction. The direction of 5' to 3' addition of the nascent RNA transcript is referred to as the direction of transcription; The region of sequence in the DNA strand that has the same sequence as the RNA transcript that is 5' to the 5' end of the RNA transcript is referred to as the "upstream sequence"; A region of sequence in a DNA strand that has the same sequence as an RNA transcript that is 3' to the 3' end of the RNA transcript is referred to as a "downstream sequence".

An "isolated nucleic acid" is a nucleic acid, e.g., RNA, DNA, or mixed nucleic acid, that is substantially separated from proteins or complexes that naturally accompany native sequences, such as ribosomes and polymerases, as well as other genomic DNA sequences. An "isolated" nucleic acid molecule is one that is separated from other nucleic acid molecules present in the natural source of the nucleic acid molecule. Moreover, an "isolated" nucleic acid molecule, such as an mRNA molecule, may be substantially free of other cellular material, or culture medium, when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. can In certain embodiments, one or more nucleic acid molecules encoding an antigen when described herein are isolated or purified. The term encompasses nucleic acid sequences removed from their naturally occurring environment, and includes recombinant or cloned DNA or RNA isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems. A substantially pure molecule may include an isolated form of the molecule.

The term “encoding nucleic acid” or its grammatical equivalents when used in reference to a nucleic acid molecule (a) engineered in its native state or by methods well known to those skilled in the art to be transcribed to produce mRNA and then translated into peptides and/or polypeptides. when it encompasses the nucleic acid molecule, and (b) the mRNA molecule itself. The antisense strand is the complement of such nucleic acid molecules, and the encoding sequence can be deduced therefrom. The term “coding region” refers to a section in an encoding nucleic acid sequence that is translated into a peptide or polypeptide. The term "untranslated region" or "UTR" refers to a portion of an encoding nucleic acid that is not translated into a peptide or polypeptide. Depending on the orientation of a UTR with respect to the coding region of a nucleic acid molecule, a UTR is referred to as a 5'-UTR if it is located at the 5'-end of the coding region, and a UTR is referred to as a 3'-UTR if located at the 3'-end of the coding region. is referred to

The term "mRNA" when used herein refers to a message RNA molecule comprising one or more open reading frames (ORFs) that can be translated by a cell or organism provided as mRNA to produce one or more peptide or protein products. . A region containing one or more ORFs is referred to as the coding region of an mRNA molecule. In certain embodiments, the mRNA molecule further comprises one or more untranslated regions (UTRs).

In certain embodiments, the mRNA is a monocistronic mRNA comprising only one ORF. In certain embodiments, the monocistronic mRNA encodes a peptide or protein comprising at least one epitope of a selected antigen ( eg, a pathogenic antigen or tumor associated antigen). In another embodiment, the mRNA is a multicistronic mRNA comprising two or more ORFs. In certain embodiments, a multiecistronic mRNA encodes two or more peptides or proteins that may be the same or different from each other. In certain embodiments, each peptide or protein encoded by a multicistronic mRNA comprises at least one epitope of a selected antigen. In certain embodiments, the different peptides or proteins encoded by each multicistronic mRNA comprise at least one epitope of a different antigen. In any of the embodiments described herein, the at least one epitope can be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 epitopes of the antigen. .

The term “nucleobase” encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural or synthetic analogs or derivatives thereof.

The term "functional nucleotide analogue" when used herein (a) retains the base-pairing properties of the corresponding canonical nucleotide, (b) has the (i) nucleobase, (ii) sugar group, ( iii) a phosphate group, or (iv) a modified version of the regular nucleotides A, G, C, U or T that contain at least one chemical modification in any combination of (i) to (iii). As used herein, base pairing refers to regular Watson-Crick adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, as well as base pairs formed between a canonical nucleotide and a functional nucleotide analogue or between a pair of functional nucleotide analogues. encompasses, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a modified nucleobase and a canonical nucleobase or between two complementary modified nucleobase structures. For example, a functional analog of guanosine (G) retains the ability to base-pair with cytosine (C) or a functional analog of cytosine. One example of such non-canonical base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. In the cases described herein, functional nucleotide analogs can be either naturally occurring or non-naturally occurring. Thus, nucleic acid molecules containing functional nucleotide analogs may have at least one modified nucleobase, sugar group, and/or internucleoside linkage. Exemplary chemical modifications to nucleobases, sugar groups, or internucleoside linkages of nucleic acid molecules are provided herein.

The terms “translational enhancer element,” “TEE” and “translational enhancer,” when used herein, refer to an agent that facilitates translation of a coding sequence of a nucleic acid into a protein or peptide product, such as via cap-dependent or cap-independent translation. Refers to a region in a nucleic acid molecule that functions. TEEs are typically located in the UTR region of a nucleic acid molecule ( eg, mRNA) and enhance the translational level of coding sequences either upstream or downstream. For example, in the 5'-UTR of a nucleic acid molecule, the TEE can be located between the promoter and the initiation codon of the nucleic acid molecule. A variety of TEE sequences are known in the art (Wellensiek et al . Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods , 2013 Aug; 10(8): 747-750; Chappell et al. PNAS June 29, 2004 101 (26) 9590-9594). Some TEEs are known to be conserved across species (Panek et al. Nucleic Acids Research , Volume 41, Issue 16, September 1, 2013, pages 7625-7634).

As used herein, the term "stem-loop sequences" are complementary or substantially complementary to each other when read in opposite directions, and thus to form at least one double helix and an unpaired loop with each other to form base-loop sequences. Refers to a single-stranded polynucleotide sequence having at least two regions capable of mating. The resulting structure is known as a stem-loop structure, hairpin or hairpin loop, a secondary structure found in many RNA molecules.

The term “peptide” when used herein refers to a polymer containing from two to fifty (2-50) amino acid residues joined by one or more covalent peptide bond(s). The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids ( eg, amino acid analogs or non-natural amino acids).

The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of more than fifty (50) amino acid residues joined by covalent peptide bonds. That is, descriptions relating to polypeptides apply equally to descriptions of proteins and vice versa . The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids ( eg, amino acid analogs). As used herein, the term encompasses amino acid chains of any length, including full-length proteins ( eg, antigens).

The term "antigen" refers to a substance that can be recognized by a subject's immune system (including by the adaptive immune system) and that can trigger an immune response (including an antigen-specific immune response) after a subject comes into contact with the antigen. do. In certain embodiments, an antigen is a protein associated with a diseased cell, such as a cell infected by a pathogen or a neoplastic cell ( eg, a tumor associated antigen (TAA)).

In the context of a peptide or polypeptide, the term "fragment" when used herein refers to a peptide or polypeptide comprising less than the full-length amino acid sequence. Such fragments may arise, for example, from truncation at the amino terminus, truncation at the carboxy terminus, and/or internal deletion of residue(s) from the amino acid sequence. Fragments may result, for example, from alternative RNA splicing or protease activity in vivo . In certain embodiments, a fragment is at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 40 contiguous amino acid residues of an amino acid sequence of a polypeptide. at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, Refers to a polypeptide comprising an amino acid sequence of at least 850, at least 900, or at least 950 contiguous amino acid residues. In certain embodiments, a fragment of a polypeptide retains at least one, at least two, at least three, or more functions of a polypeptide.

An "epitope" is a site on the surface of an antigenic molecule to which a single antibody molecule binds, such as an animal, such as a mammal ( e.g., a human) capable of binding to one or more antigen-binding regions of an antibody and capable of eliciting an immune response. ) is a localized area on the surface of an antigen that has antigenic or immunogenic activity. An epitope with immunogenic activity is a portion of a polypeptide that elicits an antibody response in an animal. An epitope having antigenic activity is a portion of a polypeptide to which an antibody binds, as determined by any method well known in the art, including, for example, by immunoassay. Antigenic epitopes need not necessarily be immunogenic. Epitopes often consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and have specific three-dimensional structural characteristics as well as specific charge characteristics. An antibody epitope can be a linear epitope or a conformational epitope. A linear epitope is formed by a contiguous sequence of amino acids in a protein. Structural epitopes are formed from amino acids that are discontinuous in a protein sequence, but are incorporated into its three-dimensional structure upon folding of the protein. An induced epitope is formed when the three-dimensional structure of a protein is an altered structure, such as after activation or binding of another protein or ligand. In certain embodiments, an epitope is a three-dimensional surface property of a polypeptide. In another embodiment, an epitope is a linear property of a polypeptide. Antigens generally have several or many different epitopes and can react with many different antibodies.

The term "genetic vaccine" when used herein refers to a therapeutic or prophylactic composition comprising at least one nucleic acid molecule encoding an antigen associated with a target disease ( eg, an infectious disease or a neoplastic disease). . Administration of a vaccine (“vaccination”) to a subject produces an encoded peptide or protein, thereby eliciting an immune response against a target disease in the subject. In certain embodiments, the immune response comprises an adaptive immune response, such as the production of antibodies against the encoded antigen, and/or the activation and proliferation of immune cells capable of specifically eliminating diseased cells expressing the antigen. In certain embodiments, the immune response further comprises an innate immune response. In the present disclosure, the vaccine can be administered to a subject before or after the onset of clinical symptoms of either target disease. In some embodiments, vaccination of a healthy or asymptomatic subject renders the vaccinated subject immune or less susceptible to developing a target disease. In some embodiments, vaccination of a subject exhibiting symptoms of a disease treats or ameliorates the condition of the disease in the vaccinated subject.

The terms "innate immune response" and "innate immunity" are art-recognized and refer to non-specific defense mechanisms that the body's immune system initiates upon recognition of pathogen-associated molecular patterns, which, through various pathways, cytokine It involves different forms of cellular activity including production and cell death. As used herein, the innate immune response includes, without limitation, increased production of inflammatory cytokines ( eg, type I interferon or IL-10 production), activation of the NFκB pathway, increased proliferation, maturation of immune cells. , differentiation and/or survival, and in some cases, induction of cell death. Activation of innate immunity can be detected using methods known in the art, such as measuring (NF)-κB activation.

The terms "adaptive immune response" and "adaptive immunity" are art-recognized and refer to antigen-specific defense mechanisms that the body's immune system initiates upon recognition of a specific antigen, which is a combination of both humoral responses and cell-mediated defense mechanisms. contain the reaction. As used herein, an adaptive immune response includes a cellular response that is triggered and/or augmented by a vaccine composition, such as a genetic composition described herein. In some embodiments, the vaccine composition comprises an antigen that is a target of an antigen-specific adaptive immune response. In another embodiment, the vaccine composition, upon administration, permits production in an immunized subject of an antigen that is a target of an antigen-specific adaptive immune response. Activation of the adaptive immune response can be detected using methods known in the art, such as by measuring the level of antigen-specific antibody production, or antigen-specific cell-mediated cytotoxicity.

The term "antibody" is intended to include polypeptide products of B cells within the immunoglobulin class of polypeptides capable of binding specific molecular antigens and consisting of two identical pairs of polypeptide chains, where each pair contains one heavy chain. (about 50-70 kDa) and one light chain (about 25 kDa), each amino-terminal segment of each chain comprising a variable region of about 100 to about 130 or more amino acids, each carboxy- The terminal section contains the constant region. For example, Antibody Engineering (Borrebaeck ed., 2d ed. 1995); and Kuby, Immunology (3d ed. 1997) , see . In certain embodiments, a particular molecular antigen may be bound by an antibody provided herein comprising a polypeptide, fragment or epitope thereof. Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, camelized antibodies, intrabodies, anti-idiotypic (anti-Id) antibodies, and some or all of the binding activity of antibodies from which fragments are derived. It includes functional fragments of any of the above, which refer to a portion of an antibody heavy or light chain polypeptide that has a. Non-limiting examples of functional fragments include single-chain Fvs (scFv) (including eg monospecific, bispecific, etc. ), Fab fragments, F(ab') fragments, F(ab) ₂ fragments, F (ab') ₂ fragments, disulfide-linked Fvs (dsFv), Fd fragments, Fv fragments, diabodies, triabodies, tetrabodies, and minibodies. In particular, antibodies provided herein comprise immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, e.g., antigen-binding domains or molecules ( e.g., one or more CDRs of an antibody) that contain an antigen-binding site. include Such antibody fragments are described, for example, in Harlow and Lane, Antibodies: A Laboratory Manual (1989); Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers ed., 1995); Huston et al. , 1993, Cell Biophysics 22:189-224; Pluckthun and Skerra, 1989, Meth. Enzymol. 178:497-515; and Day, Advanced Immunochemistry (2d ed. 1990). Antibodies provided herein may be from any class of immunoglobulin molecules ( eg, IgG, IgE, IgM, IgD, and IgA) or any subclass ( eg, IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2). ) can be.

The term “administer” or “administration” refers to an action that is present outside the body to a patient, such as by mucosal, intradermal, intravenous, intramuscular delivery, and/or any other method of physical delivery described herein or known in the art. refers to the act of injecting or otherwise physically delivering a substance ( eg, a lipid nanoparticle composition in the case described herein). When a disease, disorder, condition, or symptom thereof is being treated, administration of the substance typically occurs after onset of the disease, disorder, condition, or symptom thereof. When a disease, disorder, condition, or symptom thereof is being prevented, administration of the substance typically occurs prior to onset of the disease, disorder, condition, or symptom thereof.

"Chronic" administration is the administration of the agent(s) in a continuous mode ( eg , over a period of time, such as days, weeks, months or years) as opposed to an acute mode, in order to maintain the initial therapeutic effect (activity) for an extended period of time. refers to dosing. "Intermittent" administration is treatment that is not continuously without interruption, but rather is cyclic in nature.

The term “targeted delivery” or the verb form “target” when used herein refers to a specific organ, tissue, cell, rather than any other organ, tissue, cell, or intracellular compartment (referred to as a non-target location). and/or the process of facilitating the arrival of a delivered agent (such as a therapeutic payload molecule in a lipid nanoparticle composition when described herein) to an intracellular compartment (referred to as a targeted location). Targeted delivery can be detected using methods known in the art, for example, by comparing the concentration of the delivered agent in the targeted cell population with the concentration of the agent delivered to the non-target cell population following systemic administration. In certain embodiments, targeted delivery results in at least a 2-fold higher concentration at a targeted location when compared to a non-target location.

An “effective amount” generally reduces the severity and/or frequency of symptoms, eliminates symptoms and/or underlying causes, prevents symptoms and/or their underlying causes from occurring, and/or includes, for example, infections and tumors. an amount sufficient to ameliorate or correct damage associated with or resulting from a disease, disorder, or condition involving the formation. In some embodiments, the effective amount is a therapeutically effective amount or a prophylactically effective amount.

The term “therapeutically effective amount” when used herein refers to a given disease, disorder, or condition, and/or symptoms related thereto ( e.g., an infectious disease such as caused by a viral infection, or a neoplastic disease such as An amount of an agent ( eg, a vaccine composition) sufficient to reduce and/or ameliorate the severity and/or duration of cancer). A "therapeutically effective amount" of a substance/molecule/agent ( e.g., a lipid nanoparticle composition when described herein) of the present disclosure refers to factors such as the disease state, age, sex, and weight of an individual, and in an individual It can vary depending on the ability of the substance/molecule/agent to elicit the desired response. A therapeutically effective amount encompasses an amount in which the therapeutically beneficial effects outweigh any toxic or detrimental effects of the substance/molecule/agent. In certain embodiments, the term “therapeutically effective amount,” when described herein, refers to a lipid nanoparticle composition or a therapeutic or prophylactic agent contained therein effective to “treat” a disease, disorder, or condition in a subject or mammal ( e.g., e.g., therapeutic mRNA).

A "prophylactically effective amount" means, when administered to a subject, the intended prophylactic effect, e.g. , a disease, disorder, condition, or associated symptom(s) ( e.g., an infectious disease such as caused by a viral infection). It is the amount of the pharmaceutical composition that will prevent, delay, or reduce the likelihood of onset (or recurrence) of a disease, or neoplastic disease such as cancer). Typically, but not necessarily, a prophylactically effective amount may be less than a therapeutically effective amount, as a prophylactic dose is used in a subject prior to or at an earlier stage of the disease, disorder, or condition. A full therapeutic or prophylactic effect does not necessarily occur with the administration of one dose, but can only occur after administration of a series of doses. Thus, a therapeutically or prophylactically effective amount can be administered in one or more administrations.

The terms "prevent", "preventing", and "prevention" refer to a disease, disorder, condition, or associated symptom(s) ( e.g., an infectious disease such as caused by a viral infection, or a neoplastic disease such as cancer ) refers to reducing the likelihood of onset (or recurrence) of

The terms "administer", "managing", and "management" refer to beneficial effects that a subject derives from therapy ( eg, prophylactic or therapeutic agents), which do not result in cure of a disease. In certain embodiments, a subject is treated with one or more therapies ( e.g., prophylactic or therapeutic agents, such as those described herein) to "manage" an infectious or neoplastic disease, one or more symptoms thereof, to prevent progression or worsening of the disease. lipid nanoparticle composition) is administered.

The term "preventive agent" refers to any agent capable of inhibiting, in whole or in part, the onset, recurrence, onset, or spread of a disease and/or symptoms related thereto in a subject.

The term "therapeutic agent" is used to treat, prevent, or alleviate a disease, disorder, or condition, including in the treatment, prevention, or alleviation of one or more symptoms of the disease, disorder, or condition and/or symptoms related thereto. refers to any agent that can be used in

The term “therapy” refers to any protocol method, and/or agent that can be used in the prevention, management, treatment, and/or amelioration of a disease, disorder, or condition. In certain embodiments, the terms "therapeutics" and "therapy" refer to biologic therapy, supportive therapy, and/or other therapies useful in the prevention, management, treatment, and/or amelioration of a disease, disorder or condition known to those skilled in the art such as a healthcare practitioner. refers to

As used herein, "prophylactically effective serum titer" refers to a subject that inhibits, in whole or in part, the onset, recurrence, onset, or spread of a disease, disorder, or condition, and/or symptoms related thereto, in the subject ( eg, in humans) is the serum titer of the antibody.

In certain embodiments, a “therapeutically effective serum titer” is a serum titer of an antibody in a subject ( eg, a human) that reduces the severity, duration, and/or symptoms associated with a disease, disorder, or condition in the subject. .

The term “serum titer” refers to the average serum titer in subjects from multiple samples ( e.g., at multiple time points) or in a population of at least 10, at least 20, at least 40 subjects, up to about 100, 1000, or more.

The term "side effect" encompasses unwanted and/or adverse effects of therapy ( eg, prophylactic or therapeutic agents). Unwanted effects are not necessarily detrimental. Adverse effects from therapy ( eg, prophylactic or therapeutic agents) can be detrimental, inconvenient, or dangerous. Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, hair loss, dyspnoea, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, rash or swelling at the site of administration, flu-like symptoms such as fever, chills, and fatigue, digestive tract problems, and allergic reactions. Additional undesirable effects experienced by patients are numerous and known in the art. Many are described in the Physician's Desk Reference (68th ed. 2014).

The terms “subject” and “patient” may be used interchangeably. As used herein, in certain embodiments, a subject is a mammal, such as a non-primate ( eg, cow, pig, horse, cat, dog, rat, etc. ) or primate ( eg, monkey and human). )am. In certain embodiments, the subject is a human. In one embodiment, the subject is a mammal ( eg, a human) having an infectious or neoplastic disease. In another embodiment, the subject is a mammal ( eg, a human) at risk of developing an infectious or neoplastic disease.

The term "detectable probe" refers to a composition that provides a detectable signal. The term includes, without limitation, any fluorophore, chromophore, radioactive label, enzyme, antibody or antibody fragment that provides a detectable signal through its activity, and the like.

The term “detectable agent” refers to a substance that can be used to confirm the presence or presence of a molecule of interest in a sample or subject, such as an antigen encoded by an mRNA molecule when described herein. A detectable agent may be a substance that can be visualized or otherwise determined and/or measured ( eg, by quantification).

“Substantially all” means at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98% , at least about 99%, or about 100%.

As used herein, and unless otherwise indicated, the term "about" or "approximately" refers to an acceptable error for a particular value, as determined by one skilled in the art, which depends in part on how the value is measured or determined. means In certain embodiments, the term “about” or “approximately” means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the term “about” or “approximately” means 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% of a given value or range. %, within 1%, 0.5%, 0.05%, or less.

The singular terms "a", "an", and "the" when used herein include plural references unless the context clearly dictates otherwise.

All publications, patent applications, accession numbers, and other references cited herein are hereby incorporated by reference in their entirety as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that this invention is not entitled to antedate such disclosure by virtue of prior invention. Moreover, the date of issue provided may differ from the actual date of issue and may need to be independently verified.

A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Thus, the descriptions of the experimental sections and examples are intended to illustrate the scope of the claimed invention and not to limit it.

5.3 lipid compounds

Unless otherwise specified, descriptions provided herein apply to all formulas provided herein (eg, formula (I), including their sub-formulas) to the extent they are applicable.

In one embodiment, a compound of Formula (I):

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof is provided herein, wherein:

G ¹ and G ² are each independently a bond, C ₂ -C ₁₂ alkylene, or C ₂ -C ₁₂ alkenylene, wherein one or more -CH ₂ - in G ¹ and G ² is optionally replaced by -O- become;

Each L ¹ is independently -OC(=O)R ¹ , -C(=O)OR ¹ , -OC(=O)OR ¹ , -C(=O)R ¹ , -OR ¹ , -S(O ) _x R ¹ , -S-SR ¹ , -C(=O)SR ¹ , -SC(=O)R ¹ , -NR ^a C(=O)R ¹ , -C(=O)NR ^b R ^c , -NR ^a C(=O)NR ^b R ^c , -OC(=O)NR ^b R ^c , -NR ^a C(=O)OR ¹ , -SC(=S)R ¹ , -C(=S )SR ¹ , -C(=S)R ¹ , -CH(OH)R ¹ , -P(=O)(OR ^b )(OR ^c ), -NR ^a P(=O)(OR ^b )(OR ^c ), -(C ₆ -C ₁₀ arylene)-R ¹ , -(6- to 10-membered heteroarylene)-R ¹ , -(4- to 8-membered heterocyclylene)-R ¹ , or is R ¹ ;

Each L ² is independently -OC(=O)R ² , -C(=O)OR ² , -OC(=O)OR ² , -C(=O)R ² , -OR ² , -S(O ) _x R ² , -S-SR ² , -C(=O)SR ² , -SC(=O)R ² , -NR ^d C(=O)R ² , -C(=O)NR ^e R ^f , -NR ^d C(=O)NR ^e R ^f , -OC(=O)NR ^e R ^f , -NR ^d C(=O)OR ² , -SC(=S)R ² , -C(=S )SR ² , -C(=S)R ² , -CH(OH)R ² , -P(=O)(OR ^e )(OR ^f ), -NR ^d P(=O)(OR ^e )(OR ^f ), -(C ₆ -C ₁₀ arylene)-R ² , -(6- to 10-membered heteroarylene)-R ² , -(4- to 8-membered heterocyclylene)-R ² , or is R ² ;

R ¹ and R ² are each independently C ₆ -C ₂₄ alkyl or C ₆ -C ₂₄ alkenyl;

R ^a , R ^b , R ^d , and R ^e are each independently H, C ₁ -C ₂₄ alkyl, or C ₂ -C ₂₄ alkenyl;

R ^c and R ^f are each independently C ₁ -C ₂₄ alkyl or C ₂ -C ₂₄ alkenyl;

G ³ is C ₂ -C ₁₂ alkylene or C ₂ -C ₁₂ alkenylene, wherein some or all of the alkylene or alkenylene is C ₃ -C ₈ cycloalkylene, C ₃ -C ₈ cycloalkenylene, C optionally substituted by ₃ -C ₈ cycloalkynylene, 4- to 8-membered heterocyclylene, C ₆ -C ₁₀ arylene, or 5- to 10-membered heteroarylene;

R ³ is hydrogen, C ₁ -C ₁₂ alkyl, C ₂ -C ₁₂ alkenyl, C ₂ -C ₁₂ alkynyl, C ₃ -C ₈ cycloalkyl, C ₃ -C ₈ cycloalkenyl, C ₃ -C ₈ cycloalkynyl, 4- to 8-membered heterocyclyl, C ₆ -C ₁₀ aryl, or 5- to 10-membered heteroaryl; Portions of R ³ , G ¹ or G ¹ together with the nitrogen to which they are attached form a cyclic moiety; A portion of R ³ , G ³ or G ³ together with the nitrogen to which they are attached form a cyclic moiety;

R ⁴ is C ₁ -C ₁₂ alkyl or C ₃ -C ₈ cycloalkyl;

x is 0, 1, or 2;

n is 1 or 2;

m is 1 or 2;

wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocycle The rylene, arylene, heteroarylene, and cyclic moieties are independently optionally substituted.

In one embodiment, a compound of Formula (I):

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof is provided herein, wherein:

G ¹ and G ² are each independently a bond, C ₂ -C ₁₂ alkylene, or C ₂ -C ₁₂ alkenylene;

Each L ¹ is independently -OC(=O)R ¹ , -C(=O)OR ¹ , -OC(=O)OR ¹ , -C(=O)R ¹ , -OR ¹ , -S(O ) _x R ¹ , -S-SR ¹ , -C(=O)SR ¹ , -SC(=O)R ¹ , -NR ^a C(=O)R ¹ , -C(=O)NR ^b R ^c , -NR ^a C(=O)NR ^b R ^c , -OC(=O)NR ^b R ^c , -NR ^a C(=O)OR ¹ , -SC(=S)R ¹ , -C(=S )SR ¹ , -C(=S)R ¹ , -CH(OH)R ¹ , -P(=O)(OR ^b )(OR ^c ), -(C ₆ -C ₁₀ arylene)-R ¹ , -(6- to 10-membered heteroarylene)-R ¹ , or R ¹ ;

Each L ² is independently -OC(=O)R ² , -C(=O)OR ² , -OC(=O)OR ² , -C(=O)R ² , -OR ² , -S(O ) _x R ² , -S-SR ² , -C(=O)SR ² , -SC(=O)R ² , -NR ^d C(=O)R ² , -C(=O)NR ^e R ^f , -NR ^d C(=O)NR ^e R ^f , -OC(=O)NR ^e R ^f , -NR ^d C(=O)OR ² , -SC(=S)R ² , -C(=S )SR ² , -C(=S)R ² , -CH(OH)R ² , -P(=O)(OR ^e )(OR ^f ), -(C ₆ -C ₁₀ arylene)-R ² , -(6- to 10-membered heteroarylene)-R ² , or R ² ;

R ¹ and R ² are each independently C ₆ -C ₂₄ alkyl or C ₆ -C ₂₄ alkenyl;

R ^a , R ^b , R ^d , and R ^e are each independently H, C ₁ -C ₁₂ alkyl, or C ₂ -C ₁₂ alkenyl;

R ^c and R ^f are each independently C ₁ -C ₂₄ alkyl or C ₂ -C ₂₄ alkenyl;

G ³ is C ₂ -C ₁₂ alkylene or C ₂ -C ₁₂ alkenylene, wherein some or all of the alkylene or alkenylene is C ₃ -C ₈ cycloalkylene, C ₃ -C ₈ cycloalkenylene, C optionally substituted by ₃ -C ₈ cycloalkynylene, 4- to 8-membered heterocyclylene, C ₆ -C ₁₀ arylene, or 5- to 10-membered heteroarylene;

R ³ is hydrogen, C ₁ -C ₁₂ alkyl, C ₂ -C ₁₂ alkenyl, C ₂ -C ₁₂ alkynyl, C ₃ -C ₈ cycloalkyl, C ₃ -C ₈ cycloalkenyl, C ₃ -C ₈ cycloalkynyl, 4- to 8-membered heterocyclyl, C ₆ -C ₁₀ aryl, or 5- to 10-membered heteroaryl; Portions of R ³ , G ¹ or G ¹ together with the nitrogen to which they are attached form a cyclic moiety; A portion of R ³ , G ³ or G ³ together with the nitrogen to which they are attached form a cyclic moiety;

R ⁴ is C ₁ -C ₁₂ alkyl or C ₃ -C ₈ cycloalkyl;

x is 0, 1, or 2;

n is 1 or 2;

m is 1 or 2;

wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocycle The rylene, arylene, heteroarylene, and cyclic moieties are independently optionally substituted.

In one embodiment, n is 1. In one embodiment, n is 2. In one embodiment, m is 1. In one embodiment, m is 2. In one embodiment, n is 1 and m is 1. In one embodiment, n is 1 and m is 2. In one embodiment, n is 2 and m is 1. In one embodiment, n is 2 and m is 2.

In one embodiment, the compound is a compound of Formula (II-A):

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, the compound is a compound of formula (II-B):

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, the compound is a compound of Formula (II-C):

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, the compound is a compound of Formula (II-D):

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, G ³ is C ₂ -C ₁₂ alkylene. In one embodiment, G ³ is C ₂ -C ₈ alkylene. In one embodiment, G ³ is C ₂ -C ₆ alkylene. In one embodiment, G ³ is C ₂ -C ₄ alkylene. In one embodiment, G ³ is C ₂ alkylene. In one embodiment, G ³ is C ₃ alkylene. In one embodiment, G ³ is C ₄ alkylene. In one embodiment, G ³ is C ₅ alkylene. In one embodiment, G ³ is C ₆ alkylene. In one embodiment, G ³ is -CH ₂ CH ₂ -.

In one embodiment, G ³ is C ₂ -C ₁₂ alkenylene. In one embodiment, G ³ is C ₂ -C ₈ alkenylene. In one embodiment, G ³ is C ₂ -C ₆ alkenylene. In one embodiment, G ³ is C ₂ -C ₄ alkenylene. In one embodiment, G ³ is C ₂ alkenylene. In one embodiment, G ³ is C ₃ alkenylene. In one embodiment, G ³ is C ₄ alkenylene. In one embodiment, G ³ is C ₅ alkenylene. In one embodiment, G ³ is C ₆ alkenylene. In one embodiment, G ³ is (Z)-CH ₂ -CH=CH-CH ₂ -. In one embodiment, G ³ is (E)-CH ₂ -CH=CH-CH ₂ -.

In one embodiment, G ³ is C ₂ -C ₁₂ alkylene or C ₂ -C ₁₂ alkenylene, wherein some or all of the alkylene or alkenylene is C ₃ -C ₈ cycloalkylene, C ₃ -C ₈ cycloalkenylene, C ₃ -C ₈ cycloalkynylene, 4- to 8-membered heterocyclylene, C ₆ -C ₁₀ arylene, or 5- to 10-membered heteroarylene. In one embodiment, G ³ is C ₂ -C ₁₂ alkylene or C ₂ -C ₁₂ alkenylene, wherein some or all of the alkylene or alkenylene is replaced by C ₃ -C ₈ cycloalkylene. In one embodiment, G ³ is C ₂ -C ₁₂ alkylene or C ₂ -C ₁₂ alkenylene, wherein all of the alkylene or alkenylene are replaced by C ₃ -C ₈ cycloalkylene, ie , G ³ is C ₃ -C ₈ cycloalkylene. In one embodiment, G ³ is cyclopropylene. In one embodiment, G ³ is cyclobutylene. In one embodiment, G ³ is cyclopentylene. In one embodiment, G ³ is cyclohexylene. In one embodiment, G ³ is cycloheptylene. In one embodiment, G ³ is cyclooctylene.

In one embodiment, G ³ is am.

In one embodiment, G ³ is unsubstituted.

In one embodiment, the compound is a compound of Formula (III-A):

Wherein s is an integer from 2 to 12,

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, the compound is a compound of formula (III-B):

Wherein s is an integer from 2 to 12,

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, the compound is a compound of Formula (III-C):

Wherein s is an integer from 2 to 12,

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, the compound is a compound of formula (III-D):

Wherein s is an integer from 2 to 12,

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 3. In one embodiment, s is 4. In one embodiment, s is 5. In one embodiment, s is 6.

In one embodiment, G ¹ is a bond. In one embodiment, G ¹ is C ₂ -C ₁₂ alkylene. In one embodiment, G ¹ is C ₄ -C ₈ alkylene. In one embodiment, G ¹ is C ₅ -C ₇ alkylene. In one embodiment, G ¹ is C ₂ alkylene. In one embodiment, G ¹ is C ₃ alkylene. In one embodiment, G ¹ is C ₄ alkylene. In one embodiment, G ¹ is C ₅ alkylene. In one embodiment, G ¹ is C ₆ alkylene. In one embodiment, G ¹ is C ₇ alkylene. In one embodiment, G ¹ is C ₂ -C ₁₂ alkenylene. In one embodiment, G ¹ is C ₄ -C ₈ alkenylene. In one embodiment, G ¹ is C ₅ -C ₇ alkenylene. In one embodiment, G ¹ is C ₅ alkenylene. In one embodiment, G ¹ is C ₇ alkenylene. In one embodiment, G ¹ is linear. In one embodiment, G ¹ is branched. In one embodiment, G ¹ is divalent. In one embodiment, G ¹ is trivalent.

In one embodiment, G ² is a bond. In one embodiment, G ² is C ₂ -C ₁₂ alkylene. In one embodiment, G ² is C ₄ -C ₈ alkylene. In one embodiment, G ² is C ₅ -C ₇ alkylene. In one embodiment, G ² is C ₂ alkylene. In one embodiment, G ² is C ₃ alkylene. In one embodiment, G ² is C ₄ alkylene. In one embodiment, G ² is C ₅ alkylene. In one embodiment, G ² is C ₆ alkylene. In one embodiment, G ² is C ₇ alkylene. In one embodiment, G ² is C ₂ -C ₁₂ alkenylene. In one embodiment, G ² is C ₄ -C ₈ alkenylene. In one embodiment, G ² is C ₅ -C ₇ alkenylene. In one embodiment, G ² is C ₅ alkenylene. In one embodiment, G ² is C ₇ alkenylene. In one embodiment, G ² is linear. In one embodiment, G ² is branched. In one embodiment, G ² is divalent. In one embodiment, G ² is trivalent.

In one embodiment, G ¹ and G ² are each independently C ₂ -C ₁₂ alkylene. In one embodiment, G ¹ and G ² are each independently C ₅ alkylene. In one embodiment, G ¹ and G ² are each independently C ₇ alkylene.

In one embodiment, one or more -CH ₂ - of G ¹ is replaced by -O-. In one embodiment, one or more non-terminal -CH ₂ - of G ¹ is replaced by -O-. In one embodiment, the non-terminal -CH ₂ - of one of G ¹ is replaced by -O-. In one embodiment, G ¹ is (C ₂ -C ₅ alkylene)-O-(C ₂ -C ₆ alkylene).

In one embodiment, G ¹ is am. In one embodiment, G ¹ is am. In one embodiment, G ¹ is am. In one embodiment, G ¹ is am. In one embodiment, G ¹ is am. In one embodiment, G ¹ is am. In one embodiment, G ¹ is am. In one embodiment, G ¹ is am. In one embodiment, G ¹ is am.

In one embodiment, one or more -CH ₂ - of G ² is replaced by -O-. In one embodiment, one or more non-terminal -CH ₂ - of G ² is replaced by -O-. In one embodiment, the non-terminal -CH ₂ - of one of G ² is replaced by -O-. In one embodiment, G ² is (C ₂ -C ₅ alkylene)-O-(C ₂ -C ₆ alkylene).

In one embodiment, G ² is am. In one embodiment, G ² is am. In one embodiment, G ² is am. In one embodiment, G ² is am. In one embodiment, G ² is am. In one embodiment, G ² is am. In one embodiment, G ² is am. In one embodiment, G ² is am. In one embodiment, G ² is am.

In one embodiment, the compound is a compound of formula (IV):

In the formula, s is an integer from 2 to 12,

y is an integer from 2 to 12;

z is an integer from 2 to 12;

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, the compound is of formula (IV-A), (IV-B), (IV-C), (IV-D), (IV-E), (IV-F), (IV-G), or a compound of (IV-H):

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, the compound is a compound of formula (V):

wherein y is an integer from 2 to 12;

z is an integer from 2 to 12;

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, the compound is a compound of formula (V-A), (V-B), (V-C), (V-D), (V-E), (V-F), (V-G), or (V-H):

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, y and z are each independently an integer from 2 to 10. In one embodiment, y and z are each independently an integer from 2 to 6. In one embodiment, y and z are each independently an integer from 4 to 10.

In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8, and 9. In one embodiment, y is 5 and z is 5.

In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 3. In one embodiment, s is 4. In one embodiment, s is 5. In one embodiment, s is 6.

In one embodiment, y is 5, z is 5, and s is 2.

In one embodiment, L ¹ is R ¹ .

In one embodiment, L ¹ is -OC(=O)R ¹ , -C(=O)OR ¹ , -OC(=O)OR ¹ , -C(=O)R ¹ , -OR ¹ , -S (O) _x R ¹ , -S-SR ¹ , -C(=O)SR ¹ , -SC(=O)R ¹ , -NR ^a C(=O)R ¹ , -C(=O)NR ^b R ^c , -NR ^a C(=O)NR ^b R ^c , -OC(=O)NR ^b R ^c , -NR ^a C(=O)OR ¹ , -SC(=S)R ¹ , -C( =S)SR ¹ , -C(=S)R ¹ , -CH(OH)R ¹ , -P(=O)(OR ^b )(OR ^c ), -NR ^a P(=O)(OR ^b ) (OR ^c ), or -(4- to 8-membered heterocyclylene)-R ¹ . In one embodiment, L ¹ is -OC(=0)R ¹ , -C(=0)OR ¹ , -C(=0)SR ¹ , -SC(=0)R ¹ , -NR ^a C(= O)R ¹ , or -C(=O)NR ^b R ^c . In one embodiment, L ¹ is -OC(=0)R ¹ , -C(=0)OR ¹ , -NR ^a C(=0)R ¹ , or -C(=0)NR ^b R ^c . In one embodiment, L ¹ is -OC(=0)R ¹ . In one embodiment, L ¹ is -C(=0)OR ¹ . In one embodiment, L ¹ is -NR ^a C(=0)R ¹ . In one embodiment, L ¹ is -C(=0)NR ^b R ^c . In one embodiment, L ¹ is OR ¹ . In one embodiment, L ¹ is -NR ^a P(=0)(OR ^b )(OR ^c ). In one embodiment, L ¹ is -(4- to 8-membered heterocyclylene)-R ¹ . In one embodiment, L ¹ is am.

In one embodiment, L ² is R ² .

In one embodiment, L ² is -OC(=O)R ² , -C(=O)OR ² , -OC(=O)OR ² , -C(=O)R ² , -OR ² , -S (O) _x R ² , -S-SR ² , -C(=O)SR ² , -SC(=O)R ² , -NR ^d C(=O)R ² , -C(=O)NR ^e R ^f , -NR ^d C(=O)NR ^e R ^f , -OC(=O)NR ^e R ^f , -NR ^d C(=O)OR ² , -SC(=S)R ² , -C( =S)SR ² , -C(=S)R ² , -CH(OH)R ² , -P(=O)(OR ^e )(OR ^f ), or -NR ^d P(=O)(OR ^e )(OR ^f ), or -(4- to 8-membered heterocyclylene)-R ² . In one embodiment, L ² is -OC(=0)R ² , -C(=0)OR ² , -C(=0)SR ² , -SC(=0)R ² , -NR ^d C(= O)R ² , or -C(=O)NR ^e R ^f . In one embodiment, L ² is -OC(=0)R ² , -C(=0)OR ² , -NR ^d C(=0)R ² , or -C(=0)NR ^e R ^f . In one embodiment, L ² is -OC(=0)R ² . In one embodiment, L ² is -C(=0)OR ² . In one embodiment, L ² is -NR ^d C(=0)R ² . In one embodiment, L ² is -C(=0)NR ^e R ^f . In one embodiment, L ² is OR ² . In one embodiment, L ² is -NR ^d P(=0)(OR ^e )(OR ^f ). In one embodiment, L ² is -(4- to 8-membered heterocyclylene)-R ² . In one embodiment, L ² is am.

In one embodiment, L ¹ is -C(=0)OR ¹ or -C(=0)NR ^b R ^c ; L ² is -C(=O)OR ² or -C(=O)NR ^e R ^f . In one embodiment, L ¹ is -C(=0)OR ¹ and L ² is -C(=0)OR ² . In one embodiment, L ¹ is -C(=0)OR ¹ and L ² is -C(=0)NR ^e R ^f . In one embodiment, L ¹ is -C(=0)NR ^b R ^c and L ² is -C(=0)OR ² . In one embodiment, L ¹ is -C(=0)NR ^b R ^c and L ² is -C(=0)NR ^e R ^f .

In one embodiment, L ¹ is -OC(=0)R ¹ or -NR ^a C(=0)R ¹ ; L ² is -OC(=0)R ² or -NR ^d C(=0)R ² . In one embodiment, L ¹ is -OC(=0)R ¹ and L ² is -OC(=0)R ² . In one embodiment, L ¹ is -OC(=0)R ¹ and L ² is -NR ^d C(=0)R ² . In one embodiment, L ¹ is -NR ^a C(=0)R ¹ and L ² is -OC(=0)R ² . In one embodiment, L ¹ is -NR ^a C(=0)R ¹ and L ² is -NR ^d C(=0)R ² .

In one embodiment, L ¹ is -OR ¹ and L ² is -C(=0)OR ² . In one embodiment, L ¹ is -OR ¹ and L ² is -C(=0)NR ^e R ^f . In one embodiment, L ¹ is -C(=0)OR ¹ and L ² is -OR ² . In one embodiment, L ¹ is -C(=0)NR ^b R ^c and L ² is -OR ² .

In one embodiment, the compound is a compound of Formula (VI):

wherein z is an integer from 2 to 12;

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, z is an integer from 2 to 10. In one embodiment, z is an integer from 2 to 6. In one embodiment, z is an integer from 4 to 10. In one embodiment, z is selected from 4, 5, 6, 7, 8, and 9. In one embodiment, z is 5.

In one embodiment, R ³ is C ₁ -C ₁₂ alkyl. In one embodiment, R ³ is C ₁ -C ₈ alkyl. In one embodiment, R ³ is C ₁ -C ₆ alkyl. In one embodiment, R ³ is C ₁ -C ₄ alkyl. In one embodiment, the alkyl is a straight alkyl. In one embodiment, the alkyl is a branched alkyl. In one embodiment, R ³ is methyl. In one embodiment, R ³ is ethyl. In one embodiment, R ³ is n-propyl. In one embodiment, R ³ is isopropyl. In one embodiment, R ³ is n-butyl. In one embodiment, R ³ is n-pentyl. In one embodiment, R ³ is n-hexyl. In one embodiment, R ³ is n-octyl. In one embodiment, R ³ is n-nonyl.

In one embodiment, R ³ is C ₂ -C ₁₂ alkenyl. In one embodiment, R ³ is C ₂ -C ₈ alkenyl. In one embodiment, R ³ is C ₂ -C ₄ alkenyl. In one embodiment, alkenyl is straight alkenyl. In one embodiment, alkenyl is a branched alkenyl. In one embodiment, R ³ is ethenyl. In one embodiment, R ³ is allyl.

In one embodiment, R ³ is C ₂ -C ₁₂ alkynyl. In one embodiment, R ³ is C ₂ -C ₈ alkynyl. In one embodiment, R ³ is C ₂ -C ₄ alkynyl. In one embodiment, alkynyl is straight alkynyl. In one embodiment, alkynyl is branched alkynyl.

In one embodiment, R ³ is C ₃ -C ₈ cycloalkyl. In one embodiment, R ³ is cyclopropyl. In one embodiment, R ³ is cyclobutyl. In one embodiment, R ³ is cyclopentyl. In one embodiment, R ³ is cyclohexyl. In one embodiment, R ³ is cycloheptyl. In one embodiment, R ³ is cyclooctyl.

In one embodiment, R ³ is C ₃ -C ₈ cycloalkenyl. In one embodiment, R ³ is cyclopropenyl. In one embodiment, R ³ is cyclobutenyl. In one embodiment, R ³ is cyclopentenyl. In one embodiment, R ³ is cyclohexenyl. In one embodiment, R ³ is cycloheptenyl. In one embodiment, R ³ is cyclooctenyl.

In one embodiment, R ³ is a 4- to 8-membered heterocyclyl. In one embodiment, R ³ is a 4- to 8-membered heterocycloalkyl. In one embodiment, R ³ is oxetanyl. In one embodiment, R ³ is tetrahydrofuranyl. In one embodiment, R ³ is tetrahydropyranyl. In one embodiment, R ³ is tetrahydrothiopyranyl.

In one embodiment, R ³ is C ₆ -C ₁₀ aryl. In one embodiment, R ³ is phenyl.

In one embodiment, R ³ is a 5- to 10-membered heteroaryl. In one embodiment, R ³ is a 5-membered heteroaryl. In one embodiment, R ³ is a 6-membered heteroaryl.

In one embodiment, portions of R ³ , G ¹ or G ¹ together with the nitrogen to which they are attached form a cyclic moiety.

In one embodiment, the compound is a compound of formula (VII):

wherein s is an integer from 2 to 12;

u is 1, 2, or 3;

v is 1, 2, or 3;

y' is an integer from 0 to 10;

z is an integer from 2 to 12;

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, portions of R ³ , G ³ or G ³ together with the nitrogen to which they are attached form a cyclic moiety.

In one embodiment, the compound is of Formula (VIII-A), (VIII-B), (VIII-C), (VIII-D), (VIII-E), (VIII-F), or (VIII-G) Compound of:

wherein s' is an integer from 0 to 10;

u is 1, 2, or 3;

v is 1, 2, or 3;

y is an integer from 2 to 12;

z is an integer from 2 to 12;

y0 is an integer from 1 to 11;

z0 is an integer from 1 to 11;

y1 is an integer from 0 to 9;

z1 is an integer from 0 to 9;

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, u is 1. In one embodiment, u is 2. In one embodiment, u is 3. In one embodiment, v is 1. In one embodiment, v is 2. In one embodiment, v is 3. In one embodiment, u is 1 and v is 1. In one embodiment, u is 2 and v is 2. In one embodiment, u is 3 and v is 3.

In one embodiment, the compound is of formula (IX-A), (IX-B), (IX-C), (IX-D), (IX-E), (IX-F), (IX-G), (IX-H), (IX-I), (IX-J), (IX-K), (IX-L), (IX-M), (IX-N), (IX-O), (IX -P), (IX-Q), (IX-R), (IX-S), (IX-T), (IX-U), (IX-V), (IX-W), (IX-X ), (IX-Y), (IX-Z), or (IX-AA):

wherein s is an integer from 2 to 12;

y is an integer from 2 to 12;

z is an integer from 2 to 12;

y0 is an integer from 1 to 11;

z0 is an integer from 1 to 11;

y1 is an integer from 0 to 9;

z1 is an integer from 0 to 9;

y2 is an integer from 2 to 5;

y3 is an integer from 2 to 6;

y4 is an integer from 0 to 3;

y5 is an integer from 1 to 5;

z2 is an integer from 2 to 5;

z3 is an integer from 2 to 6;

z4 is an integer from 0 to 3;

z5 is an integer from 1 to 5;

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, y0 is an integer from 1 to 7. In one embodiment, y0 is 1. In one embodiment, y0 is 2. In one embodiment, y0 is 3. In one embodiment, y0 is 4. In one embodiment, y0 is 5. In one embodiment, y0 is 6. In one embodiment, y0 is 7. In one embodiment, z0 is an integer from 1 to 7. In one embodiment, z0 is 1. In one embodiment, z0 is 2. In one embodiment, z0 is 3. In one embodiment, z0 is 4. In one embodiment, z0 is 5. In one embodiment, z0 is 6. In one embodiment, z0 is 7.

In one embodiment, y1 is an integer from 2 to 6. In one embodiment, y1 is 2. In one embodiment, y1 is 3. In one embodiment, y1 is 4. In one embodiment, y1 is 5. In one embodiment, y1 is 6. In one embodiment, z1 is an integer from 2 to 6. In one embodiment, z1 is 2. In one embodiment, z1 is 3. In one embodiment, z1 is 4. In one embodiment, z1 is 5. In one embodiment, z1 is 6.

In one embodiment, y2 is 2. In one embodiment, y2 is 3. In one embodiment, y2 is 4. In one embodiment, y2 is 5. In one embodiment, z2 is 2. In one embodiment, z2 is 3. In one embodiment, z2 is 4. In one embodiment, z2 is 5.

In one embodiment, y3 is 2. In one embodiment, y3 is 3. In one embodiment, y3 is 4. In one embodiment, y3 is 5. In one embodiment, y3 is 6. In one embodiment, z3 is 2. In one embodiment, z3 is 3. In one embodiment, z3 is 4. In one embodiment, z3 is 5. In one embodiment, z3 is 6.

In one embodiment, y4 is 0. In one embodiment, y4 is 1. In one embodiment, y4 is 2. In one embodiment, y4 is 3. In one embodiment, z4 is zero. In one embodiment, z4 is 1. In one embodiment, z4 is 2. In one embodiment, z4 is 3.

In one embodiment, y5 is 1. In one embodiment, y5 is 2. In one embodiment, y5 is 3. In one embodiment, y5 is 4. In one embodiment, y5 is 5. In one embodiment, z5 is 1. In one embodiment, z5 is 2. In one embodiment, z5 is 3. In one embodiment, z5 is 4. In one embodiment, z5 is 5.

In one embodiment, y2 is 2 and y3 is 2. In one embodiment, y2 is 2 and y4 is 1. In one embodiment, z2 is 2 and z3 is 2. In one embodiment, z2 is 2 and z4 is 1.

In one embodiment, s, y, z, L ¹ and L ² are as otherwise defined. In one embodiment, L ¹ is -OR ¹ , -OC(=0)R ¹ , -C(=0)OR ¹ , or -C(=0)NR ^b R ^c ; L ² is -OR ² , -OC(=O)R ² , -C(=O)OR ² , or -C(=O)NR ^e R ^f . In one embodiment, when there are two L ¹ , each L ¹ is independently -OC(=0)R ¹ . In one embodiment, when there are two L ² , each L ² is independently -OC(=0)R ² . In one embodiment, when there is only one L ¹ , L ¹ is -C(=0)OR ¹ . In one embodiment, when there is only one L ¹ , L ¹ is -C(=0)NR ^b R ^c . In one embodiment, when there is only one L ² , L ² is -C(=0)OR ² . In one embodiment, when there is only one L ² , L ² is -C(=0)NR ^e R ^f .

In one particular embodiment of any of Formulas (IX-A) through (IX-AA), provided that there is only one L ¹ , then L ¹ is -C(=0)OR ¹ . In another embodiment, L ¹ is -C(=0)NR ^b R ^c . In one embodiment, R ¹ or R ^c is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₄ - C ₈ alkyl.

In one particular embodiment of any of Formulas (IX-A) through (IX-AA), provided that there is only one L ² , then L ² is -C(=0)OR ² . In another embodiment, L ² is -C(=0)NR ^e R ^f . In one embodiment, R ² or R ^f is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₄ - C ₈ alkyl.

In one particular embodiment of any one of Formulas (IX-A) through (IX-AA), When present, each L ¹ is independently -OC(=0)R ¹ . In one embodiment, each R ¹ is independently straight C ₇ -C ₁₁ alkyl.

In one particular embodiment of any one of Formulas (IX-A) through (IX-AA), When present, each L ² is independently -OC(=0)R ² . In one embodiment, each R ² is independently straight C ₇ -C ₁₁ alkyl.

In one particular embodiment of any one of Formulas (IX-A) through (IX-AA), When present, each L ¹ is independently -OR ¹ . In another embodiment, each L ¹ is independently -C(=0)OR ¹ . In one embodiment, each R ¹ is independently straight C ₇ -C ₁₁ alkyl.

In one particular embodiment of any one of Formulas (IX-A) through (IX-AA), When present, each L ² is independently -OR ² . In another embodiment, each L ² is independently -C(=0)OR ² . In one embodiment, each R ² is independently straight C ₇ -C ₁₁ alkyl.

In one embodiment, R ³ is unsubstituted.

In one embodiment, R ³ is C ₁ -C ₆ alkyl, halo, C ₁ -C ₆ haloalkyl, nitro, oxo, -OR ^g , -NR ^g C(=0)R ^h , -C(=0) NR ^g R ^h , -C(=O)R ^h , -OC(=O)R ^h , -C(=O)OR ^h and -OR ⁱ substituted with one or more substituents selected from the group consisting of -OH, wherein :

R ^g is independently at each occurrence H or C ₁ -C ₆ alkyl;

R ^h is independently at each occurrence C ₁ -C ₆ alkyl;

R ⁱ is independently at each occurrence C ₁ -C ₆ alkylene.

In one embodiment, R ³ is substituted with one or more C ₁ -C ₆ alkyl ( eg , methyl). In one embodiment, R ³ is substituted with one or more halo ( eg , -F). In one embodiment, R ³ is substituted with one or more C ₁ -C ₆ haloalkyl ( eg , -CF ₃ ). In one embodiment, R ³ is substituted with one or more hydroxyl. In one embodiment, R ³ is substituted with one hydroxyl.

In one embodiment, R ³ is substituted with one or more C ₃ -C ₈ cycloalkyl, C ₆ -C ₁₀ aryl, or 5- to 10-membered heteroaryl, each of which is optionally substituted. In one embodiment, R ³ is C 1 -C 6 alkyl substituted with one or more C ₃ -C ₈ cycloalkyl, C ₆ -C ₁₀ aryl, or _5- to ₁₀ -membered heteroaryl ( eg , methyl). , each of which is optionally substituted. In one embodiment, the C ₃ -C ₈ cycloalkyl, C ₆ -C ₁₀ aryl, or 5- to 10-membered heteroaryl is unsubstituted. In one embodiment, C ₃ -C ₈ cycloalkyl, C ₆ -C ₁₀ aryl, or 5- to 10-membered heteroaryl is one or more C ₁ -C ₆ alkyl, halo, C ₁ -C ₆ haloalkyl, nitro , hydroxy, or cyano.

In one embodiment, R ⁴ is C ₁ -C ₁₂ alkyl. In one embodiment, R ⁴ is C ₁ -C ₈ alkyl. In one embodiment, R ⁴ is C ₁ -C ₆ alkyl. In one embodiment, R ⁴ is C ₁ -C ₄ alkyl. In one embodiment, R ⁴ is methyl. In one embodiment, R ⁴ is ethyl. In one embodiment, R ⁴ is n-propyl. In one embodiment, R ⁴ is isopropyl. In one embodiment, R ⁴ is n-butyl. In one embodiment, R ⁴ is n-pentyl. In one embodiment, R ⁴ is n-hexyl. In one embodiment, R ⁴ is n-octyl. In one embodiment, R ⁴ is n-nonyl.

In one embodiment, R ⁴ is C ₃ -C ₈ cycloalkyl. In one embodiment, R ⁴ is cyclopropyl. In one embodiment, R ⁴ is cyclobutyl. In one embodiment, R ⁴ is cyclopentyl. In one embodiment, R ⁴ is cyclohexyl. In one embodiment, R ⁴ is cycloheptyl. In one embodiment, R ⁴ is cyclooctyl.

In one embodiment, R ⁴ is unsubstituted.

In one embodiment, R ⁴ is oxo, -OR ^g , -NR ^g C(=0)R ^h , -C(=0)NR ^g R ^h , -C(=0)R ^h , - OC(=0 )R ^h , -C(=0)OR ^h , -OR ⁱ -OH, and -N(R ¹⁰ )R ¹¹ , wherein:

R ^g is independently at each occurrence H or C ₁ -C ₆ alkyl;

R ^h is independently at each occurrence C ₁ -C ₆ alkyl;

R ⁱ is independently at each occurrence C ₁ -C ₆ alkylene;

R ¹⁰ is hydrogen or C ₁ -C ₆ alkyl;

R ¹¹ is C ₁ -C ₆ alkyl, C ₃ -C ₈ cycloalkyl, or C ₃ -C ₈ cycloalkenyl;

R ¹⁰ and R ¹¹ together with the nitrogen to which they are attached form a cyclic moiety;

R ¹¹ or the cyclic moiety is optionally substituted with one or more of hydroxy, oxo, -NH ₂ , -NH(C ₁ -C ₆ alkyl), or -N(C ₁ -C ₆ alkyl) ₂ .

In one embodiment, R ⁴ is substituted with one or more hydroxyl. In one embodiment, R ⁴ is substituted with one hydroxyl.

In one embodiment, R ⁴ is a substituted C ₁ -C ₁₂ alkyl. In one embodiment, R ⁴ is -(CH ₂ ) _p Q, -(CH ₂ ) _p CHQR, -CHQR, or -CQ(R) ₂ , wherein Q is C ₃ -C ₈ cycloalkyl, C ₃ - C ₈ cycloalkenyl, C ₃ -C ₈ cycloalkynyl, 4- to 8-membered heterocyclyl, C ₆ -C ₁₀ aryl, 5- to 10-membered heteroaryl, -OR, -O(CH ₂ ) _p N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -N(R) ₂ , -C(O)N (R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C( S)N(R) ₂ , -N(R)R ^{2 2} , -O(CH ₂ ) _p OR, -N(R)C(=NR ²³ )N(R) ₂ , -N(R)C(= CHR ²³ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ) ₂ R, -N(OR)C(O)OR, -N(OR)C(O)N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR) C(=NR 2 ³ )N(R) ₂ , -N(OR)C(=CHR ^{2 3} )N(R) ₂ , -C(=NR ^{2 3} )N(R) ₂ , -C(=NR ^{2 3} )R , -C(O)N(R)OR, or -C(R)N(R) ₂ C(O)OR, wherein each p is independently 1, 2, 3, 4, or 5;

R ²² is C ₃ -C ₈ cycloalkyl, C ₃ -C ₈ cycloalkenyl, C ₃ -C ₈ cycloalkynyl, 4- to 8-membered heterocyclyl, C ₆ -C ₁₀ aryl, or 5- to 8-membered heterocyclyl; 10-membered heteroaryl;

R ²³ is H, -CN, -NO ₂ , C ₁ -C ₆ alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C ₂ -C ₆ alkenyl; C ₃ -C ₈ cycloalkyl, C ₃ -C ₈ cycloalkenyl, C ₃ -C ₈ cycloalkynyl, 4- to 8-membered heterocyclyl, C ₆ -C ₁₀ aryl, or 5- to 10-membered heteroaryl;

each R is independently H, C ₁ -C ₃ alkyl, or C ₂ -C ₃ alkenyl; The two R in the N(R) ₂ moiety together with the nitrogen to which they are attached form a cyclic moiety;

Each X is independently F, CI, Br, or I.

In one embodiment, R ⁴ is —CH ₂ CH ₂ OH. In one embodiment, R ⁴ is —CH ₂ CH ₂ CH ₂ OH. In one embodiment, R ⁴ is —CH ₂ CH ₂ CH ₂ CH ₂ OH. In one embodiment, R ⁴ is —CH ₂ CH ₂ OCH ₂ CH ₂ OH.

In one embodiment, R ⁴ is substituted with one or more -N(R ¹⁰ )R ¹¹ . In one embodiment, R ⁴ is substituted with one -N(R ¹⁰ )R ¹¹ .

In one embodiment, R ¹⁰ is hydrogen.

In one embodiment, R ¹¹ is C ₃ -C ₈ cycloalkenyl. In one embodiment, R ¹¹ is cyclobutenyl. In one embodiment, R ¹¹ is substituted with one or more of oxo, -NH ₂ , -NH(C ₁ -C ₆ alkyl), or -N(C ₁ -C ₆ alkyl) ₂ .

In one embodiment, R ¹⁰ and R ¹¹ together with the nitrogen to which they are attached form a cyclic moiety. In one embodiment, the cyclic moiety is a 5- to 10-membered heteroaryl. In one embodiment, the cyclic moiety is pyrimidin-1-yl. In one embodiment, the cyclic moiety is purin-9-yl. In one embodiment, the cyclic moiety is substituted with one or more of oxo, -NH ₂ , -NH(C ₁ -C ₆ alkyl), or -N(C ₁ -C ₆ alkyl) ₂ .

In one embodiment, R ⁴ is

or

is replaced by In one embodiment, R ⁴ is is replaced by In one embodiment, R ⁴ is is replaced by

In one embodiment, R ¹ is straight C ₆ -C ₂₄ alkyl. In one embodiment, R ¹ is straight C ₇ -C ₁₅ alkyl. In one embodiment, R ¹ is straight C ₇ alkyl. In one embodiment, R ¹ is straight C ₈ alkyl. In one embodiment, R ¹ is straight C ₉ alkyl. In one embodiment, R ¹ is straight C ₁₀ alkyl. In one embodiment, R ¹ is straight C ₁₁ alkyl. In one embodiment, R ¹ is straight C ₁₂ alkyl. In one embodiment, R ¹ is straight C ₁₃ alkyl. In one embodiment, R ¹ is straight C ₁₄ alkyl. In one embodiment, R ¹ is straight C ₁₅ alkyl.

In one embodiment, R ¹ is straight C ₆ -C ₂₄ alkenyl. In one embodiment, R ¹ is straight C ₇ -C ₁₇ alkenyl. In one embodiment, R ¹ is straight C ₇ alkenyl. In one embodiment, R ¹ is straight C ₈ alkenyl. In one embodiment, R ¹ is straight C ₉ alkenyl. In one embodiment, R ¹ is straight C ₁₀ alkenyl. In one embodiment, R ¹ is straight C ₁₁ alkenyl. In one embodiment, R ¹ is straight C ₁₂ alkenyl. In one embodiment, R ¹ is straight C ₁₃ alkenyl. In one embodiment, R ¹ is straight C ₁₄ alkenyl. In one embodiment, R ¹ is straight C ₁₅ alkenyl. In one embodiment, R ¹ is straight C ₁₆ alkenyl. In one embodiment, R ¹ is straight C ₁₇ alkenyl.

In one embodiment, R ¹ is branched C ₆ -C ₂₄ alkyl. In one embodiment, R ¹ is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₅ alkylene, and R ⁸ and R ⁹ are independently C ₂ -C ₁₀ alkyl. am. In one embodiment, R ¹ is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₄ -C ₈ alkyl. am.

In one embodiment, R ¹ is branched C ₆ -C ₂₄ alkenyl. In one embodiment, R ¹ is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₅ alkylene, and R ⁸ and R ⁹ are independently C ₂ -C ₁₀ alkyl. it's kenyl In one embodiment, R ¹ is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₆ -C ₁₀ alkyl. it's kenyl

In one embodiment, R ² is straight C ₆ -C ₂₄ alkyl. In one embodiment, R ² is straight C ₇ -C ₁₅ alkyl. In one embodiment, R ² is straight C ₇ alkyl. In one embodiment, R ² is straight C ₈ alkyl. In one embodiment, R ² is straight C ₉ alkyl. In one embodiment, R ² is straight C ₁₀ alkyl. In one embodiment, R ² is straight C ₁₁ alkyl. In one embodiment, R ² is straight C ₁₂ alkyl. In one embodiment, R ² is straight C ₁₃ alkyl. In one embodiment, R ² is straight C ₁₄ alkyl. In one embodiment, R ² is straight C ₁₅ alkyl.

In one embodiment, R ² is straight C ₆ -C ₂₄ alkenyl. In one embodiment, R ² is straight C ₇ -C ₁₇ alkenyl. In one embodiment, R ² is straight C ₇ alkenyl. In one embodiment, R ² is straight C ₈ alkenyl. In one embodiment, R ² is straight C ₉ alkenyl. In one embodiment, R ² is straight C ₁₀ alkenyl. In one embodiment, R ² is straight C ₁₁ alkenyl. In one embodiment, R ² is straight C ₁₂ alkenyl. In one embodiment, R ² is straight C ₁₃ alkenyl. In one embodiment, R ² is straight C ₁₄ alkenyl. In one embodiment, R ² is straight C ₁₅ alkenyl. In one embodiment, R ² is straight C ₁₆ alkenyl. In one embodiment, R ² is straight C ₁₇ alkenyl.

In one embodiment, R ² is branched C ₆ -C ₂₄ alkyl. In one embodiment, R ² is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₅ alkylene, and R ⁸ and R ⁹ are independently C ₂ -C ₁₀ alkyl. am. In one embodiment, R ² is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₄ -C ₈ alkyl. am.

In one embodiment, R ² is branched C ₆ -C ₂₄ alkenyl. In one embodiment, R ² is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₅ alkylene, and R ⁸ and R ⁹ are independently C ₂ -C ₁₀ alkyl. it's kenyl In one embodiment, R ² is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₆ -C ₁₀ alkyl. it's kenyl

In one embodiment, R ^c is straight C ₆ -C ₂₄ alkyl. In one embodiment, R ^c is straight C ₇ -C ₁₅ alkyl. In one embodiment, R ^c is straight C ₇ alkyl. In one embodiment, R ^c is straight C ₈ alkyl. In one embodiment, R ^c is straight C ₉ alkyl. In one embodiment, R ^c is straight C ₁₀ alkyl. In one embodiment, R ^c is straight C ₁₁ alkyl. In one embodiment, R ^c is straight C ₁₂ alkyl. In one embodiment, R ^c is straight C ₁₃ alkyl. In one embodiment, R ^c is straight C ₁₄ alkyl. In one embodiment, R ^c is straight C ₁₅ alkyl.

In one embodiment, R ^c is linear C ₆ -C ₂₄ alkenyl. In one embodiment, R ^c is linear C ₇ -C ₁₇ alkenyl. In one embodiment, R ^c is straight C ₇ alkenyl. In one embodiment, R ^c is straight C ₈ alkenyl. In one embodiment, R ^c is straight C ₉ alkenyl. In one embodiment, R ^c is linear C ₁₀ alkenyl. In one embodiment, R ^c is straight C ₁₁ alkenyl. In one embodiment, R ^c is straight C ₁₂ alkenyl. In one embodiment, R ^c is straight C ₁₃ alkenyl. In one embodiment, R ^c is straight C ₁₄ alkenyl. In one embodiment, R ^c is linear C ₁₅ alkenyl. In one embodiment, R ^c is linear C ₁₆ alkenyl. In one embodiment, R ^c is straight C ₁₇ alkenyl.

In one embodiment, R ^c is branched C ₆ -C ₂₄ alkyl. In one embodiment, R ^c is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₅ alkylene, and R ⁸ and R ⁹ are independently C ₂ -C ₁₀ alkyl. am. In one embodiment, R ^c is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₄ -C ₈ alkyl. am.

In one embodiment, R ^c is branched C ₆ -C ₂₄ alkenyl. In one embodiment, R ^c is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₅ alkylene, and R ⁸ and R ⁹ are independently C ₂ -C ₁₀ alkyl. it's kenyl In one embodiment, R ^c is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₆ -C ₁₀ alkyl. it's kenyl

In one embodiment, R ^f is straight C ₆ -C ₂₄ alkyl. In one embodiment, R ^f is straight C ₇ -C ₁₅ alkyl. In one embodiment, R ^f is straight C ₇ alkyl. In one embodiment, R ^f is straight C ₈ alkyl. In one embodiment, R ^f is straight C ₉ alkyl. In one embodiment, R ^f is straight C ₁₀ alkyl. In one embodiment, R ^f is straight C ₁₁ alkyl. In one embodiment, R ^f is straight C ₁₂ alkyl. In one embodiment, R ^f is straight C ₁₃ alkyl. In one embodiment, R ^f is straight C ₁₄ alkyl. In one embodiment, R ^f is straight C ₁₅ alkyl.

In one embodiment, R ^f is linear C ₆ -C ₂₄ alkenyl. In one embodiment, R ^f is straight C ₇ -C ₁₇ alkenyl. In one embodiment, R ^f is straight C ₇ alkenyl. In one embodiment, R ^f is straight C ₈ alkenyl. In one embodiment, R ^f is straight C ₉ alkenyl. In one embodiment, R ^f is linear C ₁₀ alkenyl. In one embodiment, R ^f is straight C ₁₁ alkenyl. In one embodiment, R ^f is straight C ₁₂ alkenyl. In one embodiment, R ^f is straight C ₁₃ alkenyl. In one embodiment, R ^f is straight C ₁₄ alkenyl. In one embodiment, R ^f is linear C ₁₅ alkenyl. In one embodiment, R ^f is straight C ₁₆ alkenyl. In one embodiment, R ^f is straight C ₁₇ alkenyl.

In one embodiment, R ^f is branched C ₆ -C ₂₄ alkyl. In one embodiment, R ^f is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₅ alkylene, and R ⁸ and R ⁹ are independently C ₂ -C ₁₀ alkyl. am. In one embodiment, R ^f is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₄ -C ₈ alkyl. am.

In one embodiment, R ^f is branched C ₆ -C ₂₄ alkenyl. In one embodiment, R ^f is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₅ alkylene, and R ⁸ and R ⁹ are independently C ₂ -C ₁₀ alkyl. it's kenyl In one embodiment, R ^f is -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₆ -C ₁₀ alkyl. it's kenyl

In one embodiment, R ¹ , R ² , R ^c , and R ^f are each independently linear C ₆ -C ₁₈ alkyl, linear C ₆ -C ₁₈ alkenyl, or -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₅ alkylene, and R ⁸ and R ⁹ are independently C ₂ -C ₁₀ alkyl or C ₂ -C ₁₀ alkenyl.

In one embodiment, R ¹ , R ² , R ^c , and R ^f are each independently linear C ₇ -C ₁₅ alkyl, linear C ₇ -C ₁₅ alkenyl, or -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₄ -C ₈ alkyl or C ₆ -C ₁₀ alkenyl.

In one embodiment, R ¹ , R ² , R ^c , and R ^f are each independently one of the following structures:

In one embodiment, R ^a is H. In one embodiment, R ^d is H. In one embodiment, R ^a , R ^b , R ^d , and R ^e are each independently H. In one embodiment, R ^b is C ₁ -C ₂₄ alkyl. In one embodiment, R ^b is C ₁ -C ₁₂ alkyl. In one embodiment, R ^b is C ₂ -C ₂₄ alkenyl. In one embodiment, R ^b is C ₂ -C ₁₂ alkenyl. In one embodiment, R ^e is C ₁ -C ₂₄ alkyl. In one embodiment, R ^e is C ₁ -C ₁₂ alkyl. In one embodiment, R ^e is C ₂ -C ₂₄ alkenyl. In one embodiment, R ^e is C ₂ -C ₁₂ alkenyl.

In one embodiment, the compound is a compound in Table 1, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, the compound is a compound in Table 1A, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

In one embodiment, a compound of Formula (X):

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof is provided herein, wherein:

G ¹ is a bond, C ₂ -C ₁₂ alkylene, or C ₂ -C ₁₂ alkenylene;

Each L ¹ is independently -OC(=O)R ¹ , -C(=O)OR ¹ , -OC(=O)OR ¹ , -C(=O)R ¹ , -OR ¹ , -S(O ) _x R ¹ , -S-SR ¹ , -C(=O)SR ¹ , -SC(=O)R ¹ , -NR ^a C(=O)R ¹ , -C(=O)NR ^b R ^c , -NR ^a C(=O)NR ^b R ^c , -OC(=O)NR ^b R ^c , -NR ^a C(=O)OR ¹ , -SC(=S)R ¹ , -C(=S )SR ¹ , -C(=S)R ¹ , -CH(OH)R ¹ , -P(=O)(OR ^b )(OR ^c ), -(C ₆ -C ₁₀ arylene)-R ¹ , -(6- to 10-membered heteroarylene)-R ¹ , or R ¹ ;

R ¹ is C ₆ -C ₂₄ alkyl or C ₆ -C ₂₄ alkenyl;

R ^a and R ^b are each independently H, C ₁ -C ₁₂ alkyl, or C ₂ -C ₁₂ alkenyl;

R ^c is C ₁ -C ₂₄ alkyl or C ₂ -C ₂₄ alkenyl;

R ³ is hydrogen, C ₁ -C ₁₂ alkyl, C ₂ -C ₁₂ alkenyl, C ₂ -C ₁₂ alkynyl, C ₃ -C ₈ cycloalkyl, C ₃ -C ₈ cycloalkenyl, C ₃ -C ₈ cycloalkynyl, 4- to 8-membered heterocyclyl, C ₆ -C ₁₀ aryl, or 5- to 10-membered heteroaryl; The moiety of R ³ , G ¹ or G ¹ together with the nitrogen to which they are attached form a cyclic moiety;

x is 0, 1, or 2;

n is 1 or 2;

Z is -OH or halogen;

wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocycle The rylene, arylene, heteroarylene, and cyclic moieties are independently optionally substituted.

In one embodiment, Z is -OH. In one embodiment, Z is halogen. In one embodiment, Z is -Cl.

In one embodiment, a compound of formula (X) is an intermediate used in a process for preparing a compound of formula (I) , eg , as illustrated in the examples provided herein.

Any of the embodiments of the compounds provided herein, as set forth above, and other embodiments of the compounds, as set forth above, in which any specific substituents and/or variables in the compounds provided herein are used to form embodiments not specifically set forth above. and/or independent combinations of substituents and/or variables. Additionally, where a list of substituents and/or variables is recited for any particular group or variable, each individual substituent and/or variable may be excised from the particular embodiment and/or claim and the number of substituents and/or variables It is understood that the remainder of the list is to be considered within the scope of the embodiments provided herein.

In this description, it is understood that combinations of substituents and/or variables of depicted formulas are permissible only if such contributions result in stable compounds.

5.4 nanoparticle composition

In one aspect, described herein are nanoparticle compositions comprising a lipid compound described herein. In certain embodiments, nanoparticle compositions when described herein include compounds according to Formula (I) (and sub-formulas thereof).

In some embodiments, the largest dimension of a nanoparticle composition provided herein is 1 μm or less (e.g., as measured by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy, or another method ). For, ≤1 μm, ≤900 nm, ≤800 nm, ≤700 nm, ≤600 nm, ≤500 nm, ≤400 nm, ≤300 nm, ≤200 nm, ≤175 nm, ≤150 nm, ≤125 nm, ≤100 nm, ≤75 nm, ≤50 nm, or less). In one embodiment, lipid nanoparticles provided herein have at least one dimension ranging from about 40 to about 200 nm. In one embodiment, at least one dimension ranges from about 40 to about 100 nm.

Nanoparticle compositions that can be used in connection with the present disclosure include, for example, lipid nanoparticles (LNPs), nano lipoprotein particles, liposomes, lipid vesicles, and lipoplexes. In some embodiments, nanoparticle compositions are vesicles comprising one or more lipid bilayers. In some embodiments, nanoparticle compositions comprise two or more concentric bilayers separated by an aqueous compartment. Lipid bilayers can be functionalized and/or cross-linked with each other. A lipid bilayer may contain one or more ligands, proteins, or channels.

The characteristics of a nanoparticle composition can depend on its components. For example, a nanoparticle composition comprising cholesterol as a structural lipid may have different characteristics than a nanoparticle composition comprising a different structural lipid. Similarly, the characteristics of a nanoparticle composition may depend on the absolute or relative amounts of its components. For example, a nanoparticle composition comprising a higher mole fraction of phospholipids may have different characteristics than a nanoparticle composition comprising a lower mole fraction of phospholipids. Characteristics may also vary depending on the method and conditions of manufacture of the nanoparticle composition.

Nanoparticle compositions can be characterized in a variety of ways. For example, microscopy (eg, transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of nanoparticle compositions. Dynamic light scattering or potentiometry (eg, potentiometric titration) can be used to measure the zeta potential. Dynamic light scattering can also be utilized to determine particle size. An instrument such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, and Worcestershire, UK) can also be used to measure several characteristics of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

Dh (size): The average size of the nanoparticle composition can be in the order of 10 nm to 100 nm. For example, the average size is between about 40 nm and about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the nanoparticle composition has an average size of about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm. nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the nanoparticle composition may have an average size of about 70 nm to about 100 nm. In some embodiments, the average size may be about 80 nm. In other embodiments, the average size may be about 100 nm.

PDI: The nanoparticle composition can be relatively homogeneous. The polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, eg, the particle size distribution of a nanoparticle composition. A small (eg, less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The nanoparticle composition may have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be from about 0.10 to about 0.20.

Encapsulation Efficiency: The efficiency of encapsulation of a therapeutic and/or prophylactic agent describes the amount of therapeutic and/or prophylactic agent that is encapsulated or otherwise associated with a nanoparticle composition after manufacture, relative to the initial amount provided. The encapsulation efficiency is preferably high (eg close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and/or prophylactic agent in a solution containing the nanoparticle composition before and after dissolving the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and/or prophylactic (eg, RNA) in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of therapeutic and/or prophylactic agents is at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%. %, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, encapsulation efficiency can be at least 80%. In certain embodiments, encapsulation efficiency can be at least 90%.

Apparent pKa: The zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition. For example, zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low charges, positive or negative, are generally preferred, as higher charged species can interact undesirably with cells, tissues, and other elements in the body. In some embodiments, the nanoparticle composition has a zeta potential of about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV , about - 10 mV to about 0 mV, about - 10 mV to about - 5 mV, about - 5 mV to about + 20 mV, about - 5 mV to about + 15 mV, about - 5 mV to about + 10 mV, About - 5 mV to about + 5 mV, about - 5 mV to about 0 mV, about 0 mV to about + 20 mV, about 0 mV to about + 15 mV, about 0 mV to about + 10 mV, about 0 mV to It may be about + 5 mV, about + 5 mV to about + 20 mV, about + 5 mV to about + 15 mV, or about + 5 mV to about + 10 mV.

In another embodiment, self-replicating RNA can be formulated into liposomes. As a non-limiting example, self-replicating RNA can be formulated into liposomes as described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety. In one aspect, liposomes can include lipids with pKa values that can favor the delivery of mRNA. In another embodiment, the liposomes may have an essentially neutral surface charge at physiological pH and may therefore be effective for immunization (see, eg, the liposomes described in International Publication No. WO20120067378, incorporated herein by reference in its entirety). .

In some embodiments, nanoparticle compositions as described include a lipid component comprising at least one lipid, such as a compound according to one of Formula (I) (and sub-formulas thereof) when described herein. For example, in some embodiments, nanoparticle compositions can include a lipid component that includes one of the compounds provided herein. The nanoparticle composition may also include one or more other lipid or non-lipid components as described below.

In one embodiment, nanoparticle compositions comprising a compound provided herein and mRNA show improved expression levels of mRNA ( eg, compared to standard cationic lipid compounds known in the art, eg , MC3). In one embodiment, after administration of a nanoparticle composition comprising a compound provided herein to a subject, the compound exhibits rapid tissue clearance (eg, liver clearance).

5.4.1 Cationic/ionizable lipids

As described herein, in some embodiments, nanoparticle compositions provided herein include one or more charged or ionizable lipids in addition to a lipid according to Formula (I) (and sub-formulas thereof). Without wishing to be bound by theory, it is contemplated that certain charged or zwitterionic lipid components of nanoparticle compositions may mimic lipid components in cell membranes and thereby improve cellular uptake of nanoparticles. Exemplary charged or ionizable lipids that may form part of the present nanoparticle composition include, but are not limited to, 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10) , N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethaneamine (KL22), 14,25-ditridecyl-15,18,21 ,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1 ,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-Dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane ( DODMA), 2-({8-[(3β)-Cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3[(9Z,12Z)-octadeca-9, 12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholester-5-en-3-yloxy]octyl}oxy )-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2R)), (2S)-2 -({8-[(3β)-Cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z-,12Z)-octadeca-9,12- Dien-1-yloxy]propan-1-amine (octyl-CLinDMA (2S)), (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa 12,15-den-1-amine, N, N-dimethyl-1-{(1S,2R)-2-octylcyclopropyl}heptadecan-8-amine. Additional exemplary charged or ionizable lipids that may form part of the present nanoparticle compositions are described in Sabnis et al., incorporated herein by reference in its entirety. "A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates", Molecular Therapy Vol. 26, 6 Nov. 2018 (e.g. lipid 5).

In some embodiments, a suitable cationic lipid is N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA); N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP); 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC); 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (DLEPC); 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC); 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14:1); N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamido)ethyl]-3,4-di[ oleyloxy]-benzamide (MVL5); dioctadecylamido-glycylspermine (DOGS); 3b-[N-(N',N'-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol); dioctadecyldimethylammonium bromide (DDAB); SAINT-2, N-methyl-4-(dioleyl)methylpyridinium; 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE); 1,2-dioleoyl-3-dimethyl-hydroxyethyl ammonium bromide (DORIE); 1,2-dioleoyloxypropyl-3-dimethylhydroxyethyl ammonium chloride (DORI); di-alkylated amino acids (DILA ² ) ( eg, C18:1-norArg-C16); dioleyldimethylammonium chloride (DODAC); 1-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (POEPC); 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (MOEPC); (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl); (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G); and (R)-N,N,N-trimethyl-4,5-bis(oleoyloxy)pentane-1-aminium chloride (DOTAPen). cationic lipids with a head group that is charged at physiological pH, such as primary amines ( eg, DODAG N',N'-dioctadecyl-N-4,8-diaza-10-aminodecanoylglycine amide) and Guanidinium head groups ( e.g., bis-guanidinium-spermidine-cholesterol (BGSC), bis-guanidinium threne-cholesterol (BGTC), PONA, and (R)-5-guanidinopentane -1,2-diyl dioleate hydrochloride (DOPen-G)) is also suitable. Yet another suitable cationic lipid is (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl). In certain embodiments, cationic lipids are in particular enantiomeric or racemic forms, and as above include the various salt forms ( eg, chloride or sulfate) of cationic lipids. For example, in some embodiments, the cationic lipid is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-Cl) or N-[1 -(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium sulfate (DOTAP-sulfate). In some embodiments, the cationic lipid is an ionizable cationic lipid such as, for example, dioctadecyldimethylammonium bromide (DDAB); 1,2-Dilinoleyloxy-3-dimethylaminopropane (DLinDMA); 2,2-Dilinoleyl-4-(2dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA); heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA); 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP); 1,2-dioleyloxy-3-dimethylaminopropane (DODMA); and morpholinocholesterol (Mo-CHOL). In certain embodiments, a lipid nanoparticle comprises a combination or two or more cationic lipids ( eg, two or more cationic lipids as above).

Additionally, in some embodiments, the charged or ionizable lipids that may form part of the present nanoparticle compositions are lipids comprising cyclic amine groups. Additional cationic lipids suitable for the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of which are hereby incorporated by reference in their entirety.

5.4.2 polymer conjugated lipids

In some embodiments, the lipid component of a nanoparticle composition may include one or more polymer conjugated lipids, such as PEGylated lipids (PEG lipids). Without wishing to be bound by theory, it is contemplated that polymer conjugated lipid components in nanoparticle compositions may improve colloidal stability and/or reduce protein uptake of nanoparticles. Exemplary polymer conjugated lipids that may be used in connection with the present disclosure include, but are not limited to, PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacyl glycerol, PEG-modified dialkylglycerols, and mixtures thereof. For example, the PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, Ceramide-PEG2000, or Chol-PEG2000.

In one embodiment, the polymer conjugated lipid is a pegylated lipid. For example, some embodiments use pegylated diacylglycerols (PEG-DAG) such as 1-(monomethoxy-polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-DMG), pegylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy( polyethoxy)ethyl)butanedioate (PEG-S-DMG), pegylated ceramide (PEG-cer), or PEG dialkoxypropylcarbamate such as ω-methoxy(polyethoxy)ethyl-N-(2, 3-di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyl-N-(ω-methoxy(polyethoxy)ethyl)carbamate.

In one embodiment, the polymer conjugated lipid is present in a concentration ranging from 1.0 to 2.5 mole percent. In one embodiment, the polymer conjugated lipid is present at a concentration of about 1.7 mole percent. In one embodiment, the polymer conjugated lipid is present at a concentration of about 1.5 mole percent.

In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 35:1 to about 25:1. In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 100:1 to about 20:1.

In one embodiment, the pegylated lipid has the formula:

or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein:

R ¹² and R ¹³ are each independently a straight or branched, saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds;

w has an average value ranging from 30 to 60.

In one embodiment, R ¹² and R ¹³ are each independently a straight, saturated alkyl chain containing 12 to 16 carbon atoms. In other embodiments, the average w ranges from 42 to 55, for example, the average w is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55. In some specific embodiments, the average w is about 49.

In one embodiment, the pegylated lipid has the formula:

The average w is about 49.

5.4.3 structural lipids

In some embodiments, the lipid component of a nanoparticle composition may include one or more structural lipids. Without wishing to be bound by theory, it is contemplated that the structural lipids can stabilize the amphiphilic structure of the nanoparticle, including but not limited to the lipid bilayer structure of the nanoparticle. Exemplary structural lipids that may be used in connection with the present disclosure include, but are not limited to, cholesterol, pechosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, thomasidine, thomastine, ursolic acid, alpha-tocopherol , and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid comprises cholesterol and a corticosteroid (such as prednisolone, dexamethasone, prednisone, and hydrocortisone), or a combination thereof.

In one embodiment, a lipid nanoparticle provided herein comprises a steroid or steroid analog. In one embodiment, the steroid or steroid analog is cholesterol. In one embodiment, the steroid is present in a concentration ranging from 39 to 49 mole percent, 40 to 46 mole percent, 40 to 44 mole percent, 40 to 42 mole percent, 42 to 44 mole percent, or 44 to 46 mole percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45, or 46 mole percent.

In one embodiment, the molar ratio of cationic lipid to steroid ranges from 1.0:0.9 to 1.0:1.2, or from 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to steroid ranges from about 5:1 to 1:1. In one embodiment, the steroid is present in a concentration ranging from 32 to 40 mole percent of the steroid.

5.4.4 Phospholipids

In some embodiments, the lipid component of the nanoparticle composition comprises one or more phospholipids, such as one or more (poly)unsaturated lipids. Without wishing to be bound by theory, it is contemplated that phospholipids can assemble into one or more lipid bilayer structures. Exemplary phospholipids that may form part of the present nanoparticle composition include, but are not limited to, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn -glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero -Phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC ), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2 -Di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phospho Forcholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2 -Diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero -3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3- Phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2 -Didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin. In certain embodiments, nanoparticle compositions include DSPC. In certain embodiments, nanoparticle compositions include DOPE. In some embodiments, nanoparticle compositions include both DSPC and DOPE.

Additional exemplary neutral lipids include, for example, dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)- Cyclohexane-1carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O -monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearyoyl-2-oleoylphosphatidiethanol amine (SOPE), and 1,2-dielaidoyl-sn- glycero-3-phosphoethanolamine (transDOPE). In one embodiment, the neutral lipid is 1,2-distearoyl-sn-glycero-3phosphocholine (DSPC). In one embodiment, the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.

In one embodiment, the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE) phosphatidylserine (PS), phosphatidic acid (PA), or phosphatidylglycerol (PG).

Phospholipids that may additionally form part of this nanoparticle composition also include those described in WO2017/112865, the entire contents of which are hereby incorporated by reference in their entirety.

5.4.5 therapeutic payload

In the present disclosure, nanoparticle compositions may further include one or more therapeutic and/or prophylactic agents when described herein. These therapeutic and/or prophylactic agents are sometimes referred to as "therapeutic payloads" or "payloads" in this disclosure. In some embodiments, therapeutic payloads can be administered in vivo or in vitro using nanoparticles as delivery vehicles.

In some embodiments, the nanoparticle composition, as a therapeutic payload, is a small molecule compound ( e.g., a small molecule drug) such as an antineoplastic agent ( e.g., vincristine, doxorubicin, mitoxantrone, camptothecin , cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), antitumor agents (e.g., actinomycin D, vincristine, vinblastine, cytosine arabinosides, anthracyclines, alkylating agents, platinum compounds, antimetabolites, and nucleoside analogues such as methotrexate and purine and pyrimidine analogues), anti-infective agents, local anesthetics (eg dibucaine and chlorpromazine), beta-adrenergic blockers (eg propranolol, timolol, and labetalol), antihypertensive agents (e.g. clonidine and hydralazine), antidepressants (e.g. imipramine, amitriptyline, and doxepin), anticonvulsants (e.g. , phenytoin), antihistamines (e.g., diphenhydramine, chlorpheniramine, and promethazine), antibiotics/antimycotics (e.g., gentamicin, ciprofloxacin, and cefoxitin), antifungals (e.g., myco Nazol, terconazole, econazole, isoconazole, butaconazole, clotrimazole, itraconazole, nystatin, naphtipine, and amphotericin B), anthelmintic agents, hormones, hormone antagonists, immunomodulators, neurotransmitters antagonists, anti-glaucoma agents, vitamins, anesthetics, and imaging agents.

In some embodiments, the therapeutic payload comprises a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, a compound that induces an immune response, and/or another therapeutic and/or prophylactic agent. A cytotoxin or cytotoxic agent includes any agent that can be detrimental to cells. Examples include, but are not limited to, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin , dihydroxyanthracindione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids such as , maytansinol, rahelmycin (CC-1065), and analogs or homologs thereof. Radioactive ions include, but are not limited to, iodine (eg, iodine 125 or iodine 131), strontium 89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium 90, samarium 153, and praseodymium.

In another embodiment, the therapeutic payload of the present nanoparticle composition comprises, but is not limited to, a therapeutic and/or prophylactic agent such as an antimetabolite (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (e.g. mechlorethamine, thiotepa chlorambucil, rahelmycin (CC-1065), melphalan, carmustine (BSNU), lomustine (CCNU) ), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly of daunomycin), and doxorubicin), antibiotics (e.g. dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and antimitotic agents (e.g. , vincristine, vinblastine, taxol and maytansinoids).

In some embodiments, nanoparticle compositions, as therapeutic payloads, include biological molecules such as peptides and polypeptides. Biological molecules that form part of the present nanoparticle composition may be of either natural or synthetic origin. For example, in some embodiments, the therapeutic payload of the present nanoparticle compositions includes, but is not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte-colony stimulating factor (G-CSF), Granulocyte-macrophage colony stimulating factor (GM-CSF), factor VIR, luteinizing hormone-releasing hormone (LHRH) analogues, interferon, heparin, hepatitis B surface antigen, typhoid vaccine, cholera vaccine, and peptides and polypeptides. can

5.4.5.1 nucleic acid

In some embodiments, the nanoparticle composition comprises one or more nucleic acid molecules ( eg, DNA or RNA molecules) as a therapeutic payload. Exemplary forms of nucleic acid molecules that can be included in the present nanoparticle compositions as a therapeutic payload include, but are not limited to, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), including messenger mRNA (mRNA), hybrids thereof, RNAi-inducing agents, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA inducing triple helix formation, aptamers, vectors, and the like. In certain embodiments, the therapeutic payload comprises RNA. RNA molecules that can be included in the present nanoparticle composition as a therapeutic payload include, but are not limited to, shortmers, agomirs, antagomirs, antisense, ribozymes, small interfering RNA (siRNA) , asymmetric interfering RNA (aiRNA), microRNA (miRNA), dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and other forms known in the art. Contains RNA molecules. In certain embodiments, RNA is mRNA.

In other embodiments, nanoparticle compositions include siRNA molecules as therapeutic payloads. In particular, in some embodiments, siRNA molecules can selectively disrupt and downregulate the expression of a gene of interest. For example, in some embodiments, a siRNA payload selectively silences a gene associated with a particular disease, disorder, or condition upon administration of a nanoparticle composition comprising the siRNA to a subject in need thereof. In some embodiments, a siRNA molecule comprises a sequence complementary to an mRNA sequence encoding a protein product of interest. In some embodiments, the siRNA molecule is an immunomodulatory siRNA.

In some embodiments, nanoparticle compositions comprise shRNA molecules or vectors encoding shRNA molecules as a therapeutic payload. In particular, in some embodiments, the therapeutic payload, upon administration to the target cell, produces the shRNA inside the target cell. Constructs and mechanisms involving shRNAs are well known in the art.

In some embodiments, nanoparticle compositions include mRNA molecules as therapeutic payloads. In particular, in some embodiments, an mRNA molecule encodes a polypeptide of interest, including any naturally or non-naturally occurring or otherwise modified polypeptide. A polypeptide encoded by mRNA can be of any size and can have any secondary structure or activity. In some embodiments, a polypeptide encoded by an mRNA payload may have a therapeutic effect when expressed in a cell.

In some embodiments, nucleic acid molecules of the present disclosure include mRNA molecules. In certain embodiments, a nucleic acid molecule comprises at least one coding region ( eg, an open reading frame (ORF)) that encodes a peptide or polypeptide of interest. In some embodiments, the nucleic acid molecule further comprises at least one untranslated region (UTR). In certain embodiments, the untranslated region (UTR) is located upstream (relative to the 5'-end) of the coding region and is referred to herein as the 5'-UTR. In certain embodiments, an untranslated region (UTR) is located downstream (relative to the 3'-end) of a coding region and is referred to herein as the 3'-UTR. In certain embodiments, a nucleic acid molecule comprises both a 5'-UTR and a 3'-UTR. In some embodiments, a 5'-UTR includes a 5'-cap structure. In some embodiments, the nucleic acid molecule comprises a Kozak sequence ( eg, in the 5′-UTR). In some embodiments, the nucleic acid molecule comprises a poly-A region ( eg, in the 3′-UTR). In some embodiments, the nucleic acid molecule comprises a polyadenylation signal ( eg, in the 3'-UTR). In some embodiments, a nucleic acid molecule comprises a stabilizing region ( eg, in the 3′-UTR). In some embodiments, nucleic acid molecules include secondary structures. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-loop sequence ( eg, in the 5'-UTR and/or 3'-UTR). In some embodiments, a nucleic acid molecule comprises one or more intronic regions that can be excised during splicing. In certain embodiments, a nucleic acid molecule comprises one or more regions selected from a 5'-UTR, and a coding region. In certain embodiments, a nucleic acid molecule comprises one or more regions selected from a coding region and a 3'-UTR. In certain embodiments, a nucleic acid molecule comprises one or more regions selected from a 5'-UTR, a coding region, and a 3'-UTR.

coding area

In some embodiments, a nucleic acid molecule of the present disclosure comprises at least one coding region. In some embodiments, a coding region is an open reading frame (ORF) that encodes for a single peptide or protein. In some embodiments, a coding region comprises at least two ORFs, each encoding a peptide or protein. In those embodiments in which the coding region comprises more than one ORF, the encoded peptides and/or proteins may be the same or different from each other. In some embodiments, multiple ORFs in a coding region are separated by non-coding sequences. In certain embodiments, the non-coding sequence separating the two ORFs includes an internal ribosome entry site (IRES).

Without wishing to be bound by theory, it is contemplated that an internal ribosome entry site (IRES) may serve as the sole ribosome binding site, or may serve as one of several ribosome binding sites on mRNA. An mRNA molecule containing more than one functional ribosome binding site may encode several peptides or polypeptides that are independently translated by ribosomes ( eg, multicistronic mRNA). Thus, in some embodiments, a nucleic acid molecule ( eg, mRNA) of the present disclosure comprises one or more internal ribosome entry sites (IRES). Examples of IRES sequences that may be used in connection with the present disclosure include, without limitation, picomavirus (eg, FMDV), plague virus (CFFV), polio virus (PV), encephalomyocarditis virus (ECMV), foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), classic swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (SIV) or cricket paralysis virus (CrPV).

In various embodiments, the nucleic acid molecules of this disclos encode for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 peptides or proteins. Peptides and proteins encoded by nucleic acid molecules may be the same or different. In some embodiments, a nucleic acid molecule of the present disclosure encodes a dipeptide ( eg , chamosin and anserine). In some embodiments, the nucleic acid molecule encodes a tripeptide. In some embodiments, a nucleic acid molecule encodes a tetrapeptide. In some embodiments, the nucleic acid molecule encodes a pentapeptide. In some embodiments, a nucleic acid molecule encodes a hexapeptide. In some embodiments, the nucleic acid molecule encodes a heptapeptide. In some embodiments, the nucleic acid molecule encodes an octapeptide. In some embodiments, the nucleic acid molecule encodes a nonapeptide. In some embodiments, the nucleic acid molecule encodes a decapeptide. In some embodiments, a nucleic acid molecule encodes a peptide or polypeptide having at least about 15 amino acids. In some embodiments, a nucleic acid molecule encodes a peptide or polypeptide having at least about 50 amino acids. In some embodiments, a nucleic acid molecule encodes a peptide or polypeptide having at least about 100 amino acids. In some embodiments, a nucleic acid molecule encodes a peptide or polypeptide having at least about 150 amino acids. In some embodiments, a nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, a nucleic acid molecule encodes a peptide or polypeptide having at least about 500 amino acids. In some embodiments, a nucleic acid molecule encodes a peptide or polypeptide having at least about 1000 amino acids.

In some embodiments, a nucleic acid molecule of the present disclosure is at least about 30 nucleotides (nt) in length. In some embodiments, the nucleic acid molecule is at least about 35 nt in length. In some embodiments, the nucleic acid molecule is at least about 40 nt in length. In some embodiments, the nucleic acid molecule is at least about 45 nt in length. In some embodiments, the nucleic acid molecule is at least about 50 nt in length. In some embodiments, the nucleic acid molecule is at least about 55 nt in length. In some embodiments, the nucleic acid molecule is at least about 60 nt in length. In some embodiments, the nucleic acid molecule is at least about 65 nt in length. In some embodiments, the nucleic acid molecule is at least about 70 nt in length. In some embodiments, the nucleic acid molecule is at least about 75 nt in length. In some embodiments, the nucleic acid molecule is at least about 80 nt in length. In some embodiments, the nucleic acid molecule is at least about 85 nt in length. In some embodiments, the nucleic acid molecule is at least about 90 nt in length. In some embodiments, the nucleic acid molecule is at least about 95 nt in length. In some embodiments, the nucleic acid molecule is at least about 100 nt in length. In some embodiments, the nucleic acid molecule is at least about 120 nt in length. In some embodiments, the nucleic acid molecule is at least about 140 nt in length. In some embodiments, the nucleic acid molecule is at least about 160 nt in length. In some embodiments, the nucleic acid molecule is at least about 180 nt in length. In some embodiments, the nucleic acid molecule is at least about 200 nt in length. In some embodiments, the nucleic acid molecule is at least about 250 nt in length. In some embodiments, the nucleic acid molecule is at least about 300 nt in length. In some embodiments, the nucleic acid molecule is at least about 400 nt in length. In some embodiments, the nucleic acid molecule is at least about 500 nt in length. In some embodiments, the nucleic acid molecule is at least about 600 nt in length. In some embodiments, the nucleic acid molecule is at least about 700 nt in length. In some embodiments, the nucleic acid molecule is at least about 800 nt in length. In some embodiments, the nucleic acid molecule is at least about 900 nt in length. In some embodiments, the nucleic acid molecule is at least about 1000 nt in length. In some embodiments, the nucleic acid molecule is at least about 1100 nt in length. In some embodiments, the nucleic acid molecule is at least about 1200 nt in length. In some embodiments, the nucleic acid molecule is at least about 1300 nt in length. In some embodiments, the nucleic acid molecule is at least about 1400 nt in length. In some embodiments, the nucleic acid molecule is at least about 1500 nt in length. In some embodiments, the nucleic acid molecule is at least about 1600 nt in length. In some embodiments, the nucleic acid molecule is at least about 1700 nt in length. In some embodiments, the nucleic acid molecule is at least about 1800 nt in length. In some embodiments, the nucleic acid molecule is at least about 1900 nt in length. In some embodiments, the nucleic acid molecule is at least about 2000 nt in length. In some embodiments, the nucleic acid molecule is at least about 2500 nt in length. In some embodiments, the nucleic acid molecule is at least about 3000 nt in length. In some embodiments, the nucleic acid molecule is at least about 3500 nt in length. In some embodiments, the nucleic acid molecule is at least about 4000 nt in length. In some embodiments, the nucleic acid molecule is at least about 4500 nt in length. In some embodiments, the nucleic acid molecule is at least about 5000 nt in length.

In certain embodiments, a therapeutic payload comprises a vaccine composition ( eg, a genetic vaccine) as described herein. In some embodiments, a therapeutic payload comprises a compound capable of eliciting immunity against one or more target conditions or diseases. In some embodiments, the target condition is infection by a pathogen, such as coronavirus ( eg 2019-nCoV), influenza, measles, human papillomavirus (HPV), rabies, meningitis, pertussis, tetanus, plague, hepatitis, and tuberculosis related to or caused by the above. In some embodiments, a therapeutic payload comprises a nucleic acid sequence ( eg, mRNA) encoding a pathogenic protein characteristic for the pathogen, or an antigenic fragment or epitope thereof. A vaccine, when administered to a vaccinated subject, allows expression of the encoded pathogenic protein (or antigenic fragment or epitope thereof), thereby attracting immunity in the subject against the pathogen.

In some embodiments, the target condition is related to or caused by neoplastic growth of cells, such as cancer. In some embodiments, a therapeutic payload comprises a nucleic acid sequence ( eg, mRNA) encoding a tumor-associated antigen (TAA) characteristic for cancer, or an antigenic fragment or epitope thereof. When administered to a vaccinated subject, the vaccine allows expression of the encoded TAA (or antigenic fragment or epitope thereof), thereby attracting immunity in the subject against neoplastic cells that express the TAA.

5'-cap structure

Without wishing to be bound by theory, it is believed that the 5′-cap structure of the polynucleotide is involved in nuclear export and increasing polynucleotide stability and binds the mRNA cap binding protein (CBP), which binds poly-A to form a mature cyclic mRNA species. It is considered that the association of proteins with CBP is responsible for translational capacity and polynucleotide stability in cells. The 5'-cap structure further assists in the removal of 5'-proximal intronic removal during mRNA splicing. Thus, in some embodiments, nucleic acid molecules of the present disclosure include a 5'-cap structure.

Nucleic acid molecules can be 5'-end capped by the cell's endogenous transcriptional machinery to create a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue and the 5'-end transcribed sense nucleotide of the polynucleotide. can This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate moiety. The ribose sugars of transcribed nucleotides at the terminal and/or non-terminal of the 5' end of the polynucleotide may optionally also be 2'-O-methylated. 5'-decapping through hydrolysis and cleavage of the guanylate cap structure can target nucleic acid molecules, such as mRNA molecules, for degradation.

In some embodiments, a nucleic acid molecule of the present disclosure comprises one or more alterations to the natural 5'-cap structure produced by endogenous processes. Without being bound by theory, modifications at the 5'-cap may increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and increase polynucleotide translational efficiency.

Exemplary alterations to the native 5'-cap structure include the creation of a non-hydrolyzable cap structure that prevents decapping and thus increases polynucleotide half-life. In some embodiments, since hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphorodiester linkage, in some embodiments, modified nucleotides can be used during the capping reaction. For example, in some embodiments, the Vaccinia Capping Enzyme from New England Biolabs (Ipswich, Mass.) is used according to manufacturer's instructions to create a phosphorothioate linkage in the 5'-ppp-5' cap of α-thio- Can be used with guanosine nucleotides. Additional modified guanosine nucleotides such as α-methyl-phosphonate and seleno-phosphate nucleotides may be used.

Additional exemplary alterations to the native 5'-cap structure are also modifications at the 2'- and/or 3'-positions of the capped guanosine triphosphate (GTP), modification of sugar ring oxygens (which produced carbocyclic rings), replacement with a methylene moiety (CH ₂ ), modification at the triphosphate bridge moiety of the cap structure, or modification at the nucleobase (G) moiety.

Additional exemplary alterations to the native 5'-cap structure include, but are not limited to, ribose of the 5'-terminal and/or 5'-terminal nucleotide of the polynucleotide (as noted above) at the 2'-hydroxy group of the sugar. 2'-O-methylation of sugars. Several distinct 5'-cap structures can be used to create the 5'-cap of a polynucleotide, such as an mRNA molecule. Additional exemplary 5'-cap structures that may be used in connection with the present disclosure further include those described in International Patent Publication Nos. WO2008127688, WO 2008016473, and WO 2011015347, the entire contents of each of which are incorporated herein by reference. include

In various embodiments, the 5'-end cap may include a cap analog. Cap analogs, also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, retain cap function while retaining a natural ( i.e. , endogenous, wild-type, or physiological) 5 '- is different from the cap. Cap analogs can be chemically ( ie , non-enzymatically) or enzymatically synthesized/linked to polynucleotides.

For example, an anti-reverse cap analog (ARCA) cap contains two guanosines bound by a 5'-5'-triphosphate group, where one guanosine is a N7-methyl group as well as a 3'-O-methyl group ( i.e. , N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m ⁷ G-3'mppp-G, which is equivalent to 3' O-Me-m7G(5 ')ppp(5')G). The other, unaltered, 3'-O atom of guanosine is linked to the 5'-terminal nucleotide of the capped polynucleotide ( eg, mRNA). N7- and 3'-O-methylated guanosines provide terminal moieties of capped polynucleotides ( eg, mRNA). Another exemplary cap structure is mCAP, which is similar to ARCA but contains guanosine ( i.e. , N7,2′-O-dimethyl-guanosine-5′-triphosphate-5′-guanosine, m ₇ Gm-ppp- G) has a 2'-O-methyl group.

In some embodiments, a cap analog can be a dinucleotide cap analog. As a non-limiting example, a dinucleotide cap analog may have a boranophosphate group or a phosphoroselenoate group at different phosphate positions, such as the dinucleotides described in U.S. Patent No.: 8,519,110, the entire contents of which are incorporated herein by reference in their entirety. Can be transformed into cap analogues.

In some embodiments, the cap analog can be an N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and/or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analogues are N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4- chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analogues ( e.g., various cap analogues and caps described in Kore et al . Bioorganic & Medicinal Chemistry 2013 21:4570-4574) Methods for the synthesis of analogs, see; the entire contents of which are incorporated herein by reference). In another embodiment, a cap analog useful in connection with the nucleic acid molecules of the present disclosure is a 4-chloro/bromophenoxyethyl analog.

In various embodiments, cap analogs can include guanosine analogs. Useful guanosine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA- guanosine, and 2-azido-guanosine.

Without wishing to be bound by theory, it is contemplated that while cap analogues allow concomitant capping of polynucleotides in in vitro transcription reactions, up to 20% of transcripts remain uncapped. This, as well as the structural differences of the cap analog from the natural 5'-cap structure of the polynucleotide produced by the cell's endogenous transcriptional machinery, can lead to reduced translational capacity and reduced cellular stability.

Thus, in some embodiments, nucleic acid molecules of the present disclosure may also be capped post-translational, using enzymes, to create a more authentic 5'-cap structure. As used herein, the phrase “more authentic” refers to a property that closely mirrors or mimics, either structurally or functionally, an endogenous or wild-type property. That is, a "more authentic" property is more representative of an endogenous, wild-type, native or physiological cellular function, and/or structure when compared to a synthetic property or analog of the prior art, or which in one or more respects corresponds to a corresponding endogenous property. , surpasses wild-type, natural, or physiological properties. Non-limiting examples of more authentic 5'-cap structures useful in connection with the nucleic acid molecules of the present disclosure include, among other things, synthetic 5'-cap structures known in the art (or wild-type, natural or physiological 5'-cap structures). structure), those with improved binding of the cap binding protein, increased half-life, reduced sensitivity to 5'-endonucleases, and/or reduced 5'-decapping. For example, in some embodiments, the recombinant vaccinia virus capping enzyme and the recombinant 2'-O-methyltransferase enzyme convert a regular 5'-5'-triphosphate between the 5'-terminal nucleotide of the polynucleotide and the guanosine cap nucleotide. Linkages can be created wherein the cap guanosine contains N7-methylation and the 5'-terminal nucleotide of the polynucleotide contains 2'-O-methyl. Such a structure is termed the Cap1 structure. This cap results in higher translational-capacity, cellular stability, and reduced activation of cellular pro-inflammatory cytokines , for example , when compared to other 5' cap analog structures known in the art. . Other exemplary cap structures include 7mG(5′)ppp(5′)N,pN2p (cap 0), 7mG(5′)ppp(5′)NlmpNp (cap 1), 7mG(5′)-ppp(5′). )NlmpN2mp (cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (cap 4) include

Without wishing to be bound by theory, it is contemplated that since nucleic acid molecules of the present disclosure can be capped post-transcription, and this process is more efficient, nearly 100% of nucleic acid molecules can be capped.

Untranslated region (UTR)

In some embodiments, a nucleic acid molecule of the present disclosure comprises one or more untranslated regions (UTRs). In some embodiments, a UTR is located upstream to a coding region in a nucleic acid molecule and is termed a 5'-UTR. In some embodiments, a UTR is located downstream of a coding region in a nucleic acid molecule and is termed a 3'-UTR. The sequence of a UTR can be homologous or heterologous to the sequence of a coding region found in a nucleic acid molecule. Several UTRs may be included in a nucleic acid molecule and may be of the same or different sequences, and/or genetic origin. For purposes of this disclosure, any portion (including none) of UTRs in a nucleic acid molecule may be codon optimized and any may independently contain one or more different structural or chemical modifications, before and/or after codon optimization.

In some embodiments, a nucleic acid molecule ( eg, mRNA) of the present disclosure comprises a UTR and a coding region that are homologous to each other. In another embodiment, a nucleic acid molecule ( eg, mRNA) of the present disclosure comprises a UTR and a coding region that are heterologous to each other. In some embodiments, to monitor the activity of a UTR sequence, a nucleic acid molecule comprising the UTR and coding sequence of a detectable probe is prepared in vitro ( eg, in cell or tissue culture) or in vivo ( eg, in a subject ), and the effect of the UTR sequence ( eg, modulation on expression levels, cellular localization of an encoded product, or half-life of an encoded product) can be measured using methods known in the art. .

In some embodiments, a UTR of a nucleic acid molecule ( eg, mRNA) of the present disclosure includes at least one translational enhancer element (TEE) that functions to increase the amount of a polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the TEE is located in the 5'-UTR of a nucleic acid molecule. In another embodiment, the TEE is located in the 3'-UTR of a nucleic acid molecule. In still other embodiments, at least two TEEs are located in the 5'-UTR and 3'-UTR, respectively, of the nucleic acid molecule. In some embodiments, a nucleic acid molecule ( eg, mRNA) of the present disclosure may include one or more copies of a TEE sequence or may include more than one different TEE sequence. In some embodiments, different TEE sequences present in a nucleic acid molecule of the present disclosure may be homologous or heterologous to each other.

A variety of TEE sequences that are known in the art and can be used in connection with the present disclosure. For example, in some embodiments, a TEE can be an internal ribosome entry site (IRES), HCV-IRES or IRES element. Chappell et al. Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004; Zhou et al . Proc. Natl. Acad. Sci. Chem. and International Patent Publication Nos. WO2007/025008 and International Patent Publication Nos. WO2001/055369, the contents of each of which are incorporated herein by reference in their entirety. In some embodiments, TEEs are described in Wellensiek et al. Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods , 2013 Aug; 10(8): 747-750 in Supplementary Table 1 and in Supplementary Table 2; The contents of which are incorporated by reference in their entirety.

Additional exemplary TEEs that may be used in connection with the present disclosure include, but are not limited to, U.S. Patent No. 6,310,197, U.S. Patent No. 6,849,405, U.S. Patent No. 7,456,273, U.S. Patent No. 7,183,395, U.S. Patent Publication No. 2009/0226470, U.S. Patent Publication No. 2013/0177581, US Patent Publication No. 2007/0048776, US Patent Publication No. 2011/0124100, US Patent Publication No. 2009/0093049, International Patent Publication No. WO2009/075886, International Patent Publication No. WO2012/009644, and International Patent Publication No. WO1999 /024595, International Patent Publication No. WO2007/025008, International Patent Publication No. WO2001/055371, European Patent No. 2610341, European Patent No. 2610340, the contents of each of which are hereby incorporated by reference in their entirety. .

In various embodiments, a nucleic acid molecule ( e.g., mRNA) of the present disclosure comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least at least one UTR comprising at least 40, at least 45, at least 50, at least 55 or more than 60 TEE sequences. In some embodiments, a TEE sequence in a UTR of a nucleic acid molecule is a copy of the same TEE sequence. In another embodiment, at least two TEE sequences in the UTR of the nucleic acid molecule are different TEE sequences. In some embodiments, several different TEE sequences are arranged in one or more repeating patterns in a UTR region of a nucleic acid molecule. For illustrative purposes only, the repeating pattern can be, for example, ABABAB, AABBAABBAABB, ABCABCABC, or the like, where in these example patterns, each capital letter (A, B, or C) is a different TEE sequence. indicates In some embodiments, at least two TEE sequences are contiguous with each other in the UTR of the nucleic acid molecule ( ie , no spacer sequence in between). In another embodiment, at least two TEE sequences are separated by a spacer sequence. In some embodiments, a UTR repeats at least 1 time, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in a UTR. It may include a TEE sequence-spacer sequence module that is. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, 3'-UTR or both 5'-UTR and 3'-UTR of a nucleic acid molecule.

In some embodiments, a UTR of a nucleic acid molecule ( eg, mRNA) of the present disclosure comprises at least one translational inhibitory element that functions to reduce the amount of a polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the UTR of the nucleic acid molecule comprises one or more miR sequences or fragments thereof ( eg, miR seed sequences) recognized by one or more microRNAs. In some embodiments, a UTR of a nucleic acid molecule comprises one or more stem-loop structures that down-regulate the translational activity of the nucleic acid molecule. Other mechanisms for inhibiting the translational activity associated with nucleic acid molecules are known in the art. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, 3'-UTR or both 5'-UTR and 3'-UTR of a nucleic acid molecule.

Polyadenylation (poly-A) region

During natural RNA processing, long chains of adenosine nucleotides (poly-A regions) are normally added to messenger RNA (mRNA) molecules to increase their stability. Immediately after transcription, the 3'-end of the transcript is cleaved to liberate the 3'-hydroxy. Poly-A polymerase then adds a chain of adenosine nucleotides to the RNA. A process called polyadenylation adds poly-A regions that are 100 to 250 residues long. Without wishing to be bound by theory, it is contemplated that the poly-A region may confer a variety of advantages to the nucleic acid molecules of the present disclosure.

Thus, in some embodiments, a nucleic acid molecule ( eg, mRNA) of the present disclosure includes a polyadenylation signal. In some embodiments, a nucleic acid molecule ( eg, mRNA) of the present disclosure comprises one or more polyadenylation (poly-A) regions. In some embodiments, the poly-A region consists entirely of adenine nucleotides or functional analogs thereof. In some embodiments, a nucleic acid molecule comprises at least one poly-A region at its 3'-end. In some embodiments, a nucleic acid molecule comprises at least one poly-A region at its 5'-end. In some embodiments, a nucleic acid molecule comprises at least one poly-A region at its 5'-end and at least one poly-A region at its 3'-end.

In the present disclosure, the poly-A region can have variable lengths in different embodiments. In particular, in some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 30 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 35 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 40 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 45 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 50 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 55 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 60 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 65 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 70 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 75 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 80 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 85 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 90 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 95 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 100 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 110 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 120 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 130 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 140 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 150 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 160 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 170 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 180 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 190 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 200 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 225 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 250 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 275 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 300 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 350 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 400 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 450 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 600 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 700 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 800 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 900 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1000 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1100 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1200 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1300 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1400 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1600 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1700 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1800 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1900 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2000 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2250 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 3000 nucleotides in length.

In some embodiments, the length of a poly-A region in a nucleic acid molecule can be selected based on the overall length of the nucleic acid molecule, or portion thereof (eg, the length of the coding region or the length of the open reading frame of the nucleic acid molecule, etc. ) . For example, in some embodiments, the poly-A region is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40% of the total length of the nucleic acid molecule containing the poly-A region. %, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more.

Without wishing to be bound by theory, it is contemplated that certain RNA-binding proteins may bind poly-A regions located at the 3'-end of mRNA molecules. These poly-A binding proteins (PABPs) can regulate mRNA expression, such as interaction with the translation initiation machinery in cells and/or protection of the 3'-poly-A tail from degradation. Thus, in some embodiments, a nucleic acid molecule ( eg, mRNA) of the present disclosure comprises at least one binding site for poly-A binding protein (PABP). In another embodiment, the nucleic acid molecule is conjugated or complexed with PABP prior to loading into a delivery vehicle ( eg, lipid nanoparticle).

In some embodiments, a nucleic acid molecule ( eg, mRNA) of the present disclosure comprises a Poly-AG Quartet. The G-quartet is a cyclic hydrogen-bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of the poly-A region. The resulting polynucleotide ( eg, mRNA) can be assayed for other parameters including stability, protein production and half-life at various time points. It has been found that the polyAG quartet structure results in protein production at least 75% comparable to that seen using a poly-A region of 120 nucleotides alone.

In some embodiments, a nucleic acid molecule ( eg, mRNA) of the present disclosure can include a poly-A region and can be stabilized by the addition of a 3'-stabilizing region. In some embodiments, a 3'-stabilizing region that can be used to stabilize a nucleic acid molecule ( eg, mRNA) is as described in International Patent Publication No. WO2013/103659, the contents of which are incorporated herein by reference in their entirety. Includes a poly-A or poly-AG quartet structure.

In another embodiment, a 3'-stabilizing region that may be used in connection with a nucleic acid molecule of the present disclosure is a chain terminating nucleoside such as, but not limited to, 3'-deoxyadenosine (cordycepin), 3'-deoxyuria Dean, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides such as 2',3'-dideoxyadenosine, 2', 3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, 2'-deoxynucleoside, or O -Methylnucleoside, 3'-deoxynucleoside, 2',3'-dideoxynucleoside 3'-O-methylnucleoside, 3'-O-ethylnucleoside, 3'-ara binosides, and other alternative nucleosides known in the art and/or described herein.

secondary structure

Without wishing to be bound by theory, it is believed that the stem-loop structure can direct RNA folding, protect the structural stability of nucleic acid molecules ( e.g., mRNA), and provide recognition sites for RNA binding proteins; It is contemplated that it may serve as a substrate for enzymatic reactions. For example, incorporation of miR sequences and/or TEE sequences alters the shape of the stem loop region, which can increase and/or decrease translation (Kedde et al . A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-222 accessibility. Nat Cell Biol. , 2010 Oct; 12(10):1014-20, the contents of which are incorporated herein by reference in their entirety).

Thus, in some embodiments, a nucleic acid molecule ( eg, mRNA), or a portion thereof, when described herein may assume a stem-loop structure, such as, but not limited to, a histone stem loop. In some embodiments, the stem-loop structure is a stem-loop sequence of about 25 or about 26 nucleotides in length, such as, but not limited to, in International Patent Publication No. WO2013/103659, the contents of which are incorporated herein by reference in their entirety. formed from those described. Additional examples of stem-loop sequences include those described in International Patent Publication No. WO2012/019780 and International Patent Publication No. WO201502667, the contents of which are incorporated herein by reference. In some embodiments, a step-loop sequence comprises a TEE as described herein. In some embodiments, step-loop sequences include miR sequences when described herein. In certain embodiments, the stem loop sequence may include a miR-122 seed sequence. In certain embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO:1). In another embodiment, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO:2).

In some embodiments, a nucleic acid molecule ( eg, mRNA) of the present disclosure comprises a stem-loop sequence located upstream (relative to the 5′-end) of a coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5'-UTR of a nucleic acid molecule. In some embodiments, a nucleic acid molecule ( eg, mRNA) of the present disclosure comprises a stem-loop sequence located downstream (to the 3′-end) of a coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3'-UTR of a nucleic acid molecule. In some cases, a nucleic acid molecule may contain more than one stem-loop sequence. In some embodiments, a nucleic acid molecule comprises at least one stem-loop sequence in a 5'-UTR, and at least one stem-loop sequence in a 3'-UTR.

In some embodiments, a nucleic acid molecule comprising a stem-loop structure further comprises a stabilizing region. In some embodiments, the stabilizing region comprises at least one chain terminating nucleoside that functions to slow degradation and thus increase the half-life of the nucleic acid molecule. Exemplary chain terminating nucleosides that may be used in connection with the present disclosure include, but are not limited to, 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxycytosine, Oxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3' -dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, 2'-deoxynucleoside, or O-methylnucleoside, 3'-deoxynucleoside Seed, 2',3'-dideoxynucleoside 3'-O-methylnucleoside, 3'-O-ethylnucleoside, 3'-arabinoside, and known in the art and/or herein other alternative nucleosides described. In another embodiment, the stem-loop structure can be stabilized by alterations to the 3'-region of the polynucleotide that can prevent and/or inhibit the addition of oligoseo (U) (International Patent Publication No. WO2013/103659 , incorporated herein by reference in its entirety).

In some embodiments, a nucleic acid molecule of the present disclosure comprises at least one stem-loop sequence and a poly-A region or polyadenylation signal. Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a poly-A region or polyadenylation signal include International Patent Publication No. WO2013/120497, International Patent Publication No. WO2013/120629, International Patent Publication No. WO2013 /120500, International Patent Publication No. WO2013/120627, International Patent Publication No. WO2013/120498, International Patent Publication No. WO2013/120626, International Patent Publication No. WO2013/120499, and International Patent Publication No. WO2013/120628; The contents of each are incorporated herein by reference in their entirety.

In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or polyadenylation signal is a pathogen antigen or fragment thereof, such as international patent publications, the contents of each of which are incorporated herein by reference in their entirety. It can encode for the polynucleotide sequences described in No. WO2013/120499 and International Patent Publication No. WO2013/120628.

In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or polyadenylation signal is a therapeutic protein such as International Patent Publication No. WO2013, the contents of each of which are incorporated herein by reference in their entirety. /120497 and International Patent Publication No. WO2013/120629.

In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or polyadenylation signal is a tumor antigen or fragment thereof, such as an International Patent Publication, the contents of each of which are incorporated herein by reference in their entirety. It can encode for the polynucleotide sequences described in No. WO2013/120500 and International Patent Publication No. WO2013/120627.

In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or polyadenylation signal is an allergenic antigen or an autoimmune self-antigen, such as the contents of each of which are incorporated herein by reference in their entirety. , International Patent Publication No. WO2013/120498 and International Patent Publication No. WO2013/120626.

Functional Nucleotide Analogs

In some embodiments, a payload nucleic acid molecule described herein contains only regular nucleotides selected from A (adenosine), G (guanosine), C (cytosine), U (uridine), and T (thymidine). Without wishing to be bound by theory, it is contemplated that certain functional nucleotide analogues may impart useful properties to nucleic acid molecules. Examples of such useful properties in the context of the present disclosure include, but are not limited to, increased stability of a nucleic acid molecule, reduced immunogenicity of a nucleic acid molecule in inducing an innate immune response, improved production of a protein encoded by a nucleic acid molecule, increase of a nucleic acid molecule reduced intracellular delivery and/or retention, and/or reduced cellular toxicity of nucleic acid molecules, and the like .

Thus, in some embodiments, a payload nucleic acid molecule comprises at least one functional nucleotide analog when described herein. In some embodiments, functional nucleotide analogues contain at least one chemical modification to the nucleobase, sugar group and/or phosphate group. Thus, a payload nucleic acid molecule comprising at least one functional nucleotide analog contains at least one chemical modification in a nucleobase, sugar group, and/or internucleoside linkage. Exemplary chemical modifications to nucleobases, sugar groups, or internucleoside linkages of nucleic acid molecules are provided herein.

In cases described herein, ranges from 0% to 100% of all nucleotides in a payload nucleic acid molecule may be functional nucleotide analogues in cases described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% of all nucleotides in a nucleic acid molecule. to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100% , about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% are functional nucleotide analogs described herein am. In any of these embodiments, the functional nucleotide analog can be present at any position(s) of the nucleic acid molecule, including the 5'-end, 3'-end, and/or one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and/or different types of internucleoside linkages ( eg, backbone structures).

In the cases described herein, all nucleotides of one type in the payload nucleic acid molecule ( e.g., all purine-containing nucleotides as one kind, or all pyrimidine-containing nucleotides as one kind, or all A, G, A range of 0% to 100% of C, T or U) may be a functional nucleotide analog when described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 60% of one type of nucleotide in a nucleic acid molecule. 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90% , about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% is functional as described herein. It is a nucleotide analogue. In any of these embodiments, the functional nucleotide analog can be present at any position(s) of the nucleic acid molecule, including the 5'-end, 3'-end, and/or one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and/or different types of internucleoside linkages ( eg, backbone structures).

Modifications to Nucleobases

In some embodiments, functional nucleotide analogues contain non-canonical nucleobases. In some embodiments, regular nucleobases in a nucleotide ( eg, adenine, guanine, uracil, thymine, and cytosine) may be modified or replaced to provide one or more functional analogs of the nucleotide. Exemplary modifications to nucleobases include, but are not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and/or thio substitutions; modifications involving one or more fused or open rings, oxidation, and/or reduction, or one or more substitutions.

In some embodiments, the non-canonical nucleobase is a modified uracil. Exemplary nucleobases and nucleosides with modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza- Uracil, 2-thio-uracil (s ² U), 4-thio-uracil (s ⁴ U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho ⁵ U ), 5-aminoallyl-uracil, 5-halo-uracil (eg 5-iodo-uracil or 5-bromo-uracil), 3-methyl-uracil (m ³ U), 5-methoxy- Uracil (mo ⁵ U), uracil 5-oxyacetic acid (cmo ⁵ U), uracil 5-oxyacetic acid methyl ester (mcmo ⁵ U), 5-carboxymethyl-uracil (cm ⁵ U), 1-carboxymethyl-pseudouri Dean, 5-carboxyhydroxymethyl-uracil (chm ⁵ U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm ⁵ U), 5-methoxycarbonylmethyl-uracil (mcm ⁵ U), 5-methyl Toxycarbonylmethyl-2-thio-uracil (mcm ⁵ s ² U), 5-aminomethyl-2-thio-uracil (nm ⁵ s ² U), 5-methylaminomethyl-uracil (mnm ⁵ U), 5 -Methylaminomethyl-2-thio-uracil (mnm ⁵ s ² U), 5-methylaminomethyl-2-seleno-uracil (mnm ⁵ se ² U), 5-carbamoylmethyl-uracil (ncm ⁵ U ), 5-carboxymethylaminomethyl-uracil (cmnm ⁵ U), 5-carboxymethylaminomethyl-2-thio-uracil (cmnm ⁵ s ² U), 5-propynyl-uracil, 1-propynyl-pseudouracil , 5-taurinemethyl-uracil (τm ⁵ U), 1-taurinemethyl-pseudouridine, 5-taurinemethyl-2-thio-uracil (τm ⁵ 5s ² U), 1-tauinomethyl-4 -thio-pseudouridine, 5-methyl-uracil (m ⁵ U, ie with the nucleobase deoxythymine), 1-methyl-pseudouridine (m ¹ ψ), 1-ethyl-pseudouridine (Et ¹ ψ), 5-methyl-2-thio-uracil (m ⁵ s ² U), 1-methyl-4-thio-pseudouridine (m ¹ s ⁴ ψ), 4-thio-1-methyl-pseudouri Dean, 3-methyl-pseudouridine (m ³ ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1- Deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m ⁵ D), 2-thio-dihydrouracil, 2 -Thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1 -Methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp ³ U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp ³ ψ) , 5-(Isopentenylaminomethyl)uracil (m ⁵ U), 5-(Isopentenylaminomethyl)-2-thio-uracil (m ⁵ s ² U), 5,2'-O-dimethyl-uri Deine (m ⁵ Um), 2-thio-2'-O-methyl-uridine (s ² Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm ⁵ Um), 5 -carbamoylmethyl-2'-O-methyl-uridine (ncm ⁵ Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm ⁵ Um), 3,2'-O- Dimethyl-uridine (m ³ Um), and 5-(Isopentenylaminomethyl)-2′-O-methyl-uridine (inm ⁵ Um), 1-thio-uracil, deoxythymidine, 5-( 2-Carbomethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cya nomethyl-uracil, 5-methoxy-2-thio-uracil, and 5-[3-(1-E-propenylamino)]uracil.

In some embodiments, a non-canonical nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides with modified cytosines are 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C), N4-acetyl-cytosine (ac4C), 5- Formyl-cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine ( eg 5-iodo-cytosine), 5-hydroxymethyl- Cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-cytosine, 4-thio- Pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, Zebularin, 5-aza-zebularin, 5-methyl-zebularin, 5-aza-2-thio-zebularin, 2-thio-zebularin, 2-methoxy-cytosine, 2-methoxy-5-methyl -cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k2C), 5,2'-O-dimethyl-cytidine (m5Cm), N4- Acetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (fSCm), N4, N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl) -Contains cytosine.

In some embodiments, the non-canonical nucleobase is a modified adenine. Exemplary nucleobases and nucleosides with alternative adenine are 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine ), 6-halo-purine (eg 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8- Aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8- Aza-2,6-diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A) , N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6 -(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyl-adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonyl Carbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine ( hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy- Adenine, N6,2'-O-dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (m1Am), 2-amino- N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.

In some embodiments, the non-canonical nucleobase is a modified guanine. Exemplary nucleobases and nucleosides with modified guanines include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG- 14), iso-ybutocin (imG2), ybutocin (yW), peroxyybutocin (o2yW), hydroxyybutocin (OHyW), low-modified hydroxyybutocin (OHyW*), 7- Aza-guanine, quiosine (Q), epoxyquiosine (oQ), galactosyl-quiosine (galQ), mannosyl-quiosine (manQ), 7-cyano-7-deaza-guanine (preQO) , 7-aminomethyl-7-deaza-guanine (preQ1), arceosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl -Guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine (m2,7G), N2, N2,7-dimethyl-guanine (m2 ,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N2-dimethyl-6- Thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl -Guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine, and O-6-methyl-guanine.

In some embodiments, the non-canonical nucleobases of functional nucleotide analogs can independently be purines, pyrimidines, purine or pyrimidine analogs. For example, in some embodiments, a non-canonical nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, the non-canonical nucleobase is, for example, pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, Hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propy Nyl uracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (eg 8-bromo), 8-amino, 8-thiol, 8 -thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halo especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7- Methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3, 4-d] pyrimidine, imidazo [1,5-a] 1,3,5 triazinone, 9-deazapurine, imidazo [4,5-d] pyrazine, thiazolo [4,5-d] pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine; or naturally-occurring and synthetic derivatives of bases, including 1,3,5 triazines.

transformation for sugar

In some embodiments, functional nucleotide analogues contain non-canonical sugar groups. In various embodiments, the non-canonical sugar group is one or more substituted, such as a halo group, a hydroxy group, a thiol group, an alkyl group, an alkoxy group, an alkenyloxy group, an alkynyloxy group, a cycloalkyl group, an aminoalkoxy group, an alkoxy group. 5-carbon or 6-carbon sugars with alkoxy groups, hydroxyalkoxy groups, amino groups, azido groups, aryl groups, aminoalkyl groups, aminoalkenyl groups, aminoalkynyl groups, etc. (such as pentose, ribose, arabic norse, xylose, glucose, galactose, or deoxy derivatives thereof).

Generally, RNA molecules contain a ribose sugar group, which is a five-membered ring with oxygen. Exemplary, non-limiting alternative nucleotides include replacement of an oxygen in ribose ( eg, with S, Se, or an alkylene such as methylene or ethylene); addition of a double bond (eg, to replace ribose with cyclopentenyl or cyclohexenyl); ring constriction of ribose (eg, to form a 4-membered ring of cyclobutane or oxetane); ( e.g., for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (which also has a phosphoramidate backbone), with an additional carbon or heteroatom ring extension of ribose (to form a 6- or 7-membered ring); Polycyclic forms ( e.g., tricyclo and “unlocked” forms, such as glycol nucleic acids (GNA) ( e.g., R-GNA or S-GNA, in which ribose is replaced by a glycol unit attached to a phosphodiester bond) ), threose nucleic acids (TNA, where ribose is replaced by α-L-threofuranosyl-(3′→2′)), and peptide nucleic acids (PNA, where the 2-amino-ethyl-glycine linkage is ribose and phosphodiester backbone).

In some embodiments, the sugar group contains one or more carbons that possess the opposite stereochemical structure of the corresponding carbon in ribose. Thus, a nucleic acid molecule may contain nucleotides containing , for example , arabinose or L-ribose as a sugar. In some embodiments, a nucleic acid molecule comprises at least one nucleoside wherein the sugar is L-ribose, 2'-O-methyl-ribose, 2'-fluoro-ribose, arabinose, hexitol, LNA, or PNA do.

Modifications to Internucleoside Linkages

In some embodiments, a payload nucleic acid molecule of the present disclosure may contain one or more modified internucleoside linkages ( eg, a phosphate backbone). The backbone phosphate groups can be modified by replacing one or more of the oxygen atoms with different substituents.

In some embodiments, functional nucleotide analogs may include replacement of an unaltered phosphate moiety with another internucleoside linkage when described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyls or aryls. phosphonates, and phosphotriesters. Phosphorodithioates have all of the non-bonded oxygens replaced by sulfur. Phosphate linkers can also be modified by replacement of bonding oxygens with nitrogen (crosslinked phosphoramidates), sulfur (crosslinked phosphorothioates), and carbon (crosslinked methylene-phosphonates).

Alternative nucleosides and nucleotides may include replacement of one or more of the non-bridging oxygens with borane moieties (BH ₃ ), sulfur (thio), methyl, ethyl, and/or methoxy. As a non-limiting example, two non-bridging oxygens at the same position ( eg, alpha (α), beta (β) or gamma (γ) positions) can be replaced with sulfur (thio) and methoxy. Replacement of one or more of the oxygen atoms at the position of the phosphate moiety ( e.g., α-thiophosphate) can be applied to RNA and DNA (e.g., for exonucleases and endonucleases) via non-natural phosphorothioate backbone linkages. ) is provided to impart stability. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in the cellular environment.

Other internucleoside linkages that may be used in accordance with the present disclosure, including internucleoside linkages that do not contain a phosphorus atom, are described herein.

Additional examples of nucleic acid molecules ( e.g., mRNA), compositions, formulations and/or methods associated therewith that may be used in connection with the present disclosure further include WO2002/098443, WO2003/051401, WO2008/052770, WO2009127230, WO2006122828, WO2008/083949, WO2010088927, WO2010/037539, WO2004/004743, WO2005/016376, WO2006/024518, WO2007/095976, WO2008/014979, WO2008/0 77592, WO2009/030481, WO2009/095226, WO2011069586, WO2011026641, WO2011/ WO2012019780 WO2012013326 WO2012089338 WO2012113513 WO2012116811 WO2012116810 WO2013113502 WO2013113501 WO2013113736 WO20131 WO2013/120626, WO2013120627, WO2013120628, WO2013120629, WO2013174409, WO2014127917, WO2015/024669, WO2015/0 24668, WO2015/ 024667, WO2015/024665, WO2015/024666, WO2015/024664, WO2015101415, WO2015101414, WO2015024667, WO2015062738, WO2015101416, the contents of each of which are incorporated herein by reference in their entirety. are incorporated

5.5 formulation

In the present disclosure, nanoparticle compositions described herein may include at least one lipid component and one or more additional components, such as therapeutic and/or prophylactic agents. Nanoparticle compositions can be designed for one or more specific applications or targets. Elements of a nanoparticle composition may be selected based on a particular application or target and/or based on the efficacy, toxicity, cost, ease of use, availability, or other attribute of one or more elements. Similarly, a particular formulation of a nanoparticle composition may be selected for a particular application or target depending, for example, on the potency and toxicity of a particular combination of elements.

The lipid component of the nanoparticle composition may be, for example, a lipid according to one of Formula (I) (and sub-formulas thereof) described herein, a phospholipid (such as an unsaturated lipid such as DOPE or DSPC), a PEG lipid , and structural lipids. Elements of the lipid component may be provided in specific fractions.

In one embodiment, provided herein are nanoparticle compositions comprising a cationic or ionizable lipid compound provided herein, a therapeutic agent, and one or more excipients. In one embodiment, the cationic or ionizable lipid compound includes a compound according to one of Formula (I) (and sub-formulas thereof) when described herein, and optionally one or more additional ionizable lipid compounds. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer conjugated lipids. In one embodiment, the therapeutic agent is encapsulated within or associated with the lipid nanoparticle.

In one embodiment,

i) 40 to 50 mole percent of a cationic lipid;

ii) neutral lipids;

iii) steroids;

iv) polymer conjugated lipids; and

v) Therapeutic

Provided herein are nanoparticle compositions (lipid nanoparticles) comprising

As used herein, "mole percent" refers to the mole percentage of a component relative to the total moles of all lipid components in the LNP (i.e., total moles of cationic lipid(s), neutral lipids, steroids and polymer conjugated lipids). refers to

In one embodiment, the lipid nanoparticle is 41 to 49 mole percent, 41 to 48 mole percent, 42 to 48 mole percent, 43 to 48 mole percent, 44 to 48 mole percent, 45 to 48 mole percent, 46 to 48 mole percent , or from 47.2 to 47.8 mole percent of the cationic lipid. In one embodiment, the lipid nanoparticle comprises about 47.0, 47.1, 47.2, 47.3, 47.4, 47.5, 47.6, 47.7, 47.8, 47.9 or 48.0 mole percent cationic lipid.

In one embodiment, the neutral lipid is present in a concentration ranging from 5 to 15 mole percent, 7 to 13 mole percent, or 9 to 11 mole percent. In one embodiment, the neutral lipid is present at a concentration of about 9.5, 10 or 10.5 mole percent. In one embodiment, the molar ratio of cationic lipid to neutral lipid ranges from about 4.1:1.0 to about 4.9:1.0, from about 4.5:1.0 to about 4.8:1.0, or from about 4.7:1.0 to 4.8:1.0.

In one embodiment, the steroid is present in a concentration ranging from 39 to 49 mole percent, 40 to 46 mole percent, 40 to 44 mole percent, 40 to 42 mole percent, 42 to 44 mole percent, or 44 to 46 mole percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45, or 46 mole percent. In one embodiment, the molar ratio of cationic lipid to steroid ranges from 1.0:0.9 to 1.0:1.2, or from 1.0:1.0 to 1.0:1.2. In one embodiment, the steroid is cholesterol.

In one embodiment, the therapeutic agent to lipid ratio (i.e., N/P, where N represents moles of cationic lipid and P represents moles of phosphate present as part of the nucleic acid backbone) in the LNP is from 2:1 to 30:1 , for example in the range of 3:1 to 22:1. In one embodiment, N/P ranges from 6:1 to 20:1 or 2:1 to 12:1. An exemplary N/P range is about 3:1. including about 6:1, about 12:1 and about 22:1.

In one embodiment,

i) cationic lipids with an effective pKa greater than 6.0; ii) 5 to 15 mole percent of a neutral lipid;

iii) 1 to 15 mole percent of an anionic lipid;

iv) 30 to 45 mole percent of a steroid;

v) polymer conjugated lipids; and

vi) a therapeutic agent, or a pharmaceutically acceptable salt or prodrug thereof

Provided herein are lipid nanoparticles comprising

The mole percent herein is determined based on the total moles of lipid present in the lipid nanoparticle.

In one embodiment, the cationic lipid can be any of a number of lipid species that have a net positive charge at a selected pH, such as physiological pH. Exemplary cationic lipids are described herein below. In one embodiment, the cationic lipid has a pKa greater than 6.25. In one embodiment, the cationic lipid has a pKa greater than 6.5. In one embodiment, the cationic lipid has a pKa greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65, or greater than 6.7.

In one embodiment, the lipid nanoparticle comprises 40 to 45 mole percent cationic lipid. In one embodiment, the lipid nanoparticle comprises 45 to 50 mole percent cationic lipid.

In one embodiment, the molar ratio of cationic lipid to neutral lipid ranges from about 2:1 to about 8:1. In one embodiment, the lipid nanoparticle comprises 5 to 10 mole percent of a neutral lipid.

Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG) or 1,2-distearoyl-sn-glycero-3-phospho -(1′-rac-glycerol) (DSPG).

In one embodiment, the lipid nanoparticle comprises 1 to 10 mole percent of an anionic lipid. In one embodiment, the lipid nanoparticle comprises 1 to 5 mole percent of an anionic lipid. In one embodiment, the lipid nanoparticle comprises 1 to 9 mole percent, 1 to 8 mole percent, 1 to 7 mole percent, or 1 to 6 mole percent of an anionic lipid. In one embodiment, the molar ratio of anionic lipid to neutral lipid ranges from 1:1 to 1:10.

In one embodiment, steroid cholesterol. In one embodiment, the molar ratio of cationic lipid to cholesterol ranges from about 5:1 to 1:1. In one embodiment, the lipid nanoparticle comprises 32 to 40 mole percent steroid.

In one embodiment, the sum of the mole percent of neutral lipids and the mole percent of anionic lipids ranges from 5 to 15 mole percent. In one embodiment, the sum of the mole percent of neutral lipids and the mole percent of anionic lipids ranges from 7 to 12 mole percent.

In one embodiment, the molar ratio of anionic lipid to neutral lipid ranges from 1:1 to 1:10. In one embodiment, the sum of mole percent of neutral lipid and mole percent steroid ranges from 35 to 45 mole percent.

In one embodiment, the lipid nanoparticle is

i) 45 to 55 mole percent of a cationic lipid;

ii) 5 to 10 mole percent of a neutral lipid;

iii) 1 to 5 mole percent of an anionic lipid; and

iv) 32 to 40 mole percent of a steroid

includes

In one embodiment, the lipid nanoparticle comprises 1.0 to 2.5 mole percent of conjugated lipid. In one embodiment, the polymer conjugated lipid is present at a concentration of about 1.5 mole percent.

In one embodiment, the neutral lipid is present in a concentration ranging from 5 to 15 mole percent, 7 to 13 mole percent, or 9 to 11 mole percent. In one embodiment, the neutral lipid is present at a concentration of about 9.5, 10 or 10.5 mole percent. In one embodiment, the molar ratio of cationic lipid to neutral lipid ranges from about 4.1:1.0 to about 4.9:1.0, from about 4.5:1.0 to about 4.8:1.0, or from about 4.7:1.0 to 4.8:1.0.

In one embodiment, the steroid is cholesterol. In some embodiments, the steroid is present in a concentration ranging from 39 to 49 mole percent, 40 to 46 mole percent, 40 to 44 mole percent, 40 to 42 mole percent, 42 to 44 mole percent, or 44 to 46 mole percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45, or 46 mole percent. In certain embodiments, the molar ratio of cationic lipid to steroid ranges from 1.0:0.9 to 1.0:1.2, or from 1.0:1.0 to 1.0:1.2.

In one embodiment, the molar ratio of cationic lipid to steroid ranges from 5:1 to 1:1.

In one embodiment, the lipid nanoparticle comprises 1.0 to 2.5 mole percent of conjugated lipid. In one embodiment, the polymer conjugated lipid is present at a concentration of about 1.5 mole percent.

In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 100:1 to about 20:1. In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 35:1 to about 25:1.

In one embodiment, the lipid nanoparticles have an average diameter ranging from 50 nm to 100 nm, or from 60 nm to 85 nm.

In one embodiment, a composition comprises a cationic lipid, DSPC, cholesterol, and PEG-lipid, and mRNA provided herein. In one embodiment, the cationic lipid, DSPC, cholesterol, and PEG-lipid provided herein are in a molar ratio of about 50:10:38.5:1.5.

Nanoparticle compositions can be designed for one or more specific applications or targets. For example, nanoparticle compositions can be designed to deliver therapeutic and/or prophylactic agents such as RNA to specific cells, tissues, organs, or systems or groups thereof in the mammalian body. The physicochemical properties of the nanoparticle composition can be altered to increase selectivity for specific bodily targets. For example, the particle size can be adjusted based on the size of the stomatomy of different organs. Therapeutic and/or prophylactic agents included in the nanoparticle composition may also be selected based on the desired delivery target or targets. For example, a therapeutic and/or prophylactic agent is delivered (e.g., localized or specific delivery) for a particular indication, condition, disease, or disorder and/or to a particular cell, tissue, organ, or system or group thereof. ) can be selected for. In certain embodiments, nanoparticle compositions can include mRNA encoding a polypeptide of interest that can be translated within a cell to produce the polypeptide of interest. Such compositions may be designed to be delivered specifically to a particular organ. In certain embodiments, the composition may be designed to be delivered specifically between mammals.

The amount of therapeutic and/or prophylactic agent in a nanoparticle composition may depend on the properties of the therapeutic and/or prophylactic agent, as well as the size, composition, desired target and/or application, or other characteristics of the nanoparticle composition. For example, the amount of RNA useful in a nanoparticle composition can depend on the size, sequence, and other characteristics of the RNA. The relative amounts of therapeutic and/or prophylactic agents and other elements ( eg, lipids) in the nanoparticle composition may also vary. In some embodiments, the wt/wt ratio of the lipid component to the therapeutic and/or prophylactic agent in the nanoparticle composition is from about 5:1 to about 60:1, such as 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25: 1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the wt/wt ratio of lipid component to therapeutic and/or prophylactic agent can be from about 10:1 to about 40:1. In certain embodiments, the wt/wt ratio is about 20:1. The amount of therapeutic and/or prophylactic agent in a nanoparticle composition can be measured using, for example, absorption spectroscopy (eg, ultraviolet-visible spectroscopy).

In some embodiments, nanoparticle compositions include one or more RNAs, and the one or more RNAs, lipids, and amounts thereof can be selected to provide a specific N:P ratio. The N:P ratio of a composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in RNA. In some embodiments, lower N:P ratios are selected. The one or more RNAs, lipids, and amounts thereof may be in an N:P ratio of about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8 :1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30: 1 can be chosen. In certain embodiments, the N:P ratio may be from about 2:1 to about 8:1. In another embodiment, the N:P ratio is from about 5:1 to about 8:1. For example, the N:P ratio can be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1. For example, the N:P ratio may be about 5.67:1.

The physical properties of a nanoparticle composition can depend on its components. For example, a nanoparticle composition comprising cholesterol as a structural lipid may have different characteristics compared to a nanoparticle composition comprising a different structural lipid. Similarly, the characteristics of a nanoparticle composition may depend on the absolute or relative amounts of its components. For example, a nanoparticle composition comprising a higher mole fraction of phospholipids may have different characteristics than a nanoparticle composition comprising a lower mole fraction of phospholipids. Characteristics may also vary depending on the method and conditions for preparing the nanoparticle composition.

Nanoparticle compositions can be characterized in a variety of ways. For example, microscopy (eg, transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of nanoparticle compositions. Dynamic light scattering or potentiometry (eg, potentiometric titration) can be used to measure the zeta potential. Dynamic light scattering can also be utilized to determine particle size. An instrument such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) can also be used to measure several characteristics of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

In various embodiments, the average size of nanoparticle compositions can be in the range of 10 nm to 100 nm. For example, the average size is between about 40 nm and about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the nanoparticle composition has an average size of about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm. nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the nanoparticle composition may have an average size of about 70 nm to about 100 nm. In some embodiments, the average size may be about 80 nm. In other embodiments, the average size may be about 100 nm.

A nanoparticle composition can be relatively homogeneous. The polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, eg , the particle size distribution of a nanoparticle composition. A small ( eg, less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The nanoparticle composition may have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be from about 0.10 to about 0.20.

The zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition. For example, zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low charges, positive or negative, are generally preferred, as more highly charged species can interact undesirably with cells, tissues, and other elements in the body. In some embodiments, the nanoparticle composition has a zeta potential of about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV , about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

The efficiency of encapsulation of a therapeutic and/or prophylactic agent describes the amount of therapeutic and/or prophylactic agent that is encapsulated or otherwise associated with a nanoparticle composition after manufacture, relative to the initial amount provided. The encapsulation efficiency is preferably high ( eg close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and/or prophylactic agent in a solution containing the nanoparticle composition before and after degradation of the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and/or prophylactic ( eg , RNA) in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of therapeutic and/or prophylactic agents is at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%. %, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, encapsulation efficiency can be at least 80%. In certain embodiments, encapsulation efficiency can be at least 90%.

A nanoparticle composition may optionally include one or more coatings. For example, nanoparticle compositions can be formulated into capsules, films, or tablets with coatings. Capsules, films, or tablets comprising the compositions described herein may have any useful size, tensile strength, hardness, or density.

5.6 pharmaceutical composition

In the present disclosure, nanoparticle compositions may be formulated in whole or in part as pharmaceutical compositions. A pharmaceutical composition may include one or more nanoparticle compositions. For example, a pharmaceutical composition may include one or more nanoparticle compositions comprising one or more different therapeutic and/or prophylactic agents. The pharmaceutical composition may further include one or more pharmaceutically acceptable excipients or minor ingredients such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and preparations are found, eg, in Remington's The Science and Practice of Pharmacy, ^21st Edition, AR Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006. Conventional excipients and excipients may be used in any pharmaceutical composition, except that any conventional excipients or excipients are incompatible with one or more components of the nanoparticle composition. An excipient or subcomponent may be incompatible with a component of the nanoparticle composition if the component and combination thereof may result in any undesirable biological or otherwise detrimental effect.

In some embodiments, one or more excipients or minor components may constitute more than 50% of the total mass or volume of a pharmaceutical composition comprising a nanoparticle composition. For example, one or more excipients or minor components may constitute 50%, 60%, 70%, 80%, 90%, or more of the pharmaceutical composition. In some embodiments, a pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, an excipient is approved for use in humans and for veterinary use. In some embodiments, an excipient is approved by the US Food and Drug Administration. In some embodiments, an excipient is pharmaceutical grade. In some embodiments, an excipient meets the standards of the United States Pharmacopoeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia, and/or International Pharmacopoeia.

The relative amounts of one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and/or any additional components in a pharmaceutical composition according to the present disclosure may be dependent on the identity, size, and/or condition of the treated subject. and further depending on the route by which the composition is to be administered. By way of example, a pharmaceutical composition may comprise from 0.1% to 100% (wt/wt) of one or more nanoparticle compositions.

In certain embodiments, nanoparticle compositions and/or pharmaceutical compositions of the present disclosure are refrigerated or frozen for storage and/or shipping (e.g., a temperature of 4° C. or less, such as a temperature of about -150° C. to about 0° C. °C or about -80 °C to about -20 °C ( e.g., about -5 °C, -10 °C, -15 °C, -20 °C, -25 °C, -30 °C, -40 °C, -50 °C, - stored at -60 °C, -70 °C, -80 °C, -90 °C, -130 °C or -150 °C) For example, including compounds of any of formula (I) (and sub-formulas thereof) The pharmaceutical composition is a solution that is refrigerated for storage and/or shipment, for example, at about -20 °C, -30 °C, -40 °C, -50 °C, -60 °C, -70 °C, or -80 °C. In certain embodiments, the present disclosure also provides nanoparticle compositions and/or pharmaceutical compositions to a temperature of 4 °C or less, such as a temperature of about -150 °C to about 0 °C or about -80 °C to about -20 °C, for example , about -5 ℃, -10 ℃, -15 ℃, -20 ℃, -25 ℃, -30 ℃, -40 ℃, -50 ℃, -60 ℃, -70 ℃, -80 ℃, -90 ℃, -130 °C or -150 °C) to increase the stability of nanoparticle compositions and/or pharmaceutical compositions comprising a compound of any of formula (I) (and sub-formulas thereof). For example, a nanoparticle composition and/or pharmaceutical composition disclosed herein may be administered for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, For at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months, for example, It is stable to temperatures up to 4 °C (eg, from about 4 °C to -20 °C). In one embodiment, the formulation is stabilized at about 4° C. for at least 4 weeks. In certain embodiments, a pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein and a tris, acetate salt (eg, sodium acetate) , citrate (eg, sodium citrate), saline, PBS, and a pharmaceutically acceptable carrier selected from one or more of sucrose. In certain embodiments, the pharmaceutical composition of the present disclosure has a pH value of about 7 to 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9 or 8.0; or 7.5 to 8 or 7 to 7.8). For example, a pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein, Tris, saline and sucrose, and has a pH of about 7.5-8, which can be stored and stored, for example, at about -20 °C. For example, a pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein and PBS, and is suitable for storage and/or shipment, e.g., at about 4° C. or less, about 7- It has a pH of 7.8. “Stability,” “stabilized,” and “stable” in the context of this disclosure means, for example, when subjected to stress such as shear, freeze/thaw stress, and the like, given preparation, manufacture, transportation, storage, and/or Refers to the resistance of a nanoparticle composition and/or pharmaceutical composition disclosed herein to chemical or physical changes ( eg, degradation, change in particle size, aggregation, change in encapsulation, etc. ) under conditions of use.

Nanoparticle compositions and/or pharmaceutical compositions comprising one or more nanoparticle compositions may provide treatment provided by delivery of therapeutic and/or prophylactic agents to one or more specific cells, tissues, organs, or systems or groups thereof, such as the renal system. It can be administered to any patient or subject, including those patients or subjects who may benefit from adverse effects. Although the descriptions provided herein of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions principally relate to compositions suitable for administration to humans, it is skilled in the art that such compositions are generally suitable for administration to any other mammal. will be understood by Modification of a composition suitable for administration to humans in order to render the composition suitable for administration to a variety of animals is well understood, and generally a skilled veterinary pharmacologist can design and/or perform such modification in no more than a routine, if any, laboratory procedure. there is. Subjects to whom administration of the composition is contemplated include, but are not limited to, humans, other primates, and other mammals including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and/or rats. include

A pharmaceutical composition comprising one or more nanoparticle compositions may be prepared by any method known or hereafter developed in the art of pharmacology. Generally, such preliminary methods involve cross-linking the active ingredient with an excipient and/or one or more other minor ingredients, and then, if desired or necessary, dividing, shaping, and/or dividing the product into desired single- or multi-dose units. or packaging.

A pharmaceutical composition according to the present disclosure may be manufactured, packaged, and/or sold in bulk as a single unit dose, and/or as a plurality of single unit doses. As used herein, a “unit dose” is a discrete amount of a pharmaceutical composition comprising a predetermined amount of an active ingredient ( eg, a nanoparticle composition). The amount of active ingredient is generally equal to the dosage of active ingredient to be administered to a subject and/or a convenient fraction of such dosage, such as, for example, 1/2 or 1/3 of such dosage.

The pharmaceutical composition can be prepared in a variety of forms suitable for a variety of routes and methods of administration. For example, pharmaceutical compositions may be formulated into liquid dosage forms ( e.g. , emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and/or transdermal administration (eg, ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), suspensions, powders, and It can be made in other forms.

Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, sprays, and/or elixirs. In addition to the active ingredient, liquid dosage forms may contain an inert diluent commonly used in the art, such as, for example, water or other solvents, solubilizing agents, and emulsifying agents such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol. , benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohols, fatty acid esters of polyethylene glycol and sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions may contain additional therapeutic and/or prophylactic agents, additional agents such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and/or perfuming agents. In certain embodiments for parenteral administration, the composition is admixed with a solubilizing agent such as Cremophor ^™ , alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and/or combinations thereof.

Injectable preparations, eg, sterile injectable aqueous or oleaginous suspensions, may be formulated according to the known art using suitable dispersing, wetting, and/or suspending preparations. The sterile injectable preparation can be a sterile injectable solution, suspension, and/or emulsion in a non-toxic parenterally acceptable diluent and/or solvent, for example as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P., and isotonic sodium chloride solution. Sterile, fixed oils are commonly employed as solvents or suspending media. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. Fatty acids such as oleic acid can be used in the preparation of injectables.

Injectable formulations may be prepared by filtration, for example, through a bacteria-retaining filter, and/or in the form of a sterile solid composition which may be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. It can be sterilized by incorporating.

The present disclosure provides methods for delivering therapeutic and/or prophylactic agents to mammalian cells or organs, methods for producing a polypeptide of interest in mammalian cells, and administration to a mammal and/or nanoparticles comprising the therapeutic and/or prophylactic agents. A method of treating a disease or disorder in a mammal in need thereof comprising contacting the composition with a mammalian cell is characterized.

6. Examples

The embodiments in this section are provided by way of example, and not by way of limitation.

general way.

General preparative HPLC method: HPLC purification is performed on a Waters 2767 equipped with a diode array detector (DAD) on an Inertsil Pre-C8 OBD column, typically with water containing 0.1% TFA as solvent A and acetonitrile as solvent B. do.

General LCMS method: LCMS analysis is performed on Shimadzu (LC-MS2020) System. Chromatography is typically performed on a SunFire C18 with water containing 0.1% formic acid as solvent A and acetonitrile containing 0.1% formic acid as solvent B.

6.1 Example 1: Preparation of starting materials and intermediates.

Preparation of Compound A

Diisopropylethylamine ( 2.7 g, 2.08 mmol, 2.5 equiv) and DMAP (203 mg, 1.67 mmol, 0.2 equiv) were added. After stirring for 5 min at ambient temperature, EDCI (2.4 g, 12.5 mmol, 1.5 equiv) was added and the reaction mixture was stirred at room temperature overnight after which time TLC showed complete disappearance of the starting alcohol. The reaction mixture was diluted with CH ₂ Cl ₂ (300 mL) and washed with saturated NaHCO ₃ (100 mL), water (100 mL) and brine (100 mL). The combined organic layers were dried over Na ₂ SO ₄ and the solvent removed in vacuo. Evaporation of the solvent gave a crude product which was purified by column (silica gel, 0-1% ethyl acetate (EA) in hexanes) chromatography to give compound A (2.0 g, 57%) as a colorless oil.

Preparation of Compound B

Cyclohexanone (2.0 g, 20.0 mmol, 1.0 equiv), titanium(IV) isopropoxide (7.4 g, 26 mmol, 1.3 equiv), and 2-aminoethanol (3.66 g, 60.0 mmol) in methanol (10.0 mL) , 3.0 eq) was stirred at RT under argon for 5 h. Sodium borohydride (760.0 mg, 20.0 mmol, 1.0 eq) was then added at 0 °C and the resulting mixture stirred for an additional 2 h. The reaction was then quenched by addition of water (10.0 mL). Stirring was continued at RT for 20 min then the reaction mixture was acidified with hydrochloric acid (1 M, 5 mL), filtered over a pad of celite, washed with water and EA. The organic layer was separated, dried over Na ₂ SO ₄ , evaporated under reduced pressure and purified by flash column chromatography (FCC) (PE/EA=5/1-0/1) to obtain compound B (1.5 g, 52% yield) as a yellow oil.

Preparation of Compound C

To a solution of compound A (446.0 mg, 1.0 mmol, 1.0 equiv) and ethanolamine (180.0 mg, 3.0 mmol, 3.0 equiv) in acetonitrile (ACN, 10.0 mL) was added Cs ₂ CO ₃ (97.5 mg, 0.3 mmol, 0.3 equiv). ), K ₂ CO ₃ (414.0 mg, 3.0 mmol, 3.0 equiv) and NaI (14.6 mg, 0.1 mmol, 0.1 equiv) were added at RT. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH=1/0-20/1) to give Compound C (0.35 g, 82% yield) as a yellow oil.

Preparation of Compound D

A mixture of cyclobutanone (8.0 g, 114 mol, 1.0 equiv) and 2-aminoethanol (20.9 g, 342 mol, 3.0 equiv) in methanol (100 mL) was stirred at RT under argon for 16 h. Sodium borohydride (4.3 g, 114 mmol, 1.0 equiv) was then added at 0 °C and the resulting mixture stirred for an additional 16 hours. The reaction mixture was then concentrated under reduced pressure. Water (200 mL) was added and extracted with dichloromethane (DCM). The combined organic layers were dried over Na ₂ SO ₄ , evaporated under reduced pressure and purified by column chromatography (silica gel, 2%-10% MeOH in DCM) to obtain compound D (3.9 g, 30% yield) as a pale yellow oil.

Preparation of Compound E

Step 1: Preparation of Compound E-1

To a solution of PMB-NH ₂ (5.166 g, 37.66 mmol, 4.0 equiv) in EtOH (30 mL) was added 1,2-epoxytetradecane (2.0 g, 9.416 mmol, 1.0 equiv). The reaction mixture was stirred at RT for 16 h. LCMS showed the reaction to be complete. The mixture was evaporated under reduced pressure and purified by FCC to give compound E-1 (1.42 g, 43.09%) as a white solid. LCMS: Rt: 0.815 min; MS m/z (ESI): 350.3 [M+H] ⁺ .

Step 2: Preparation of Compound E-2

To a solution of compound E-1 (1.42 g, 4.057 mmol, 1.0 equiv) in ACN (25 mL) was compound A (5.106 mg, 12.17 mmol, 3.0 equiv), K ₂ CO ₃ (1.668 g, 12.17 mmol, 3.0 equiv). , Cs ₂ CO ₃ (397 mg, 1.217 mmol, 0.3 equiv), and NaI (30 mg, 0.2029 mmol, 0.05 equiv) were added. The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent and purification by FCC provided compound E-2 (2.5 g, 89.55%) as a colorless oil. LCMS: Rt: 0.241 min; MS m/z (ESI): 688.5 [M+H] ⁺ .

Step 3: Preparation of Compound E

To a solution of compound E-2 (250 mg, 0.3633 mmol) in MeOH (10 mL) was added Pd/C (50 mg). The reaction mixture was stirred under H ₂ for 16 h at RT. LCMS showed the reaction to be complete. After removal of the solvent, purification by pre-HPLC provided compound E (105 mg, 50.88% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ): 3.97 (d, J = 6 Hz, 2H), 3.58 (s, 1H), 2.73-2.58 (m, 3H), 2.45-2.40 (m, 1H), 2.33- 2.29 (m, 2H), 1.66–1.60 (m, 2H), 1.51–1.40 (m, 2H), 1.39–1.34 (m, 4H), 1.26 (s, 46H), 0.90–0.86 (m, 9H). LCMS: Rt: 1.083 min; MS m/z (ESI): 568.5 [M+H] ⁺ .

Preparation of Compound F

To a mixture of cyclopropanamine (5.7 g, 100 mmol, 2.5 equiv) in EtOH (50 mL) was added 2-bromoethanol (5 g, 40 mmol, 1 equiv). The reaction mixture was stirred at 50 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent gave compound F (6.6 g crude) as a yellow oil.

Preparation of Compound G

A solution of cyclopentanone (16.8 g, 200 mmol, 1 equiv) and 2-aminoethanol (13.4 g, 220 mmol, 1.1 equiv) with 3 drops of acetic acid (AcOH) in MeOH (300 mL) was stirred at room temperature overnight. , then NaBH ₄ (8.4 g, 220 mmol, 1.1 equiv) was added to the mixture at 0 °C. The mixture was stirred at RT for 2 hours. The mixture was quenched with water (100 mL), extracted with EA (3 x 100 mL), dried and concentrated. Purification by silica gel column chromatography (MeOH:DCM = 0% to 10%) provided compound G (17.8 g, 49.0% yield) as a yellow oil.

Preparation of Compound H

To a solution of 2-octyldecan-1-ol (1.5 g, 5.545 mmol, 1.0 equiv) in DCM (15 mL) was added 6-bromohexanoic acid (1.3 g, 6.654 mmol, 1.2 equiv), EDCI (1.6 g, 8.318 mmol, 1.5 equiv), DMAP (135 mg, 1.109 mmol, 0.2 equiv), and diisopropylethylamine (DIEA, 1.4 g, 11.09 mmol, 2.0 equiv) were added. The reaction mixture was stirred at 50 °C for 16 hours. TLC showed the reaction to be complete. Removal of the solvent and purification of the crude product by FCC provided compound H (1.2 g, 48.36%) as a yellow oil.

Preparation of compound K

A mixture of cycloheptanone (15 g, 134 mmol, 1 equiv) and 2-aminoethanol (9 g, 147 mmol, 1.1 equiv) with 3 drops of AcOH in MeOH (250 mL) was stirred overnight at room temperature, then NaBH ₄ (5.6 g, 147 mmol, 1.1 equiv) was added to the mixture at 0 °C. The mixture was stirred at RT for 2 hours. The mixture was quenched with water (100 mL), extracted with EA (3 x 100 mL), dried and concentrated. Purification by silica gel column chromatography (MeOH:DCM = 0% to 10%) provided compound K (10.3 g, 69.2% yield) as a yellow oil.

Preparation of compound L

A mixture of cyclooctanone (2.0 g, 15.85 mmol, 1 equiv) and 2-aminoethanol (1.07 g, 17.43 mmol, 1.1 equiv) with 3 drops of AcOH in MeOH (30 mL) was stirred overnight at room temperature, then NaBH ₄ (660 mg, 17.43 mmol, 1.1 equiv) was added to the mixture at 0 °C. The mixture was stirred at room temperature for 2 hours. The mixture was quenched with water (100 mL), extracted over EA (3 x 100 mL) and dried. After concentration, the residue was purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give compound L (960 mg, 35% yield) as a yellow oil.

Manufacturing of SM2

Compound 26-1 (250 mg, 0.56 mmol, 1.0 equiv), 2-aminoethanol (243 mg, 1.68 mmol, 3.0 equiv), K ₂ CO ₃ (232 mg, 1.68 mmol, 3.0 equiv) in ACN (10 mL) , Cs ₂ CO ₃ (7 mg, 0.02 mmol, 0.03 equiv) and sodium iodide (30 mg, 0.2 mmol, 0.3 equiv) were stirred overnight at 100 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product SM2 (1.78 g, 62.1% yield) as a yellow oil. LCMS: Rt: 1.427 min; MS m/z (ESI): 428.5 [M+H] ⁺ .

Manufacture of SM4

Compound SM4-1 (2.1 g, 4.5 mmol, 1.0 equiv), 2-aminoethanol (830 mg, 13.6 mmol, 3.0 equiv), K ₂ CO ₃ (1.9 g, 13.6 mmol, 3.0 equiv) in ACN (15 mL) , Cs ₂ CO ₃ (440 mg, 1.4 mmol, 0.3 equiv), NaI (200 mg, 1.4 mmol, 0.3 equiv) was stirred overnight at reflux. The mixture was diluted with water, extracted with EA, concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product SM4 (860 mg, 41% yield) as a yellow oil. . LCMS: Rt: 1.000 min; MS m/z (ESI): 442.4 [M+H] ⁺ .

Manufacturing of SM9

To a solution of compound SM9-1 (1.0 g, 2.166 mmol, 1.0 equiv) in ACN (15 mL) was added compound SM6 (0.4 g, 6.498 mmol, 3.0 equiv), K ₂ CO ₃ (0.9 g, 6.498 mmol, 3.0 equiv). , Cs ₂ CO ₃ (212 mg, 0.6498 mmol, 0.3 equiv), NaI (32 mg, 0.2166 mmol, 0.1 equiv) were added. The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound SM9 (350 mg, 37.87%) as a yellow oil.

Manufacture of SM10

Step 1: Preparation of Compound SM10-2

HATU to a mixture of compound SM10-1 (2.0 g, 6.700 mmol, 1.0 equiv), compound SM8 (0.83 g, 8.040 mmol, 1.2 equiv), DIEA (2.6 g, 20.10 mmol, 3.0 equiv) in DCM (30 mL). (3.8 g, 10.50 mmol, 1.5 eq) was added. The reaction mixture was stirred at rt for 1 hour. TLC showed the reaction to be complete. Mixture power in water and washed with DCM. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound SM10-2 (2.4 g, 93.36%) as a colorless oil.

Step 2: Compound SM10 -3 manufacture of

To a mixture of compound SM10-2 (2.4 g, 6.255 mmol, 1.0 equiv) and DIEA (1.62 g, 12.51 mmol, 2.0 equiv) in DCM (60 mL) was added MsCl (0.86 g, 7.506 mmol, 1.2 equiv) at 0 °C. was added under N ₂ . The reaction mixture was stirred at 0 °C for 1 hour. TLC showed the reaction to be complete. The mixture was poured into water and washed with DCM. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound SM10-3 (2.5 g, 86.57%) as a yellow oil.

Step 3: Compound SM10 -4 manufacture of

To a solution of compound SM10-3 (1.5 g, 3.249 mmol, 1.0 equiv) in ACN (30 mL) was added compound B (0.45 g, 3.899 mmol, 1.2 equiv), K ₂ CO ₃ (1.35 g, 9.747 mmol, 3.0 equiv). , Cs ₂ CO ₃ (318 mg, 0.9747 mmol, 0.3 equiv), NaI (49 mg, 0.3249 mmol, 0.1 equiv) were added. The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound SM10-4 (700 mg, 44.81%) as a yellow oil. LCMS: Rt: 0.830 min; MS m/z (ESI): 481.4 [M+H] ⁺ .

Step 4: Preparation of Compound SM10

To a solution of compound SM10-4 (300 mg, 0.6240 mmol, 1.0 equiv) in DCM (15 mL) was added SOCl ₂ (223 mg, 1.872 mmol, 3.0 equiv). The reaction mixture was stirred at 35 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent gave compound SM10 (310 mg, crude) as a yellow oil. LCMS: Rt: 0.860 min; MS m/z (ESI): 499.3 [M+H] ⁺ .

Preparation of SM11:

Step 1: Preparation of Compound SM11-2

A mixture of compound SM10-1 (1.5 g, 5.025 mmol, 1.0 equiv), compound SM7 (1.26 g, 7.538 mmol, 1.5 equiv) and TsOH (300 mg) in toluene (20 mL) was stirred at reflux for 2 h. TLC showed the reaction to be complete. The mixture was evaporated under reduced pressure to give compound SM11-2 (1.4 g, 62.26%) as a yellow oil by FCC.

Step 2: Preparation of Compound SM11

To a solution of compound SM11-2 (1.0 g, 2.235 mmol, 1.0 equiv) in ACN (15 mL) was added compound SM6 (0.41 g, 6.704 mmol, 3.0 equiv), K ₂ CO ₃ (0.93 g, 6.704 mmol, 3.0 equiv). , Cs ₂ CO ₃ (218 mg, 0.6704 mmol, 0.3 equiv), NaI (33 mg, 0.2235 mmol, 0.1 equiv) were added. The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound SM11 (700 mg, 44.81%) as a yellow oil. LCMS: Rt: 0.890 min; MS m/z (ESI): 428.3 [M+H] ⁺ .

Preparation of SM:

Step 1: Preparation of Compound SM-2

To a mixture of NaH (12 g, 227.1 mmol, 2.5 equiv) in DMF (100 mL) was added compound SM-1 (12 g, 90.84 mmol, 1.0 equiv) at 0 °C under N ₂ . The reaction mixture was stirred at 0 °C for 1 hour. C ₈ H ₁₇ Br (44 g, 227.1 mmol, 2.5 equiv) in DMF (100 mL) was added to this. The reaction mixture was stirred at rt for 16 h. TLC showed the reaction to be complete. Mixture power in water and washed with EA. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound SM-2 (17.8 g, 54.96%) as a colorless oil. ¹ H NMR (400 MHz, CCl ₃ D): 3.71 (s, 6H), 1.88-1.84 (m, 4H), 1.59 (s, 1H), 1.25 (s, 19H), 1.14-1.10 (m, 4H) , 0.89–0.86 (m, 6H).

Step 2: Preparation of Compound SM-3

To a solution of SM-2 (17.8 g, 49.93 mmol, 1.0 equiv) in DMF (260 mL) was added LiCl (21.17 g, 499.3 mmol, 10.0 equiv). The reaction mixture was stirred at 120 °C for 12 hours. TLC showed the reaction to be complete. Mixture power in water and washed with EA. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound SM-3 (10 g, 67.10%) as a colorless oil. ¹ H NMR (400 MHz, CCl ₃ D): 0.89-0.86 (m, 6H), 1.25 (s, 22H), 1.45-1.40 (m, 2H), 1.59 (s, 4H), 2.36-2.30 (m, 1H), 3.67 (s, 3H).

Step 3: Preparation of Compound SM

To a solution of compound SM-3 (10 g, 33.50 mmol, 1.0 equiv) in THF (100 mL) was added LiAlH ₄ (2.546 g, 67.00 mmol, 2.0 equiv) slowly at 0 °C. The reaction mixture was stirred at reflux for 1 hour. TLC showed the reaction to be complete. After cooling to 0 °C, the mixture was mixed with water (3.4 mL), 15% aq. It was quenched by sequential addition of NaOH (3.4 mL) and water (10 mL). The resulting mixture was diluted with EA and the precipitate was removed by filtration. The filtrate was evaporated under reduced pressure and FCC gave the compound SM (8.5 g, 93.80%) as a yellow oil. ¹ H NMR (400 MHz, CCl ₃ D): 0.90-0.86 (m, 6H), 1.27 (s, 27H), 1.43 (s, 3H), 3.54 (d, J = 5.2 Hz, 2H).

Manufacture of SM15:

To a solution of compound 26-1 (400 mg, 0.89 mmol, 1.0 equiv) in ACN (30 mL) was added SM15-1 (140 mg, 1.79 mmol, 2.0 equiv), K ₂ CO ₃ (370 mg, 2.68 mmol, 3.0 equiv). equiv), Cs ₂ CO ₃ (90 mg, 0.27 mmol, 0.3 equiv) and NaI (40 mg, 0.27 mmol, 0.3 equiv) were added. The reaction mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. Removal of solvent, FCC gave compound SM15 (120 mg, 30%). LCMS: Rt: 0.900 min; MS m/z (ESI): 442.3 [M+H] ⁺ .

Manufacture of SM16:

K ₂ CO ₃ (365 mg, 2.64 mmol, 3.0 equiv) to a solution of compound 71-7 (420 mg, 0.88 mmol, 1.0 equiv) and compound SM6 (108 mg, 1.76 mmol, 2.0 equiv) in ACN (20 mL). , Cs ₂ CO ₃ (85 mg, 0.26 mmol, 0.3 equiv) and NaI (39 mg, 0.26 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give compound SM16 (146 mg, 37% yield) as a yellow oil. LCMS: Rt: 0.810 min; MS m/z (ESI): 444.3 [M+H] ⁺ .

Manufacture of SM18:

Compound SM18-1 (2.0 g, 4.48 mmol, 1.0 equiv), tert-butyl (2-aminoethyl) carbamate (1.0 g, 6.72 mmol, 1.5 equiv), K ₂ CO ₃ (1.8 equiv) in ACN (20 mL) g, 13.4 mmol, 3.0 equiv), Cs ₂ CO ₃ (440 mg, 1.34 mmol, 0.3 equiv), NaI (200 mg, 1.34 mmol, 0.3 equiv) was stirred at 90 °C overnight. LCMS showed the target product. The mixture was concentrated and the residue was purified by column chromatography to give product SM18 (860 mg, 36.5% yield) as a white solid. LCMS: Rt: 0.870 min; MS m/z (ESI): 526.5 [M+H] ⁺ .

Manufacture of SM20:

Step 1: Preparation of Compound SM20-1

To a solution of compound 26-1 (1.0 g, 2.24 mmol, 1.0 equiv) and compound B (511.0 mg, 4.48 mmol, 2.0 equiv) in ACN (20.0 mL) was added Cs ₂ CO ₃ (218.0 mg, 0.67 mmol, 0.3 equiv). , K ₂ CO ₃ (927.0 mg, 6.72 mmol, 3.0 equiv) and NaI (33.0 mg, 0.22 mmol, 0.1 equiv) were added at RT. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH = 1/0-20/1) to give compound SM20-1 (0.6 g, 56% yield) as a brown oil did LCMS: Rt: 0.950 min; MS m/z (ESI): 482.4 [M+H] ⁺ .

Step 2: Preparation of Compound SM20

To a solution of compound SM20-1 (0.2 g, 0.41 mmol, 1.0 equiv) in DCM (5.0 mL) was added SOCl ₂ (144.0 mg, 1.23 mmol, 3.0 equiv) at RT. The mixture was stirred for 16 hours. LCMS showed the reaction to be complete and the mixture was evaporated under reduced pressure to give compound SM20 (0.23 g, crude) as a brown oil. LCMS: Rt: 1.330 min; MS m/z (ESI): 500.3 [M+H] ⁺ .

Manufacture of SM22:

Step 1: Preparation of Compound SM22-2

To a solution of compound SM22-1 (30.0 g, 98.25 mmol, 1.0 equiv) in DMF (800 mL) was added NaCN (9.63 g, 196.5 mmol, 2.0 equiv). The reaction was stirred at 60 °C for 10 hours. The reaction mixture was poured into water (500 mL) and extracted with EtOAc (3 x 500 mL). The combined organic layers were washed with brine, dried over anhydrous Na ₂ SO ₄ and concentrated in vacuo. The crude product was purified by flash column chromatography (EtOAc:PE = 1:20) to give the target product (18.3 g, 74 % yield) as a yellow oil.

Step 2: Preparation of Compound SM22-3

To a solution of compound SM22-2 (17.0 g, 67.61 mmol, 1.0 equiv) in EtOH (200 mL) was added H ₂ SO ₄ (40 mL). The reaction was stirred at 90 °C for 48 hours. The reaction mixture was poured into water (500 mL) and extracted with EtOAc (3 x 500 mL). The combined organic layers were washed with brine, dried over anhydrous Na ₂ SO ₄ and concentrated in vacuo to give the target product (15 g, 75 % yield) as a yellow oil.

Step 3: Preparation of Compound SM22

To a solution of compound SM22-3 (14 g, 46.90 mmol, 1.0 equiv) in MeOH (240 mL) and H ₂ O (60 mL) was added LiOH.H ₂ O (9.84 g, 234.5 mmol, 5.0 equiv). The reaction was stirred at 50 °C for 10 hours. The reaction mixture was concentrated in vacuo to give the crude target product. The crude product was dissolved in water. The residue was adjusted to pH = 2 with 6M HCl and extracted with EtOAc (3 x 500 mL). The combined organic layers were washed with brine, dried over anhydrous Na ₂ SO ₄ and concentrated in vacuo to give compound SM22 (15 g, 75 % yield) as a yellow oil. ¹ H NMR (400 MHz, CCl ₃ D): 0.87 (t, J = 8 Hz, 6H), 1.22-1.46 (m, 24H), 1.85-1.95 (m, 2H), 2.22-2.34 (m, 1H) .

Manufacture of SM23:

Step 1: Preparation of Compound SM23-1

To a solution of compound SM22 (4 g, 14.79 mmol, 1.0 equiv) in CH ₂ Cl ₂ (100 mL) was added DIEA (5.73 g, 44.37 mmol, 3.0 equiv), compound SM7 (2.96 g, 17.75 mmol, 1.2 equiv), EDCI (4.25 g, 22.18 mmol, 1.5 equiv), and DMAP (550 mg, 4.44 mmol, 0.3 equiv) were added. The reaction was stirred at 50 °C for 10 hours. The reaction mixture was concentrated in vacuo and purified by flash column chromatography (EtOAc: PE =20:1) to give the target product (4 g, 64 % yield) as a yellow oil.

Step 2: Preparation of Compound SM23

To a solution of compound SM23-1 (1.5 g, 3.58 mmol, 1.0 equiv) in CH ₃ CN (50 mL) was added K ₂ CO ₃ (1.48 g, 10.73 mmol, 3.0 equiv), Cs ₂ CO ₃ (0.4 g, 1.07 mmol). , 0.3 equiv), NaI (0.16 g, 1.07 mmol, 0.3 equiv), and compound SM6 (0.45 g, 7.15 mmol, 2.0 equiv) were added. The reaction was stirred at 80 °C for 10 hours. The reaction mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (CH ₂ Cl ₂ :MeOH = 10 : 1) to give the target product (800 mg, 56 % yield) as a yellow oil. LCMS: Rt: 0.898 min; MS m/z (ESI): 400.3 [M+H] ⁺ .

Manufacture of SM24:

EDCI (24.0 g, 125 mmol, 1.5 equiv), DMAP ( 2.0 g, 16.7 mmol, 0.2 equiv) and DIEA (27.0 g, 208 mmol, 2.5 equiv) were added. The reaction mixture was stirred at room temperature for 16 hours. TLC showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography (silica gel, 0-1% EA in PE) to give compound SM24 (17 g, 49%) as a colorless oil.

Manufacture of SM26:

Step 1: Preparation of Compound SM26-2

To a mixture of compound SM26-1 (2 g, 7.080 mmol, 1.0 equiv) and compound SM7 (1.42 g, 8.496 mmol, 1.2 equiv) was added DIEA (1.8 g, 14.16 mmol, 2.0 equiv), EDCI ( 2 g, 10.62 mmol, 1.5 equiv), DMAP (0.17 g, 1.416 mmol, 0.2 equiv) were added. The reaction mixture was stirred at 50 °C for 16 hours. TLC showed the reaction to be complete. Mixture power in water and washed with DCM. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound SM26-2 (1.5 g, 49.10%) as a yellow oil.

Step 2: Preparation of Compound SM26

To a solution of compound SM26-2 (1.5 g, 3.476 mmol, 1.0 equiv) in ACN (30 mL) was added compound SM6 (0.64 g, 10.43 mmol, 3.0 equiv), K ₂ CO ₃ (1.4 g, 10.43 mmol, 3.0 equiv). , Cs ₂ CO ₃ (0.34 g, 1.043 mmol, 0.3 equiv), NaI (0.16 g, 1.043 mmol, 0.3 equiv) were added. The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound SM26 (800 mg, 55.90%) as a yellow oil.

Manufacture of SM30:

Step 1: Preparation of Compound SM30-2

To a solution of compound SM30-1 (6.3 g, 35.2 mmol, 1.0 equiv) in DCM (150 mL) was added TsOH ^. H ₂ O (1.3 g, 7.0 mmol, 0.2 equiv) and Na ₂ SO ₄ (15.0 g, 105.6 mmol, 3.0 equiv) were added. The mixture was stirred at rt overnight. The mixture was filtered and concentrated. The residue was purified by column chromatography on silica gel (PE/EA = 100/1) to give compound SM30-2 (9.7 g, 66% yield) as a colorless oil.

Step 2: Preparation of Compound SM30

K ₂ CO ₃ (4.1 g, 30.0 mmol, 3.0 equiv) to a solution of compound SM30-2 (4.2 g, 10.0 mmol, 1.0 equiv) and ethanolamine (1.8 g, 30.0 mmol, 3.0 equiv) in ACN (50 mL). , Cs ₂ CO ₃ (977 mg, 3.0 mmol, 0.3 equiv) and NaI (450 mg, 3.0 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was concentrated and purified by column chromatography on silica gel (PE/EA =10/1-3/1-1/1-0/1) to give compound SM30 (2.3 g, 58% yield) as a colorless oil. provided. LCMS: Rt: 1.010 min; MS m/z (ESI): 402.4 [M+H] ⁺ .

Manufacture of SM34:

Step 1: Preparation of Compound SM34-2

To a solution of compound SM22-1 (30 g, 98.2 mmol, 1.0 equiv) in DMF (400 mL) was added compound SM34-1 (36.4 g, 196.4 mmol, 2.0 equiv). The mixture was stirred at 90 °C for 16 hours. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (PE/EA = 100/1) to give compound SM34-2 (31.6 g, 86% yield) as a yellow oil.

Step 2: Preparation of Compound SM34-3

To a solution of compound SM34-2 (15.8 g, 42.5 mmol, 1.0 equiv) in EtOH (500 mL) was added hydrazine monohydrate (5.0 g, 85.0 mmol, 2.0 equiv). The mixture was stirred at reflux for 16 hours. LCMS showed the reaction to be complete. The mixture was filtered and washed with EtOH. The filtrate was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 20/1) to give compound SM34-3 (9.1 g, 88% yield) as a yellow oil.

Step 3: Preparation of Compound SM34-4

To a solution of compound SM34-3 (6.5 g, 26.9 mol, 1.2 equiv) in DCM (100 mL) was added compound W (4.4 g, 22.4 mmol, 1.0 equiv), HATU (12.8 g, 33.6 mmol, 1.5 equiv) and DIPEA ( 8.7 g, 67.2 mmol, 3.0 equiv) was added. The mixture was stirred at room temperature for 16 hours. The reaction mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel to give compound SM34-4 (7.4 g, 65.6% yield) as a yellow oil.

Step 4: Preparation of Compound SM34

DIPEA (6.9 g, 54.0 mmol, 3.0 equiv) and NaI ( 800 mg, 5.4 mmol, 0.3 eq) was added. The mixture was stirred at 70 °C for 10 hours. LCMS showed the reaction to be complete. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel to give compound SM34 (6.3 g, 88% yield) as a colorless oil. LCMS: Rt: 1.620 min; MS m/z (ESI): 399.5 [M+H] ⁺ .

Manufacture of SM38:

Compound 71-7 (600 mg, 1.25 mmol, 1.0 equiv), isopropylamine (739 mg, 12.5 mmol, 10.0 equiv), K ₂ CO ₃ (519 mg, 3.76 mmol, 3.0 equiv) in ACN (10 mL), A mixture of Cs ₂ CO ₃ (124 mg, 0.38 mmol, 0.3 equiv) and NaI (51 mg, 0.38 mmol, 0.3 equiv) was stirred at reflux overnight. LCMS showed product. The mixture was diluted with EA, washed with water and brine, dried and concentrated. The residue was purified by FCC to give compound SM38 (320 mg, 58.0% yield) as a colorless oil.

Manufacture of SM39:

To a solution of compound SM24 (10 g, 23.9 mmol, 1.0 equiv) in CH ₃ CN (150 mL) was added K ₂ CO ₃ (9.9 g, 71.7 mmol, 3.0 equiv), Cs ₂ CO ₃ (2.3 g, 7.17 mmol, 0.3 g). equiv), NaI (1.1 g, 7.17 mmol, 0.3 equiv), and compound SM6 (2.9 g, 47.8 mmol, 2.0 equiv) were added. The reaction mixture was stirred at 80 °C for 16 hours. The reaction mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (CH ₂ Cl ₂ :MeOH = 20:1-10:1) to give compound SM39 as a yellow oil (5.1 g, yield: 53%). LCMS: Rt: 0.880 min; MS m/z (ESI): 400.3 [M+H].

6.2 Example 2: Preparation of Compound 1.

Step 1: Preparation of compound 1-1

Compound A (1.26 g, 3 mmol, 1.5 equiv), Compound B (280 mg, 2 mmol, 1 equiv), DIEA (774 mg, 6 mmol, 3 equiv), and NaI in tetrahydrofuran (THF, 6 mL) (0.1 eq) was stirred overnight at 70 °C. The mixture was concentrated in vacuo and purified by silica gel column chromatography (MeOH:DCM=0:1 to 1:80) to give the desired product compound 1-1 (269 mg, 28.5% yield) as a yellow oil. LCMS: Rt: 1.000 min; MS m/z (ESI):482.5 [M+H] ⁺ .

Step 2: Preparation of compound 1-2

A mixture of compound 1-1 (269 mg, 0.56 mmol, 1 equiv) and SOCl ₂ (200 mg, 1.68 mmol, 3 equiv) in DCM (6 mL) was stirred overnight at 35 °C. The mixture was concentrated in vacuo to give the desired product compound 1-2 (313 mg, crude) as a yellow oil. LCMS: Rt: 0.970 min; MS m/z (ESI): 500.4 [M+H] ⁺ .

Step 3: Preparation of Compound 1

A catalyst of compound 1-2 (313mg, 0.63mmol, 1.2 equiv), compound C (211mg, 0.53mmol, 1 equiv), DIEA (205mg, 1.59mmol, 3 equiv) and NaI in THF (4mL). The mixture was stirred overnight at 70 °C. The mixture was concentrated in vacuo and purified by preparative HPLC to give compound 1 (79 mg, 14.6% yield) as a light brown oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.83-0.93 (m, 12H), 1.04-1.16 (m, 2H), 1.18-1.39 (m, 60H), 1.40-1.55 (m, 3H), 1.56- 1.74 (m, 9H), 1.86 (s, 2H), 2.25-2.39 (m, 5H), 2.56 (s, 3H), 2.70 (s, 3H), 3.62 (s, 2H), 3.89-4.04 (m, 4H). LCMS: Rt: 2.000 min; MS m/z (ESI): 863.7 [M+H] ⁺ .

The following compounds were prepared in a similar manner to compound 1 using the corresponding starting materials.

6.3 Example 3: Preparation of Compound 2.

Step 1: Preparation of Compound 2-1

1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDCI, 16.69 g, 87.05 mmol, 1.5 equiv) in a solution of 1-undecanol (10 g, 58.03 mmol, 1.0 equiv) in DCM (120 mL) ), 4-dimethylaminopyridine (DMAP, 1.42 g, 11.61 mmol, 0.2 equiv), DIEA (15 g, 116.06 mmol, 2.0 equiv), and 6-bromohexanoic acid (12.45 g, 63.84 mmol, 1.1 equiv) has been added The reaction mixture was stirred at 55 °C for 16 hours. TLC showed the reaction to be complete. Removal of the solvent and purification of the crude product by FCC provided compound 2-1 (8.6 g, 42.43%) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 4.08-4.05 (m, 2H), 3.55-3.52 (m, 2H), 2.34-2.30 (m, 2H), 1.83-1.76 (m, 2H), 1.69- 1.60 (m, 4H), 1.51–1.43 (m, 2H), 1.23 (s, 16H), 0.89–0.86 (m, 3H).

Step 2: Preparation of Compound 2-2

Compound D (275 mg, 2.386 mmol, 1.0 equiv), K ₂ CO ₃ (989 mg, 7.158 mmol, 3.0 equiv) to a solution of compound 2-1 (1 g, 2.863 mmol, 1.2 equiv) in ACN (20 mL). , Cs ₂ CO ₃ (233 mg, 0.7158 mmol, 0.3 equiv), and NaI (18 mg, 0.1193 mmol, 0.05 equiv) were added. The reaction mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent and purification of the crude product by FCC provided compound 2-2 (170 mg, 18.57%) as a yellow oil. LCMS: Rt: 0.811 min; MS m/z (ESI): 384.3 [M+H] ⁺ .

Step 3: Preparation of compound 2-3

To a solution of compound 2-2 (170 mg, 0.4432 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl ₂ (158 mg, 1.330 mmol, 3.0 equiv). The reaction mixture was stirred at 35 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent provided compound 2-3 (180 mg, crude) as a yellow oil. LCMS: Rt: 0.860 min; MS m/z (ESI): 402.3 [M+H] ⁺ .

Step 4: Preparation of Compound 2

Compound E (381 mg, 0.6715 mmol, 1.5 equiv) and NaI ( 20 mg) was added. The reaction mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete. After removal of the solvent, purification by preparative-HPLC provided compound 2 (35 mg, 8.37% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 4.07-4.04 (m, 2H), 3.9 (d, J = 5.6 Hz, 2H), 3.53 (m, 1H), 3.08-3.04 (m, 1H), 2.49 -2.37 (m, 9H), 2.32-2.25 (m, 5H), 1.98-1.88 (m, 4H), 1.66-1.58 (m, 9H), 1.49-1.38 (m, 7H), 1.26 (s, 63H) , 0.90–0.86 (m, 12H). LCMS: Rt: 0.994 min; MS m/z (ESI): 933.8 [M+H] ⁺ .

6.4 Example 4: Preparation of compound 3.

Step 1: Preparation of Compound 3-1

K ₂ CO ₃ (593 mg, 4.29 mmol, 3.0 equiv) to a solution of compound 2-1 (1.0 g, 2.86 mmol, 2.0 equiv) and compound F (145 mg, 1.43 mmol, 1.0 equiv) in ACN (30 mL). , Cs ₂ CO ₃ (140 mg, 0.429 mmol, 0.3 equiv) and NaI (64 mg, 0.429 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 48 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by silica gel column chromatography (DCM/MeOH=50/1-25/1) to give compound 3-1 (350 mg, 66% yield) as a yellow oil. LCMS: Rt: 0.800 min; MS m/z (ESI): 370.3 [M+H] ⁺ .

Step 2: Preparation of Compound 3-2

To a solution of compound 3-1 (200 mg, 0.54 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl ₂ (193 mg, 1.62 mmol, 3.0 equiv). The mixture was stirred at 30 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was concentrated under reduced pressure to give compound 3-2 (200 mg, 95%) as a yellow oil.

Step 3: Preparation of Compound 3

N, N-diisopropylethylamine (DIPEA, (202 Added mg, 1.56mmol, 3.0 equiv.) and NaI (24mg, 0.16mmol, 0.3 equiv.) The mixture was stirred at 70° C. for 16 hours. LCMS showed that the reaction was complete. The mixture was concentrated and aliquot- Purification by HPLC gave compound 3 (80 mg, 8% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.48-0.50 (m, 4H), 0.86-0.90 (m, 9H), 1.26-1.30 (m, 45H), 1.49-1.66 (m, 11H), 1.72- 1.77 (m, 1H), 2.28-2.32 (m, 4H), 2.52-2.76 (m, 10H), 3.52-3.58 (m, 2H), 3.96-3.98 (m, 2H), 4.04-4.07 (m, 2H) ). LCMS: Rt: 1.250 min; MS m/z (ESI): 751.6 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 3, using the corresponding starting materials.

6.5 Example 5: Preparation of compound 6.

Step 1: Preparation of Compound 6-1

Compound 2-1 (786 mg, 2.24 mmol, 1.2 equiv), Compound B (268 mg, 1.87 mol, 1 equiv), DIEA (724 mg, 5.61 mmol, 3 equiv), and NaI (0.1 equiv) in THF (10 mL) equivalents) was stirred overnight at 70 °C. The mixture was concentrated in vacuo and purified by silica gel column chromatography (MeOH:DCM=0:1 to 1:20) to give compound 6-1 (1.18 g, crude) as a light brown oil. LCMS: Rt: 0.910 min; MS m/z (ESI): 412.3 [M+H] ⁺ .

Step 2: Preparation of Compound 6-2

A mixture of compound 6-1 (412 mg, 1 mmol, 1 equiv) and SOCl ₂ (357 mg, 3 mmol, 3 equiv) in DCM (6 mL) was stirred overnight at 35 °C. The mixture was concentrated in vacuo to give compound 6-2 (430 mg, crude) as a yellow oil. LCMS: Rt: 0.930 min; MS m/z (ESI): 430.3 [M+H] ⁺ .

Step 3: Preparation of Compound 6

Catalytic amount of compound 6-2 (215mg, 0.5mmol, 1 equiv), compound C (150mg, 0.4mmol, 0.75 equiv), DIEA (195mg, 1.5mmol, 3 equiv) and NaI in THF (3mL) The mixture was stirred overnight at 70 °C. The mixture was concentrated in vacuo and purified by prep-HPLC to give compound 6 (15 mg, 12.8% yield) as a light brown oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.83-0.92 (m, 9H), 1.18-1.36 (m, 40H), 1.38-1.48 (m, 4H), 1.49-1.75 (m, 27H), 1.85- 2.15 (m, 5H), 2.16-2.27 (m, 1H), 2.30-2.39 (m, 3H), 3.11-3.25 (m, 2H), 3.35-3.48 (m, 1H), 3.93-3.99 (m, 2H) ), 4.01–4.11 (m, 2H). LCMS: Rt: 1.720 min; MS m/z (ESI): 793.6 [M+H] ⁺ .

6.6 Example 6: Preparation of Compound 8.

Step 1: Preparation of 8-1

To a solution of compound A (0.85 g, 1.98 mmol) in CH ₃ CN (50 mL) was added K ₂ CO ₃ (410 mg, 2.97 mmol), Cs ₂ CO ₃ (100 mg, 0.29 mmol), NaI (50 mg, 0.29 mmol). mmol) and compound G (127 mg, 0.99 mmol) were added. The reaction was stirred at 80 °C for 10 hours. The reaction mixture was concentrated in vacuo . The crude product was purified by flash column chromatography (CH ₂ Cl ₂ :MeOH =10:1) to give compound 8-1 as a yellow oil (300 mg, yield: 65%). LCMS: Rt: 0.88 min; MS m/z (ESI): 468.4 [M+H] ⁺ .

Step 2: Preparation of Compound 8-2

To a solution of compound 8-1 (300 mg, 0.64 mmol) in CH ₂ Cl ₂ (10 mL) was added SOCl ₂ (250 mg, 2.05 mmol). The reaction was stirred at 30 °C for 10 hours. The reaction mixture was concentrated in vacuo to give compound 8-2 as a yellow oil (310 mg, yield: 100%).

Step 3: Preparation of Compound 8

To a solution of compound 8-2 (300 mg, 0.62 mmol) in THF (10 mL) was added DIEA (240 mg, 1.85 mmol), NaI (100 mg, 0.65 mmol) and compound C (530 mg, 1.31 mmol). . The reaction was stirred at 70 °C for 10 hours. The reaction mixture was filtered and concentrated in vacuo . The crude product was purified by prep-HPLC to give compound 8 as a yellow oil (45 mg, yield: 8.5%).

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.87-0.90 (t, J = 6.8 Hz, 12H), 1.26 (m, 50H), 1.40-1.51 (m, 8H), 1.60-1.66 (m, 8H) ( m, 4H). LCMS: Rt: 1.740 min; MS m/z (ESI): 849.7 [M+H] ⁺ .

The following compounds were prepared in a similar manner to compound 8, using the corresponding starting materials.

6.7 Example 7: Preparation of Compound 10.

Step 1: Preparation of Compound 10-1

To a solution of compound H (446.0 mg, 1.0 mmol, 1.0 equiv) and ethanolamine (180.0 mg, 3.0 mmol, 3.0 equiv) in ACN (10.0 mL) was added Cs ₂ CO ₃ (97.5 mg, 0.3 mmol, 0.3 equiv), K ₂ CO ₃ (414.0 mg, 3.0 mmol, 3.0 equiv) and NaI (14.6 mg, 0.1 mmol, 0.1 equiv) were added at RT. The mixture was stirred at 85 °C for 16 hours. LCMS showed that the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH=1/0-20/1) to give compound 10-1 (0.35 g, 82% yield) as a yellow oil did LCMS: Rt: 0.942 min; MS m/z (ESI): 428.3 [M+H] ⁺ .

Step 2: Preparation of Compound 10-2

To a solution of compound H (1.0 g, 2.24 mmol, 1.0 equiv) and compound D (511.0 mg, 4.48 mmol, 2.0 equiv) in ACN (20.0 mL) was added Cs ₂ CO ₃ (218.0 mg, 0.67 mmol, 0.3 equiv), K ₂ CO ₃ (927.0 mg, 6.72 mmol, 3.0 equiv) and NaI (33.0 mg, 0.22 mmol, 0.1 equiv) were added at RT. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH=1/0-20/1) to give compound 10-2 (0.6 g, 56% yield) as a brown oil did LCMS: Rt: 0.950 min; MS m/z (ESI): 482.4 [M+H] ⁺ .

Step 3: Preparation of Compound 10-3

To a solution of compound 10-2 (0.2 g, 0.41 mmol, 1.0 equiv) in DCM (5.0 mL) was added SOCl ₂ (144.0 mg, 1.23 mmol, 3.0 equiv) at RT. The mixture was stirred for 16 hours. LCMS showed the reaction to be complete and the mixture was evaporated under reduced pressure to give compound 10-3 (0.23 g, crude) as a brown oil. LCMS: Rt: 1.330 min; MS m/z (ESI): 500.3 [M+H] ⁺ .

Step 4: Preparation of Compound 10

DIEA (193 mg, 1.5 mmol, 5.0 equiv) was added to a solution of compound 10-3 (150.0 mg, 0.3 mmol, 1.0 equiv) and compound 10-1 (192.0 mg, 0.45 mmol, 1.5 equiv) in THF (5.0 mL). was added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 10 (80.0 mg, 25% yield) as a brown oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.89 (m, 12H), 1.26-1.32 (m, 61H), 1.41-1.65 (m, 12H), 1.85-2.02 (m, 4H), 2.28- 2.61 (m, 14H), 3.00–3.12 (m, 1H), 3.53–3.55 (m, 2H), 3.97 (d, J = 5.6 Hz, 4H). LCMS: Rt: 2.520 min; MS m/z (ESI): 891.7 [M+H] ⁺ .

6.8 Example 8: Preparation of Compound 11.

Step 1: Preparation of Compound 11-A

Methanesulfonyl chloride (MsCl, 1.4 g, 12.0 mmol, 1.2 eq) was added dropwise. The mixture was stirred at room temperature for 2 hours. The reaction mixture was washed with water, brine, dried over Na ₂ SO ₄ and concentrated to give compound 11-A (3.1 g, 91% yield) as a yellow oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 6H), 1.26-1.32 (m, 29H), 3.00 (s, 3H), 4.11-4.13 (m, 2H).

Step 2: Preparation of Compound 11-1

To a solution of 11-A (18.0 g, 51.6 mmol, 1.0 equiv) in DMF (300 mL) was added potassium phthalimide (19.1 g, 103.2 mmol, 2.0 equiv). The mixture was stirred at 90 °C for 16 hours. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. Purification by silica gel column chromatography (PE/EA=100/1) provided compound 11-1 (14.6 g, 71% yield) as a colorless oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.85-0.88 (m, 6H), 1.24-1.29 (m, 28H), 1.82-1.89 (m, 1H), 3.56-3.58 (m, 2H), 7.72- 7.72 (m, 2H), 7.83–7.85 (m, 2H).

Step 3: Preparation of Compound 11-2

To a solution of compound 11-1 (14.6 g, 36.5 mmol, 1.0 equiv) in EtOH (400 mL) was added hydrazine monohydrate (3.65 g, 73.0 mmol, 2.0 equiv). The mixture was stirred at reflux for 16 hours. LCMS showed the reaction to be complete. The mixture was filtered and washed with EtOH. The filtrate was concentrated and purified by silica gel column chromatography (DCM/MeOH=100/1-50/1) to give compound 11-2 (6.9 g, 70% yield) as a yellow oil. LCMS: Rt: 1.260 min; MS m/z (ESI): 270.3 [M+H] ⁺ .

Step 4: Preparation of Compound 11-3

To a solution of compound 11-2 (6.9 g, 25.6 mmol, 1.0 equiv) in DCM (250 mL) was added 6-bromohexanoic acid (6.0 g, 30.7 mmol, 1.2 equiv), HATU (11.7 g, 30.7 mmol, 1.2 equiv). ) and DIPEA (9.9 g, 76.8 mmol, 3.0 eq) were added. The mixture was stirred at RT for 16 h. The reaction mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. Purification by silica gel column chromatography (PE/EA=10/1-8/1) provided compound 11-3 (7.1 g, 62% yield) as a yellow oil.

Step 5: Preparation of Compound 11-4

K ₂ CO ₃ (493 mg, 3.57 mmol, 3.0 equiv) to a solution of compound 11-3 (800 mg, 1.79 mmol, 1.5 equiv) and compound D (137 mg, 1.19 mmol, 1.0 equiv) in ACN (40 mL). , Cs ₂ CO ₃ (116 mg, 0.357 mmol, 0.3 equiv) and NaI (54 mg, 0.357 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by silica gel column chromatography (DCM/MeOH=10/1) to give compound 11-4 (400 mg, 70% yield) as a yellow oil. LCMS: Rt: 0.920 min; MS m/z (ESI): 481.4 [M+H] ⁺ .

Step 6: Preparation of Compound 11-5

To a solution of compound 11-4 (200 mg, 0.42 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl ₂ (150 mg, 1.26 mmol, 3.0 equiv). The mixture was stirred at 30 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was concentrated under reduced pressure to give compound 11-5 (200 mg, 95%) as a yellow oil. LCMS: Rt: 0.980 min; MS m/z (ESI): 499.3 [M+H] ⁺ .

Step 7: Preparation of compound 11-6

K ₂ CO ₃ (564 mg, 4.08 mmol, 3.0 equiv) to a solution of compound 11-3 (610 mg, 1.36 mmol, 1.0 equiv) and ethanolamine (166 mg, 2.72 mmol, 2.0 equiv) in ACN (20 mL). , Cs ₂ CO ₃ (134 mg, 0.41 mmol, 0.3 equiv) and NaI (61 mg, 0.41 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. Purification by silica gel column chromatography (DCM/MeOH=10/1) provided compound 11-6 (320 mg, 55% yield) as a yellow oil. LCMS: Rt: 0.96 min; MS m/z (ESI): 427.3 [M+H] ⁺ .

Step 8: Preparation of Compound 11

To a solution of compound 11-5 (175 mg, 0.35 mmol, 1.0 equiv) and compound 11-6 (150 mg, 0.35 mmol, 1.0 equiv) in THF (10 mL) DIPEA (136 mg, 1.05 mmol, 3.0 equiv) and NaI (10 mg, 0.07 mmol, 0.2 eq) was added. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was concentrated and purified by pre-HPLC to give compound 11 (34 mg, 11% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.34 (m, 64H), 1.41-1.54 (m, 6H), 1.59-1.77 (m, 6H), 1.99- 2.07 (m, 2H), 2.17-2.21 (m, 4H), 2.47-2.71 (m, 10H), 3.15-3.18 (m, 4H), 3.55-3.62 (m, 2H), 5.73-5.84 (m, 2H) ). LCMS: Rt: 1.610 min; MS m/z (ESI): 889.8 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 11 using the corresponding starting materials.

6.9 Example 9: Preparation of Compound 15.

To a solution of compound 11-6 (221 mg, 0.52 mmol, 1.0 equiv) and compound 10-3 (259 mg, 0.52 mmol, 1.0 equiv) in THF (10 mL), DIPEA (202 mg, 1.56 mmol, 3.0 equiv) and NaI (16 mg, 0.104 mmol, 0.2 eq) was added. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was concentrated and purified by pre-HPLC to give compound 15 (121 mg, 26% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.92 (m, 12H), 1.26-1.30 (m, 67H), 1.46-1.72 (m, 12H), 1.98-2.09 (m, 2H), 2.15- 2.19 (m, 2H), 2.31–2.71 (m, 8H), 3.16–3.23 (m, 2H), 3.56–3.66 (m, 2H), 3.95–4.03 (m, 2H), 7.30 (s, 1H). LCMS: Rt: 1.68 min; MS m/z (ESI): 890.7 [M+H] ⁺ .

The following compounds were prepared in a similar manner to compound 15 using the corresponding starting materials.

6.10 Example 10: Preparation of Compound 18.

Step 1: Preparation of Compound 18-1

To a stirred solution of dimethyl malonate (5 g, 38 mmol, 1 equiv) in DMF (76 mL) was added sodium hydride (3.8 g, 95 mmol, 2.5 equiv) at room temperature under an argon atmosphere. After 0.5 h, (Z)-1-bromodec-4-ene (21 g, 95 mmol, 2.5 equiv) was added to the mixture and the mixture was stirred overnight at room temperature. The mixture was quenched with water (130 mL) and extracted with EA (3 x 65 mL); The combined organic layers were washed with brine (2 x 65 mL), dried over anhydrous sodium sulfate, and concentrated under vacuum. Purification by silica gel column chromatography (EA:PE=0% - 5%) provided compound 18-1 (10.5 g, 68.2 % yield) as a colorless oil.

Step 2: Preparation of Compound 18-2

A mixture of compound 18-1 (10.5 g, 25.7 mmol, 1 equiv) and LiCl (10.9 g, 257 mmol, 10 equiv) in DMF (180 mL) was stirred at 120 °C for 24 hours. The mixture was diluted with water, extracted with EA, washed with brine, dried and concentrated. The residue was purified by silica gel column chromatography (EA:PE=0%-5%) to give compound 18-2 (7.5 g, 83.2% yield) as a colorless oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.80-0.95 (m, 6H), 1.18-1.37 (m, 16H), 1.40-1.52 (m, 2H), 1.54-1.66 (m, 3H), 1.90- 2.08 (m, 7H), 2.24–2.41 (m, 1H), 3.60–3.75 (m, 3H), 5.24–5.49 (m, 4H).

Step 3: Preparation of Compound 18-3

A mixture of compound 18-2 (7.5 g, 21.5 mmol, 1 equiv) and LiAlH ₄ (1.6 g, 43 mmol, 2 equiv) in THF (100 mL) was stirred overnight at 80 °C. The mixture was quenched with water and filtered; The filtrate was concentrated and purified by silica gel column chromatography (EA:PE=0% to 5%) to give compound 18-3 (6.2 g, 89.8% yield) as a yellow oil.

Step 4: Preparation of Compound 18-4

Compound 18-3 (1.8 g, 5.5 mmol, 1 equiv), 6-bromohexanoic acid (1.3 g, 6.6 mmol, 1.2 equiv), DIEA (2.14 g, 16.5 mmol, 3 equiv) in DCM (20 mL), A mixture of DMAP (337 mg, 2.76 mmol, 0.5 equiv) and EDCI (1.27 g, 6.6 mmol, 1.2 mmol) was stirred overnight at 40 °C. The mixture was concentrated and purified by silica gel column chromatography (EA:PE=0%-2%) to provide compound 18-4 (2.1 g, 75.2 % yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.83-0.93 (m, 6H), 1.23-1.40 (m, 20H), 1.41-1.54 (m, 2H), 1.62-1.72 (m, 3H), 1.83- 2.10 (m, 10H), 2.25–2.46 (m, 2H), 3.18–3.52 (m, 2H), 3.87–4.03 (m, 2H), 5.18–5.58 (m, 4H).

Step 5: Preparation of Compound 18-5

Compound 18-4 (300 mg, 0.6 mmol, 1 equiv), Compound B (133 mg, 0.9 mmol, 1.5 equiv), DIEA (232 mg, 1.8 mmol, 3 equiv) and sodium iodide (30 equiv) in THF (6 mL) mg, 0.2 mmol, 0.3 eq) was stirred overnight at 70 °C. The mixture was concentrated and purified by silica gel column chromatography (MeOH:DCM=0% to 10%) to give compound 18-5 (147 mg, 43.6% yield) as a colorless oil. LCMS: Rt: 0.900 min; MS m/z (ESI): 562.4 [M+H] ⁺ .

Step 6: Preparation of Compound 18-6

A mixture of compound 18-5 (147 mg, 0.26 mmol, 1 equiv) and SOCl ₂ (93 mg, 0.78 mmol, 3 equiv) in DCM (5 mL) was stirred overnight at 35 °C. The mixture was concentrated to give compound 18-6 (137 mg, 90.2% yield). LCMS: Rt: 1.210 min; MS m/z (ESI): 580.4 [M+H] ⁺ .

Step 7: Preparation of compound 18-7

Compound 18-4 (1971 mg, 2 mmol, 1 equiv), 2-aminoethanol (147 mg, 2.4 mmol, 1.2 mmol), K ₂ CO ₃ (828 mg, 6 mmol, 3 equiv) in ACN (40 mL) , Cs ₂ CO ₃ (20 mg, 0.06 mmol, 0.03 equiv) and NaI (15 mg, 0.1 mmol, 0.05 equiv) were stirred overnight at 80 °C. The mixture was concentrated and purified by silica gel column chromatography (MeOH:DCM=0% to 10%) to give compound 18-7 (610 mg, 65.4% yield) as a brown oil. LCMS: Rt: 0.910 min; MS m/z (ESI): 480.4 [M+H] ⁺ .

Step 8: Preparation of Compound 18

Compound 18-6 (137mg, 0.24mmol, 1 equiv), compound 18-7 (138mg, 0.29mmol, 1.2 equiv), sodium iodide (10mg, 0.07mmol, 0.3 equiv) and DIEA in THF (5mL) (93 mg, 0.72mmol, 3 eq) was stirred overnight at 70 °C. The mixture was concentrated under vacuum. Purification by preparative-HPLC provided compound 18 (21 mg, 8.7% yield) as a light brown oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.83-0.92 (m, 12H), 1.15-1.23 (m, 3H), 1.24-1.36 (m, 47H), 1.37-1.52 (m, 5H), 1.56- 1.69 (m, 12H), 1.71-1.79 (m, 4H), 1.95-2.05 (m, 14H), 2.21-2.33 (m, 4H), 2.42-2.60 (m, 9H), 3.49-3.56 (m, 1H) ), 3.95–3.99 (m, 3H), 5.30–5.42 (m, 8H). LCMS: Rt: 0.640 min; MS m/z (ESI): 1023.7 [M+H] ⁺ .

6.11 Example 11: Preparation of Compound 19.

Step 1: Preparation of Compound 19-1

To a solution of cis-4-decen-1-ol (1.56 g, 10.0 mmol, 1.0 equiv) and 6-bromohexanoic acid (2.9 g, 15.0 mmol, 1.5 equiv) in 30 mL of dichloromethane was added DIEA (3.87 g, 30.0 mmol, 3.0 equiv) and DMAP (244.0 mg, 2.0 mmol, 0.2 equiv) were added. After stirring for 5 min at ambient temperature, EDCI (2.86 g, 15.0 mmol, 1.5 equiv) was added and the reaction mixture was stirred at room temperature overnight after which time TLC showed complete disappearance of the starting alcohol. The reaction mixture was diluted with dichloromethane (300 mL) and washed with saturated NaHCO ₃ (100 mL), water (100 mL) and brine (100 mL). The combined organic layers were dried over Na ₂ SO ₄ and the solvent removed in vacuo. Evaporation of the solvent gave the crude product which was purified by silica gel column chromatography (0-2% EA in PE) to give compound 19-1 (1.3 g, 39%) as a colorless oil.

Step 2: Preparation of Compound 19-2

Cs ₂ CO ₃ (195.0 mg, 0.6 mmol, 0.3 equiv) to a solution of compound 19-1 (664.0 mg, 2.0 mmol, 1.0 equiv) and compound B (572.0 mg, 4.0 mmol, 2.0 equiv) in ACN (10.0 mL). , K ₂ CO ₃ (828.0 mg, 6.0 mmol, 3.0 equiv) and NaI (28.0 mg, 0.2 mmol, 0.1 equiv) were added at RT. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction to be complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH=1/0-20/1) to give compound 19-2 (0.37 g, 47% yield) as a yellow oil did LCMS: Rt: 0.740 min; MS m/z (ESI): 396.3 [M+H] ⁺ .

Step 3: Preparation of Compound 19-3

To a solution of compound 19-2 (170.0 mg, 0.43 mmol, 1.0 equiv) in DCM (5.0 mL) was added SOCl ₂ (152.0 mg, 1.29 mmol, 3.0 equiv) at RT. The mixture was stirred for 16 hours. LCMS showed the reaction to be complete and concentration under reduced pressure provided compound 19-3 (0.2 g, crude) as a brown oil. LCMS: Rt: 0.785 min; MS m/z (ESI): 414.3 [M+H] ⁺ .

Step 4: Preparation of Compound 19

DIEA (309.0 mg, 2.4 mmol, 5.0 equiv) was added to a solution of compound 19-3 (200.0 mg, 0.48 mmol, 1.0 equiv) and compound 10-1 (247.0 mg, 0.58 mmol, 1.2 equiv) in THF (5.0 mL). was added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete, concentration under reduced pressure and purification by prep-HPLC provided compound 19 (80.0 mg, 21% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.89 (m, 9H), 1.26-1.45 (m, 43H), 1.60-1.80 (m, 17H), 1.98-2.16 (m, 4H), 2.28- 2.61 (m, 15H), 3.52–3.54 (m, 2H), 3.96–4.08 (m, 4H), 5.26–5.46 (m, 2H). LCMS: Rt: 1.137 min; MS m/z (ESI): 805.7 [M+H] ⁺ .

6.12 Example 12: Preparation of Compound 20.

Step 1: Preparation of Compound 20-1

To a solution of myristyl alcohol (2.1 g, 10.0 mmol, 1.0 equiv) in THF (20.0 mL) was added NaH (0.8 g, 20.0 mmol, 2.0 equiv). The mixture was stirred for 2 h at RT, then 1-bromo-2,3-epoxypropane (2.5 g, 15.0 mmol, 1.5 equiv) was added and stirred at 70 °C for 16 h. LCMS showed that the reaction was complete, water was added, extracted with EA, concentrated and purified by FCC (PE/EA=20/1) to give compound 20-1 (2.6 g, 96% yield) as a colorless oil. provided as. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.89 (m, 3H), 1.21-1.35 (m, 20H), 1.58-1.67 (m, 2H), 2.60-2.78 (m, 1H), 2.79- 2.81 (m, 1H), 3.13–3.17 (m, 1H), 3.36–3.50 (m, 3H), 3.51–3.72 (m, 1H).

Step 2: Preparation of Compound 20-2

To a solution of cyclobutanone (840 mg, 12.0 mmol, 1.2 equiv) in MeOH (10 mL) was added 2-(benzyloxy)ethan-1-amine (1.5 g, 10.0 mmol, 1.0 equiv). The mixture was stirred at 25 °C for 2 h. NaCNBH ₃ (1.0 g, 15.0 mmol, 1.5 equiv) was then added to the mixture. The mixture was stirred at 25 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH=20/1) to give compound 20-2 (1.0 g, crude) as a yellow oil.

Step 3: Preparation of Compound 20-3

A solution of compound 20-1 (0.8 g, 2.96 mmol, 1.0 equiv) and compound 20-2 (1.0 g, 3.84 mmol, 1.3 equiv) in EtOH (10.0 mL) was stirred at 70 °C for 16 h. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by FCC (DCM/MeOH =30/1) to give compound 20-3 (0.5 g, 35% yield) as a yellow oil. LCMS: Rt: 0.840 min; MS m/z (ESI): 476.3 [M+H] ⁺ .

Step 4: Preparation of Compound 20-4

To a solution of compound 20-3 (475 mg, 1.0 mmol, 1.0 equiv) in THF (10.0 mL) was added NaH (160 mg, 4.0 mmol, 4.0 equiv). The mixture was stirred for 2 h at RT, then C ₈ H ₁₇ Br (576 mg, 3.0 mmol, 3.0 equiv) was added and stirred at 70 °C for 16 h. LCMS showed that the reaction was complete, water was added, extracted with EA, concentrated and purified by FCC (PE/EA=20/1) to give compound 20-4 (300 mg, 51% yield) as a colorless oil. provided as. LCMS: Rt: 1.280 min; MS m/z (ESI): 588.4 [M+H] ⁺ .

Step 5: Preparation of Compound 20-5

To a solution of compound 20-4 (250 mg, 0.43 mmol, 1.0 equiv) in EA (10 mL) was added Pd/C (25.0 mg) and HCl (5 drops). The mixture was stirred under H ₂ at RT for 16 hours. LCMS showed the reaction to be complete, filtered and concentrated to give compound 20-5 (250 mg, crude) as a yellow oil. LCMS: Rt: 1.023 min; MS m/z (ESI): 498.4 [M+H] ⁺ .

Step 6: Preparation of Compound 20-6

To a solution of compound 20-5 (240 mg, 0.5 mmol, 1.0 equiv) in DCM (5.0 mL) was added SOCl ₂ (177.0 mg, 1.5 mmol, 3.0 equiv) at RT. The mixture was stirred for 16 hours. LCMS showed the reaction to be complete and the mixture was concentrated under reduced pressure to give compound 20-6 (0.27 g, crude) as a brown oil.

Step 7: Preparation of Compound 20

DIEA (148.0 mg, 1.1 mmol, 5.0 equiv) was added to a solution of compound 20-6 (120.0 mg, 0.23 mmol, 1.0 equiv) and compound 10-1 (120.0 mg, 0.28 mmol, 1.2 equiv) in THF (5.0 mL). was added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete, the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 20 (30.0 mg, 14% yield) as a yellow oil.

^1H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.89 (m, 12H), 1.21-1.35 (m, 65H), 1.50-1.65 (m, 11H), 1.98-2.00 (m, 3H), 2.28- 2.32 (m, 2H), 2.53–2.62 (m, 9H), 3.40–3.59 (m, 10H), 3.96 (d, J = 5.6 Hz, 2H). LCMS: Rt: 4.600 min; MS m/z (ESI): 907.8 [M+H] ⁺ .

6.13 Example 13: Preparation of Compound 22.

Step 1: Preparation of Compound 22-1

To a mixture of NaH (3 g, 74.07 mmol, 2.5 equiv) in DMF (30 mL) was added dimethyl malonate (4 g, 30 mmol, 1.0 equiv) at 0 °C under N ₂ . The reaction mixture was stirred at 0 °C for 0.5 h. 1-Bromoheptane (13.4 g, 75 mmol, 2.5 equiv) in DMF (30 mL) was added. The reaction mixture was stirred at RT for 16 h. TLC showed the reaction to be complete. The reaction mixture was quenched with water and washed with EA. The organic layer was separated and dried over Na ₂ SO ₄ . Removal of the solvent and purification by FCC provided compound 22-1 (5.3 g, 53.78%) as a colorless oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 3.71 (s, 6H), 1.88-1.84 (m, 4H), 1.31-1.26 (m, 16H), 1.14-1.10 (m, 4H), 0.89-0.86 ( m, 6H).

Step 2: Preparation of Compound 22-2

To a solution of compound 22-1 (5.3 g, 16.13 mmol, 1.0 equiv) in DMF (100 mL) was added LiCl (6.8 g, 161.3 mmol, 10.0 equiv). The reaction mixture was stirred at 120 °C for 12 hours. TLC showed the reaction to be complete. The reaction mixture was quenched with water and washed with EA. The organic layer was separated and dried over Na ₂ SO ₄ . Removal of the solvent and purification by FCC provided compound 22-2 (3.4 g, 78.07%) as a colorless oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 3.67 (s, 3H), 2.33-2.31 (m, 1H), 1.60-1.40 (m, 6H), 1.25 (s, 18H), 0.89-0.86 (m, 6H).

Step 3: Preparation of Compound 22-3

To a solution of compound 22-2 (3.4 g, 12.57 mmol, 1.0 equiv) in THF (60 mL) was added LiAlH ₄ (955 mg, 25.14 mmol, 2.0 equiv) slowly at 0 °C. The reaction mixture was stirred at reflux for 1 hour. TLC showed the reaction to be complete. After cooling to 0 °C, the mixture was mixed with water (1.3 mL), 15% aq. It was quenched by sequential addition of NaOH (1.3 mL) and water (3.9 mL). The resulting mixture was diluted with EA and the precipitate was removed by filtration. The filtrate was concentrated under reduced pressure and the crude product was purified by FCC to give compound 22-3 (2.3 g, 75.48%) as a yellow oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 3.54 (d, J = 5.6 Hz, 2H), 1.46-1.40 (m, 2H), 1.27 (s, 24H), 0.90-0.87 (m, 6H).

Step 4: Preparation of Compound 22-4

To a solution of compound 22-3 (1 g, 4.125 mmol, 1.0 equiv) in DCM (15 mL) was added 6-bromohexanoic acid (0.966 g, 4.950 mmol, 1.2 equiv), EDCI (1.19 g, 6.188 mmol, 1.5 equiv). ), DMAP (101 mg, 0.8250 mmol, 0.2 equiv), and DIEA (1.07 g, 8.250 mmol, 2.0 equiv) were added. The reaction mixture was stirred at 50 °C for 16 hours. TLC showed the reaction to be complete. Removal of the solvent and purification by FCC provided compound 22-4 (1 g, 57.79%) as a yellow oil.

Step 5: Preparation of Compound 22-5

Ethanolamine (49 mg, 0.79 mmol, 1.0 equiv), K ₂ CO ₃ (329 mg, 2.384 mmol, 3.0 equiv) to a solution of compound 22-4 (0.33 g, 0.79 mmol, 1.0 equiv) in ACN (15 mL). , Cs ₂ CO ₃ (78 mg, 0.2384 mmol, 0.3 equiv), and NaI (6 mg, 0.0397 mmol, 0.05 equiv) were added. The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent and purification by FCC provided compound 22-5 (280 mg, 47.73%) as a yellow oil.

Step 4: Preparation of Compound 22

DIEA (413.0 mg, 3.2 mmol, 5.0 equiv) was added to a solution of compound 22-5 (230.0 mg, 0.53 mmol, 1.0 equiv) and compound 6-2 (257.0 mg, 0.64 mmol, 1.2 equiv) in THF (10.0 mL). was added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 22 (100.0 mg, 24% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.89 (m, 9H), 1.26-1.35 (m, 52H), 1.46-1.49 (m, 3H), 1.60-1.65 (m, 8H), 1.78 ( s, 3H), 2.28–2.32 (m, 5H), 2.49–2.60 (m, 10H), 3.54 (s, 2H), 3.95–4.06 (m, 4H). LCMS: Rt: 1.250 min; MS m/z (ESI): 793.7 [M+H] ⁺ .

6.14 Example 14: Preparation of Compound 25.

Step 1: Preparation of Compound 25-2

To a mixture of compound 25-1 (5 g, 23.25 mmol, 1.0 equiv) in CH ₃ CN (200 mL) was added BnNH ₂ (5 g, 46.5 mmol, 2.0 equiv) and K ₂ CO ₃ (9.64 g, 69.75 mmol, 3.0 equiv). equivalent) was added. The reaction mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound 25-2 (3.0 g, 53% yield) as a colorless oil. LCMS: Rt: 0.740 min; MS m/z (ESI): 242.1 [M+H] ⁺ .

Step 2: Preparation of Compound 25-4

A mixture of compound 25-2 (2.5 g, 10.36 mmol, 1.0 equiv) and compound 25-3 (5.56 g, 20.72 mmol, 2.0 equiv) in EtOH (100 mL) was stirred at 70 °C for 10 h. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound 25-4 (2.5 g, 47 % yield) as a yellow oil. LCMS: Rt: 1.320 min; MS m/z (ESI): 510.4 [M+H] ⁺ .

Step 3: Preparation of Compound 25-5

To a mixture of NaH (710 mg, 17.65 mmol, 6.0 equiv) in THF (60 mL) was added compound 25-4 (1.5 g, 2.94 mmol, 1.0 equiv) at RT under N ₂ . The reaction mixture was stirred at RT for 2 h. C ₈ H ₁₇ Br (2.27 g, 11.77 mmol, 4.0 equiv) was added to this. The reaction mixture was stirred at 70 °C for 10 hours. LCMS showed the reaction to be complete. Mixture power in water and washed with EA. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound 25-5 (0.8 g, 43% yield) as a yellow oil. LCMS: Rt: 0.733 min; MS m/z (ESI): 622.5 [M+H] ⁺ .

Step 4: Preparation of compound 25-6

To a solution of compound 25-5 (0.8 g, 1.29 mmol, 1.0 equiv) in ethyl acetate (100 mL) was added Pd/C (1.0 g). The reaction mixture was stirred under H ₂ for 48 hours at RT. LCMS showed the reaction to be complete. The mixture was filtered through diatomaceous earth. Removal of the solvent gave compound 25-6 (350 mg, 61% yield) as a yellow oil. LCMS: Rt: 1.040 min; MS m/z (ESI): 442.4 [M+H] ⁺ .

Step 5: Preparation of Compound 25

Compound 25-7 (200 mg, 0.4 mmol, 0.5 equiv) in a mixture of compound 25-6 (350 mg, 0.8 mmol, 1.0 equiv), DIEA (200 mg, 1.6 mmol, 2.0 equiv) in THF (20 mL); NaI (60 mg) was added. The reaction mixture was stirred at 70 °C for 10 hours. LCMS showed the reaction to be complete. After removal of the solvent, the residue was purified by preparative-HPLC to give the title compound (20 mg, 12% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.87 (t, J = 8 Hz, 12H), 1.26-1.97 (m, 91H), 2.19-2.64 (m, 10H), 3.28-3.53 (m, 9H) . LCMS: Rt: 0.627 min; MS m/z (ESI): 919.8 [M+H] ⁺ .

6.15 Example 15: Preparation of Compound 26.

Step 1: Preparation of Compound 26-2

Cs ₂ CO ₃ (95 mg, 0.34 mmol, 0.3 equiv) to a solution of compound 26-1 (500 mg, 1.12 mmol, 1.0 equiv) and compound SM1 (170 mg, 2.24 mmol, 2.0 equiv) in ACN (10 mL). , K ₂ CO ₃ (465 mg, 3.36 mmol, 3.0 equiv) and NaI (14 mg, 0.1 mmol, 0.1 equiv) were added at RT. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH = 1/0-20/1) to give compound 26-2 (500 mg, 81% yield) as a yellow oil did LCMS: Rt: 1.680 min; MS m/z (ESI): 442.4 [M+H] ⁺ .

Step 2: Preparation of Compound 26-3

To a solution of compound 26-2 (100 mg, 0.23 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl ₂ (82 mg, 0.69 mmol, 3.0 equiv) at RT. The mixture was stirred at 35 °C for 16 hours. LCMS showed the reaction to be complete and the mixture was evaporated under reduced pressure to give compound 26-3 (100 mg, crude) as a yellow oil. LCMS: Rt: 0.920 min; MS m/z (ESI): 460.3 [M+H] ⁺ .

Step 3: Preparation of Compound 26

DIEA (413 mg, 3.2 mmol, 5.0 equiv) and NaI ( 5 mg, 0.02 mmol, 0.1 equiv) was added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 26 (20 mg, 10% yield) as a colorless oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.39 (m, 59H), 1.58-1.68 (m, 9H), 2.29-2.34 (m, 4H), 2.77- 3.24 (m, 16H), 3.73 (s, 2H), 3.95–3.97 (m, 4H). LCMS: Rt: 1.760 min; MS m/z (ESI): 851.8 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 26 using the corresponding starting materials.

6.16 Example 16: Preparation of Compound 28.

Step 1: Preparation of compound 28-2

A mixture of compound 28-1 (1 g, 10 mmol, 1.0 equiv), SM6 (0.9 g, 15 mmol, 1.5 equiv), 2 drops of AcOH in MeOH (20 mL) was stirred overnight at RT. A reagent of NaBH ₃ CN (0.9 g, 15 mmol, 1.5 equiv) was added to the mixture and stirred for 1 hour. The mixture was quenched with water, extracted over ethyl acetate, concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product compound 28-2 (893 mg, 61.6% yield) as a yellow color Served as an oil. LCMS: Rt: 0.380 min; MS m/z (ESI): 146.2 [M+H] ⁺ .

Step 2: Preparation of Compound 28-3

Compound 26-1 (250 mg, 0.56 mmol, 1.0 equiv), Compound 28-1 (243 mg, 1.68 mmol, 3.0 equiv), K ₂ CO ₃ (232 mg, 1.68 mmol, 3.0 equiv) in ACN (10 mL) A mixture of ,Cs ₂ CO ₃ (7 mg, 0.02 mmol, 0.03 equiv) and sodium iodide (30 mg, 0.2 mmol, 0.3 equiv) was stirred overnight at 80 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product compound 28-3 (122 mg, 42.7% yield) as a yellow oil. LCMS: Rt: 0.910 min; MS m/z (ESI): 512.4 [M+H] ⁺ .

Step 3: Preparation of Compound 28-4

A mixture of compound 28-3 (122 mg, 0.24 mmol, 1.0 equiv) and SOCl ₂ (85 mg, 0.72 mmol, 3.0 equiv) in DCM (5 mL) was stirred overnight at 35 °C. The mixture was concentrated to give the desired product compound 28-4 (125 mg, crude) as a yellow oil. LCMS: Rt: 1.350 min; MS m/z (ESI): 530.4 [M+H] ⁺ .

Step 4: Preparation of Compound 28

Compound 28-4 (125mg, 0.24mmol, 1.0 equiv), compound SM2 (100mg, 0.23mmol, 1.0 equiv), sodium iodide (20mg, 0.13mmol, 0.6 equiv) and DIEA (155 mg, 0.13mmol, 0.6 equiv) in THF (5mL) mg, 1.20mmol, 5.0 equiv) was stirred overnight at 70°C. The mixture was concentrated under vacuum. The residue was purified by prep-HPLC to give the desired product compound 28 (23 mg, 10.6% yield) as a yellow oil.

^1H NMR (400 MHz, CDCl ₃ ) δ: 0.82-0.94 (m, 12H), 1.17-1.39 (m, 60H), 1.49-1.73 (m, 13H), 1.95-2.06 (m, 1H), 2.17- 2.37 (m, 6H), 2.40–3.11 (m, 11H), 3.27–3.45 (m, 2H), 3.90–3.97 (m, 4H), 3.99–4.09 (m, 2H). LCMS: Rt: 2.240 min; MS m/z (ESI): 921.8 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 28 using the corresponding starting materials.

6.17 Example 17: Preparation of Compound 37.

Step 1: Preparation of Compound 37-1

A mixture of compound SM2 (200 mg, 0.47 mmol, 1.0 equiv), compound SM3 (154 mg, 0.93 mmol, 2.0 equiv), DIEA (300 mg, 2.35 mmol, 5.0 equiv) in THF (20 mL) was stirred at reflux overnight. It became. LCMS showed the target product. The mixture was concentrated, diluted with ethyl acetate, washed with water and brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by pre-HPLC to give compound 37-1 (180 mg, 82% yield) as a yellow oil. LCMS: Rt: 0.940 min; MS m/z (ESI): 519.4 [M+H] ⁺ .

Step 2: Preparation of Compound 37-2

A mixture of compound 37-1 (180 mg, 0.35 mmol, 1.0 equiv) and SOCl ₂ (205 mg, 1.7 mmol, 5.0 equiv) in DCM (5 mL) was stirred overnight at 35 °C. The mixture was concentrated to give the desired product compound 37-2 (210 mg, crude) as a yellow oil.

Step 3: Preparation of Compound 37

Compound 37-2 (210 mg, 0.35 mmol, 1.0 equiv), compound SM2 (180 mg, 0.42 mmol, 1.2 equiv), sodium iodide (15 mg, 0.1 mmol, 0.3 equiv) and DIEA (135 mg, 0.1 mmol, 0.3 equiv) in THF (5 mL) mg, 1.1 mmol, 3.0 eq) was stirred overnight at 70 °C. The mixture was concentrated under vacuum. The residue was purified by preparative-HPLC to give the desired product compound 37 (43 mg, 12.4% yield) as a pale yellow oil. LCMS: Rt: 1.740 min; MS m/z (ESI): 928.7 [M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26 (s, 62H), 1.38-1.43 (m, 5H), 1.61-1.64 (m, 4H), 2.26-2.30 ( m, 4H), 2.41-2.44 (m, 4H), 2.51-2.57 (m, 6H), 3.50-3.52 (m, 2H), 3.57 (s, 2H), 3.96 (d, J = 5.6 Hz, 4H) , 7.27–7.29 (m, 2H), 8.53–8.54 (m, 2H).

6.18 Example 18: Preparation of Compound 43.

Step 1: Preparation of Compound 43-2

Compound 43-1 (5.0 g, 14.3 mmol, 1.0 equiv), Compound D (2.5 g, 17.2 mmol, 1.2 equiv), K ₂ CO _{3 (} 5.9 g, 42.9 mmol, 3.0 equiv), Cs in ACN (60 mL) A mixture of ₂ CO ₃ (1.4 g, 4.3 mmol, 0.3 equiv) and NaI (645 mg, 0.43 mmol, 0.3 equiv) was stirred at reflux overnight. The mixture was diluted with water, extracted with ethyl acetate, concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product compound 43-2 (2.6 g, 44.2% yield) as a yellow color Served as an oil. LCMS: Rt: 0.800 min; MS m/z (ESI): 412.3 [M+H] ⁺ .

Step 2: Preparation of Compound 43-3

A mixture of compound 43-2 (400 mg, 0.97 mmol, 1.0 equiv) and SOCl ₂ (580 mg, 4.9 mmol, 5.0 equiv) in DCM (10 mL) was stirred overnight at 35 °C. The mixture was concentrated to give the desired product compound 43-3 (440 mg, crude) as a yellow oil.

Step 3: Preparation of Compound 43

Compound SM4 (210 mg, 0.47 mmol, 1.0 equiv), compound 43-3 (240 mg, 0.57 mmol, 1.2 equiv), sodium iodide (21 mg, 0.1 mmol, 0.3 equiv) and DIEA (182 mg, 1.4 mmol, 3.0 eq) was stirred overnight at 70 °C. The mixture was concentrated under vacuum. The residue was purified by prep-HPLC to give the desired product compound 43 (86 mg, 21.8% yield) as a brown oil. LCMS: Rt: 1.190 min; MS m/z (ESI): 835.7 [M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 9H), 1.14-1.26 (m, 59H), 1.44-1.46 (m, 4H), 1.60-1.67 (m, 6H), 1.77- 1.79 (m, 4H), 2.28-2.32 (m, 4H), 2.42-2.50 (m, 8H), 2.59 (s, 2H), 3.52-3.53 (m, 2H), 3.96 (d, J = 5.6 Hz, 2H), 4.03–4.07 (m, 2H).

The following compounds were prepared in an analogous manner to compound 43 using the corresponding starting materials.

6.19 Example 19: Preparation of compound 50.

Step 1: Preparation of Compound 50-2

To a solution of compound 50-1 (600 mg, 5.60 mmol, 1.0 equiv) in MeOH (30 mL) was added compound SM5 (841 mg, 5.60 mmol, 1.0 equiv) and AcOH (1 drop). The mixture was stirred at RT for 2 h. Then NaCNBH ₃ (387 mg, 6.16 mmol, 1.1 equiv) was added and the resulting mixture was stirred at RT for 16 h. LCMS showed the reaction to be complete. The mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 30/1) to give the title compound (810 mg, 60% yield) as a yellow oil. LCMS: Rt: 0.737 min; MS m/z (ESI): 242.1 [M+H] ⁺ .

Step 2: Preparation of Compound 50-3

To a solution of compound 50-2 (600 mg, 2.48 mmol, 1.0 equiv) in MeOH (10 mL) was added Pd/C (60 mg) and concentrated HCl (3 drops). The mixture was stirred at RT under H ₂ for 16 h. LCMS showed the reaction to be complete. The mixture was filtered through a pad of celite and rinsed with MeOH. Filtration was concentrated to give the title compound (345 mg, 91% yield) as a yellow oil. LCMS: Rt: 0.320 min; MS m/z (ESI): 152.2 [M+H] ⁺ .

Step 3: Preparation of Compound 50-4

K ₂ CO ₃ (945 mg, 6.84 mmol, 3.0 equiv), Cs ₂ CO ₃ (223 mg, 0.684 mmol, 0.3 equiv) and NaI (102 mg, 0.684 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 25/1) to give the title compound (320 mg, 33% yield) as a yellow oil. LCMS: Rt: 0.880 min; MS m/z (ESI): 420.3[M+H] ⁺ .

Step 4: Preparation of Compound 50-5

To a solution of compound 50-4 (160 mg, 0.38 mmol, 1.0 equiv) and DIPEA (98 mg, 0.76 mmol, 2.0 equiv) in DCM (5 mL) was added MsCl (52 mg, 0.46 mmol, 1.2 equiv) at 0 °C. has been added The mixture was stirred at room temperature for 2 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give the title compound (176 mg, 93% yield) as a yellow oil. It was used in the next step without further purification. LCMS: Rt: 0.800 min; MS m/z (ESI): 402.3 [M-OMs] ⁺ .

Step 5: Preparation of Compound 50

DIPEA (226 mg, 1.75 mmol, 5.0 equiv) and NaI ( 16 mg, 0.11 mmol, 0.3 equiv) was added. The mixture was stirred at 70 °C for 16 h. LCMS showed the reaction to be complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (29 mg, 10% yield) as a colorless oil. LCMS: Rt: 1.430 min; MS m/z (ESI): 829.6 [M+H] ⁺ _.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 9H), 1.26-1.30 (m, 49H), 1.39-1.48 (m, 4H), 1.58-1.68 (m, 8H), 2.28- 2.32 (m, 4H), 2.40-2.70 (m, 12H), 3.05-3.13 (m, 2H), 3.49-3.65 (m, 2H), 3.96-3.97 (m, 2H), 4.04-4.06 (m, 2H) ).

6.20 Example 20: Preparation of Compound 56.

Step 1: Preparation of Compound 56-2

To a solution of compound 56-1 (1.85 g, 15 mmol, 1.0 equiv) in DCM (30 mL) was added DIPEA (2.9 g, 22.5 mmol, 1.5 equiv) and TBSCl (2.28 g, 15 mmol, 1.0 equiv). The mixture was stirred at RT for 2 h. The reaction mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (PE/EA = 50/1) to give the title compound (1.2 g, 34% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.15 (s, 6H), 0.89 (s, 9H), 6.84-6.86 (m, 2H), 7.67-7.70 (m, 2H), 9.79 (s, 1H) .

Step 2: Preparation of Compound 56-3

To a solution of compound 56-2 (1.2 g, 5.08 mmol, 1.0 equiv) in MeOH (25 mL) was added compound SM6 (465 mg, 7.62 mmol, 1.5 equiv) and AcOH (3 drops). The mixture was stirred at RT for 2 h. Then NaCNBH ₃ (383 mg, 6.10 mmol, 1.2 eq) was added and the resulting mixture was stirred at RT for 16 h. LCMS showed the reaction to be complete. The mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 25/1) to give the title compound (629 mg, 45% yield) as a colorless oil. LCMS: Rt: 0.740 min; MS m/z (ESI): 282.2 [M+H] ⁺ .

Step 3: Preparation of Compound 56-4

To a solution of compound 56-3 (629 mg, 2.23 mmol, 1.0 equiv) and compound 26-1 (1.0 g, 2.23 mmol, 1.0 equiv) in ACN (40 mL) was added K ₂ CO ₃ (924 mg, 6.69 mmol, 3.0 equiv). equiv), Cs ₂ CO ₃ (218 mg, 0.67 mmol, 0.3 equiv) and NaI (100 mg, 0.67 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 40/1) to give the title compound (290 mg, 33% yield) as a colorless oil. LCMS: Rt: 1.030 min; MS m/z (ESI): 648.4 [M+H] ⁺ .

Step 4: Preparation of Compound 56-5

To a solution of compound 56-4 (290 mg, 0.45 mmol, 1.0 equiv) and DIPEA (116 mg, 0.90 mmol, 2.0 equiv) in DCM (6 mL) was added MsCl (77 mg, 0.68 mmol, 1.5 equiv). The mixture was stirred at room temperature for 2 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give the title compound (324 mg, 100% yield) as a yellow oil. It was used in the next step without further purification. LCMS: Rt: 0.940 min; MS m/z (ESI): 630.4 [M-OMs] ⁺ .

Step 5: Preparation of Compound 56-6

DIPEA (174 mg, 1.35 mmol, 3.0 equiv) and NaI ( 20 mg, 0.135 mmol, 0.3 equiv) was added. The mixture was stirred at 70 °C for 16 h. LCMS showed the reaction to be complete. The mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 30/1) to give the title compound (195 mg, 41% yield) as a yellow oil. LCMS: Rt: 0.640 min; MS m/z (ESI): 1057.7 [M+H] ⁺ .

Step 6: Preparation of Compound 56

To a solution of compound 56-6 (190 mg, 0.18 mmol, 1.0 equiv) in DCM (8 mL) was added HCl in 1,4-dioxane (2.0 mL, 4.0 M). The mixture was stirred at room temperature for 72 hours. LCMS showed the reaction to be complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (32 mg, 19% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.13-1.26 (m, 65H), 1.53-1.65 (m, 8H), 2.27-2.37 (m, 6H), 2.47- 2.69 (m, 7H), 3.52–3.61 (m, 4H), 3.96–4.00 (m, 4H), 6.80–6.82 (m, 2H), 7.18–7.20 (m, 2H). LCMS: Rt: 1.560 min; MS m/z (ESI): 943.5 [M+H] ⁺ .

6.21 Example 21: Preparation of compound 57.

Step 1: Preparation of Compound 57-2

A mixture of Compound 57-1 (500mg, 3.0mmol, 1 equiv), Compound SM7 (982mg, 4.5mmol, 1.5 equiv) and DIEA (1.16mg, 9.0mmol, 3 equiv) in DCM (10mL) was incubated for 1 hour. while stirring at RT. The mixture was quenched with water, extracted over ethyl acetate, concentrated and purified by column chromatography silica gel (EA:PE = 0% to 5%) to give the desired product 57-2 (942 mg, 59.0 % yield) as a yellow oil. provided as.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.83-0.93 (m, 3H), 1.14-1.38 (m, 16H), 1.45-1.55 (m, 2H), 1.56-1.73 (m, 4H), 1.82- 1.95 (m, 2H), 2.25–2.34 (m, 2H), 3.37–3.48 (m, 2H), 4.02–4.12 (m, 2H).

Step 2: Preparation of Compound 57-3

Compound 57-2 (600 mg, 1.68 mmol, 1.0 equiv), Compound D (291 mg, 2.01 mmol, 1.2 equiv), K ₂ CO ₃ (696 mg, 5.04 mmol, 3.0 equiv), Cs in ACN (24 mL) A mixture of ₂ CO ₃ (21 mg, 0.05 mmol, 0.03 equiv) and sodium iodide (90 mg, 0.6 mmol, 0.4 equiv) was stirred overnight at 100 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 3%) to give the desired product 57-3 (344 mg, 29.1% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.83-0.93 (m, 3H), 1.14-1.44 (m, 26H), 1.56-1.73 (m, 9H), 2.25-2.33 (m, 2H), 2.56- 2.81 (m, 4H), 3.36–3.45 (m, 2H), 4.03–4.11 (m, 2H).

Step 3: Preparation of Compound 57-4

A mixture of compound 57-3 (344 mg, 0.84 mmol, 1.0 equiv) and SOCl ₂ (298 mg, 2.51 mmol, 3.0 equiv) in DCM (10 mL) was stirred overnight at 35 °C. The mixture was concentrated to give the desired product 57-4 (364 mg, crude) as a yellow oil. LCMS: Rt: 0.840 min; MS m/z (ESI): 430.3 [M+H] ⁺ .

Step 4: Preparation of Compound 57

Compound 57-4 (172mg, 0.4mmol, 1.0 equiv), compound SM11 (150mg, 0.35mmol, 0.9 equiv), sodium iodide (30mg, 0.2mmol, 0.5 equiv) and DIEA (155 mg, 0.2mmol, 0.5 equiv) in THF (5mL) mg, 1.2mmol, 3.0 equiv) was stirred overnight at 70 °C. The mixture was concentrated under vacuum. The residue was purified by prep-HPLC to give the desired product 57 (68 mg, 20.7% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.80-0.94 (m, 9H), 1.14-1.39 (m, 53H), 1.41-1.53 (m, 5H), 1.56-1.69 (m, 8H), 1.73- 1.84 (m, 5H), 2.18-2.32 (m, 4H), 2.38-2.54 (m, 8H), 2.56-2.62 (m, 2H), 3.48-3.59 (m, 2H), 3.48-3.59 (m, 4H) ). LCMS: Rt: 1.280 min; MS m/z (ESI): 821.6 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 57 using the corresponding starting materials.

6.22 Example 22: Preparation of Compound 58.

Step 1: Preparation of Compound 58-2

Compound 58-1 (500 mg, 2.5 mmol, 1.0 equiv), compound SM8 (283 mg, 2.8 mmol, 1.51 equiv), HATU (1.1 g, 2.8 mmol, 1.1 equiv) and DIEA (483 mg) in DCM (10 mL) , 3.8 mmol, 1.5 equiv) was stirred at RT for 1 h. The mixture was quenched with water, extracted over ethyl acetate, concentrated and purified by column chromatography silica gel (EA:PE = 0% to 67%) to give the desired product 58-2 (693 mg, 97.2% yield) as a white solid. provided as. LCMS: Rt: 1.410 min; MS m/z (ESI): 286.3 [M+H] ⁺ .

Step 2: Preparation of Compound 58-3

A mixture of compound 58-2 (300 mg, 1.05 mmol, 1.0 equiv), MsCl (144 mg, 1.26 mmol, 1.2 equiv) and DIEA (204 mg, 1.58 mmol, 1.5 equiv) in DCM (10 mL) for 1 hour. Stirred at RT. The mixture was quenched with water, extracted over ethyl acetate and concentrated to give the desired product 58-3 (382 mg, crude) as a yellow solid. LCMS: Rt: 1.110 min; MS m/z (ESI): 364.2 [M+H] ⁺ .

Step 3: Preparation of Compound 58-4

Compound 58-3 (382 mg, 1.05 mmol, 1.0 equiv), Compound D (226 mg, 1.58 mmol, 1.5 equiv), K ₂ CO ₃ (435 mg, 3.15 mmol, 3.0 equiv), Cs in ACN (10 mL) A mixture of ₂ CO ₃ (10 mg, 0.03 mmol, 0.03 equiv) was stirred overnight at 100 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 3%) to give the desired product 58-4 (162 mg, 37.5% yield) as a yellow oil. LCMS: Rt: 0.750 min; MS m/z (ESI): 411.3 [M+H] ⁺ .

Step 4: Preparation of Compound 58-5

A mixture of compound 58-4 (162 mg, 0.39 mmol, 1.0 equiv) and SOCl ₂ (140 mg, 1.18 mmol, 3.0 equiv) in DCM (10 mL) was stirred overnight at 35 °C. The mixture was concentrated to give the desired product 58-5 (187 mg, crude) as a yellow oil. LCMS: Rt: 0.780 min; MS m/z (ESI): 429.3 [M+H] ⁺ .

Step 5: Preparation of Compound 58

Compound 58-5 (187 mg, 0.4 mmol, 1.0 equiv), compound SM9 (100 mg, 0.2 mmol, 0.5 equiv), sodium iodide (30 mg, 0.2 mmol, 0.5 equiv) and DIEA (155 mg, 1.2 mmol, 3.0 eq) was stirred overnight at 70 °C. The mixture was concentrated under vacuum. The residue was purified by prep-HPLC to give the desired product 58 (22 mg, 6.2% yield) as a yellow oil. LCMS: Rt: 1.000 min; MS m/z (ESI): 819.6 [M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.79-0.94 (m, 9H), 1.08-1.37 (m, 53H), 1.42-1.55 (m, 8H), 1.57-1.65 (m, 5H), 1.75- 1.91 (m, 8H), 2.03-2.10 (m, 2H), 2.11-2.20 (m, 2H), 2.43-2.64 (m, 9H), 3.17-3.28 (m, 4H), 3.48-3.62 (m, 2H) ).

The following compounds were prepared in an analogous manner to compound 58 using the corresponding starting materials.

6.23 Example 23: Preparation of Compound 62.

Step 1: Preparation of Compound 62-2

To a solution of compound 62-1 (0.4 g, 0.8939 mmol, 1.0 equiv) in ACN (15 mL) was added compound B (124 mg, 1.073 mmol, 1.2 equiv), K ₂ CO ₃ (371 mg, 2.682 mmol, 3.0 equiv). , Cs ₂ CO ₃ (87 mg, 0.2682 mmol, 0.3 equiv), NaI (13 mg, 0.08939 mmol, 0.1 equiv) were added. The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound 62-2 (330 mg, 79.28%) as a yellow oil. LCMS: Rt: 0.970 min; MS m/z (ESI): 482.4 [M+H] ⁺ .

Step 2: Preparation of Compound 62-3

To a solution of compound 62-2 (200 mg, 0.4151 mmol, 1.0 equiv) in DCM (15 mL) was added SOCl ₂ (148 mg, 1.245 mmol, 3.0 equiv). The reaction mixture was stirred at 35 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent gave compound 62-3 (200 mg, crude) as a yellow oil. LCMS: Rt: 1.140 min; MS m/z (ESI): 500.4 [M+H] ⁺ .

Step 3: Preparation of Compound 62

To a mixture of compound 62-3 (200 mg, 0.3998 mmol, 1.14 equiv), DIEA (136 mg, 1.052 mmol, 3.0 equiv) in THF (15 mL) was added compound SM11 (150 mg, 0.3507 mmol, 1.0 equiv), NaI ( 15 mg) was added. The reaction mixture was stirred at 75 °C for 64 hours. LCMS showed the reaction to be complete. After removal of the solvent, the residue was purified by pre-HPLC to give the title compound (80 mg, 25.59% yield) as a yellow oil. LCMS: Rt: 1.790 min; MS m/z (ESI): 891.7 [M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ): 0.86-0.90 (m, 12H), 1.26 (s, 59H), 1.44-1.65 (m, 11H), 1.83-2.00 (m, 7H), 2.22 (d, J = 6.8 Hz, 4H), 2.42–2.62 (m, 10H), 3.08 (s, 1H), 3.54–3.56 (m, 2H), 4.03–4.07 (m, 4H).

6.24 Example 24: Preparation of Compound 64.

Step 1: Preparation of Compound 64-2

To a mixture of compound 64-1 (2.0 g, 13.4 mmol, 1.0 equiv) and DIEA (4.2 g, 32.1 mmol, 2.4 equiv) in DCM (30 mL) was added Boc ₂ O (3.5 g, 16.0 mmol, 1.2 equiv). It became. The mixture was stirred at RT for 2 h and TLC showed the reaction to be complete. The mixture was diluted with DCM, washed with water and brine, dried, concentrated and the residue was purified by column chromatography to give product 64-2 (2.3 g, 80% yield) as a white solid.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 1.46 (s, 9H), 1.62-1.72 (m, 2H), 2.22-2.26 (m, 2H), 2.38-2.46 (m, 4H), 3.93 (s, 1H), 4.50 (s, 1H).

Step 2: Preparation of Compound 64-3

A mixture of compound 64-2 (2.3 g, 10.8 mmol, 1 equiv), compound SM6 (2.0 g, 32.3 mmol, 3.0 equiv), NaBH ₃ CN (1.4 g, 21.7 mmol, 2.0 equiv) in MeOH (30 mL) was Stirred overnight at reflux. LCMS showed the reaction to be complete. The mixture was diluted with ethyl acetate, washed with water and brine, dried, concentrated and the residue was purified by column chromatography to give the product 64-3 (1.6 g, 57 % yield) as a yellow oil.

Step 3: Preparation of Compound 64-4

To a solution of compound 64-3 (1.6 g, 6.2 mmol, 1.0 equiv) in THF (30 mL) was added LAH (470 mg, 12.4 mmol, 2.0 equiv) at RT. The mixture was stirred at reflux for 2 h and LCMS showed the target product. The mixture was quenched with water, filtered and concentrated. The residue was used in the next step without further purification. LCMS: Rt: 0.290 min; MS m/z (ESI): 173.2 [M+H] ⁺ .

Step 4: Preparation of Compound 64

Compound 64-4 (60 mg, 0.35 mmol, 1.0 equiv) in ACN (10 mL), Compound 26-1 (390 mg, 0.87 mmol, 2.5 equiv), K ₂ CO ₃ (144 mg, 1.04 mmol, 3.0 equiv), Cs ₂ CO ₃ (33 mg, 0.1 mmol, 0.3 equiv), NaI (15 mg, 0.1 mmol, 0.3 equiv) equivalents) was stirred overnight at reflux. LCMS showed the reaction to be complete. The mixture was diluted with ethyl acetate, washed with water and brine, dried and concentrated. The residue was purified by pre-HPLC to give product 64 (14 mg, 4.4% yield) as a yellow oil. LCMS: Rt: 1.340 min; MS m/z (ESI): 905.8 [M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26 (s, 58H), 1.42-1.47 (m, 6H), 1.61-1.68 (m, 10H), 1.78-1.86 ( m, 5H), 2.23 (s, 3H), 2.29-2.32 (m, 5H), 2.37-2.46 (m, 5H), 2.57-2.60 (m, 2H), 3.45-3.48 (m, 2H), 3.97 ( d, J = 6.0 Hz, 4H).

6.25 Example 25: Preparation of Compound 65.

Step 1: Preparation of Compound 65-1

A solution of compound 26-1 (892.0 mg, 2.0 mmol, 1.0 equiv) and compound SM13 (426.0 mg, 6.0 mmol, 3.0 equiv) was dissolved in ACN (10.0 mL) and Cs ₂ CO ₃ (195.0 mg, 0.6 mmol, 0.3 equiv), K ₂ CO ₃ (826.0 mg, 6.0 mmol, 3.0 equiv) and NaI (29 mg, 0.2 mmol, 0.1 equiv) were added at RT. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH = 1/0-20/1) to give 65-1 (0.6 g, 68% yield) as a yellow oil. . LCMS: Rt: 0.950 min; MS m/z (ESI): 438.3 [M+H] ⁺ .

Step 2: Preparation of Compound 65-2

To a solution of compound 65-1 (100.0 mg, 0.23 mmol, 1.0 equiv) and compound SM14 (58.0 mg, 0.27 mmol, 1.2 equiv) in THF (5.0 mL) was added DIEA (44.0 mg, 0.34 mmol, 1.5 equiv) at RT. has been added The mixture was stirred at 50 °C for 16 hours. LCMS showed the reaction to be complete and the mixture was evaporated to give 65-2 (230.0 mg, crude) as a brown oil. LCMS: Rt: 0.443 min; MS m/z (ESI): 572.2 [M+H] ⁺ .

Step 3: Preparation of Compound 65

DIEA (258 mg, 2.0 mmol, 5.0 equiv) was added to a solution of compound 65-2 (230.0 mg, 0.4 mmol, 1.0 equiv) and compound SM2 (207.0 mg, 0.48 mmol, 1.2 equiv) in THF (5.0 mL) at 0 °C. was added in The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete, the mixture was evaporated under reduced pressure and purified by pre-HPLC to give 65 (32.0 mg, 9% yield) as a yellow oil.

^1H NMR (400 MHz, CDCl3) δ: 0.86-0.90 (m, 12H), 1.13-1.38 (m, 64H), 1.41-1.70 (m, 13H), 2.02-2.04 (m, 2H), 2.28-2.39 (m, 4H), 2.41-2.60 (m, 5H), 3.09-3.13 (m, 4H), 3.54-3.55 (m, 2H), 3.96 (d, J = 0.4 Hz, 4H), 5.62-5.66 (m , 2H). LCMS: Rt: 0.581 min; MS m/z (ESI): 917.6 [M+H] ⁺ .

6.26 Example 26: Preparation of Compound 67.

Step 1: Preparation of Compound 67-2

A mixture of compound 67-1 (200 mg, 1.45 mmol, 1.0 equiv) and compound SM1 (196 mg, 1.31 mmol, 0.9 equiv) in methanol (5 mL) was stirred at RT for 2 h. NaBH ₃ CN (190 mg, 3.0 mmol, 2.0 equiv) was added. The mixture was stirred at rt overnight. LCMS showed the target product. The mixture was diluted with ethyl acetate, washed with water and brine, dried, concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product 67-2 (240 mg, 69.5%) yield) as a yellow oil. LCMS: Rt: 0.730 min; MS m/z (ESI): 236.2 [M+H] ⁺ .

Step 2: Preparation of Compound 67-3

Compound 67-2 (240 mg, 1.0 mmol, 1.0 equiv), Compound 26-1 (550 mg, 1.2 mmol, 1.2 equiv), K ₂ CO ₃ (420 mg, 3.0 mmol, 3.0 equiv) in THF (10 mL) , Cs ₂ CO ₃ (100 mg, 0.3 mmol, 0.3 equiv) and NaI (45 mg, 0.3 mmol, 0.3 equiv) were stirred overnight at 90 °C. The mixture was concentrated under vacuum. The residue was purified by column chromatography to give the desired product 67-3 (230 mg, 38.3% yield) as a brown oil. LCMS: Rt: 0.930 min; MS m/z (ESI): 602.4 [M+H] ⁺ .

Step 3: Preparation of Compound 67-4

A mixture of compound 67-3 (230 mg, 0.38 mmol, 1.0 equiv) and Pd/C (23 mg) in ethyl acetate (5 mL) was stirred at RT under a hydrogen atmosphere overnight and LCMS showed the reaction to be complete. The mixture was filtered and concentrated. The residue was used in the next step without further purification. LCMS: Rt: 1.687 min; MS m/z (ESI): 512.4 [M+H] ⁺ .

Step 4: Preparation of Compound 67-5

A mixture of compound 67-4 (180 mg, 0.35 mmol, 1.0 equiv) and SOCl ₂ (210 mg, 1.76 mmol, 5.0 equiv) in DCM (5 mL) was stirred at 40 °C for 4 h and LCMS showed that the reaction was complete. showed that it was The mixture was concentrated and the residue was used in the next step without further purification.

Step 5: Preparation of Compound 67

Compound 67-5 (220 mg (crude), 0.35 mmol, 1.0 equiv) in THF (5 mL), Compound SM2 (150 mg, 0.35 mmol, 1.0 equiv) and DIEA (225 mg, 1.75 mmol, 5.0 equiv) was stirred at 70 °C overnight and LCMS showed the reaction to be complete. The mixture was concentrated and the residue was purified by pre-HPLC to give product 67 (102 mg, 31.6% yield). LCMS: Rt: 1.910 min; MS m/z (ESI): 921.7 [M+H] ⁺ _.

^1H NMR (400 MHz, CDCl3) δ: 0.86-0.90 (m, 12H), 1.26-1.30 (m, 60H), 1.38-1.48 (m, 5H), 1.59-1.67 (m, 7H), 1.80-1.83 (m, 2H), 2.28-2.32 (m, 4H), 2.36-2.51 (m, 10H), 2.53-2.60 (m, 3H), 3.22-3.24 (m, 3H), 3.52-3.57 (m, 2H) ,3.96 (d, J = 5.6 Hz, 4H).

The following compounds were prepared in an analogous manner to compound 67 using the corresponding starting materials.

6.27 Example 27: Preparation of Compound 68.

Step 1: Preparation of compound 26-1

A mixture of compound SM (2.0 g, 7.394 mmol, 1.0 equiv), compound W (2.2 g, 11.09 mmol, 1.5 equiv) and TsOH (500 mg) in toluene (20 mL) was stirred at reflux for 2 h. TLC showed the reaction to be complete. The mixture was evaporated under reduced pressure to give compound 26-1 (3 g, 90.90%) as a yellow oil by FCC.

Step 2: Preparation of Compound 68-1

To a solution of compound 26-1 (742 mg, 1.658 mmol, 1.0 equiv) in ACN (15 mL) was added compound 50-3 (0.3 g, 1.658 mmol, 1.0 equiv), K ₂ CO ₃ (687 mg, 4.974 mmol, 3.0 equiv). equiv), Cs ₂ CO ₃ (162 mg, 0.4974 mmol, 0.3 equiv), NaI (25 mg, 0.1658 mmol, 0.1 equiv) were added. The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound 68-1 (400 mg, 46.59%) as a yellow oil. LCMS: Rt: 1.200 min; MS m/z (ESI): 518.4 [M+H] ⁺ .

Step 3: Preparation of Compound 68-2

To a mixture of compound 68-1 (200 mg, 0.3862 mmol, 1.0 equiv), DIEA (100 mg, 0.7724 mmol, 2.0 equiv) in DCM (20 mL) was added MscI (53 mg, 0.4635 mmol, 1.2 equiv) at 0 °C. was added under N ₂ . The reaction mixture was stirred at 0 °C for 1 hour. TLC showed the reaction to be complete. Mixture power in water and washed with DCM. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound 68-2 (230 mg, crude) as a yellow oil.

Step 4: Preparation of Compound 68

Compound SM2 (138 mg, 0.3216 mmol, 1.0 equiv), NaI ( 15 mg) was added. The reaction mixture was stirred at 75 °C for 16 hours. LCMS showed the reaction to be complete. After removal of the solvent, the residue was purified by pre-HPLC to give the title compound (20 mg, 5.59% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ): 0.86-0.88 (m, 12H), 1.26 (s, 52H), 1.43-1.63 (m, 19H), 2.28-2.32 (m, 4H), 2.45-2.59 (m , 14H), 3.05 (s, 1H), 3.53 (s, 2H), 3.95–3.97 (m, 4H). LCMS: Rt: 1.970 min; MS m/z (ESI): 927.6 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 68 using the corresponding starting materials.

6.28 Example 28: Preparation of Compound 71.

Step 1: Preparation of Compound 71-2

Compound 71-1 (2.18 g, 20.1 mmol, 1.0 equiv), 1,4-dibromobutane (10.0 g, 46.3 mmol, 2.3 equiv) and tetrabutylammonium hydrogen sulfate (171 mg, 0.50 mmol, 0.025 equiv) were added. The mixture was stirred at 80 °C for 16 hours. The reaction mixture was extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (PE/EA = 50/1) to give the title compound (3.3 g, 67% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 1.72-1.80 (m, 2H), 1.94-2.01 (m, 2H), 3.43 (t, J = 6.8 Hz, 2H), 3.50 (t, J = 6.2 Hz) , 2H), 4.50 (s, 2H), 7.27–7.37 (m, 5H).

Step 2: Preparation of Compound 71-3

To a suspension of NaH (653 mg, 16.3 mmol, 1.2 equiv) in THF (60 mL) was added dimethyl malonate (3.6 g, 27.2 mmol, 2.0 equiv) dropwise. Then compound 71-2 in THF (10 mL) (3.3 g, 13.6 mmol, 1.0 equiv) was added dropwise and the resulting mixture stirred at reflux for 16 h. After cooling to RT, the mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (PE/EA = 20/1-5/1) to give the title compound (3.2 g, 80% yield) as a colorless oil.

Step 3: Preparation of Compound 71-4

Compound 71-3 in THF (20 mL) to a solution of LiAlH ₄ (828 mg, 21.8 mmol, 2.0 equiv) in THF (40 mL) (3.2 g, 10.9 mmol, 1.0 eq) was added dropwise. The reaction mixture was stirred at room temperature for 16 hours. Reaction mixing was done carefully with ethyl acetate and water. 6 mL of 2N NaOH aqueous solution was added. The mixture was filtered through a pad of Celite and rinsed with EA. The filtrate was dried over Na ₂ SO ₄ and purified by column chromatography on silica gel (DCM/MeOH = 30/1-20/1) to give the title compound (1.6 g, 62% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 1.20-1.24 (m, 2H), 1.36-1.44 (m, 2H), 1.57-1.68 (m, 2H), 1.72-1.75 (m, 1H), 3.33 ( s, 2H), 3.45–3.49 (m, 2H), 3.57–3.61 (m, 2H), 3.73–3.76 (m, 2H), 4.49 (s, 2H), 7.27–7.34 (m, 5H).

Step 4: Preparation of Compound 71-5

To a solution of compound 71-4 (1.0 g, 4.2 mmol, 1.0 equiv) and octanoic acid (1.8 g, 12.6 mmol, 3.0 equiv) in toluene (40 mL) was added TsOH.H ₂ O (36 mg). The mixture was stirred for 4 hours through a Dean-Stark trap under reflux. The reaction mixture was concentrated and purified by column chromatography on silica gel (PE/EA = 30/1) to give the title compound (926 mg, 46% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 6H), 1.27-1.29 (m, 13H), 1.36-1.48 (m, 4H), 1.58-1.64 (m, 9H), 1.92- 2.02 (m, 1H), 2.29 (t, J = 7.6 Hz, 4H), 3.46 (t, J = 6.4 Hz, 2H), 4.00–4.10 (m, 4H), 4.49 (s, 2H), 7.28–7.37 (m, 5H).

Step 5: Preparation of 71-6

To a solution of compound 71-5 (820 mg, 1.67 mmol, 1.0 equiv) in MeOH (20 mL) was added Pd/C (82 mg). The mixture was stirred at 35 °C under H ₂ for 36 hours. The mixture was filtered through a pad of celite and rinsed with MeOH. Filtration concentrated to give the title compound (630 mg, 941% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 6H), 1.27-1.39 (m, 15H), 1.41-1.51 (m, 6H), 1.58-1.65 (m, 6H), 1.96- 2.05 (m, 1H), 2.30 (t, J = 7.6 Hz, 4H), 3.65 (t, J = 6.4 Hz, 2H), 4.02–4.11 (m, 4H).

Step 6: Preparation of compound 71-7

To a solution of compound 71-6 (630 mg, 1.57 mmol, 1.0 equiv) and DIPEA (406 mg, 3.14 mmol, 2.0 equiv) in DCM (15 mL) at 0 °C was added MscI (216 mg, 1.88 mmol, 1.2 equiv). has been added The mixture was stirred at room temperature for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give the title compound (682 mg, 91% yield) as a yellow oil. It was used in the next step without further purification.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 6H), 1.27-1.37 (m, 14H), 1.41-1.46 (m, 4H), 1.53-1.63 (m, 6H), 1.73- 1.80 (m, 2H), 1.96-2.03 (m, 1H), 2.30 (t, J = 6.2 Hz, 4H), 3.01 (s, 3H), 4.02-4.10 (m, 4H), 4.23 (t, J = 6.4 Hz, 2H).

Step 7: Preparation of compound 71-8

K ₂ CO ₃ (224 mg, 1.62 mmol, 3.0 equiv) to a solution of compound 71-7 (260 mg, 0.54 mmol, 1.0 equiv) and compound B (62 mg, 0.54 mmol, 1.0 equiv) in ACN (15 mL). , Cs ₂ CO ₃ (52 mg, 0.16 mmol, 0.3 equiv) and NaI (24 mg, 0.16 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 20/1) to give the title compound (182 mg, 67% yield) as a yellow oil. LCMS: Rt: 0.830 min; MS m/z (ESI): 498.4 [M+H] ⁺ .

Step 8: Preparation of compound 71-9

To a solution of compound 71-8 (180 mg, 0.36 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl ₂ (128 mg, 1.08 mmol, 3.0 equiv). The mixture was stirred at 30 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was concentrated to give the title compound (185 mg, 100% yield) as a yellow oil. It was used in the next step without further purification. LCMS: Rt: 0.870 min; MS m/z (ESI): 516.3 [M+H] ⁺ .

Step 9: Preparation of Compound 71

DIPEA (120 mg, 0.93 mmol, 3.0 equiv.) and NaI ( 14　mg, 0.093　mmol, 0.3 equiv) was added. The mixture was stirred at 70 °C for 16 h. LCMS showed the reaction to be complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (100 mg, 35% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ:0.86-0.90 (m, 12H), 1.27-1.50 (m, 44H), 1.57-1.67 (m, 10H), 1.85-2.05 (m, 6H), 2.28- 2.36 (m, 8H), 2.45–3.13 (m, 12H), 3.52–3.60 (m, 2H), 4.01–4.10 (m, 8H). LCMS: Rt: 1.110 min; MS m/z (ESI): 923.7[M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 71 using the corresponding starting materials.

6.29 Example 29: Preparation of Compound 72.

Step 1: Preparation of Compound 72-2

Compound 72-1 (400 mg, 0.86 mmol, 1 equiv), Compound C (167 mg, 1.3 mmol, 1.5 equiv) and K ₂ CO ₃ (359 mg, 2.6 mmol, 3 equiv), Cs in ACN (10 mL) A mixture of ₂ CO ₃ (10 mg, 0.03 mmol, 0.03 equiv) was stirred overnight at 80 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 3%) to give the desired product 72-2 (106 mg, 24.7% yield) as a yellow oil. LCMS: Rt: 0.810 min; MS m/z (ESI): 495.4 [M+H] ⁺ .

Step 2: Preparation of Compound 72-3

A mixture of 72-2 (106 mg, 0.2 mmol, 1 equiv) and SOCl ₂ (77 mg, 0.6 mmol, 3 equiv) in DCM (5 mL) was stirred overnight at 35 °C. The mixture was diluted with water, extracted over ethyl acetate, dried and concentrated to give the desired product 72-3 (117 mg, crude) as a yellow oil. LCMS: Rt: 0.880 min; MS m/z (ESI): 513.4 [M+H] ⁺ .

Step 3: Preparation of Compound 72

Compound 72-3 (91 mg, 0.19 mmol, 1.0 equiv), compound SM2 (100 mg, 0.23 mmol, 1.2 equiv), K ₂ CO ₃ (79 mg, 0.57 mmol, 3.0 equiv), Cs in ACN (5 mL) A mixture of ₂ CO ₃ (3 mg, 0.01 mmol, 0.03 equiv) and NaI (15 mg, 0.10 mmol, 0.5 equiv) was stirred overnight at 80 °C. The mixture was concentrated under vacuum. The residue was purified by prep-HPLC to give the desired product 72 (31 mg, 18.1% yield) as a yellow oil. LCMS: Rt: 1.510 min; MS m/z (ESI): 904.7 [M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.81-0.93 (m, 12H), 1.07-1.38 (m, 62H), 1.39-1.57 (m, 9H), 1.58-1.90 (m, 11H), 1.96- 2.10 (m, 3H), 2.16-2.26 (m, 2H), 2.42-2.68 (m, 8H), 3.18-3.32 (m, 2H), 3.49-3.61 (m, 2H), 3.99-4.12 (m, 2H) ).

The following compounds were prepared in an analogous manner to compound 72 using the corresponding starting materials.

6.30 Example 30: Preparation of Compound 76.

Step 1: Preparation of Compound 76-2

Compound B (210 mg, 1.79 mmol, 1.0 equiv), K ₂ CO ₃ (750 mg, 5.37 mmol, 3.0 equiv) to a solution of compound 76-1 (800 mg, 1.79 mmol, 1.0 equiv) in ACN (50 mL). , Cs ₂ CO ₃ (180 mg, 0.54 mmol, 0.3 equiv) and NaI (80 mg, 0.54 mmol, 0.3 equiv) were added. The reaction mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound 76-1 (700 mg, 81%). LCMS: Rt: 0.870 min; MS m/z (ESI): 481.4 [M+H] ⁺ .

Step 2: Preparation of Compound 76-3

To a solution of compound 76-2 (200 mg, 0.41 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl ₂ (150 mg, 1.25 mmol, 3.0 equiv). The reaction mixture was stirred at 35 °C for 10 hours. LCMS showed the reaction to be complete. Removal of the solvent gave compound 76-3 (207 mg, 100 % yield) as a yellow oil. LCMS: Rt: 0.440 min; MS m/z (ESI): 499.3 [M+H]

Step 3: Preparation of Compound 76

Compound SM15 (100 mg, 0.23 mmol, 1.0 equiv), NaI ( 35 mg) was added. The reaction mixture was stirred at 70 °C for 10 hours. LCMS showed the reaction to be complete. After removal of the solvent, the residue was purified by pre-HPLC to give the title compound (35 mg, 17% yield) as a yellow oil.

^1H NMR (400 MHz, CDCl ₃ ): 0.87 (t, J = 8 Hz, 12H), 1.26-2.00 (m, 79H), 2.15-2.60 (m, 14H), 3.16-3.19 (m, 3H), 3.75-3.77 (m, 2H), 3.95-3.97 (m, 2H), 5.89 (brs, 1H). LCMS: Rt: 0.600 min; MS m/z (ESI): 904.7 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 76, using the corresponding starting materials.

6.31 Example 31: Preparation of Compound 78.

Step 1: Preparation of Compound 78-2

To a solution of compound 78-1 (3.0 g, 13.44 mmol, 1.0 equiv) in DMF (100 mL) was added potassium 1,3-dioxoisoindolin-2-ide (4.98 g, 26.89 mmol, 2.0 equiv). The reaction mixture was stirred at 100 °C for 10 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound 78-2 (2.0 g, 53%). LCMS: Rt: 1.120 min; MS m/z (ESI): 290.1 [M+H] ⁺ .

Step 2: Preparation of Compound 78-3

To a solution of compound 78-2 (2.0 g, 6.91 mmol, 1.0 equiv) in EtOH (50 mL) was added NH ₂ NH ₂ .H ₂ O (0.7 g, 13.82 mmol, 2.0 equiv). The reaction mixture was stirred at 90 °C for 10 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound 78-3 (0.5 g, 45%). LCMS: Rt: 0.590 min; MS m/z (ESI): 160.2 [M+H] ⁺ .

Step 3: Preparation of Compound 78-4

To a solution of compound 26-1 (1.4 g, 3.14 mmol, 1.0 equiv) in ACN (50 mL) was added compound 78-3 (500 mg, 3.14 mmol, 1.0 equiv), K ₂ CO ₃ (1.3 g, 9.42 mmol, 3.0 equiv). equiv), Cs ₂ CO ₃ (300 mg, 0.94 mmol, 0.3 equiv) and NaI (140 mg, 0.94 mmol, 0.3 equiv) were added. The reaction mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound 78-4 (165 mg, 10%). LCMS: Rt: 0.920 min; MS m/z (ESI): 526.4 [M+H] ⁺ .

Step 4: Preparation of Compound 78

To a mixture of compound 78-4 (140 mg, 0.27 mmol, 1.0 equiv), DIEA (100 mg, 0.80 mmol, 3.0 equiv) in THF (10 mL), compound 76-3 (140 mg, 0.27 mmol, 1.0 equiv), NaI (40 mg) was added. The reaction mixture was stirred at 70 °C for 10 hours. LCMS showed the reaction to be complete. After removal of the solvent, the residue was purified by pre-HPLC to give the title compound (20 mg, 7% yield) as a yellow oil. ^1H NMR (400 MHz, CDCl ₃ ): 0.87 (t, J = 8 Hz, 12H), 1.26-1.98 (m, 91H), 2.08-2.41 (m, 14H), 3.00-3.09 (m, 3H), 3.55-3.58 (m, 2H), 3.88-3.90 (m, 2H), 5.89 (brs, 1H). LCMS: Rt: 0.613 min; MS m/z (ESI): 988.7[M+H] ⁺ .

6.32 Example 32: Preparation of Compound 79.

Step 1: Preparation of compound 79-1

A mixture of compound SM2 (500 mg, 1.2 mmol, 1.0 equiv) and DIEA (300 mg, 2.3 mmol, 2.0 equiv) in DCM (5 mL) was added Boc ₂ O (306 mg, 1.4 mmol, 1.2 equiv). The mixture was stirred at RT for 30 min. TLC showed the reaction to be complete. The mixture was concentrated and the residue was purified by column chromatography to give product 79-1 (520 mg, 91% yield) as a colorless oil.

Step 2: Preparation of Compound 79-2

To a mixture of compound 79-1 (520mg, 1.0mmol, 1.0 equiv) and DIEA (260mg, 2.0mmol, 2.0 equiv) in DCM (5mL) was added MsCl (140mg, 1.2mmol, 1.2 equiv). The mixture was stirred at RT for 30 min. TLC showed the reaction to be complete. The mixture was diluted with water and brine, dried, concentrated and the residue was used in the next step without further purification.

Step 3: Preparation of Compound 79-3

A mixture of compound 79-2 (560 mg (crude), 1.0 mmol, 1.0 equiv) and NaN ₃ (100 mg, 1.5 mmol, 1.5 equiv) in DMF (10 mL) was stirred at 100 °C overnight and TLC showed the reaction showed that it was done. The mixture was diluted with ethyl acetate, washed with water and brine, dried and concentrated. The residue was purified by column chromatography to give compound 79-3 (180 mg, 36% yield) as a colorless oil.

Step 4: Preparation of Compound 79-4

Compound 79-3 (180 mg, 0.33 mmol, 1.0 equiv) in ethyl acetate (5 mL), Pd/C (18 mg) was stirred at RT overnight and LCMS showed the reaction to be complete. The mixture was filtered and concentrated. The residue was used in the next step without further purification. LCMS: Rt: 0.900 min; MS m/z (ESI): 527.4 [M+H] ⁺ .

Step 5: Preparation of Compound 79-5

Compound 79-4 (170 mg, 0.33 mmol, 1.0 equiv) and Compound SM19 in DCM (5 mL) (170 mg, 1.0 mmol, 3.0 equiv) was stirred at RT overnight, then methylamine was added. The mixture was stirred for 24 hours. TFA (5 mL) was added. The mixture was stirred for 2 hours and concentrated. The residue was diluted with ethyl acetate, washed with saturated NaHCO ₃ (aq.), dried and concentrated. The residue was used in the next step without further purification. LCMS: Rt: 0.900 min; MS m/z (ESI): 536.4 [M+H] ⁺ .

Step 6: Preparation of Compound 79

Compound 79-5 (90 mg (crude), 0.17 mmol, 1.0 equiv) in THF (5 mL), Compound 26-2 (180 mg, 0.34 mmol, 2.0 equiv) and DIEA (110 mg, 0.85 mmol, 5.0 equiv) was stirred at 70 °C overnight and LCMS showed the reaction to be complete. The mixture was concentrated and the residue was purified by pre-HPLC to give product compound 79 (26 mg, 18% yield).

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.30 (m, 59H), 1.43-1.48 (m, 4H), 1.57-1.65 (m, 6H), 1.93 ( s, 3H), 2.21 (s, 3H), 2.29-2.48 (m, 10H), 2.54 (s, 2H), 2.61-2.63 (m, 2H), 3.30 (d, J = 4.2 Hz, 3H), 3.67 (d, J = 5.6 Hz, 2H), 3.94–3.97 (m, 4H). LCMS: Rt: 2.47 min; MS m/z (ESI): 959.7 [M+H] ⁺ .

6.33 Example 33: Preparation of Compound 80.

Step 1: Preparation of Compound 80-1

A solution of compound 26-1 (600 mg, 1.34 mmol, 1.0 equiv) and compound SM17 (143 mg, 1.61 mmol, 1.2 equiv) was dissolved in ACN (10 mL) and added with Cs ₂ CO ₃ (130 mg, 0.40 mmol, 0.3 equiv), K ₂ CO ₃ (555 mg, 4.02 mmol, 3.0 equiv) and NaI (18 mg, 0.13 mmol, 0.1 equiv) were added at 0 °C. The mixture was stirred at 85 °C for 16 hours. LCMS showed that the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH = 1/0-20/1) to give compound 80-1 (520 mg, 86% yield) as a yellow oil did LCMS: Rt: 0.890 min; MS m/z (ESI): 456.4 [M+H] ⁺ .

Step 2: Preparation of Compound 80-2

To a solution of compound 80-1 (200 mg, 0.44 mmol, 1.0 equiv) was dissolved in DCM (10 mL) and SOCl ₂ (264 mg, 2.20 mmol, 5.0 equiv) was added at RT. The mixture was stirred at 35 °C for 16 hours. LCMS showed the reaction to be complete and the mixture was evaporated under reduced pressure to give compound 80-2 (200 mg, crude) as a yellow oil. LCMS: Rt: 0.940 min; MS m/z (ESI): 474.3 [M+H] ⁺ .

Step 3: Preparation of Compound 80-3

DIEA (340 mg, 2.65 mmol, 5.0 equiv) and NaI ( 7 mg, 0.05 mmol, 0.1 equiv) was added at 0 °C. The mixture was stirred at 75 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 80-3 (300 mg, 59% yield) as a colorless oil. LCMS: Rt: 1.710 min; MS m/z (ESI): 963.7 [M+H] ⁺ .

Step 4: Preparation of Compound 80-4

To a solution of compound 80-3 (200 mg, 0.21 mmol, 1.0 equiv) in DCM (4 mL), TFA (1 mL) was added at RT. The mixture was stirred at RT for 16 hours. LCMS showed the reaction to be complete and the mixture was evaporated under reduced pressure to give compound 80-4 (200 mg, crude) as a colorless oil. LCMS: Rt: 0.850 min; MS m/z (ESI): 863.7 [M+H] ⁺ .

Step 5: Preparation of Compound 80-5

To a solution of compound 80-4 (200 mg, 0.23 mmol, 1.0 equiv) was dissolved in DCM (5 mL) and compound SM19 (50 mg, 0.28 mmol, 1.2 equiv) was added at RT. The mixture was stirred at 40 °C for 16 hours. LCMS showed the reaction to be complete and the mixture was evaporated under reduced pressure to give compound 80-5 (200 mg, crude) as a yellow oil. LCMS: Rt: 1.310 min; MS m/z (ESI): 987.7 [M+H] ⁺ .

Step 6: Preparation of Compound 80

A mixture of CH ₃ NH ₂ (25 mg, 0.80 mmol, 4.0 equiv), compound 80-5 (200 mg, 0.2 mmol, 1.0 equiv), DIEA (2 mL) in DCM (10 mL) was stirred overnight at RT. The mixture was concentrated under vacuum. The residue was purified by prep-HPLC to give the desired product compound 80 (63 mg, 18% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.77-0.98 (m, 12H), 1.14-1.41 (m, 61H), 1.42-1.57 (m, 6H), 1.58-1.72 (m, 8H), 2.13- 2.26 (m, 3H), 2.27-2.38 (m, 3H), 2.39-2.56 (m, 6H), 2.57-2.71 (m, 3H), 3.04-3.20 (m, 3H), 3.21-3.36 (m, 3H) ), 3.67–3.83 (m, 2H), 3.84–4.02 (m, 2H), 5.69–5.83 (m, 1H). LCMS: Rt: 0.950 min; MS m/z (ESI): 972.7 [M+H] ⁺ .

The following compounds were prepared in a similar manner to compound 80 using the corresponding starting materials.

6.34 Example 34: Preparation of Compound 81.

Step 1: Preparation of Compound 81-1

Compound 26-1 (2.0 g, 4.47 mmol, 1 equiv), tert-butyl (2-aminoethyl) carbamate (1.1 g, 6.70 mmol, 1.5 equiv), K ₂ CO ₃ (1.8 equiv) in ACN (20 mL) g, 13.4 mmol, 3.0 equiv), Cs ₂ CO ₃ (440 mg, 1.34 mmol, 0.3 equiv), NaI (200 mg, 1.34 mmol, 0.3 equiv) was stirred at 90 °C overnight. LCMS showed the target product. The mixture was concentrated and the residue was purified by column chromatography to give the product compound 81-1 (1.4 g, 64% yield) as a yellow oil. LCMS: Rt: 0.960 min; MS m/z (ESI): 527.4 [M+H] ⁺ .

Step 2: Preparation of Compound 81-2

Compound 81-1 (500 mg, 0.95 mmol, 1.0 equiv), Compound SM20 (570 mg, 1.14 mmol, 1.2 equiv), DIEA (370 mg, 2.85 mmol, 3.0 equiv), NaI (44 mg) in THF (10 mL) , 0.29 mmol, 0.3 eq) was stirred overnight at reflux. LCMS showed the reaction to be complete. The mixture was diluted with ethyl acetate, washed with water and brine, dried, concentrated and the residue was purified by column chromatography to give product compound 81-2 (610 mg, 72 % yield) as a yellow oil. LCMS: Rt: 2.090 min; MS m/z (ESI): 990.7 [M+H] ⁺ .

Step 3: Preparation of Compound 81-3

Compound 81-2 (300 mg, 0.3 mmol, 1.0 equiv) in DCM (2 mL), TFA (345 mg, 3.0 mmol, 10.0 equiv) was stirred at RT for 4 h and LCMS showed the reaction to be complete. The mixture was concentrated and the residue was used in the next step without further purification. LCMS: Rt: 1.420 min; MS m/z (ESI): 890.7 [M+H] ⁺

Step 4: Preparation of Compound 81

Compound 81-3 (120 mg, 0.13 mmol, 1.0 equiv) in DCM (5 mL), DIEA (170 mg, 1.3 mmol, 10.0 equiv) and compound SM19 (46 mg, 0.27 mmol, 2.0 equiv) was stirred at RT overnight and methylamine (0.67 mmol, 5.0 equiv) was added. LCMS showed the reaction to be complete. The residue was purified by pre-HPLC to give product compound 81 (45 mg, 28% yield) as a white solid. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.46 (m, 66H), 1.59-1.64 (m, 6H), 2.21 (s, 6H), 2.29-2.49 ( m, 12H), 2.61 (s, 2H), 3.15 (s, 1H), 3.31 (d, J = 5.2 Hz, 3H), 3.66–3.75 (m, 2H), 3.94–3.97 (m, 4H). LCMS: Rt: 0.093 min; MS m/z (ESI): 999.7 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 81 using the corresponding starting materials.

6.35 Example 35: Preparation of Compound 83.

Step 1: Preparation of Compound 83-2

A mixture of compound 83-1 (1.4 g, 4.73 mmol, 1.0 equiv), compound SM7 (1.2 g, 7.10 mmol, 1.5 equiv), TsOH (20 mg) in toluene (70 mL) was stirred at 180 °C for 2 h. . TLC showed the reaction to be complete. The mixture was concentrated and purified by column chromatography silica gel (EA:PE = 0% to 5%) to provide compound 83-2 (1.0 g, 75% yield) as a colorless oil.

Step 2: Preparation of Compound 83-3

A mixture of compound 83-2 (700 mg, 1.58 mmol, 1.0 equiv) and Pd/C (310 mg, 1.58 mmol, 1.0 equiv) in a solution of MeOH (10 mL) and ethyl acetate (10 mL) was incubated with H for 16 h. Stirred at RT under ₂ . TLC showed the reaction to be complete. The mixture was concentrated to give the desired product compound 83-3 (650 mg, crude) as a colorless oil.

Step 3: Preparation of Compound 83-4

Compound 83-3 (500 mg, 1.12 mmol, 1.0 equiv), Compound B (130 mg, 1.12 mmol, 1.0 equiv) and K ₂ CO ₃ (465 mg, 3.36 mmol, 3.0 equiv), Cs in ACN (10 mL) A mixture of ₂ CO ₃ (110 mg, 0.34 mmol, 0.3 equiv) and NaI (15 mg, 0.11 mmol, 0.1 equiv) was stirred overnight at 85 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product 83-4 (465 mg, 78% yield) as a yellow oil. LCMS: Rt: 0.900 min; MS m/z (ESI): 482.4 [M+H] ⁺ .

Step 4: Preparation of Compound 83-5

To a solution of compound 83-4 (185 mg, 0.39 mmol, 1.0 equiv) was dissolved in DCM (10 mL) and SOCl ₂ (230 mg, 2.00 mmol, 5.0 equiv) was added at RT. The mixture was stirred at 35 °C for 16 hours. LCMS showed the reaction to be complete and the mixture was evaporated under reduced pressure to give compound 83-5 (185 mg, crude) as a yellow oil. LCMS: Rt: 0.930 min; MS m/z (ESI): 500.4 [M+H] ⁺ .

Step 5: Preparation of Compound 83

Compound SM2 (205mg, 0.48mmol, 1.2 equiv), Compound 83-5 (200mg, 0.4mmol, 1.0 equiv), DIEA (260mg, 2.0mmol, 5.0 equiv), NaI (6mg) in THF (10mL) , 0.04 mmol, 0.1 equiv) was stirred overnight at 75 °C. The mixture was concentrated under vacuum. The residue was purified by prep-HPLC to give the desired product compound 83 (63 mg, 18% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.00-1.41 (m, 59H), 1.42-1.52 (m, 4H), 1.57-1.69 (m, 10H), 1.71- 2.12 (m, 4H), 2.22-2.34 (m, 5H), 2.35-2.44 (m, 3H), 2.45-2.56 (m, 4H), 2.57-2.61 (m, 2H), 3.01-3.23 (m, 1H) ), 3.51–3.55 (m, 2H), 3.90–4.00 (m, 2H), 4.01–4.11 (m, 2H). LCMS: Rt: 1.980 min; MS m/z (ESI): 891.7 [M+H] ⁺ .

6.36 Example 36: Preparation of Compound 84.

Step 1: Preparation of Compound 84-2

A mixture of compound 84-1 (1.2 g, 4 mmol, 1.0 equiv) and LiOH H ₂ O (1.7 g, 40 mmol, 10.0 equiv) with MeOH (30 mL) and H ₂ O (5 mL) was heated to 70 °C overnight. was stirred in The mixture was concentrated and extracted over ethyl acetate, dried and concentrated to give compound 84-2 (853 mg, 74.5% yield) as a yellow oil.

Step 2: Preparation of Compound 84-3

A mixture of compound 84-2 (853mg, 3.0mmol, 1.0 equiv), compound SM12 (648mg, 3.6mmol, 1.2 equiv), TsOH (258mg, 1.5mmol, 0.5 equiv) in toluene was heated at 180°C for 2 hours. Stirred. The mixture was concentrated and purified by column chromatography silica gel (EA:PE = 0% to 5%) to give compound 84-3 (834 mg, 62.1% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.79-0.93 (m, 6H), 1.11-1.33 (m, 25H), 1.35-1.51 (m, 6H), 1.59-1.70 (m, 3H), 1.81- 2.1 (m, 2H), 2.26–2.35 (m, 1H), 3.36–3.45 (m, 2H), 4.02–4.11 (m, 2H).

Step 3: Preparation of Compound 84-4

Compound 84-3 (300 mg, 0.67 mmol, 1.0 equiv), Compound B (93 mg, 0.81 mmol, 1.2 equiv), K ₂ CO ₃ (278 mg, 2.01 mmol, 3 equiv), Cs in ACN (10 mL) A mixture of ₂ CO ₃ (7 mg, 0.02 mmol, 0.03 equiv) and sodium iodide (51 mg, 0.34 mmol, 0.5 equiv) was stirred overnight at 80 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product 84-4 (314 mg, 97.2% yield) as a yellow oil. LCMS: Rt: 0.920 min; MS m/z (ESI): 482.4 [M+H] ⁺ .

Step 4: Preparation of Compound 84-5

A mixture of compound 84-4 (314 mg, 0.65 mmol, 1.0 equiv) and SOCl ₂ (232 mg, 1.95 mmol, 3.0 equiv) in DCM (10 mL) was stirred overnight at 35 °C. The mixture was concentrated to give the desired product 84-5 (343 mg, crude). LCMS: Rt: 1.080 min; MS m/z (ESI): 500.3 [M+H] ⁺ .

Step 5: Preparation of Compound 84

Compound 84-5 (152 mg, 0.3 mmol, 1.0 equiv), compound SM2 (130 mg, 0.3 mmol, 1.0 equiv), sodium iodide (23 mg, 0.15 mmol, 0.5 equiv) and DIEA (116 mg, 0.9 mmol, 3.0 eq) was stirred overnight at 70 °C. The mixture was concentrated under vacuum. The residue was purified by prep-HPLC to give the desired product 84 (54 mg, 19.9% yield) as a brown oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.80-0.94 (m, 12H), 1.00-1.34 (m, 59H), 1.36-1.50 (m, 6H), 1.51-1.70 (m, 9H), 1.78- 2.05 (m, 5H), 2.26-2.33 (m, 3H), 2.36-2.45 (m, 3H), 2.46-2.55 (m, 4H), 2.57-2.63 (m, 2H), 3.01-3.14 (m, 1H) ), 3.49–3.59 (m, 2H), 3.93–3.99 (m, 2H), 4.01–4.10 (m, 2H). LCMS: Rt: 2.010 min; MS m/z (ESI): 891.7 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 84 using the corresponding starting materials.

6.37 Example 37: Preparation of Compound 86.

To a solution of compound 65 (0.19 g, 0.21 mmol, 1.0 equiv) in MeOH (5.0 mL) was added Pd/C (30 mg) and stirred for 16 h at RT under H ₂ . LCMS showed the reaction to be complete, concentrated and purified by pre-HPLC to give compound 86 (60 mg, 31% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.39 (m, 60H), 1.43-1.62 (m, 9H), 1.61-1.67 (m, 8H), 1.77- 2.00 (m, 4H), 2.28-2.47 (m, 12H), 2.56-2.58 (m, 2H), 2.95-3.10 (m, 1H), 3.51-3.54 (m, 2H), 3.96 (d, J = 6.0 Hz, 4H). LCMS: Rt: 1.490 min; MS m/z (ESI): 919.9 [M+H] ⁺ .

6.38 Example 38: Preparation of Compound 87.

Step 1: Preparation of Compound 87-2

A solution of compound 83-2 (500 mg, 1.12 mmol, 1.0 equiv) and compound B (130 mg, 1.12 mmol, 1.0 equiv) was dissolved in ACN (10 mL) and Cs ₂ CO ₃ (110 mg, 0.34 mmol, 0.3 equiv), K ₂ CO ₃ (465 mg, 3.36 mmol, 3.0 equiv) and NaI (15 mg, 0.11 mmol, 0.1 equiv) were added at RT. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH = 1/0-20/1) to give compound 87-2 (470 mg, 85% yield) as a yellow oil did LCMS: Rt: 0.930 min; MS m/z (ESI): 480.4 [M+H] ⁺ .

Step 2: Preparation of Compound 87-3

DIEA (90mg, 0.70mmol, 1.5 equiv) was slowly added to a mixture of compound 87-2 (2.4mg, 5.5mmol, 1.0 equiv) and MsCl (55mg, 0.46mmol, 1.0 equiv) in anhydrous DCM (5mL). was added at °C. After addition, the mixture was stirred at RT for 2 h and TLC showed the reaction to be complete. The mixture was washed with water and concentrated. The residue (210 mg) was used in the next step without further purification.

Step 3: Preparation of Compound 87

DIEA (188 mg, 1.35 mmol, 5.0 equiv) and NaI ( 5 　 mg, 0.03 　 mmol, 0.1 equivalent) was added at 0 °C. The mixture was stirred at 75 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 87 (56 mg, 23% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.39 (m, 49H), 1.58-1.68 (m, 14H), 1.98-2.22 (m, 10H), 2.23- 2.34 (m, 5H), 2.38-2.72 (m, 9H), 2.81-3.17 (m, 2H), 3.45-3.65 (m, 2H), 3.95-4.00 (m, 2H), 4.01-4.05 (m, 2H) ), 5.02–5.12 (m, 1H). LCMS: Rt: 1.680 min; MS m/z (ESI): 889.7 [M+H] ⁺ .

6.39 Example 39: Preparation of Compound 88.

Step 1: Preparation of Compound 88-2

To a solution of compound 88-1 (1.34 g, 10.0 mmol, 1.0 equiv) in DCE (20.0 mL) was added compound SM13 (0.68 g, 10.0 mmol, 1.0 equiv) and AcOH (0.7 g, 10.0 mmol, 1.0 equiv). Stirred at RT for 2 h, then NaCNBH ₃ (1.02 g, 15.0 mmol, 1.5 equiv) was added and stirred at RT for 16 h. LCMS showed the reaction was complete, HO was added, extracted with DCM, concentrated and purified by FCC (DCM/MeOH = 20/1) to give compound 88-2 (0.4 g, 21% yield) as a yellow oil. was obtained as LCMS: Rt: 0.720 min; MS m/z (ESI): 190.2 [M+H]

Step 2: Preparation of Compound 88-3

K ₂ CO ₃ (414 mg, 3.0 mmol, 3.0 equiv), Cs ₂ CO ₃ (97.5 mg, 0.3 mmol, 0.3 equiv) and NaI (14.6 mg, 0.1 mmol, 0.1 equiv) were added at RT. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH = 30/1) to give compound 88-3 (0.26 g, 46% yield) as a yellow oil. LCMS: Rt: 0.990 min; MS m/z (ESI): 556.4 [M+H] ⁺ .

Step 3: Preparation of Compound 88

To a solution of compound 88-3 (0.2 g, 0.36 mmol, 1.0 equiv) in DCE (10.0 mL) was added compound SM2 (0.18 g, 0.43 mmol, 1.2 equiv) and AcOH (3 drops) and stirred at RT for 2 h. Then NaBH(OAc) ₃ (0.114 g, 0.54 mmol, 1.5 equiv) was added and stirred at RT for 16 h. LCMS showed the reaction to be complete, concentrated and purified by pre-HPLC to give compound 88 (70 mg, 20% yield) as a yellow oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.39 (m, 60H), 1.43-1.62 (m, 13H), 1.78-2.00 (m, 4H), 2.25- 2.30 (m, 5H), 2.45-2.62 (m, 5H), 3.10 (s, 1H),3.49-3.59 (m, 6H), 3.96 (d, J = 5.2 Hz, 4H), 7.16-7.22 (m, 4H). LCMS: Rt: 1.350 min; MS m/z (ESI): 967.7 [M+H] ⁺ .

6.40 Example 40: Preparation of Compound 90.

Step 1: Preparation of Compound 90-2

90-1 (5 g, 25.9 mmol, 3.0 equiv), PMBNH ₂ (1.2 g, 8.6 mmol, 1.0 equiv) and K ₂ CO ₃ (3.6 g, 25.9 mmol, 3.0 equiv), Cs ₂ in ACN (40 mL). A mixture of CO ₃ (100 mg, 0.3 mmol, 0.03 equiv) and NaI (0.6 g, 4.3 mmol, 0.5 equiv) was stirred overnight at 80 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product 90-2 (2.5 g, crude) as a yellow oil. LCMS: Rt: 0.810 min; MS m/z (ESI): 362.3 [M+H] ⁺ .

Step 2: Preparation of Compound 90-3

A mixture of compound 90-2 (2.5 g, 6.9 mmol, 1.0 equiv) and Pd/C (10%, 1 g) in a solution of MeOH (100 mL) and ethyl acetate (10 mL) was stirred at 50 °C for 5 days. It became. The mixture was concentrated to give the desired product 90-3 (1.48 g, crude) as a yellow semi-solid. LCMS: Rt: 0.780 min; MS m/z (ESI): 242.3 [M+H] ⁺ .

Step 3: Preparation of Compound 90-4

Compound 90-3 (242 mg, 1 mmol, 1.0 equiv), Compound W (214 mg, 1.1 mmol, 1.1 equiv), DIEA (194 mg, 3 mmol, 3.0 equiv) and HATU (418 mg) in DCM (5 mL) , 1.1 mmol, 1.1 equiv) was stirred at RT for 1 h. The mixture was diluted with water, extracted over ethyl acetate, washed with brine, dried, concentrated and purified on column chromatography silica gel (EA:PE = 0% to 33%) to give the desired product 90-4 (298 mg, 71.2% yield) as a yellow oil. LCMS: Rt: 2.250 min; MS m/z (ESI): 418.2, 420.2 [M+H] ⁺ .

Step 4: Preparation of Compound 90-5

Compound 90-4 (298 mg, 0.71 mmol, 1.0 equiv), compound SM6 (130 mg, 2.13 mmol, 3.0 equiv) and K ₂ CO ₃ (295 mg, 2.13 mmol, 3.0 equiv), Cs in ACN (12 mL) A mixture of ₂ CO ₃ (7 mg, 0.02 mmol, 0.03 equiv) and NaI (53 mg, 0.35 mmol, 0.5 equiv) was stirred overnight at 80 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product 90-5 (150 mg, 52.8% yield) as a yellow oil. LCMS: Rt: 0.800 min; MS m/z (ESI): 399.3 [M+H] ⁺ .

Step 5: Preparation of Compound 90

Compound 43-3 (170mg, 0.3mmol, 1.0 equiv), compound 90-5 (150mg, 0.4mmol, 1.3 equiv), DIEA (116mg, 0.9mmol, 3.0 equiv), NaI (116mg, 0.9mmol, 3.0 equiv) in THF (5mL) 23 mg, 0.15 mmol, 0.5 eq) was stirred overnight at 70 °C. The mixture was concentrated under vacuum. The residue was purified by prep-HPLC to give the desired product 90 (82 mg, 34.5% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.80-0.94 (m, 9H), 1.00-1.37 (m, 47H), 1.39-1.56 (m, 8H), 1.57-1.69 (m, 7H), 1.71- 1.87 (m, 4H), 2.22-2.34 (m, 4H), 2.36-2.71 (m, 10H), 3.13-3.23 (m, 2H), 3.24-3.38 (m, 2H), 3.48-3.60 (m, 2H) ), 4.00–4.11 (m, 2H). LCMS: Rt: 1.070 min; MS m/z (ESI): 792.6 [M+H] ⁺ .

The following compounds were prepared in a similar manner to compound 90 using the corresponding starting materials.

6.41 Example 41: Preparation of Compound 100.

Step 1: Preparation of Compound 100-1

To a mixture of compound SM8 (2.8 g, 17.1 mmol, 1.0 equiv) and DIEA (7.0 g, 54.2 mmol, 2.0 equiv) in DCM (100 mL) was added Boc ₂ O (7.1 g, 32.6 mmol, 1.2 equiv) at RT. It became. The mixture was stirred at RT for 1 hour and TLC showed the reaction to be complete. The mixture was washed with water and brine, dried and concentrated. The residue was purified by column chromatography to give product 100-1 (4.9 g, 86% yield) as a colorless oil.

Step 2: Preparation of Compound 100-2

Compound 100-1 (4.8　g, 24.1mmol, 1.0 equiv), DIEA (6.2　g, 48.2mmol, 2.0 equiv), MsCl (3.3g, 28.9mmol, 1.2 equiv) was added to a mixture of DCM (100mL) at 0 °C. has been added TLC showed the reaction to be complete. The mixture was washed with water and brine, dried, concentrated and the residue was purified by column chromatography to give the product 100-2 (6.1 g, 90 % yield) as a yellow oil.

Step 3: Preparation of Compound 100-3

A mixture of compound 100-2 (3.0 g, 10.7 mmol, 1.0 equiv), compound SM6 (2.0 g, 32.0 mmol, 3.0 equiv), K ₂ CO ₃ (2.2 g, 16.0 mmol, 1.5 equiv) in ACN (30 mL). was stirred overnight at reflux. LCMS showed the reaction to be complete. The mixture was concentrated and the residue was purified by pre-HPLC to give the product 100-3 (2.6 g, 88% yield) as a yellow oil. LCMS: Rt: 0.836 min; MS m/z (ESI): 247.1 [M+H] ⁺ .

Step 4: Preparation of Compound 100-4

Compound 100-3 (500 mg, 2.0 mmol, 1.0 equiv) in THF (20 mL), DIEA (790 mg, 6.1 mmol, 3.0 equiv), compound 43-3 (1.0 g, 2.4 mmol, 1.2 equiv), NaI (90 mg, 0.6 mmol, 0.3 equiv) was stirred at reflux overnight and LCMS showed that the reaction was showed that it was done. The mixture was concentrated and the residue was purified by column chromatography to give the title product (920 mg, 70% yield) as a yellow oil. LCMS: Rt: 0.830 min; MS m/z (ESI): 640.5 [M+H] ⁺ .

Step 5: Preparation of Compound 100-5

Compound 100-4 (920 mg, 1.4 mmol, 1.0 equiv) in DCM (5.0 mL), TFA (2.0 mL) was stirred at reflux overnight and LCMS showed the reaction to be complete. The mixture was concentrated and the residue diluted with ethyl acetate and saturated aq. It was washed with NaHCO ₃ . The organic layer was concentrated and used in the next step without further purification.

Step 6: Preparation of Compound 100

To a solution of compound SM21 (crude, 0.05 M, 7.4 mL, 2.0 equiv) in DCM was added compound 100-5 (100 mg, 0.2 mmol, 1.0 equiv) stirred at RT overnight and LCMS showed the target product. . The mixture was concentrated and the residue was purified by pre-HPLC to give 100 (21 mg, 10.8% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 9H), 1.26-1.30 (m, 46H), 1.41-1.52 (m, 4H), 1.60-1.68 (m, 16H), 1.74- 1.81 (m, 4H), 2.27-2.31 (m, 2H), 2.39-2.50 (m, 9H), 2.56-2.60 (m, 2H), 2.86-2.93 (m, 2H), 3.52-3.54 (m, 2H) ), 3.93–4.00 (m, 4H), 4.03–4.08 (m, 2H). LCMS: Rt: 1.020 min; MS m/z (ESI): 872.7 [M+H] ⁺ .

6.42 Example 42: Preparation of Compound 108.

Step 1: Preparation of compound 108-2

To a solution of compound 108-1 (758 mg, 4.54 mmol, 1.0 equiv) and compound SM7 (1.4 g, 5.0 mmol, 1.1 equiv) in toluene (40 mL) was added TsOH.H ₂ O (20 mg). The mixture was stirred for 2 hours through a Dean-Stark trap under reflux. The reaction mixture was concentrated and purified by column chromatography on silica gel (PE/EA = 50/1) to give the title compound (910 mg, 47% yield) as a colorless oil. LCMS: Rt: 0.840 min; MS m/z (ESI): 429.1/431.1 [M+H] ⁺ .

Step 2: Preparation of Compound 108-3

K ₂ CO ₃ (799 mg, 5.78 mmol, 3.0 equiv) to a solution of compound 108-2 (910 mg, 2.12 mmol, 1.1 equiv) and compound D (276 mg, 1.93 mmol, 1.0 equiv) in ACN (30 mL). , Cs ₂ CO ₃ (188 mg, 0.58 mmol, 0.3 equiv) and NaI (87 mg, 0.58 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 20/1) to give the title compound (270 mg, 39% yield) as a yellow oil. LCMS: Rt: 0.880 min; MS m/z (ESI): 492.4 [M+H] ⁺ .

Step 3: Preparation of Compound 108-4

To a solution of compound 108-3 (270 mg, 0.55 mmol, 1.0 equiv) and DIPEA (142 mg, 1.10 mmol, 2.0 equiv) in DCM (6 mL) was added MsCl (94 mg, 0.52 mmol, 1.5 equiv). The mixture was stirred at room temperature for 2 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give the title compound (313 mg, 100% yield) as a yellow oil. It was used in the next step without further purification. LCMS: Rt: 0.927 min; MS m/z (ESI): 474.2 [M-OMs] ⁺ .

Step 4: Preparation of Compound 108

DIPEA (355 mg, 2.75 mmol, 5.0 equiv) and NaI ( 25 mg, 0.16 mmol, 0.3 eq) was added. The mixture was stirred at 70 °C for 16 h. LCMS showed the reaction to be complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (115 mg, 23% yield) as a yellow oil. LCMS: Rt: 1.450 min; MS m/z (ESI): 901.7[M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 9H), 1.13-1.36 (m, 53H), 1.43-1.50 (m, 4H), 1.51-1.64 (m, 8H), 1.68- 1.79 (m, 4H), 2.02-2.07 (m, 4H), 2.27-2.32 (m, 4H), 2.42-2.54 (m, 8H), 2.62-2.70 (m, 2H), 2.75-2.80 (m, 2H) ), 3.50–3.56 (m, 2H), 3.96–3.97 (m, 2H), 4.04–4.07 (m, 2H), 5.30–5.43 (m, 4H).

The following compounds were prepared in a similar manner to compound 108 using the corresponding starting materials.

6.43 Example 43: Preparation of Compound 114.

Step 1: Preparation of compound 114-2

Compound SM6 (350 mg, 5.59 mmol, 2.0 equiv), K ₂ CO ₃ (1.16 g, 8.39 mmol, 3.0 equiv) to a solution of compound 114-1 (1.3 g, 2.8 mmol, 1.0 equiv) in ACN (30 mL). , Cs ₂ CO ₃ (280 mg, 0.84 mmol, 0.3 equiv) and NaI (130 mg, 0.84 mmol, 0.3 equiv) were added. The reaction mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound 114-2 (600 mg, 50%). LCMS: Rt: 0.880 min; MS m/z (ESI): 430.3 [M+H] ⁺ .

Step 2: Preparation of compound 114

To a mixture of compound 114-3 (180 mg, 0.42 mmol, 1.0 equiv), DIEA (150 mg, 1.05 mmol, 2.5 equiv) in THF (10 mL), compound 114-2 (150 mg, 0.35 mmol, 0.8 equiv), NaI (50 mg) was added. The reaction mixture was stirred at 70 °C for 10 hours. LCMS showed the reaction to be complete. After removal of the solvent, the residue was purified by pre-HPLC to give the title compound (30 mg, 11% yield) as a yellow oil. LCMS: Rt: 0.600 min; MS m/z (ESI): 795.5 [M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ): 0.87 (t, J = 8 Hz, 9H), 1.26-1.99 (m, 60H), 2.27-2.31 (m, 2H), 2.39-2.43 (m, 4H), 2.56-2.76 (m, 8H), 3.05-3.09 (m, 1H), 3.50-3.55 (m, 4H), 3.68-3.71 (m, 2H),3.98-4.07 (m, 4H).

The following compounds were prepared in an analogous manner to compound 114 using the corresponding starting materials.

6.44 Example 44: Preparation of Compound 118

Step 1: Preparation of compound 118-2

Compound 26-1 (200 mg, 0.45 mmol, 1.0 equiv), Compound 118-1 (64 mg, 0.50 mmol, 1.1 equiv), K ₂ CO ₃ (186 mg, 1.35 mmol, 3.0 equiv) in ACN (5 mL) , Cs ₂ CO ₃ (3 mg, 0.01 mmol, 0.03 equiv), NaI (34 mg, 0.23 mmol, 0.5 equiv) was stirred overnight at 90 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 3%) to give the desired product 118-2 (168 mg, crude) as a yellow oil. LCMS: Rt: 0.890 min; MS m/z (ESI): 496.4 [M+H] ⁺ .

Step 2: Preparation of Compound 118-3

A mixture of compound 118-2 (156 mg, 0.3 mmol, 1.0 equiv), Pd/C (15 mg) in MeOH (6 mL) was stirred overnight at 40 °C under a hydrogen atmosphere. The mixture was filtered and the filtrate was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 3%) to give the desired product 118-3 (145 mg, 92.5% yield) as a yellow oil. LCMS: Rt: 1.780 min; MS m/z (ESI): 498.5 [M+H] ⁺ .

Step 3: Preparation of Compound 118-4

A mixture of compound 118-3 (148 mg, 0.3 mmol, 1.0 equiv) and SOCl ₂ (108 mg, 0.9 mmol, 3.0 equiv) in DCM (5 mL) was stirred overnight at 35 °C. The mixture was concentrated to give the desired product 118-4 (167 mg, crude) as a yellow oil. LCMS: Rt: 1.140 min; MS m/z (ESI): 516.4 [M+H] ⁺ .

Step 4: Preparation of Compound 118

Compound 118-4 (167 mg, 0.33 mmol, 1.0 equiv), compound SM2 (170 mg, 0.40 mmol, 1.2 equiv), DIEA (128 mg, 0.99 mmol, 3.0 equiv) and NaI (24 mg) in THF (5 mL) , 0.16 mmol, 0.5 equiv) was stirred overnight at 70 °C. The mixture was concentrated under vacuum. The residue was purified by prep-HPLC to give the desired product 118 (22 mg, 7.5% yield) as a brown oil. LCMS: Rt: 2.440 min; MS m/z (ESI): 907.8 [M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.81-0.94 (m, 18H), 1.18-1.38 (m, 62H), 1.41-1.56 (m, 5H), 1.58-1.70 (m, 7H), 2.20- 2.35 (m, 4H), 2.37–2.64 (m, 12H), 3.45–3.56 (m, 2H), 3.91–4.01 (m, 4H).

6.45 Example 45: Preparation of Compound 120

Step 1: Preparation of Compound 120-1

Compound 114-1 (300 mg, 0.65 mmol, 1.0 equiv), Compound 118-1 (125 mg, 0.97 mmol, 1.5 equiv) and K ₂ CO ₃ (269 mg, 1.94 mmol, 3.0 equiv) in ACN (10 mL) , Cs ₂ CO ₃ (65 mg, 0.20 mmol, 0.3 equiv), NaI (8 mg, 0.06 mmol, 0.1 equiv) was stirred overnight at 85 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product 120-1 (150 mg, 46% yield) as a yellow oil. LCMS: Rt: 0.890 min; MS m/z (ESI): 498.4 [M+H] ⁺ .

Step 2: Preparation of Compound 120-2

A solution of compound 120-1 (150mg, 0.30mmol, 1.0 equiv) was dissolved in DCM (10mL), DIEA (58mg, 0.45mmol, 1.5 equiv) and MsCl (52mg, 0.45mmol, 1.5 equiv) at RT. was added in The mixture was stirred at RT for 1 hour. TLC showed the reaction to be complete and the mixture was evaporated under reduced pressure to give 120-2 (110 mg, 64% yield) as a yellow oil.

Step 2: Preparation of Compound 120

Compound 114-2 (103 mg, 0.24 mmol, 1.2 equiv), Compound 120-2 (110 mg, 0.20 mmol, 1.0 equiv), DIEA (77 mg, 0.60 mmol, 3.0 equiv), NaI ( 8 mg, 0.06 mmol, 0.3 eq) was stirred overnight at 75 °C. The mixture was concentrated under vacuum. The residue was purified by prep-HPLC to give the desired product 120 (15 mg, 8% yield) as a yellow oil. LCMS: Rt: 2.110 min; MS m/z (ESI): 909.8 [M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.80-0.95 (m, 12H), 1.16-1.36 (m, 52H), 1.53-1.70 (m, 6H), 1.71-1.85 (m, 5H), 2.49- 2.84 (m, 15H), 3.03-3.19 (m, 1H), 3.43-3.64 (m, 6H), 3.77-3.90 (m, 5H), 3.91-4.03 (m, 5H), 5.19-5.33 (m, 1H) ).

The following compounds were prepared in an analogous manner to compound 120 using the corresponding starting materials.

6.46 Example 46: Preparation of Compound 127

Step 1: Preparation of compound 127-2

To a solution of compound 127-1 (300.0 mg, 0.7 mmol, 1.0 equiv) and compound D (97.0 mg, 0.7 mmol, 1.0 equiv) in ACN (15.0 mL) was added K ₂ CO ₃ (276.0 mg, 2.01 mmol, 3.0 equiv). , Cs ₂ CO ₃ (65.0 mg, 0.2 mmol, 0.3 equiv) and NaI (10.0 mg, 0.07 mmol, 0.1 equiv) were added at RT. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH = 1/0-10/1) to give 127-2 (0.24 g, crude) as a yellow oil. LCMS: Rt: 0.813 min; MS m/z (ESI): 497.4 [M+H] ⁺ .

Step 2: Preparation of Compound 127-3

To a solution of compound 127-2 (0.24 g, 0.48 mmol, 1.0 equiv) in DCM (10.0 mL) was added DIEA (124.0 mg, 0.96 mmol, 2.0 equiv) and MsCl (67.0 mg, 0.58 mmol, 1.2 equiv) at 0 °C. was added in The mixture was stirred for 1 hour. TLC showed the reaction to be complete, H ₂ O was added and extracted with DCM and dried over Na ₂ SO ₄ . The mixture was evaporated under reduced pressure to give 127-3 (0.26 g, crude) as a yellow oil.

Step 3: Preparation of Compound 127

DIEA (162.0 mg, 1.2 mmol, 3.0 equiv.) and NaI ( 6.0 mg, 0.04 mmol, 0.1 equivalent) was added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete, the mixture was evaporated under reduced pressure and purified by pre-HPLC to give 127 (35.0 mg, 9% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.14-1.36 (m, 59H), 1.42-1.78 (m, 18H), 2.20-2.60 (m, 12H), 3.17 ( s, 4H), 3.53 (s, 2H), 3.96–4.06 (m, 4H). LCMS: Rt: 1.680 min; MS m/z (ESI): 906.9 [M+H] ⁺ .

6.47 Example 47: Preparation of Compound 128

Step 1: Preparation of compound 128-1

A solution of compound SM7 (332.0 mg, 2.0 mmol, 1.0 equiv) was dissolved in toluene (10.0 mL) at 0 °C, followed by pyridine (1.1 g, 16.0 mmol, 8.0 equiv) and triphosgene (1.1 g, 1.2 mmol, 0.6 eq) was added. The mixture was stirred at RT for 1 h then compound SM (540.0 mg, 2.0 mmol, 1.0 eq) was added. The mixture was stirred at RT for 16 hours. TLC showed the reaction to be complete, the mixture was poured into H ₂ O and extracted with EA. The mixture was evaporated under reduced pressure and purified by FCC (PE/EA = 100/1-10/1) to give 128-1 (350.0 mg, crude) as a yellow oil.

Step 2: Preparation of Compound 128-2

To a solution of compound 128-1 (300.0 mg, 0.65 mmol, 1.0 equiv) and ethanolamine (120.0 mg, 2.0 mmol, 3.0 equiv) in ACN (15.0 mL) was added DIEA (419.0 mg, 3.25 mmol, 5.0 equiv) at RT. has been added The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH = 1/0-10/1) to give 128-2 (0.2 g, crude) as a yellow oil. LCMS: Rt: 0.882 min; MS m/z (ESI): 444.4 [M+H] ⁺ .

Step 3: Preparation of Compound 128

To a solution of compound 128-2 (155.0 mg, 0.35 mmol, 1.0 equiv) and compound 43-3 (150.0 mg, 0.35 mmol, 1.0 equiv) in THF (5.0 mL) was added DIEA (135 mg, 1.2 mmol, 5.0 equiv) and NaI (5.0 mg, 0.035 mmol, 0.1 equiv) was added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete, the mixture was evaporated under reduced pressure and purified by pre-HPLC to give 128 (20.0 mg, 7% yield) as a yellow oil. LCMS: Rt: 1.380 min; MS m/z (ESI): 837.7[M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 9H), 1.26-1.38 (m, 57H), 1.59-1.71 (m, 16H), 2.28-2.32 (m, 2H), 2.52- 2.70 (m, 8H), 3.50–3.61 (m, 2H), 4.03–4.14 (m, 6H).

6.48 Example 48: Preparation of Compound 133

Step 1: Preparation of Compound 133-1

To a solution of compound 128-1 (500.0 mg, 1.0 mmol, 1.0 equiv) and compound D (158.0 mg, 1.0 mmol, 1.0 equiv) in ACN ( 15.0 mL) was added DIEA (418.0 mg, 3.0 mmol, 3.0 equiv) and NaI (15.0 mg, 0.1 mmol, 0.1 equiv) was added at RT. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH = 1/0-10/1) to give 133-1 (0.3 g, crude) as a yellow oil. LCMS: Rt: 0.945 min; MS m/z (ESI): 526.5 [M+H] ⁺ .

Step 2: Preparation of Compound 133-2

To a solution of compound 133-1 (0.3 g, 0.57 mmol, 1.0 equiv) in DCM (10.0 mL) was added DIEA (147.0 mg, 1.14 mmol, 2.0 equiv) and MsCl (79.0 mg, 0.68 mmol, 1.2 equiv) at 0 °C. was added in The mixture was stirred for 1 hour. TLC showed the reaction to be complete, H ₂ O was added and extracted with DCM and dried over Na ₂ SO ₄ . The mixture was evaporated under reduced pressure to give 133-2 (0.35 g, crude) as a yellow oil.

Step 3: Preparation of Compound 133

DIEA (162.0 mg, 1.2 mmol, 3.0 equiv) and NaI ( 6.0 mg, 0.04 mmol, 0.1 equiv) was added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete, the mixture was evaporated under reduced pressure and purified by pre-HPLC to give 133 (25.0 mg, 7% yield) as a yellow oil. LCMS: Rt: 2.170 min; MS m/z (ESI): 935.8 [M+H] ⁺ _.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.14-1.36 (m, 68H), 1.60-1.82 (m, 15H), 2.28-2.32 (m, 2H), 2.54- 2.64 (m, 9H), 3.58 (s, 2H), 3.98–4.14 (m, 6H).

6.49 Example 49: Preparation of Compound 134

Step 1: Preparation of Compound 134

To a solution of triphosgene (300 mg, 1.0 mmol, 1.0 equiv) in (20 mL) in DCM was added octanol (395 mg, 3.0 mmol, 3.0 equiv) and pyridine (640 mg, 8.0 mmol, 8.0 equiv) at RT. It became. The mixture was stirred for 1 hour. Compound 100-5 (100 mg, 0.20 mmol, 0.2 eq) was added to the reaction mixture (4 mL). The mixture was stirred overnight and LCMS showed the target product. The mixture was concentrated and the residue was purified by pre-HPLC to give the product 134 (16 mg, 4.3% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.88 (m, 6H), 1.07-1.30 (m, 32H), 1.47-1.59 (m, 26H), 1.78-1.79 (m, 4H), 1.98- 2.04 (m, 2H), 2.26-2.58 (m, 6H), 2.10-3.12 (m, 1H), 3.49-3.53 (m, 1H), 4.03-4.07 (m, 2H), 4.66-5.38 (m, 1H) ). LCMS: Rt: 0.880 min; MS m/z (ESI): 696.6 [M+H] ⁺ .

6.50 Example 50: Preparation of Compound 147

Step 1: Preparation of Compound 100-1

To a mixture of compound SM8 (1 g, 9.690 mmol, 1.0 equiv) and DIEA (1.9 g, 14.54 mmol, 1.5 equiv) in DCM (15 mL) was added Boc ₂ O (2.5 g, 11.63 mmol, 1.2 equiv). The reaction mixture was stirred at RT for 16 h. TLC showed the reaction to be complete. Mixture power in water and washed with DCM. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound 100-1 (1.7 g, 86.30%) as a colorless oil.

Step 2: Preparation of Compound 147-1

To a solution of compound 100-1 (1.7 g, 8.362 mmol, 1.0 equiv) in THF F (30 mL) was added LiAlH ₄ (0.64 g, 16.72 mmol, 2.0 equiv) slowly at 0 °C. The reaction mixture was stirred at reflux for 2 hours. TLC showed the reaction to be complete. After cooling to 0 °C. The mixture was quenched by successive additions of water (1.3 mL), 15% aqueous NaOH (1.3 mL) and water (3.9 mL). The resulting mixture was diluted with ethyl acetate and the precipitate was removed by titration. The filtrate was evaporated under reduced pressure to give compound 147-1 (0.8 g, 81.63%) as a yellow oil.

Step 3: Preparation of Compound 147-2

HATU ( 1.46 g, 3.839 mmol, 1.5 equiv) was added. The reaction mixture was stirred at RT for 2 h. TLC showed the reaction to be complete. Mixture power in water and washed with DCM. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound 147-2 (800 mg, crude) as a colorless oil.

Step 4: Preparation of Compound 147-3

To a mixture of compound 147-2 (800 mg, 2.165 mmol, 1.0 equiv) and DIEA (560 mg, 4.329 mmol, 2.0 equiv) in DCM (15 mL) was added MscI (248 mg, 2.165 mmol, 1.0 equiv) at 0 °C. was added under N ₂ . The reaction mixture was stirred at 0 °C for 2 hours. TLC showed the reaction to be complete. Mixture power in water and washed with DCM. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound 147-3 (550 mg, 56.74%) as a yellow oil.

Step 5: Preparation of Compound 147-4

To a solution of compound 147-3 (550 mg, 1.229 mmol, 1.0 equiv) in ACN (15 mL) was compound E (232 mg, 1.474 mmol, 1.2 equiv), K ₂ CO ₃ (509 mg, 3.686 mmol, 3.0 equiv). , Cs ₂ CO ₃ (120 mg, 0.3686 mmol, 0.3 equiv), NaI (55 mg, 0.3686 mmol, 0.3 equiv) were added. The reaction mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound 147-4 (230 mg, 36.77%) as a yellow oil. LCMS: Rt: 0.850 min; MS m/z (ESI): 509.5 [M+H] ⁺ .

Step 6: Preparation of Compound 147-5

To a solution of compound 147-4 (230 mg, 0.4520 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl ₂ (161 mg, 1.356 mmol, 3.0 equiv). The reaction mixture was stirred at 35 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent gave compound 147-5 (270 mg, crude) as a yellow oil. LCMS: Rt: 0.890 min; MS m/z (ESI): 527.5[M+H] ⁺ .

Step 7: Preparation of Compound 147

To a mixture of compound 147-5 (270 mg, 0.4520 mmol, 1.0 equiv), DIEA (292 mg, 2.260 mmol, 5.0 equiv) in THF (15 mL) was added compound SM23 (217 mg, 0.5424 mmol, 1.2 equiv), NaI ( 15 mg) was added. The reaction mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete. After removal of the solvent, the residue was purified by pre-HPLC to give the title compound (50 mg, 12.42% yield) as a yellow oil. LCMS: Rt: 1.420 min; MS m/z (ESI): 890.8[M+H] ⁺ _.

¹ H NMR (400 MHz, CDCl ₃ ): 0.86-0.89 (m, 12H), 1.26 (s, 48H), 1.34-1.41 (m, 6H), 1.45-1.52 (m, 10H), 1.62-1.91 (m , 11H), 2.19–2.23 (m, 4H), 2.38–2.67 (m, 11H), 2.94 (d, J = 25.2 Hz, 3H), 3.24–3.37 (m, 2H), 3.52–3.54 (m, 2H) ), 4.04–4.07 (m, 2H).

6.51 Example 51: Preparation of Compound 148

Step 1: Preparation of compound 148-1

K ₂ CO ₃ (962 mg, 6.96 mmol, 3.0 equiv) to a solution of compound 118-1 (600 mg, 4.64 mmol, 2.0 equiv) and compound SM24 (973 mg, 2.32 mmol, 1.0 equiv) in ACN (40 mL). , Cs ₂ CO ₃ (228 mg, 0.70 mmol, 0.3 equiv) and NaI (105 mg, 0.70 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 25/1) to give the title compound (525 mg, 49% yield) as a yellow oil. LCMS: Rt: 0.850 min; MS m/z (ESI): 468.4 [M+H] ⁺ .

Step 2: Preparation of Compound 148-2

To a solution of compound 148-1 (220 mg, 0.47 mmol, 1.0 equiv) and DIPEA (121 mg, 0.94 mmol, 2.0 equiv) in DCM (5 mL) at 0 °C was added MscI (65 mg, 0.56 mmol, 1.2 equiv). has been added The mixture was stirred at room temperature for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give the title compound (238 mg, 93% yield) as a yellow oil. It was used in the next step without further purification. LCMS: Rt: 0.940 min; MS m/z (ESI): 486.4 [M-OMs+Cl] ⁺ .

Step 3: Preparation of Compound 148

K ₂ CO ₃ (153 mg, 1.11 mmol, 3.0 equiv) to a solution of compound 148-2 (200 mg, 0.37 mmol, 1.0 equiv) and compound SM16 (163 mg, 0.37 mmol, 1.0 equiv) in ACN (10 mL). , Cs ₂ CO ₃ (36 mg, 0.11 mmol, 0.3 equiv) and NaI (16 mg, 0.11 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 h. LCMS showed the reaction to be complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (50 mg, 15% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.35 (m, 48H), 1.41-1.52 (m, 4H), 1.59-1.64 (m, 10H), 1.73- 1.76 (m, 3H), 1.95-2.01 (m, 1H), 2.28-2.32 (m, 6H), 2.37-2.62 (m, 9H), 3.03-3.11 (m, 2H), 3.50-3.56 (m, 2H) ), 3.95–3.97 (m, 2H), 4.00–4.10 (m, 4H), 5.23–5.28 (m, 1H). LCMS: Rt: 1.470 min; MS m/z (ESI): 893.7 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 148 using the corresponding starting materials.

6.52 Example 52: Preparation of Compound 149

Step 1: Preparation of compound 149-2

Compound 149-1 (885 mg, 4.56 mmol, 1.1 equiv), Compound W (1.0 g, 4.15 mmol, 1.0 equiv), HATU (1.9 g, 4.98 mmol, 1.2 equiv) and DIEA (1.6 g) in DCM (20 mL) , 4.98mmol, 1.2 equiv) was stirred at RT for 16 hours. TLC showed the reaction to be complete. The mixture was concentrated and purified by column chromatography silica gel (EA:PE = 0% to 5%) to give compound 149-2 (1.2 g, 63% yield) as a colorless oil.

Step 2: Preparation of compound 149-3

Compound 149-2 (500 mg, 1.20 mmol, 1.0 equiv), Compound 118-1 (170 mg, 1.31 mmol, 1.1 equiv), K ₂ CO ₃ (497 mg, 3.60 mmol, 3.0 equiv) in ACN (10 mL) , Cs ₂ CO ₃ (117 mg, 0.36 mmol, 0.3 equiv) and NaI (17 mg, 0.12 mmol, 0.1 equiv) were stirred overnight at 85 °C. The mixture was concentrated and purified by column chromatography silica gel (MeOH:DCM = 0% to 10%) to give the desired product 149-3 (300 mg, 54% yield) as a yellow oil. LCMS: Rt: 0.820 min; MS m/z (ESI): 467.4 [M+H] ⁺ .

Step 3: Preparation of Compound 149-4

To a solution of compound 149-3 (280 mg, 0.60 mmol, 1.0 equiv) was dissolved in DCM (10 mL) and MsCl (82 mg, 0.72 mmol, 1.2 equiv) was added at RT. The mixture was stirred at RT for 1 hour. LCMS showed the reaction to be complete and the mixture was evaporated under reduced pressure to give compound 149-4 (200 mg, crude) as a yellow oil. LCMS: Rt: 0.830 min; MS m/z (ESI): 449.4 [M-OMs] ⁺ .

Step 4: Preparation of Compound 149

Compound SM25 (200 mg, 0.41 mmol, 1.2 equiv), Compound 149-4 (182 mg, 0.41 mmol, 1.0 equiv), K ₂ CO ₃ (170 mg, 1.23 mmol, 3.0 equiv), Cs in ACN (10 mL) A mixture of ₂ CO ₃ (40 mg, 0.12 mmol, 0.3 equiv) and NaI (5.6 mg, 0.04 mmol, 0.1 equiv) was stirred overnight at 85 °C. LCMS showed the reaction to be complete and the residue was purified by prep-HPLC to give the desired product 149 (62 mg, 17% yield) as a yellow oil. LCMS: Rt: 0.980 min; MS m/z (ESI): 892.8 [M+H] ⁺ _.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.80-0.94 (m, 12H), 1.19-1.42 (m, 42H), 1.43-1.55 (m, 4H), 1.56-1.71 (m, 12H), 1.72- 1.83 (m, 4H), 1.83-2.03 (m, 2H), 2.04-2.24 (m, 4H), 2.25-2.40 (m, 6H), 2.41-2.76 (m, 9H), 3.06-3.24 (m , 3H), 3.47–3.65 (m, 2H), 4.00–4.12 (m, 4H), 5.16–5.31 (m, 1H).

The following compounds were prepared in an analogous manner to compound 149 using the corresponding starting materials.

6.53 Example 53: Preparation of Compound 151

Step 1: Preparation of compound 151-2

To a solution of DMSO (3.2 g, 41.2 mmol, 2.0 equiv) in DCM (120 mL) at -78 °C under N ₂ was added dropwise a solution of oxalyl chloride (2.9 g, 22.7 mmol, 1.1 equiv) in DCM (20 mL). has been added The mixture was stirred for 30 min and then compound 151-1 (5.0 g, 20.6 mmol, 1.0 equiv) was added drop wise at -78 °C. The mixture was stirred at -78 °C for 60 minutes. TEA (6.3 g, 61.8 mmol, 3.0 eq) was added and the mixture was allowed to warm to RT. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (PE/EA = 10/1) to give the title compound (3.2 g, 65% yield) as a colorless oil.

Step 2: Preparation of compound 151-3

To a solution of compound 151-2 (878 mg, 3.65 mmol, 1.0 equiv) and compound 71-4 (870 mg, 3.65 mmol, 1.0 equiv) in toluene (30 mL) was added p-TsOH (70 mg, 0.37 mmol, 0.1 equiv). ) was added. The mixture was stirred at 40 °C for 16 hours. The mixture was diluted with ethyl acetate and washed with saturated aqueous NaHCO ₃ solution. The organic layer was washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (PE/EA = 100/1) to give the title compound (1.2 g, 71% yield) as a colorless oil.

Step 3: Preparation of Compound 151-4

To a solution of compound 151-3 (1.2 g, 2.60 mmol, 1.0 equiv) in ethyl acetate (25 mL) was added Pd/C (120 mg). The mixture was stirred at 35 °C under H ₂ for 16 h. The mixture was filtered through a pad of Celite and rinsed with EA. Filtration was concentrated and purified by column chromatography on silica gel (PE/EA = 5/1) to give the title compound (610 mg, 63% yield) as a colorless oil.

Step 4: Preparation of Compound 151-5

To a solution of compound 151-4 (610 mg, 1.65 mmol, 1.0 equiv) and DIPEA (426 mg, 3.30 mmol, 2.0 equiv) in DCM (20 mL) at 0 °C was MscCl (227 mg, 1.98 mmol, 1.2 equiv). has been added The mixture was stirred at room temperature for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give the title compound (640 mg, 87% yield) as a yellow oil. It was used in the next step without further purification.

Step 5: Preparation of Compound 151-6

K ₂ CO ₃ (593 mg, 4.29 mmol, 3.0 equiv) to a solution of compound 151-5 (640 mg, 1.43 mmol, 1.0 equiv) and compound SM6 (178 mg, 2.86 mmol, 2.0 equiv) in ACN (28 mL). , Cs ₂ CO ₃ (140 mg, 0.43 mmol, 0.3 equiv) and NaI (64 mg, 0.43 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give the title compound (362 mg, 61% yield) as a yellow oil. LCMS: Rt: 0.870 min; MS m/z (ESI): 414.4[M+H] ⁺ .

Step 6: Preparation of Compound 151

K ₂ CO ₃ (182 mg, 1.32 mmol, 3.0 equiv), Cs ₂ CO ₃ (42 mg, 0.13 mmol, 0.3 equiv) and NaI (19 mg, 0.13 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 h. LCMS showed the reaction to be complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (36 mg, 10% yield) as a yellow oil. LCMS: Rt: 1.710 min; MS m/z (ESI): 863.8 [M+H] ⁺ .

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.89 (m, 12H), 0.96-0.99 (m, 2H), 1.26-1.38 (m, 51H), 1.46-1.59 (m, 6H), 1.62- 1.86 (m, 10H), 1.95-1.99 (m, 1H), 2.28-2.30 (m, 2H), 2.41-2.71 (m, 9H), 2.96-3.15 (m, 2H), 3.24-3.30 (m, 2H) ), 3.48-3.59 (m, 2H), 3.80-3.85 (m, 1H), 3.91-3.97 (m, 2H), 4.05-4.09 (m, 2H), 4.30-4.45 (m, 1H), 5.22-5.28 (m, 1H).

6.54 Example 54: Preparation of Compound 152

Step 1: Preparation of compound 152-1

To a mixture of compound SM22 (1 g, 3.697 mmol, 1.0 equiv), compound SM8 (1.2 g, 4.436 mmol, 1.2 equiv), DIEA (0.96 g, 7.394 mmol, 2.0 equiv) in DCM (15 mL) HATU (2.1 g) , 5.546 mmol, 1.5 equiv) was added. The reaction mixture was stirred at RT for 2 h. TLC showed the reaction to be complete. Mixture power in water and washed with DCM. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound 152-1 (1.2 g, 91.28%) as a yellow oil.

Step 2: Preparation of Compound 152-2

To a mixture of compound 152-1 (1.2 g, 3.375 mmol, 1.0 equiv) and DIEA (0.87 g, 6.750 mmol, 2.0 equiv) in DCM (20 mL) was added MsCl (0.46 g, 4.049 mmol, 1.2 equiv) at 0 °C. was added under N ₂ . The reaction mixture was stirred at 0 °C for 2 hours. TLC showed the reaction to be complete. Mixture power in water and washed with DCM. Organics were separated and dried over Na ₂ SO ₄ . Removal of the solvent, FCC gave compound 152-2 (1 g, 64.18%) as a yellow oil.

Step 3: Preparation of Compound 152-3

To a solution of compound 152-2 (1 g, 2.166 mmol, 1.0 equiv) in ACN (20 mL) was compound E (0.4 g, 2.599 mmol, 1.2 equiv), K ₂ CO ₃ (0.9 g, 6.498 mmol, 3.0 equiv). , Cs ₂ CO ₃ (0.21 g, 0.6498 mmol, 0.3 equiv), NaI (0.1 g, 0.6498 mmol, 0.3 equiv) were added. The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent, FCC gave compound 152-3 (600 mg, 55.98%) as a yellow oil. LCMS: Rt: 0.870 min; MS m/z (ESI): 495.4 [M+H] ⁺ .

Step 4: Preparation of Compound 152-4

To a solution of compound 152-3 (600 mg, 1.213 mmol, 1.0 equiv) in DCM (15 mL) was added SOCl ₂ (433 mg, 3.638 mmol, 3.0 equiv). The reaction mixture was stirred at 35 °C for 16 hours. LCMS showed the reaction to be complete. Removal of the solvent gave compound 152-4 (650 mg, crude) as a yellow oil. LCMS: Rt: 0.910 min; MS m/z (ESI): 513.4 [M+H] ⁺ .

Step 5: Preparation of Compound 152

To a mixture of compound 152-4 (200 mg, 0.3896 mmol, 1.0 equiv) in ACN (10 mL) was added compound SM26 (192 mg, 0.4676 mmol, 1.2 equiv), K ₂ CO ₃ (162 mg, 1.169 mmol, 3.0 equiv). , Cs ₂ CO ₃ (38 mg, 0.1169 mmol, 0.3 equiv), NaI (18 mg, 0.1169 mmol, 0.3 equiv) were added. The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. After removal of the solvent, the residue was purified by pre-HPLC to give the title compound (52 mg, 15.02% yield) as a yellow oil. LCMS: Rt: 1.440 min; MS m/z (ESI): 888.8 [M+H] ⁺ _.

¹ H NMR (400 MHz, CDCl ₃ ): 0.86-0.89 (m, 9H), 1.28 (d, J = 19.6 Hz, 49H), 1.45-1.52 (m, 9H), 1.62-1.68 (m, 10H), 1.78-1.86 (m, 4H), 1.99-2.07 (m, 6H), 2.27-2.31 (m, 2H), 2.50-2.68 (m, 11H), 3.22-3.26 (m, 2H), 3.52-3.55 (m , 2H), 4.04–4.07 (m, 2H), 5.33–5.36 (m, 2H), 5.85 (s, 1H).

The following compounds were prepared in an analogous manner to compound 152 using the corresponding starting materials.

6.55 Example 55: Preparation of Compound 161

Step 1: Preparation of compound 161-1

K ₂ CO ₃ (433 mg, 3.132 mmol, 3.0 equiv) to a solution of compound 71-7 (500 mg, 1.044 mmol, 1.0 equiv) and compound F (215 mg, 1.253 mmol, 1.2 equiv) in ACN (10 mL). , Cs ₂ CO ₃ (102 mg, 0.3132 mmol, 0.3 equiv) and NaI (51 mg, 0.3132 mmol, 0.3 equiv) were added. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give the title compound (300 mg, 51.88%) as a yellow oil. LCMS: Rt: 0.840 min; MS m/z (ESI): 554.4 [M+H] ⁺ .

Step 2: Preparation of Compound 161-2

To a solution of compound 161-1 (300 mg, 0.5416 mmol, 1.0 equiv) and DIPEA (105 mg, 0.8124 mmol, 1.5 equiv) in DCM (10 mL) was added MsCl (74 mg, 0.6499 mmol, 1.2 equiv). The mixture was still stirred for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give the title compound (340 mg, crude) as a yellow oil.

Step 3: Preparation of Compound 161

To a solution of compound 161-2 (340 mg, 0.5380 mmol, 1.04 equiv) and compound SM16 (230 mg, 0.5184 mmol, 1.0 equiv) in THF (15 mL) was added DIEA (335 mg, 2.592 mmol, 5.0 equiv) and NaI ( 15 mg) was added. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (60 mg, 11.82% yield) as a yellow oil. ^1H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.29 (s, 31H), 1.32-1.35 (m, 7H), 1.42-1.44 (m, 11H), 1.59-1.72 ( m, 19H), 1.95-2.00 (m, 2H), 2.28-2.32 (m, 8H), 2.35-2.42 (m, 3H), 2.47-2.60 (m, 6H), 2.80 (s, 1H), 3.52- 3.54 (m, 2H), 4.00-4.10 (m, 8H). LCMS: Rt: 1.145 min; MS m/z (ESI): 979.7 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 161 using the corresponding starting materials.

6.56 Example 56: Preparation of Compound 170

Step 1: Preparation of Compound 170-2

To a solution of compound 170-1 (500 mg, 3.69 mmol, 1.0 equiv) and compound 26-1 (1.3 g, 2.95 mmol, 1.0 equiv) in ACN (60 mL) was added K ₂ CO ₃ (1.5 g, 11.07 mmol, 3.0 equiv). equiv), Cs ₂ CO ₃ (361 mg, 1.11 mmol, 0.3 equiv) and NaI (166 mg, 1.11 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 50/1) to give the title compound (630 mg, 37% yield) as a yellow oil. LCMS: Rt: 1.007 min; MS m/z (ESI): 466.3[M+H] ⁺ .

Step 2: Preparation of Compound 170

To a solution of compound 170-2 (300 mg, 0.64 mmol, 1.0 equiv) in MeOH (10 mL) was added compound SM2 (219 mg, 0.51 mmol, 0.8 equiv) and AcOH (1 drop). The mixture was stirred at RT for 2 h. Then NaCNBH ₃ (40 mg, 0.64 mmol, 1.0 equiv) was added and the resulting mixture was stirred at RT for 16 h. LCMS showed the reaction to be complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (54 mg, 12% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.36 (m, 60H), 1.42-1.54 (m, 5H), 1.59-1.74 (m, 10H), 1.89- 1.96 (m, 2H), 2.30-2.35 (m, 6H), 2.48-2.57 (m, 3H), 2.64-2.66 (m, 2H), 3.00-3.03 (m, 2H), 3.49-3.52 (m, 2H) ), 3.96–3.97 (m, 4H). LCMS: Rt: 2.360 min; MS m/z (ESI): 877.7 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 170 using the corresponding starting materials.

6.57 Example 57: Preparation of Compound 178.

Step 1: Preparation of Compound 178-2

To a suspension of compound 178-1 (10.0 g, 68.41 mmol, 1.0 equiv) in THF (300 mL) was added NaH (3.28 g, 82.09 mmol, 1.2 equiv) dropwise. Then compound Q (22.07 g, 102.61 mmol, 1.5 eq) was added dropwise and the resulting mixture was stirred at 50 °C for 10 h. After cooling to RT, the mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (PE/EA = 4/1) to give the title compound (6.0 g, 31% yield) as a yellow oil.

Step 2: Preparation of Compound 178-3

To a solution of compound 178-2 (6.0 g, 21.4 mmol, 1.0 equiv) in THF (100 mL) in aqueous HCl (50 mL, 100 mmol, 4.7 eq) was added. The mixture was stirred at RT for 2 h. The mixture was poured into water and extracted with EtOAc. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give the title compound (4.5 g, 87% yield) as a colorless oil.

Step 3: Preparation of Compound 178-4

DIEA (12.1 g, 93.63 mmol, 5.0 equiv.), EDCI ( 10.77 g, 56.18 mmol, 3.0 equiv.) and DMAP (2.29 g, 18.73 mmol, 1.0 equiv.) were added. The mixture was stirred at 40 °C for 10 hours. The reaction mixture was concentrated and purified by column chromatography on silica gel (PE/EA = 10/1) to give the title compound (7.0 g, 76% yield) as a colorless oil.

Step 4: Preparation of Compound 178-5

To a solution of compound 178-4 (7.0 g, 14.21 mmol, 1.0 equiv) in EtOAc (150 mL) was added Pd/C (1.0 g). The mixture was stirred at RT under H ₂ for 10 h. The mixture was filtered through a pad of celite and rinsed with MeOH. Filtration concentrated to give the title compound (5.1 g, 58% yield) as a yellow oil.

Step 5: Preparation of Compound 178-6

To a solution of compound 178-5 (2.0 g, 4.97 mmol, 1.0 equiv) and DIPEA (1.93 g, 14.90 mmol, 3.0 equiv) in DCM (50 mL) was added MsCl (850 mg, 7.45 mmol, 1.5 equiv). The mixture was stirred at room temperature for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give the title compound (2.0 g, 83% yield) as a yellow oil. It was used in the next step without further purification.

Step 6: Preparation of Compound 178-7

K ₂ CO ₃ (860 mg, 6.24 mmol, 3.0 equiv) to a solution of compound 178-6 (1.0 g, 2.08 mmol, 1.0 equiv) and compound B (480 mg, 4.16 mmol, 2.0 equiv) in ACN (30 mL). , Cs ₂ CO ₃ (200 mg, 0.62 mmol, 0.3 equiv) and NaI (100 mg, 0.62 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give the title compound (500 mg, 48% yield) as a yellow oil. LCMS: Rt: 0.800 min; MS m/z (ESI): 500.3 [M+H] ⁺ .

Step 7: Preparation of Compound 178-8

To a solution of compound 178-7 (300 mg, 0.6 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl ₂ (215 mg, 1.8 mmol, 3.0 equiv). The mixture was stirred at 35 °C for 10 hours. The mixture was concentrated to give the title compound (311 mg, 100% yield) as a yellow oil. LCMS: Rt: 0.467 min; MS m/z (ESI): 518.2 [M+H] ⁺ .

Step 8: Preparation of Compound 178-9

K ₂ CO ₃ (860 mg, 6.24 mmol, 3.0 equiv) to a solution of compound 178-6 (1.0 g, 2.08 mmol, 1.0 equiv) and compound SM6 (250 mg, 4.16 mmol, 2.0 equiv) in ACN (30 mL). , Cs ₂ CO ₃ (200 mg, 0.62 mmol, 0.3 equiv) and NaI (100 mg, 0.62 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give the title compound (500 mg, 54% yield) as a yellow oil. LCMS: Rt: 0.810 min; MS m/z (ESI): 446.3[M+H] ⁺ .

Step 9: Preparation of Compound 178

To a solution of compound 178-8 (200mg, 0.38mmol, 1.0 equiv) and compound 178-9 (180mg, 0.38mmol, 1.0 equiv) in THF (10mL) DIPEA (150mg, 1.16mmol, 3.0 equiv) and NaI (60 mg, 0.38 mmol, 1.0 equiv) was added. The mixture was stirred at 70 °C for 10 hours. LCMS showed the reaction to be complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (50 mg, 14% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.27-1.32 (m, 30H), 1.59-1.64 (m, 10H), 1.85-1.99 (m, 7H), 2.28- 2.32 (m, 10H), 2.48–2.74 (m, 10H), 3.11–3.15 (m, 1H), 3.43–3.53 (m, 10H), 4.09–4.14 (m, 8H). LCMS: Rt: 1.080 min; MS m/z (ESI): 927.5[M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 178 using the corresponding starting materials.

6.58 Example 58: Preparation of Compound 99.

Step 1: Preparation of compound 99-2

A solution of SM7 (400.0 mg, 2.0 mmol, 1.0 equiv) was dissolved in toluene (10.0 mL) at 0 °C, followed by Py (1.1 g, 16.0 mmol, 8.0 equiv) and triphosgene (355.0 mg, 1.2 mmol, 0.6 equivalent) was added. The mixture was stirred for 1 h at RT, then compound 99-1 (578.0 mg, 2.4 mmol, 1.2 eq) was added. The mixture was stirred at RT for 16 hours. TLC showed the reaction to be complete, the mixture was poured into H ₂ O and calibrated with EA. The mixture was evaporated under reduced pressure and purified by FCC (PE/EA=100/1-10/1) to give compound 99-2 (0.3 g, crude) as a yellow oil.

Step 2: Preparation of Compound 99-3

To a solution of compound 99-2 (300.0 mg, 0.7 mmol, 1.0 equiv) and ethanolamine (126.0 mg, 2.01 mmol, 3.0 equiv) in ACN (15.0 mL) was added K ₂ CO ₃ (276.0 mg, 2.01 mmol, 3.0 equiv). , Cs ₂ CO ₃ (65.0 mg, 0.2 mmol, 0.3 equiv) and NaI (10.0 mg, 0.07 mmol, 0.1 equiv) were added at RT. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM/MeOH = 1/0-10/1) to give compound 99-3 (0.16 g, crude) as a colorless oil. LCMS: Rt: 0.863 min; MS m/z (ESI): 415.3 [M+H] ⁺ .

Step 3: Preparation of Compound 99

To a solution of compound 99-3 (160.0 mg, 0.4 mmol, 1.0 equiv) and compound 43-3 (170.0 mg, 0.4 mmol, 3.0 equiv) in THF (5.0 mL) was added DIEA (153 mg, 1.2 mmol, 5.0 equiv) and NaI (6.0 mg, 0.04 mmol, 0.1 equiv) was added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete, the mixture was evaporated under reduced pressure and purified by pre-HPLC to give compound 99 (100.0 mg, 31% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 9H), 1.23-1.36 (m, 48H), 1.45-1.50 (m, 7H), 1.59-1.67 (m, 7H), 1.78- 1.80 (m, 4H), 2.27-2.31 (m, 2H), 2.49-2.60 (m, 10H), 3.18 (s, 4H), 3.54 (s, 2H), 4.03-4.06 (m, 4H). LCMS: Rt: 1.560 min; MS m/z (ESI): 808.7 [M+H] ⁺ .

6.59 Example 59: Preparation of Compound 180.

Step 1: Preparation of Compound 180-1

Compound 71-7 (1.2g, 2.5 mmol, 1.0 equiv), Compound 170-1 (500 mg, 3.7 mmol, 1.5 equiv), K ₂ CO ₃ (1.0 g, 7.5 mmol, 3.0 equiv) in ACN (30 mL) , Cs ₂ CO ₃ (260 mg, 0.8 mmol, 0.3 equiv) and NaI (120 mg, 0.8 mmol, 0.3 equiv) were stirred at 90 °C overnight. LCMS showed the reaction to be complete. The mixture was concentrated and purified by FCC to give compound 180-1 (820 mg, 70% yield) as a yellow oil.

Step 2: Preparation of Compound 180

To a solution of compound 180-1 (200 mg, 0.42 mmol, 1.0 equiv), compound SM16 (221 mg, 0.50 mmol, 1.2 equiv) in DCE (5 mL) was stirred at RT overnight. NaBH(AcO) ₃ (176 mg, 0.83 mmol, 2.0 equiv) was added. After stirring for 4 hours, LCMS showed the reaction to be complete. The mixture was concentrated and purified by pre-HPLC to give compound 180 (28 mg, 7.9% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.42 (m, 48H), 1.59-1.65 (m, 8H), 1.83-1.87 (m, 2H), 1.96- 2.07 (m, 3H), 2.28-2.32 (m, 10H), 2.44-2.53 (m, 3H), 2.60-2.64 (m, 2H), 2.93-3.03 (m, 2H), 3.47-3.49 (m, 2H) ), 4.03–4.07 (m, 8H). LCMS: Rt: 0.960 min; MS m/z (ESI): 909.0 [M+H] ⁺ .

6.60 Example 60: Preparation of Compound 181.

Step 1: Preparation of compound 181-1

To a solution of compound 71-7 (800 mg, 1.67 mmol, 1.0 equiv), cyclopentylamine (426 mg, 5.01 mmol, 3.0 equiv), DIEA (431 mg, 3.34 mmol, 2.0 equiv) in ACN (10 mL) was 70 It was stirred overnight at °C. LCMS showed the reaction to be complete. The mixture was concentrated and purified by FCC to give compound 181-1 (410 mg, 52.5% yield) as a yellow oil.

Step 2: Preparation of Compound 181-2

Compound 181-1 (410 mg, 0.88 mmol, 1.0 equiv), compound SM27 (400 mg, 2.63 mmol, 3.0 equiv), K ₂ CO ₃ (363 mg, 2.63 mmol, 3.0 equiv), Cs in ACN (10 mL) A solution of ₂ CO ₃ (85 mg, 0.26 mmol, 0.3 equiv) and NaI (39 mg, 0.26 mmol, 0.3 equiv) was stirred at 90 °C overnight. LCMS showed the reaction to be complete. The mixture was concentrated and purified by FCC to give compound 181-2 (320 mg, 62.3% yield) as a yellow oil.

Step 3: Preparation of Compound 181-3

A mixture of compound 181-2 (320 mg, 0.55 mmol, 1.0 equiv) and TFA (310 mg, 2.74 mmol, 5.0 equiv) in DCM (5 mL) was stirred at RT overnight. LCMS showed the reaction to be complete. The mixture was diluted with DCM, washed with water and brine, dried and concentrated to give crude compound 181-3 (230 mg, 77.6% yield) as a yellow oil, which was used in the next step without further purification.

Step 4: Preparation of Compound 181

A solution of compound 181-3 (230 mg, 0.43 mmol, 1.0 equiv), compound SM16 (227 mg, 0.51 mmol, 1.2 equiv) in DCE (5 mL) was stirred at RT overnight. NaBH(AcO) ₃ (186 mg, 0.86 mmol, 2.0 equiv) was added. After stirring for 4 hours, LCMS showed the reaction to be complete. The mixture was concentrated and purified by prep-HPLC to give compound 181 (110 mg, 26.5% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.29-1.47 (m, 55H), 1.61-1.64 (m, 8H), 1.74-1.80 (m, 2H), 1.94- 2.03 (m, 2H), 2.28-2.32 (m, 8H), 2.43-2.47 (m, 8H), 2.55-2.61 (m, 2H), 2.90-2.31 (m, 1H), 3.49-3.55 (m, 2H) ), 4.00–4.10 (m, 8H). LCMS: Rt: 1.190 min; MS m/z (ESI): 965.7 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 181 using the corresponding starting materials.

6.61 Example 61: Preparation of Compound 182.

Step 1: Preparation of compound 182-1

K ₂ CO ₃ (1.2 g, 8.59 mmol, 3.0 equiv) to a solution of compound 43-1 (1.0 g, 2.86 mmol, 1.0 equiv) and compound D (495 mg, 4.29 mmol, 1.5 equiv) in ACN (30 mL). , Cs ₂ CO ₃ (28 mg, 0.09 mmol, 0.03 equiv) and NaI (215 mg, 1.43 mmol, 0.5 equiv) were added. The mixture was stirred at 70 °C for 16 hours. The mixture was concentrated and purified by column chromatography on silica gel (MeOH/DCM = 0/1-1/40) to give compound 182-1 (1.1 g, crude) as a yellow oil. LCMS: Rt: 0.800 min; MS m/z (ESI): 384.4 [M+H] ⁺ .

Step 2: Preparation of Compound 182-2

A mixture of compound 182-1 (300 mg, 0.78 mmol, 1.0 equiv) and SOCl ₂ (279 mg, 2.35 mmol, 3.0 equiv) in DCM (6 mL) was stirred overnight at 35 °C. Quenched with water, extracted over EA, washed with brine, dried, concentrated and purified by FCC (MeOH/DCM = 0% to 20%) to give compound 182-2 (190 mg, 60.42% yield) as a pale yellow oil. provided.

Step 3: Preparation of Compound 182

To a solution of compound 182-2 (190 mg, 0.47 mmol, 1.0 equiv) in THF (4 mL) was added compound SM16 (210 mg, 0.47 mmol, 1.0 equiv), DIEA (183 mg, 1.43 mmol, 3.0 equiv), NaI ( 35 mg, 0.24 mmol, 0.5 eq) was added at room temperature. The mixture was stirred overnight at 70 °C. The mixture was washed with water, brine, the organic layer was concentrated and purified by pre-HPLC to give compound 182 (57 mg, 15.55% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.89 (m, 9H), 1.25-1.35 (m, 32H), 1.43-1.45 (m, 4H), 1.56-1.65 (m, 17H), 1.85- 1.99 (m, 5H), 2.27-2.32 (m, 6H), 2.41-2.59 (m, 10H), 3.05-3.10 (m, 1H), 3.53-3.55 (m, 2H), 4.03-4.07 (m, 6H) ). LCMS: Rt: 1.230 min; MS m/z (ESI): 809.6 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 182 using the corresponding starting materials.

6.62 Example 62: Preparation of Compound 186.

Step 1: Preparation of Compound 186-1

To a solution of compound 76-1 (600 mg, 1.29 mmol, 1.0 equiv) in ACN (20 mL) was added compound SM13 (184 mg, 2.58 mmol, 2.0 equiv), K ₂ CO ₃ (537 mg, 3.87 mmol, 3.0 equiv). , Cs ₂ CO ₃ (126 mg, 0.38 mmol, 0.3 equiv) and NaI (56 mg, 0.38 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 10 hours. TLC showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give compound 186-1 (350 mg, 61.8% yield) as a colorless oil.

Step 2: Preparation of Compound 186-2

K ₂ CO ₃ (332 mg, 2.4 mmol, 3.0 equiv) to a solution of compound 186-1 (350 mg, 0.8 mmol, 1.0 equiv) and compound SM27 (360 mg, 2.4 mmol, 3.0 equiv) in ACN (25 mL). , Cs ₂ CO ₃ (78 mg, 0.24 mmol, 0.3 equiv) and NaI (34 mg, 0.24 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. TLC showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give compound 186-2 (380 mg, 85.7% yield) as a colorless oil.

Step 3: Preparation of Compound 186-3

To a solution of compound 186-2 (380 mg, 0.68 mmol, 1.0 equiv) in DCM (20 mL) was added TFA (1 mL). The mixture was stirred at 25 °C for 10 hours. LCMS showed the reaction to be complete. The reaction mixture was extracted with EA and Na ₂ CO ₃ solution. The organic layer was washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 186-3 (280 mg, 86.1 % yield) as a yellow oil.

Step 4: Preparation of Compound 186

To a solution of compound 186-3 (280 mg, 0.55 mmol, 1.0 equiv) and compound SM16 (243 mg, 0.55 mmol, 1.0 equiv) in DCE (10 mL) was added 2 drops of CH ₃ COOH and incubated at 25 °C for 2 h. , then NaBH(OAc) ₃ (233 mg, 1.1 mmol, 2.0 equiv) was added at 25 °C and stirred for 10 h. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by pre-HPLC to give compound 186 (10 mg, 2.1% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.89 (m, 12H), 1.26-1.61 (m, 54H), 1.63-1.71 (m, 18H), 2.22-2.31 (m, 8H), 2.76- 2.92 (m, 6H),2.91-3.17 (m, 2H), 3.44-3.80 (m, 6H), 3.81-4.07 (m, 4H), 5.70-5.83 (m, 1H). LCMS: Rt: 1.150 min; MS m/z (ESI): 934.7 [M+H] ⁺ .

6.63 Example 63: Preparation of Compound 187.

Step 1: Preparation of compound 187-1

K ₂ CO ₃ (925 mg, 6.70 mmol, 3.0 equiv) to a solution of compound 26-1 (1.0 g, 2.23 mmol, 1.0 equiv) and compound SM13 (477 mg, 6.70 mmol, 3.0 equiv) in ACN (30 mL). , Cs ₂ CO ₃ (22 mg, 0.07 mmol, 0.03 equiv) and NaI (168 mg, 1.12 mmol, 0.5 equiv) were added. The mixture was stirred at 80 °C for 16 hours. The mixture was concentrated and purified by column chromatography on silica gel (MeOH/DCM = 0/1-1/20) to give compound 187-1 (598 mg, 61.12% yield) as a dark brown oil. LCMS: Rt: 0.970 min; MS m/z (ESI): 438.5 [M+H] ⁺ .

Step 2: Preparation of Compound 187-2

To a solution of compound 187-1 (598 mg, 1.37 mmol, 1.0 equiv) and compound SM28 (247 mg, 1.50 mmol, 1.1 equiv) in ACN (12 mL) was added K ₂ CO ₃ (565 mg, 4.10 mmol, 3.0 equiv). , Cs ₂ CO ₃ (13 mg, 0.04 mmol, 0.03 equiv) and NaI (102 mg, 0.68 mmol, 0.5 equiv) were added. The mixture was stirred at 80 °C for 16 hours. The mixture was concentrated and purified by column chromatography on silica gel (MeOH/DCM = 0/1-1/60) to give compound 187-2 (485 mg, 62.74% yield) as a pale yellow oil. LCMS: Rt: 1.015 min; MS m/z (ESI): 566.6 [M+H] ⁺ .

Step 3: Preparation of Compound 187-3

TFA to a stirred solution of compound 187-2 (264 mg, 0.47 mmol, 1.0 equiv) in DCM (6 mL) (6 mL, 80.4 mmol, 172.5 eq) was added at room temperature. The mixture was stirred overnight at room temperature. It was quenched with saturated sodium bicarbonate, extracted over EA, washed with brine, dried and concentrated to give compound 187-3 (221 mg, 90.77% yield) as a dark brown oil. LCMS: Rt: 0.960 min; MS m/z (ESI): 522.5 [M+H] ⁺ .

Step 4: Preparation of Compound 187

A mixture of compound 187-3 (110 mg, 0.21 mmol, 1.0 equiv), compound SM16 (94 mg, 0.21 mmol, 1.0 equiv) and 2 drops of acetic acid in DCE (6 mL) was stirred at room temperature for 2 hours. NaBH(OAc) ₃ (89 mg, 0.42 mmol, 2.0 equiv) was added to the above mixture and stirred overnight at room temperature. The mixture was quenched with water and extracted over DCM, the organic layer was concentrated and purified by pre-HPLC to give compound 187 (32 mg, 15.99% yield) as a pale yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.25-1.35 (m, 57H), 1.40-1.47 (m, 6H), 1.61-1.63 (m, 11H), 1.95- 2.15 (m, 4H), 2.28-2.32 (m, 6H), 2.44-2.62 (m, 8H), 3.50-3.60 (m, 2H), 3.96-4.07 (m, 6H). LCMS: Rt: 1.190 min; MS m/z (ESI): 949.8 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 187 using the corresponding starting materials.

6.64 Example 64: Preparation of Compound 188.

Step 1: Preparation of Compound 188-2

K ₂ CO ₃ (1.2 g, 8.61 mmol, 3.0 equiv) to a solution of compound 188-1 (1.0 g, 2.87 mmol, 1.0 equiv) and compound D (660 mg, 5.74 mmol, 2.0 equiv) in ACN (30 mL). , Cs ₂ CO ₃ (28 mg, 0.09 mmol, 0.03 equiv) and NaI (216 mg, 1.44 mmol, 0.5 equiv) were added. The mixture was stirred at 80 °C for 16 hours. The mixture was concentrated and purified by column chromatography on silica gel (MeOH/DCM = 0/1-1/30) to give compound 188-2 (632 mg, 57.55% yield) as a yellow oil. LCMS: Rt: 0.770 min; MS m/z (ESI): 383.4 [M+H] ⁺ .

Step 2: Preparation of Compound 188-3

MsCl to a stirred solution of compound 188-2 (341 mg, 0.89 mmol, 1.0 equiv) and DIEA (172 mg, 1.34 mmol, 1.5 equiv) in DCM (6 mL). (112 mg, 0.98 mmol, 1.1 equiv) was added drop wise in an ice bath. The mixture was stirred at room temperature for 1 hour. Quenched with water, extracted over EA, washed with brine, dried, concentrated and purified by FCC (MeOH/DCM = 0% to 1.67%) to give compound 188-3 (141 mg, 34.99% yield) as a yellow oil. provided. LCMS: Rt: 0.790 min; MS m/z (ESI): 401.4 [M+H] ⁺ .

Step 3: Preparation of Compound 188

Compound 188-3 (120 mg, 0.30 mmol, 1.0 equiv), K ₂ CO ₃ (124 mg, 0.90 mmol, 3.0 equiv), Cs ₂ CO ₃ (3 mg, 0.01 mmol, 0.03 equiv) in ACN (5 mL) , A mixture of compound SM16 (159 mg, 0.36 mmol, 1.2 equiv) and NaI (22 mg, 0.15 mmol, 0.5 equiv) was stirred at 90 °C for 48 h. The mixture was washed with water, brine, the organic layer was concentrated and purified by preparative-HPLC to give compound 188 (32 mg, 13.23% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 9H), 1.26-1.35 (m, 41H), 1.47-1.49 (m, 6H), 1.59-1.65 (m, 8H), 1.95- 2.02 (m, 8H), 2.15-2.20 (m, 2H), 2.28-2.32 (m, 5H), 2.50-2.66 (m, 6H), 3.20-3.25 (m, 2H), 3.55-3.61 (m, 2H) ), 4.00–4.10 (m, 4H). LCMS: Rt: 1.050 min; MS m/z (ESI): 808.7 [M+H] ⁺ .

The following compounds were prepared in a similar manner to compound 188 using the corresponding starting materials.

6.65 Example 65: Preparation of Compound 190.

Step 1: Preparation of Compound 190-1

To a solution of compound SM24 (1 g, 2.3 mmol, 1.0 equiv) in ACN (25 mL) was added compound SM29 (0.37 g, 6.9 mmol, 3.0 equiv), K ₂ CO ₃ (0.98 g, 6.9 mmol, 3.0 equiv), Cs ₂ CO ₃ (0.23 g, 0.69 mmol, 0.3 equiv) and NaI (0.1 g, 0.69 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 10 hours. TLC showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give compound 190-1 (500 mg, 53% yield) as a colorless oil.

Step 2: Preparation of Compound 190-2

K ₂ CO ₃ (523 mg, 3.78 mmol, 3.0 equiv) to a solution of compound 190-1 (500 mg, 1.26 mmol, 1.0 equiv) and compound SM27 (578 mg, 3.78 mmol, 3.0 equiv) in ACN (15 mL). , Cs ₂ CO ₃ (123 mg, 0.38 mmol, 0.3 equiv) and NaI (54 mg, 0.38 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. TLC showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give compound 190-2 (523 mg, 80.9% yield) as a colorless oil.

Step 3: Preparation of Compound 190-3

To a solution of compound 190-2 (523 mg, 1.08 mmol, 1.0 equiv) in DCM (15 mL) was added TFA (1 mL). The mixture was stirred at 25 °C for 10 hours. LCMS showed the reaction to be complete. The reaction mixture was extracted with EA and Na ₂ CO ₃ solution. The organic layer was washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 190-3 (380 mg, 79.8% yield) as a colorless oil.

Step 4: Preparation of Compound 190

To a solution of compound 190-3 (350 mg, 0.75 mmol, 1.0 equiv) and compound SM16 (332 mg, 0.75 mmol, 1.0 equiv) in DCE (10 mL) was added 2 drops of CH ₃ COOH and incubated at 25 °C for 2 h. , then NaBH(OAc) ₃ (310 mg, 1.5 mmol, 2.0 equiv) was added at 25 °C and stirred for 10 h. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by preparative-HPLC to give compound 190 (70 mg, 10.4% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.51-0.86 (m, 12H), 1.28-1.39 (m, 48H), 1.60-1.68 (m, 24H), 2.28-2.31 (m, 8H), 2.32- 2.69 (m, 6H), 3.96–4.06 (m, 6H). LCMS: Rt: 1.150 min; MS m/z (ESI): 893.7 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 190 using the corresponding starting materials.

6.66 Example 66: Preparation of Compound 195.

Step 1: Preparation of Compound 195-1

Compound 149-2 (0.6 g, 1.43 mmol, 1.0 equiv), compound SM29 (250 mg, 4.3 mmol, 3.0 equiv), K ₂ CO ₃ (590 mg, 4.3 mmol, 3.0 equiv), Cs in ACN (10 mL) A solution of ₂ CO ₃ (140 mg, 0.43 mmol, 0.3 equiv) and NaI (65 mg, 0.43 mmol, 0.3 equiv) was stirred at 80 °C overnight. TLC showed the reaction to be complete. The mixture was concentrated and purified by FCC to give compound 195-1 (300 mg, 53.15% yield) as a yellow oil.

Step 2: Preparation of Compound 195-2

Compound 195-1 (300 mg, 0.76 mmol, 1.0 equiv), Compound SM27 (350 mg, 2.28 mmol, 3.0 equiv), K ₂ CO ₃ (320 mg, 2.28 mmol, 3.0 equiv), Cs in ACN (10 mL) A solution of ₂ CO ₃ (75 mg, 0.23 mmol, 0.3 equiv) and NaI (35 mg, 0.23 mmol, 0.3 equiv) was stirred at 80 °C for 40 h. TLC showed the reaction to be complete. The mixture was concentrated and purified by FCC to give compound 195-2 (300 mg, 77.28% yield) as a yellow oil.

Step 3: Preparation of Compound 195-3

A mixture of compound 195-2 (300 mg, 0.59 mmol, 1.0 equiv) and TFA (0.5 mL) in DCM (10 mL) was stirred at RT overnight. TLC showed the reaction to be complete. The mixture was diluted with DCM, washed with water and brin, dried and concentrated to give compound 195-3 (280 mg, crude) as a yellow oil, which was used in the next step without further purification.

Step 4: Preparation of Compound 195

To a solution of compound 195-3 (280 mg, 0.59 mmol, 1.0 equiv), compound SM16 (310 mg, 0.71 mmol, 1.2 equiv) in DCE (10 mL) was stirred at RT overnight. NaBH(AcO) ₃ (250 mg, 1.2 mmol, 2.0 equiv) was added. After stirring for 24 hours, LCMS showed the reaction to be complete. The mixture was concentrated and purified by pre-HPLC to give compound 195 (110 mg, 20.89% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.36-0.45 (m, 4H), 0.86-0.90 (m, 12H), 1.26-1.35 (m, 46H), 1.40-1.55 (m, 8H), 0.60- 1.77 (m, 9H), 1.97-2.00 (m, 1H), 2.15-2.19 (m, 2H), 2.29-2.32 (m, 4H), 2.43-2.59 (m, 10H), 3.16-3.19 (m, 2H) ), 3.51–3.54 (m, 2H), 4.00–4.10 (m, 4H), 5.50 (s, 1H). LCMS: Rt: 0.080 min; MS m/z (ESI): 892.6 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 195 using the corresponding starting materials.

6.67 Example 67: Preparation of Compound 200.

Step 1: Preparation of Compound 200-1

To a solution of compound 182-1 (650 mg, 1.7 mmol, 1.0 equiv) and DIPEA (880 mg, 6.8 mmol, 4.0 equiv) in DCM (10 mL) at 0 °C was Msc1 (390 mg, 3.4 mmol, 3.0 equiv). has been added The mixture was still stirred for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 200-1 (600 mg, 76.44% yield) as a yellow oil.

Step 2: Preparation of Compound 200

Compound 200-1 (600 mg, 1.3 mmol, 1.0 equiv), compound SM30 (630 mg, 1.56 mmol, 1.2 equiv), K ₂ CO ₃ (540 mg, 3.9 mmol, 3.0 equiv), Cs in ACN (10 mL) A solution of ₂ CO ₃ (130 mg, 0.39 mmol, 0.3 equiv) and NaI (60 mg, 0.39 mmol, 0.3 equiv) was stirred at 80 °C overnight. TLC showed the reaction to be complete. The mixture was concentrated and purified by pre-HPLC to give compound 200 (50 mg, 5.01% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.89 (m, 9H), 1.26 (s, 35H), 1.41-1.46 (m, 6H), 1.54-1.66 (m, 14H), 1.85-1.99 ( m, 6H), 2.27-2.31 (m, 2H), 2.39-2.59 (m, 12H), 3.04-3.08 (m, 1H), 3.36-3.42 (m, 2H), 3.52-3.58 (m, 4H), 4.03-4.07 (m, 2H), 4.43-4.46 (m, 1H). LCMS: Rt: 1.730 min; MS m/z (ESI): 767.6 [M+H] ⁺ .

6.68 Example 68: Preparation of Compound 201.

Step 1: Preparation of Compound 201-1

To a solution of compound SM24 (1.0 g, 2.38 mmol, 1.0 equiv) and compound D (550 mg, 4.77 mmol, 2.0 equiv) in ACN (50 mL) K ₂ CO ₃ (1.0 g, 7.15 mmol, 3.0 equiv), Cs ₂ CO ₃ (230 mg, 0.71 mmol, 0.3 equiv) and NaI (110 mg, 0.71 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give compound 201-1 (600 mg, 55% yield) as a yellow oil. LCMS: Rt: 0.940 min; MS m/z (ESI): 454.4 [M+H] ⁺ .

Step 2: Preparation of Compound 201-2

To a solution of compound 201-1 (300 mg, 0.66 mmol, 1.0 equiv) and DIPEA (260 mg, 1.99 mmol, 3.0 equiv) in DCM (20 mL) was added MsCl (115 mg, 0.99 mmol, 1.5 equiv). The mixture was stirred at room temperature for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 201-2 (280 mg, 80% yield) as a yellow oil.

Step 3: Preparation of Compound 201

K ₂ CO ₃ (195 mg, 1.41 mmol, 3.0 equiv) to a solution of compound 201-2 (250 mg, 0.47 mmol, 1.0 equiv) and compound SM30 (190 mg, 0.47 mmol, 1.0 equiv) in ACN (10 mL). , Cs ₂ CO ₃ (46 mg, 0.14 mmol, 0.3 equiv) and NaI (21 mg, 0.14 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The mixture was concentrated and purified by prep-HPLC to give compound 201 (35 mg, 9% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.80-0.83 (m, 12H), 1.20-1.56 (m, 66H), 1.82-1.95 (m, 4H), 2.23-2.53 (m, 12H), 2.92- 3.09 (m, 1H), 3.31–3.40 (m, 2H), 3.47–3.51 (m, 4H), 3.89–3.90 (m, 2H), 4.35–4.39 (m, 1H). LCMS: Rt: 2.170 min; MS m/z (ESI): 837.7 [M+H] ⁺ .

6.69 Example 69: Preparation of Compound 202.

Step 1: Preparation of Compound 202-1

K ₂ CO ₃ (0.6 g, 4.30 mmol, 3.0 equiv) to a solution of compound 149-2 (0.6 g, 1.43 mmol, 1.0 equiv) and compound K (450 mg, 2.87 mmol, 2.0 equiv) in ACN (30 mL). , Cs ₂ CO ₃ (140 mg, 0.43 mmol, 0.3 equiv) and NaI (65 mg, 0.43 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give compound 202-1 (350 mg, 48% yield) as a yellow oil. LCMS: Rt: 0.840 min; MS m/z (ESI): 495.5 [M+H] ⁺ .

Step 2: Preparation of Compound 202-2

To a solution of compound 202-1 (350 mg, 0.71 mmol, 1.0 equiv) and DIPEA (280 mg, 2.12 mmol, 3.0 equiv) in DCM (20 mL) was added MsCl (120 mg, 1.06 mmol, 1.5 equiv). The mixture was stirred at room temperature for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 202-2 (280 mg, 69% yield) as a yellow oil.

Step 3: Preparation of Compound 202

K ₂ CO ₃ (181 mg, 1.31 mmol, 3.0 equiv) to a solution of compound 202-2 (250 mg, 0.44 mmol, 1.0 equiv) and compound SM30 (176 mg, 0.44 mmol, 1.0 equiv) in ACN (10 mL). , Cs ₂ CO ₃ (43 mg, 0.13 mmol, 0.3 equiv) and NaI (20 mg, 0.13 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The mixture was concentrated and purified by preparative HPLC to give the title compound (25 mg, 6% yield) as a yellow oil.

^1H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.67 (m, 78H), 2.16-2.20 (m, 2H), 2.47-2.59 (m, 10H), 3.16- 3.19 (m, 2H), 3.39–3.41 (m, 2H), 3.53–3.57 (m, 4H), 4.44–4.46 (m, 1H). LCMS: Rt: 1.770 min; MS m/z (ESI): 878.8 [M+H] ⁺ .

6.70 Example 70: Preparation of Compound 216.

Step 1: Preparation of Compound 216-2

EDCI (3.6 g, 18.9 mmol, 1.5 equiv), DMAP ( 0.46 g, 3.78 mmol, 0.3 equiv), DIEA (4.9 g, 37.8 mmol, 3.0 equiv) were added. The mixture was stirred at RT for 16 h. TLC showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel to give compound 216-2 (2.5 g, 40.43% yield) as a yellow oil.

Step 2: Preparation of Compound 216-3

To a solution of compound 216-2 (2.5 g, 5.09 mmol, 1.0 equiv) and C ₁₀ H ₂₁ COOH (1.1 g, 6.11 mmol, 1.2 equiv) in DCM (40 mL) was added EDCI (1.5 g, 7.64 mmol, 1.5 equiv). , DMAP (0.2 g, 1.53 mmol, 0.3 equiv), DIEA (2 g, 15.3 mmol, 3.0 equiv) were added. The mixture was stirred at 55 °C for 16 hours. TLC showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel to give compound 216-3 (2.5 g, 74.48% yield) as a colorless oil.

Step 3: Preparation of Compound 216-4

To a solution of compound 216-3 (2.5 g, 3.79 mmol, 1.0 equiv) in EA (50 mL) was added Pd/C (300 mg). The mixture was stirred at 50 °C under H ₂ for 16 h. The mixture was filtered through a pad of Celite and rinsed with EA. Filtration was concentrated and purified by column chromatography on silica gel (PE/EA = 3/1) to give compound 216-4 (2 g, 92.81% yield) as a yellow oil.

Step 4: Preparation of Compound 216-5

To a solution of compound 216-4 (300 mg, 0.53 mmol, 1.0 equiv) and DIPEA (210 mg, 1.59 mmol, 3.0 equiv) in DCM (10 mL) at 0 °C was added MscI (91 mg, 0.79 mmol, 1.5 equiv). has been added The mixture was still stirred for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 216-5 (350 mg, crude) as a yellow oil.

Step 5: Preparation of Compound 216

K ₂ CO ₃ (220 mg, 1.6 mmol, 3.0 equiv) to a solution of compound 216-5 (350 mg, 0.53 mmol, 1.0 equiv) and compound K (250 mg, 1.6 mmol, 3.0 equiv) in ACN (10 mL). , Cs ₂ CO ₃ (50 mg, 0.16 mmol, 0.3 equiv) and NaI (20 mg, 0.16 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by preparative HPLC to give compound 216 (40 mg, 10.66%) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 9H), 1.26-1.44 (m, 48H), 1.53-1.83 (m, 12H), 1.95-1.99 (m, 1H), 2.23- 2.32 (m, 4H), 2.39–2.43 (m, 2H), 2.56–2.63 (m, 3H), 3.46–3.48 (m, 2H), 4.00–4.10 (m, 4H). LCMS: Rt: 0.093 min; MS m/z (ESI): 708.5 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 216 using the corresponding starting materials.

6.71 Example 71: Preparation of Compound 218.

Step 1: Preparation of Compound 76-1

To a solution of compound SM31 (2 g, 7.42 mmol, 1.0 equiv) and compound W (1.7 g, 8.91 mmol, 1.2 equiv) in DCM (40 mL) was added DIEA (1.9 g, 14.8 mmol, 2.0 equiv) and HATU (3.4 g). , 8.91 mmol, 1.2 equiv) was added. The mixture was stirred at RT for 2 h. TLC showed the reaction to be complete. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ , concentrated and purified by column chromatography on silica gel to give compound 76-1 (3.0 g, 90.52% yield) as a yellow oil.

Step 2: Preparation of Compound 218-1

K ₂ CO ₃ (740 mg, 5.37 mmol, 3.0 equiv) to a solution of compound 76-1 (800 mg, 1.79 mmol, 1.0 equiv) and compound SM32 (270 mg, 1.97 mmol, 1.1 equiv) in ACN (20 mL). , Cs ₂ CO ₃ (180 mg, 0.54 mmol, 0.3 equiv) and NaI (27 mg, 0.18 mmol, 0.1 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and FCC gave compound 218-1 (450 mg, 54.06%) as a yellow oil.

Step 3: Preparation of Compound 218

To a solution of compound 218-1 (220 mg, 0.47 mmol, 1.0 equiv) and compound SM16 (210 mg, 0.47 mmol, 1.0 equiv) in DCE (10 mL) was added AcOH (1 drop). The mixture was stirred at RT for 16 h. Then NaBH(OAc) ₃ (300 mg, 1.42 mmol, 3.0 equiv) was added. The mixture was stirred at rt for 24 h. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by prep-HPLC to give compound 218 (50 mg, 11.84% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.34 (m, 50H), 1.41-1.52 (m, 5H), 1.59-1.67 (m, 10H), 1.85- 2.00 (m, 4H), 2.15-2.18 (m, 2H), 2.28-2.32 (m, 6H), 2.45-2.49 (m, 3H), 2.61-2.64 (m, 2H), 2.98 (d, J = 11.2 Hz, 2H), 3.16–3.19 (m, 2H), 3.46–3.49 (m, 2H), 4.00–4.09 (m, 4H), 5.33–5.36 (m, 1H). LCMS: Rt: 0.093 min; MS m/z (ESI): 892.7 [M+H] ⁺ .

6.72 Example 72: Preparation of Compound 223.

Step 1: Preparation of Compound 223-2

To a solution of compound 223-1 (7.0 g, 23.0 mmol, 1.0 equiv) in MeOH/H ₂ O (50 mL/50 mL) was added NaOH (7.6 g, 184.0 mmol, 8.0 equiv). The mixture was stirred at 25 °C for 10 hours. TLC showed the reaction to be complete. The reaction mixture was concentrated to remove the organic layer. The aqueous layer was adjusted to pH 5 with 2N HCl and then extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 223-2 (4.6 g, 72% yield) as a colorless oil.

Step 2: Preparation of Compound 223-3

To a solution of compound 223-2 (4.6 g, 17.0 mmol, 1.0 equiv) and compound SM33 (5.4 g, 42.0 mmol, 2.5 equiv) in toluene (60 mL) was added TsOH (0.32 g, 1.7 mmol, 0.1 equiv). . The mixture was stirred for 3 hours through a Dean-Stark trap under reflux. TLC showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel to give compound 223-3 (6.3 g, 74% yield) as a colorless oil.

Step 3: Preparation of Compound 223-4

To a solution of compound 223-3 (2.4 g, 4.8 mmol, 1.0 equiv) in EA (25 mL) was added Pd/C (0.2 g) and 2 drops of concentrated HCl. The mixture was stirred at 25 °C under H ₂ for 5 h. TLC showed the reaction to be complete. The reaction mixture was filtered through a pad of celite and rinsed with EA. The filtrate was concentrated to provide compound 223-4 (2 g, 92% yield) as a colorless oil.

Step 4: Preparation of Compound 223-5

To a solution of compound 223-4 (2.0 g, 5.0 mmol, 1.0 equiv) and TEA (1.0 g, 10.0 mmol, 2.0 equiv) in DCM (50 mL) was added MsCl (687 mg, 6.0 mmol, 1.2 equiv). The mixture was stirred at rt for 2 h. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 223-5 (12.4 g, 100% yield) as a yellow oil.

Step 5: Preparation of Compound 223-6

K ₂ CO ₃ (261 mg, 1.89 mmol, 3.0 equiv) to a solution of compound 223-5 (300 mg, 0.63 mmol, 1.0 equiv) and compound D (145 mg, 126 mmol, 2.0 equiv) in ACN (12 mL). , Cs ₂ CO ₃ (62 mg, 0.19 mmol, 0.3 equiv) and NaI (28 mg, 0.19 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 25/1) to give compound 223-6 (126 mg) as a yellow oil which was further purified by pre-HPLC to give compound 223- 6 (65 mg, 21% yield) was provided as a yellow oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 6H), 1.27-1.32 (m, 22H), 1.45-1.74 (m, 9H), 1.87-2.10 (m, 6H), 2.44- 2.65 (m, 4H), 3.14-3.19 (m, 1H), 3.24-3.31 (m, 1H), 3.54-3.61 (m, 2H), 4.08-4.17 (m, 4H). LCMS: Rt: 0.860 min; MS m/z (ESI): 498.5 [M+H] ⁺ .

Step 6: Preparation of Compound 223-7

To a solution of compound 223-6 (1.0 g, 2.0 mmol, 1.0 equiv) and DIPEA (517 mg, 4.0 mmol, 2.0 equiv) in DCM (20 mL) was added MsCl (275 mg, 2.4 mmol, 1.2 equiv). The mixture was stirred at 0 °C for 2 h. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 223-7 (1.1 g, 95% yield) as a yellow oil.

Step 7: Preparation of Compound 223

K ₂ CO ₃ (721 mg, 5.22 mmol, 3.0 equiv) to a solution of compound 223-7 (1.0 g, 1.74 mmol, 1.0 equiv) and compound SM39 (694 mg, 1.74 mmol, 1.0 equiv) in ACN (30 mL). , Cs ₂ CO ₃ (169 mg, 0.52 mmol, 0.3 equiv) and NaI (78 mg, 0.52 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 25/1) to give compound 223 (520 mg, 35% yield) as a yellow oil. 100 mg product was further purified by prep-HPLC to give compound 223 (45 mg, 45% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.30 (m, 49H), 1.44-1.68 (m, 12H), 1.87-2.14 (m, 5H), 2.29- 3.00 (m, 15H), 3.30–3.33 (m, 1H), 3.53–3.69 (m, 2H), 3.96–3.97 (m, 2H), 4.11–4.17 (m, 4H). LCMS: Rt: 1.620 min; MS m/z (ESI): 879.7 [M+H] ⁺ .

6.73 Example 73: Preparation of Compound 238.

Step 1: Preparation of Compound 238-1

To a solution of compound 108-1 (3.53 g, 12.59 mmol, 1.0 equiv) and compound 216-1 (1.0 g, 4.20 mmol, 0.3 equiv) in DCM (50 mL) was added DIEA (2.71 g, 20.98 mmol, 1.7 equiv), EDCI (2.41 g, 12.59 mmol, 1.0 equiv) and DMAP (0.52 g, 4.20 mmol, 0.3 equiv) were added. The mixture was stirred at 45 °C for 10 hours. The reaction mixture was concentrated and purified by column chromatography on silica gel (PE/EA = 10:1) to give compound 238-1 (2.0 g, 62% yield) as a colorless oil.

Step 2: Preparation of Compound 238-2

To a solution of compound 238-1 (1.0 g, 1.31 mmol, 1.0 equiv) in DCM (20 mL) was added BCl ₃ (15.6 mL, 15.6 mmol, 12.0 equiv) at -78 °C. The mixture was stirred at -78 °C for 1 hour. The mixture was poured into aqueous NaHCO ₃ and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ , concentrated and purified by column chromatography on silica gel (PE/EA = 4:1) to give compound 238-2 (0.5 g, 57% yield) ) as a colorless oil.

Step 3: Preparation of Compound 238-3

To a solution of compound 238-2 (800 mg, 1.19 mmol, 1.0 equiv) and DIPEA (310 mg, 2.38 mmol, 2.0 equiv) in DCM (20 mL) was added MsCl (165 mg, 1.43 mmol, 1.2 equiv). The mixture was stirred at room temperature for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 238-3 (600 mg, 67% yield) as a yellow oil, which was used in the next step without further purification.

Step 4: Preparation of Compound 238-4

K ₂ CO ₃ (332 mg, 2.4 mmol, 3.0 equiv) to a solution of compound 238-3 (600 mg, 0.8 mmol, 1.0 equiv) and compound B (230 mg, 1.6 mmol, 2.0 equiv) in ACN (30 mL). , Cs ₂ CO ₃ (79 mg, 0.24 mmol, 0.3 equiv) and NaI (36 mg, 0.24 mmol, 0.2 equiv) were added. The mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 20/1) to give compound 238-4 (500 mg, 78% yield) as a yellow oil. LCMS: Rt: 1.380 min; MS m/z (ESI): 798.6 [M+H] ⁺ .

Step 5: Preparation of Compound 238-5

To a solution of compound 238-4 (250 mg, 0.31 mmol, 1.0 equiv) and DIPEA (122 mg, 0.94 mmol, 3.0 equiv) in DCM (20 mL) was added MsCl (44 mg, 0.38 mmol, 1.0 equiv). The mixture was stirred at room temperature for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 238-5 (220 mg, 80% yield) as a yellow oil, which was used in the next step without further purification.

Step 6: Preparation of Compound 238

K ₂ CO ₃ (95 mg, 0.69 mmol, 3.0 equiv) to a solution of compound 238-5 (200 mg, 0.23 mmol, 1.0 equiv) and compound SM34 (91 mg, 0.23 mmol, 1.0 equiv) in ACN (10 mL). , Cs ₂ CO ₃ (23 mg, 0.07 mmol, 0.3 equiv) and NaI (11 mg, 0.07 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 10 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by prep-HPLC to give compound 238 (11 mg, 4% yield) as a yellow oil.

^1H NMR (400 MHz, CDCl ₃ ) δ: 0.79-0.84 (m, 12H), 1.19-1.74 (m, 81H), 1.95-2.72 (m, 30H), 3.09-3.13 (m, 2H), 3.13- 3.50 (m, 2H), 3.92–4.09 (m, 4H), 5.27–5.30 (m, 8H). LCMS: Rt: 0.627 min; MS m/z (ESI): 1179.0 [M+H] ⁺ .

6.74 Example 74: Preparation of Compound 239.

Step 1: Preparation of Compound 239-1

K ₂ CO ₃ (527 mg, 3.81 mmol, 3.0 equiv) to a solution of compound 216-5 (820 mg, 1.27 mmol, 1.0 equiv) and compound B (273 mg, 1.91 mmol, 1.5 equiv) in ACN (25 mL). , Cs ₂ CO ₃ (124 mg, 0.38 mmol, 0.3 equiv) and NaI (57 mg, 0.38 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 50/1) to give compound 239-1 (290 mg, 33% yield) as a yellow oil. LCMS: Rt: 1.420 min; MS m/z (ESI): 694.6 [M+H] ⁺ .

Step 2: Preparation of Compound 239-2

To a solution of compound 239-1 (290 mg, 0.42 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl ₂ (150 mg, 1.26 mmol, 3.0 equiv). The mixture was stirred at 30 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was concentrated to give compound 239-2 (298 mg, 100% yield) as a yellow oil, which was used in the next step without further purification. LCMS: Rt: 1.700 min; MS m/z (ESI): 712.6 [M+H] ⁺ .

Step 3: Preparation of Compound 239

DIPEA (147 mg, 1.14 mmol, 3.0 equiv) and NaI ( 17 mg, 0.114 mmol, 0.3 eq) was added. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was concentrated and purified by prep-HPLC to give compound 239 (80 mg, 20% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 15H), 1.26-1.36 (m, 76H), 1.37-1.70 (m, 10H), 1.74-1.94 (m, 4H), 1.97- 2.00 (m, 1H), 2.11-2.32 (m, 7H), 2.37-2.71 (m, 8H), 2.93-3.07 (m, 2H), 3.16-3.19 (m, 2H), 3.50-3.64 (m, 2H) ), 3.99–4.10 (m, 4H). LCMS: Rt: 0.507 min; MS m/z (ESI): 1074.9 [M+H] ⁺ .

6.75 Example 75: Preparation of Compound 241.

Step 1: Preparation of compound 241-1

To a solution of compound SM24 (2.0 g, 4.8 mmol, 1.0 equiv) and compound SM35 (709 mg, 12.0 mmol, 2.5 equiv) in ACN (50 mL) was added K ₂ CO ₃ (2.0 g, 14.4 mmol, 3.0 equiv), Cs ₂ CO ₃ (469 mg, 1.44 mmol, 0.3 equiv) and NaI (216 mg, 1.44 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 25/1) to give compound 241-1 (830 mg, 44% yield) as a yellow oil. LCMS: Rt: 0.850 min; MS m/z (ESI): 398.5 [M+H] ⁺ .

Step 2: Preparation of compound 241-2

To a solution of compound 241-1 (400 mg, 1.0 mmol, 1.0 equiv) and compound SM36 (157 mg, 1.0 mmol, 1.0 equiv) in DCE (10 mL) was added AcOH (1 drop). The mixture was stirred at rt for 4 h. Then NaBH ₃ CN (94 mg, 1.5 mmol, 1.5 eq) was added. The mixture was stirred at rt for 16 h. LCMS showed the reaction to be complete. The mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 30/1) to give compound 241-2 (282 mg, 52% yield) as a yellow oil. LCMS: Rt: 0.467 min; MS m/z (ESI): 538.5 [M+H] ⁺ .

Step 3: Preparation of Compound 241-3

To a solution of compound 241-2 (250 mg, 0.46 mmol, 1.0 equiv) in DCM (9 mL) was added TFA (3.0 mL). The mixture was stirred at rt for 24 h. LCMS showed the reaction to be complete. The mixture was adjusted to pH=8 with saturated NaHCO ₃ solution and then extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 241-3 (223 mg, 97% yield) as a brown oil. LCMS: Rt: 0.920 min; MS m/z (ESI): 494.5 [M+H] ⁺ .

Step 4: Preparation of Compound 241-4

To a solution of compound 241-3 (230 mg, 0.47 mmol, 1.0 equiv) and compound SM6 (57 mg, 0.94 mmol, 2.0 equiv) in DCE (10 mL) was added AcOH (1 drop). The mixture was stirred at rt for 4 h. Then NaBH ₃ CN (44 mg, 0.71 mmol, 1.5 equiv) was added. The mixture was stirred at rt for 16 h. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 10/1) to give compound 241-4 (144 mg, 57% yield) as a yellow oil. LCMS: Rt: 0.160 min; MS m/z (ESI): 539.5 [M+H] ⁺ .

Step 5: Preparation of Compound 241

K ₂ CO ₃ (112 mg, 0.81 mmol, 3.0 equiv) to a solution of compound 241-4 (144 mg, 0.27 mmol, 1.0 equiv) and compound SM24 (227 mg, 0.54 mmol, 2.0 equiv) in ACN (10 mL). , Cs ₂ CO ₃ (26 mg, 0.081 mmol, 0.3 equiv) and NaI (12 mg, 0.081 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was concentrated and purified by pre-HPLC to give compound 241 (51 mg, 22% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 15H), 1.27 (s, 56H), 1.38-1.41 (m, 6H), 1.51-1.63 (m, 7H), 1.74-1.91 ( m, 4H), 2.29–2.71 (m, 14H), 3.43–3.52 (m, 2H), 3.96–3.97 (m, 4H). LCMS: Rt: 0.400 min; MS m/z (ESI): 877.8 [M+H] ⁺ .

6.76 Example 76: Preparation of Compound 244.

Step 1: Preparation of Compound 244-2

A mixture of 244-1 (4.0 g, 27.7 mmol, 1.0 equiv), SOCl ₂ (9.9 g, 83.2 mmol, 3.0 equiv), pyridine (6.6 g, 83.2 mmol, 3.0 equiv) in DCM (50 mL) was refluxed at 4 stirred for an hour. TLC showed the reaction to be complete. The mixture was diluted with DCM, washed with water and brine, dried and concentrated. The residue was purified by FCC to give compound 244-2 (4.5 g, 89.7% yield) as a colorless oil.

Step 2: Preparation of Compound 244-3

244-2 (612 mg, 3.38 mmol, 1.0 equiv), SM16 (500 mg, 1.13 mmol, 3.0 equiv), K ₂ CO ₃ (466 mg, 3.38 mmol, 3.0 equiv), Cs ₂ CO in ACN (10 mL) A mixture of ₃ (111 mg, 0.34 mmol, 3.0 equiv) and NaI (51 mg, 0.34 mmol, 3.0 equiv) was stirred at reflux overnight. LCMS showed product. The mixture was diluted with EA, washed with water and brine, dried and concentrated. The residue was purified by FCC to give compound 244-3 (260 mg, 39.1% yield) as a colorless oil.

Step 3: Preparation of Compound 244-4

244-3 (260 mg, 0.44 mmol, 1.0 equiv), SM38 (234 mg, 0.53 mmol, 1.2 equiv), K ₂ CO ₃ (184 mg, 1.33 mmol, 3.0 equiv), Cs ₂ CO in ACN (5 mL) A mixture of ₃ (42 mg, 0.13 mmol, 3.0 equiv), NaI (20 mg, 0.13 mmol, 3.0 equiv) was stirred at reflux overnight. LCMS showed product. The mixture was diluted with EA, washed with water and brine, dried and concentrated. The residue was purified by pre-HPLC to give compound 244 (38 mg, 8.7% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-1.08 (m, 18H), 1.28-1.36 (m, 52H), 1.61-1.63 (m, 8H), 1.80-2.04 (m, 7H), 2.26- 2.32 (m, 11H), 2.44-2.76 (m, 4H) 2.84-3.01 (m, 2H), 3.48-3.70 (m, 2H), 3.99-4.11 (m, 8H). LCMS: Rt: 1.380 min; MS m/z (ESI): 993.8 [M+H] ⁺ .

6.77 Example 77: Preparation of Compound 246.

Step 1: Preparation of Compound 246-2

DIEA (4.7 g, 36.6 mmol, 5.0 equiv) to a solution of 246-1 (1.7 g, 7.3 mmol, 1.0 equiv) and undec-10-enoic acid (4.0 g, 22.0 mmol, 3.0 equiv) in DCM (40 mL). , EDCI (4.2 g, 22.0 mmol, 3.0 equiv) and DMAP (268 mg, 2.2 mmol, 0.3 equiv) were added. The mixture was stirred at 40 °C for 16 hours. The reaction mixture was concentrated and purified by column chromatography on silica gel (PE/EA = 10:1) to give compound 246-2 (1.7 g, 41.1% yield) as a colorless oil.

Step 2: Preparation of Compound 246-3

To a solution of 246-2 (1.7 g, 3.01 mmol, 1.0 equiv) in DCM (34 mL) at 0 °C was added 4 M HCl in dioxane (5 mL, 20 mmol, 6.6 equiv). The mixture was stirred at 0 °C for 40 min. The mixture was poured into NaHCO ₃ (aq) and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ , concentrated and purified by column chromatography on silica gel (EA/DCM = 1/10) to give compound 246-3 (869 mg, 60.1% yield) ) as a colorless oil.

Step 3: Preparation of Compound 246-4

To a solution of 246-3 (869 mg, 1.8 mmol, 1.0 equiv) and Et ₃ N (350 mg, 2.7 mmol, 1.5 equiv) in DCM (16 mL) was added MsCl (228 mg, 2.0 mmol, 0.1 equiv). . The mixture was stirred at room temperature for 1 hour. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 246-4 (1.1 g, crude) as a colorless oil. It was used in the next step without further purification.

Step 4: Preparation of Compound 246-5

To a solution of 246-4 (1.1 g, 2.0 mmol, 1.0 equiv) and compound G (756 mg, 5.9 mmol, 3.0 equiv) in ACN (30 mL) was K ₂ CO ₃ (815 mg, 5.9 mmol, 3.0 equiv); Cs ₂ CO ₃ (19 mg, 0.06 mmol, 0.03 equiv) and NaI (148 mg, 1.0 mmol, 0.5 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by column chromatography on silica gel (DCM/MeOH = 30/1) to give compound 246-5 (899 mg, 77.2% yield) as a colorless oil. LCMS: Rt: 1.630 min; MS m/z (ESI): 592.5 [M+H] ⁺ .

Step 5: Preparation of Compound 246-6

To a solution of 246-5 (300 mg, 0.5 mmol, 1.0 equiv) and Et ₃ N (98 mg, 0.8 mmol, 1.6 equiv) in DCM (6 mL) was added MsCl (69 mg, 0.6 mmol, 1.2 equiv). . The mixture was stirred at room temperature for 1 hour. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 246-6 (362 mg, crude) as an orange oil. It was used in the next step without further purification.

Step 6: Preparation of Compound 246

To a solution of 246-6 (342 mg, 0.5 mmol, 1.0 equiv) and SM34 (210 mg, 0.5 mmol, 1.0 equiv) in ACN (10 mL) was added K ₂ CO ₃ (211 mg, 1.5 mmol, 3.0 equiv), Cs ₂ CO ₃ (5 mg, 0.02 mmol, 0.04 equiv) and NaI (38 mg, 0.26 mmol, 0.52 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was concentrated and purified by pre-HPLC to provide compound 246 (11 mg, 7.22% yield) as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.89 (m, 6H), 1.26-1.39 (m, 51H), 1.49-1.68 (m, 14H), 1.95-2.06 (m, 8H), 2.18- 2.32 (m, 9H), 2.52-2.69 (m, 7H), 2.95-3.19 (m, 6H), 3.49-3.67 (m, 2H), 4.00-4.10 (m, 4H), 4.91-5.02 (m, 4H) ), 5.76–5.86 (m, 2H). LCMS: Rt: 1.510 min; MS m/z (ESI): 972.8 [M+H] ⁺ .

The following compounds were prepared in an analogous manner to compound 246 using the corresponding starting materials.

6.78 Example 78: Preparation of Compound 247.

Step 1: Preparation of Compound 247-2

To a solution of 247-1 (3.5 g, 12.6 mmol, 3.0 equiv) and compound 216-1 (1.0 g, 4.2 mmol, 1.0 equiv) in DCM (50 mL) was added DIEA (2.7 g, 21.0 mmol, 5.0 equiv), EDCI (2.4 g, 12.6 mmol, 3.0 equiv) and DMAP (1.3 g, 8.4 mmol, 2.0 equiv) were added. The mixture was stirred at 50 °C for 16 hours. The reaction mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (PE/EA = 10:1) to give compound 247-2 (2.8 g, 87.5 % yield) as a colorless oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.87-1.03 (m, 6H), 1.25-1.43 (m, 20H), 1.58-1.65 (m, 6H), 2.02-2.11 (m, 9H), 2.24- 2.34 (m, 4H), 2.69-2.90 (m, 8H), 3.45-3.51 (m, 2H), 4.02-4.10 (m, 4H), 4.49-4.52 (m, 2H), 4.24-4.54 (m, 12H) ), 4.27–4.38 (m, 5H).

Step 2: Preparation of Compound 247-3

To a solution of 247-2 (1.0 g, 1.3 mmol, 1.0 equiv) in DCM (20 mL) was added BCl ₃ (15.6 mL, 15.6 mmol, 12.0 equiv) at -78 °C. The mixture was stirred at -78 °C for 1 hour. The mixture was poured into NaHCO ₃ (aq) and extracted with DCM. The organic layer was washed with brine, dried over Na ₂ SO ₄ , concentrated and purified by column chromatography on silica gel (PE/EA = 5:1) to give compound 247-3 (634 mg, 72.87% yield). Provided as a colorless oil. ¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.90-1.00 (m, 6H), 1.26-1.37 (m, 20H), 1.58-1.63 (m, 4H), 1.70-1.80 (m, 2H), 2.03- 2.12 (m, 8H), 2.26-2.34 (m, 5H), 2.45-2.55 (m, 1H), 2.77-2.87 (m, 6H), 3.63-3.66 (m, 2H), 3.78-3.94 (m, 1H) ), 4.02–4.11 (m, 5H), 5.25–5.60 (m, 12H).

Step 3: Preparation of Compound 247-4

To a solution of 247-3 (630 mg, 0.94 mmol, 1.0 equiv) and DIPEA (243 mg, 1.88 mmol, 2.0 equiv) in DCM (20 mL) was added MsCl (129 mg, 1.13 mmol, 1.2 equiv) at 0°. It became. The mixture was stirred at room temperature for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 247-4 (652 mg, 92.88 % yield) as a yellow oil. It was used in the next step without further purification.

Step 4: Preparation of Compound 247-5

To a solution of 247-4 (600 mg, 0.8 mmol, 1.0 equiv) and Compound B (229 mg, 1.6 mmol, 2.0 equiv) in ACN (10 mL) was K ₂ CO ₃ (332 mg, 2.4 mmol, 3.0 equiv); Cs ₂ CO ₃ (78 mg, 0.24 mmol, 0.23 equiv) and NaI (36 mg, 0.24 mmol, 0.3 equiv) were added. The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 20/1) to give compound 247-5 (472 mg, 74.33% yield) as a yellow oil. LCMS: Rt: 1.135 min; MS m/z (ESI): 794.7 [M+H] ⁺ .

Step 5: Preparation of Compound 247-6

To a solution of 247-5 (472 mg, 0.59 mmol. 1.0 equiv) and DIPEA (152 mg, 1.18 mmol, 2.0 equiv) in DCM (10 mL) was added MsCl (81 mg, 0.71 mmol, 1.2 equiv) at 0°. It became. The mixture was stirred at room temperature for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated to give compound 247-6 (500 mg, 97.09% yield) as a yellow oil. It was used in the next step without further purification.

Step 6: Preparation of Compound 247

To a solution of 247-6 (500 mg, 0.6 mmol, 1.0 equiv) and compound SM34 (480 mg, 1.2 mmol, 2.0 equiv) in THF (10 mL) was added DIEA (230 mg, 1.8 mmol, 3.0 equiv) and NaI (30 mg, 0.18 mmol, 0.3 eq) was added. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete. The reaction mixture was poured into water and extracted with EA. The organic layer was washed with brine, dried over Na ₂ SO ₄ , concentrated and purified by pre-HPLC to give compound 247 (38 mg, 5.4% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.91 (m, 6H), 0.94-1.01 (m, 6H), 0.26-1.33 (m, 50H), 1.57-1.69 (m, 10H), 1.76- 1.84 (m, 4H), 1.89-2.06 (m, 12H), 2.10-2.21 (m, 3H), 2.26-2.32 (m, 6H), 2.53-2.67 (m, 6H), 2.70-2.85 (m, 9H) ), 3.15–3.23 (m, 3H), 3.47–3.74 (m, 3H), 4.00–4.15 (m, 5H), 5.28–5.45 (m, 12H). LCMS: Rt: 25.165 min; MS m/z (ESI): 1174.8 [M+H] ⁺ .

6.79 Example 79: Preparation of Compound 261.

Step 1: Preparation of compound 261-1

K ₂ CO ₃ (829 mg, 6.0 mmol, 3.0 equiv) to a solution of compound 26-1 (895 mg, 2.0 mmol, 1.0 equiv) and compound SM32 (407 mg, 3.0 mmol, 1.5 equiv) in ACN (20 mL). , Cs ₂ CO ₃ (195 mg, 0.6 mmol, 0.3 equiv) and NaI (90 mg, 0.6 mmol, 0.3 equiv) were added. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by column chromatography on silica gel (DCM/MeOH = 40/1) to give compound 261-1 (530 mg, 57% yield) as a yellow oil.

Step 2: Preparation of Compound 261

To a solution of compound 261-1 (200 mg, 0.43 mmol, 1.0 equiv) and compound SM16 (191 mg, 0.43 mmol, 1.0 equiv) in DCE (8 mL) was added AcOH (1 drop). The mixture was stirred at rt for 6 h. Then NaBH(OAc) ₃ (137 mg, 0.65 mmol, 1.5 equiv) was added. The mixture was stirred at rt for 16 h. LCMS showed the reaction to be complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ and concentrated. The residue was purified by preparative-HPLC to give compound 261 (22 mg, 6% yield) as a yellow oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ: 0.86-0.90 (m, 12H), 1.26-1.41 (m, 53H), 1.56-1.69 (m, 18H), 1.92-2.03 (m, 2H), 2.29- 2.32 (m, 7H), 2.52-2.90 (m, 6H), 3.96-4.10 (m, 6H). LCMS: Rt: 0.520 min; MS m/z (ESI): 893.6 [M+H] ⁺ .

6.80 Example 80: Preparation and characterization of lipid nanoparticles

Briefly, the cationic lipids, DSPC, cholesterol, and PEG-lipids provided herein were solubilized in ethanol in a molar ratio of 50:10:38.5:1.5, and mRNA was diluted in 10-50 mM citrate buffer, pH = 4. LNPs were prepared at a total lipid to mRNA weight ratio of approximately 10:1 to 30:1 by mixing an aqueous mRNA solution and an ethanolic lipid solution in a volume ratio of 1:3 using a microfluidic apparatus with a total flow rate ranging from 9-30 mL/min. was manufactured Ethanol was thereby removed and replaced by DPBS using dialysis. Finally, the lipid nanoparticles were filtered through a 0.2 μm sterile filter.

Lipid nanoparticle size was determined by dynamic light scattering using a Malvern Zetasizer Nano ZS (Malvern, UK) using the 173 ^° backscatter detection mode. The encapsulation efficiency of the lipid nanoparticles was determined using the Quant-it Ribogreen RNA Quantification Assay Kit (Thermo Fisher Scientific, UK) according to the manufacturer's instructions.

As reported in the literature, the apparent pKa of LNP formulations correlates with the delivery efficiency of LNPs for nucleic acids in vivo . The apparent pKa of each formulation was determined using an assay based on the fluorescence of 2-(p-toluidino)-6-naphthalene sulfonic acid (TNS). LNP formulations containing cationic lipids/DPC/Cholesterol/DMG-PEG (50/10/38.5/1.5 mol %) in PBS were prepared as described above. TNS was prepared as a 300 μM stock solution in distilled water. The LNP formulation was diluted to 0.1 mg/mL total lipid in 3 mL of a buffered solution containing 50 mM sodium citrate, 50 mM sodium phosphate, 50 mM sodium borate, and 30 mM sodium chloride with a pH ranging from 3 to 9. An aliquot of TNS solution was added to give a final concentration of 0.1 mg/mL and after vortex mixing the fluorescence intensity was measured at room temperature on a Molecular Devices Spectramax iD3 spectrometer using excitation and mission wavelengths of 325 nm and 435 nm. A sigmoidal best fit analysis was applied to the fluorescence data and the pKa value was determined as the pH that resulted in the half-maximal fluorescence intensity.

6.81 Example 81: Animal Studies

Lipid nanoparticles containing compounds in the table below encapsulating human erythropoietin (hEPO) mRNA were administered systemically to 6-8 week old female ICR mice (Xipuer-Bikai, Shanghai) at a dose of 0.5 mg/kg by tail vein injection. administration and mouse blood was sampled at a specific time point (eg, 6 hours) after administration. In addition to the above-mentioned tested groups, lipid nanoparticles comprising dilinoleylmethyl-4-dimethylaminobutyrate (DL in-MC3-DMA, usually abbreviated as MC3) encapsulating hEPO mRNA were used as positive controls in mice. Age and sex comparison groups were similarly administered at the same dose.

Mice were euthanized by CO ₂ overdose after the last sampling time point. Serum was separated from total blood by centrifugation at 5000g for 10 minutes at 4°C, snap-frozen and stored at -80°C for analysis. ELISA assays were performed using a commercial kit (DEP00, R&D Systems) according to the manufacturer's instructions.

The characteristics of the lipid nanoparticles tested, including the expression levels for MC3 (μg/ml) measured from the tested groups, are listed in the table below.

A: ≥ 2

B: ≥ 1 and < 2

C: ≥ 0.1 and < 1

D: < 0.1

6.82 Example 82: Lipid Removal Study

LNPs were injected into mice via the tail vein (ICR female, IV, 0.5 mg mRNA/kg), then mice were anesthetized under carbon dioxide at different times post administration ( e.g. , 6, 24, and 48 hours). and was sacrificed via cardiac puncture. Liver tissue was immediately collected and then rinsed with ice-cold saline. Liver samples were weighed and homogenized in an ice-water bath by adding pre-cooled 20% methanol-water (v/v) at 2-8 °C in a ratio of 1:5 (w/v). Homogenized tissue samples were stored in a -90 to -60 °C freezer prior to analysis.

sample processing. All liver tissue homogenate samples were allowed to thaw at room temperature. An aliquot of 50 μL of sample was added with 50 μL MgCl ₂ (2M), followed by Verapamil, 5 ng mL ^-1 and Glibenclamide, 50 ng mL ^-1 for protein precipitation. and ACN containing Diclofenac, 200 ng·mL ⁻¹ and Tolbutamide, 200 ng·mL ⁻¹ , then centrifuged at 13000 rpm for 8 minutes. Then 100 μL of the supernatant was added with 100 μL water, then vortexed well. An aliquot of 5 μL of the mixture was injected into the LC-MS/MS system.

Results for MC3 and selected lipid compounds provided herein are listed in the table below.

^a Percentage of original lipid dose in mouse liver at different times after 0.5 mg/kg iv bolus dose mRNA

SEQUENCE LISTING <110> SUZHOU ABOGEN BIOSCIENCES CO., LTD. <120> LIPID COMPOUNDS AND LIPID NANOPARTICLE COMPOSITIONS <130> 14639-019-146 <140> TBA <141> <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 24 <212> DNA <213> artificial sequence <220> <223> stem-loop sequences <400> 1 caaaggctct tttcagagcc acca 24 <210> 2 <211> 24 <212> RNA <213> artificial sequence <220> <223> stem-loop sequences <400> 2 caaaggcucu uuucagagcc acca 24

Claims (51)

As a compound of formula (I) or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof,

During the meal:
G ¹ and G ² are each independently a bond, C ₂ -C ₁₂ alkylene, or C ₂ -C ₁₂ alkenylene, wherein at least one -CH ₂ - in said G ¹ and G ² is optionally by -O- replaced;
Each L ¹ is independently -OC(=O)R ¹ , -C(=O)OR ¹ , -OC(=O)OR ¹ , -C(=O)R ¹ , -OR ¹ , -S(O ) _x R ¹ , -S-SR ¹ , -C(=O)SR ¹ , -SC(=O)R ¹ , -NR ^a C(=O)R ¹ , -C(=O)NR ^b R ^c , -NR ^a C(=O)NR ^b R ^c , -OC(=O)NR ^b R ^c , -NR ^a C(=O)OR ¹ , -SC(=S)R ¹ , -C(=S )SR ¹ , -C(=S)R ¹ , -CH(OH)R ¹ , -P(=O)(OR ^b )(OR ^c ), -NR ^a P(=O)(OR ^b )(OR ^c ), -(C ₆ -C ₁₀ arylene)-R ¹ , -(6- to 10-membered heteroarylene)-R ¹ , -(4- to 8-membered heterocyclylene)-R ¹ , or is R ¹ ;
Each L ² is independently -OC(=O)R ² , -C(=O)OR ² , -OC(=O)OR ² , -C(=O)R ² , -OR ² , -S(O ) _x R ² , -S-SR ² , -C(=O)SR ² , -SC(=O)R ² , -NR ^d C(=O)R ² , -C(=O)NR ^e R ^f , -NR ^d C(=O)NR ^e R ^f , -OC(=O)NR ^e R ^f , -NR ^d P(=O)(OR ^e )(OR ^f ), -SC(=S)R ² , -C(=S)SR ² , -C(=S)R ² , -CH(OH)R ² , -P(=O)(OR ^e )(OR ^f ), -NR ^a P(=O) (OR ^b )(OR ^c ), -(C ₆ -C ₁₀ arylene)-R ² , -(6- to 10-membered heteroarylene)-R ² , -(4- to 8-membered heterocyclylene) )-R ² , or R ² ;
R ¹ and R ² are each independently C ₆ -C ₂₄ alkyl or C ₆ -C ₂₄ alkenyl;
R ^a , R ^b , R ^d , and R ^e are each independently H, C ₁ -C ₂₄ alkyl, or C ₂ -C ₂₄ alkenyl;
R ^c and R ^f are each independently C ₁ -C ₂₄ alkyl or C ₂ -C ₂₄ alkenyl;
G ³ is C ₂ -C ₁₂ alkylene, or C ₂ -C ₁₂ alkenylene, wherein some or all of the alkylene or alkenylene is C ₃ -C ₈ cycloalkylene, C ₃ -C ₈ cycloalkenylene, optionally substituted by C ₃ -C ₈ cycloalkynylene, 4- to 8-membered heterocyclylene, C ₆ -C ₁₀ arylene, or 5- to 10-membered heteroarylene;
R ³ is hydrogen, C ₁ -C ₁₂ alkyl, C ₂ -C ₁₂ alkenyl, C ₂ -C ₁₂ alkynyl, C ₃ -C ₈ cycloalkyl, C ₃ -C ₈ cycloalkenyl, C ₃ -C ₈ cycloalkynyl, 4- to 8-membered heterocyclyl, C ₆ -C ₁₀ aryl, or 5- to 10-membered heteroaryl; Portions of R ³ , G ¹ or G ¹ together with the nitrogen to which they are attached form a cyclic moiety; A portion of R ³ , G ³ or G ³ together with the nitrogen to which they are attached form a cyclic moiety;
R ⁴ is C ₁ -C ₁₂ alkyl or C ₃ -C ₈ cycloalkyl;
x is 0, 1 or 2;
n is 1 or 2;
m is 1 or 2;
each of alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocyclylene , wherein the arylene, heteroarylene, and cyclic moieties are independently optionally substituted. The compound according to claim 1, which is a compound of formula (II-A), (II-B), (II-C), or (II-D) or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof. :
3. The compound according to claim 1 or 2, wherein G ³ is C ₂ -C ₆ alkylene. The compound of claim 1, which is a compound of Formula (III-A), (III-B), (III-C), or (III-D) or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof. :

In the formula, s is an integer from 2 to 12. 5. The compound of claim 4, wherein s is 2. The compound according to any one of claims 1 to 5, wherein G ¹ and G ² are each independently C ₂ -C ₁₂ alkylene. The compound according to claim 6, wherein G ¹ and G ² are each independently C ₅ alkylene. The compound according to claim 1, which is a compound of formula (IV) or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof:

In the formula, s is an integer from 2 to 12,
y is an integer from 2 to 12;
z is an integer from 2 to 12; The method according to any one of claims 1 to 8, wherein L ¹ is -OC(=O)R ¹ , -C(=O)OR ¹ , -NR ^a C(=O)R ¹ , or -C( =0)NR ^b R ^c ; L ² is -OC(=O)R ² , -C(=O)OR ² , -NR ^d C(=O)R ² , or -C(=O)NR ^e R ^f . 9. The compound of claim 8 of formula (IV-A), (IV-B), (IV-C), (IV-D), (IV-E), (IV-F), (IV-G), or A compound of (IV-H) or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof:
The compound according to claim 1, which is a compound of formula (V) or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof:

wherein y is an integer from 2 to 12;
z is an integer from 2 to 12; The method of claim 11, wherein L ¹ is -OC(=O)R ¹ , -C(=O)OR ¹ , -NR ^a C(=O)R ¹ , or -C(=O)NR ^b R ^c ; L ² is -OC(=O)R ² , -C(=O)OR ² , -NR ^d C(=O)R ² , or -C(=O)NR ^e R ^f . 12. The compound of formula (VA), (VB), (VC), (VD), (VE), (VF), (VG), or (VH) or a pharmaceutically acceptable salt thereof according to claim 11, Compounds, prodrugs or stereoisomers:
14. The compound according to any one of claims 8 to 13, wherein y is 5 and z is 5. The compound according to claim 1, which is a compound of formula (VI) or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof:

Wherein z is an integer from 2 to 12. 16. The compound of any one of claims 1-15, wherein R ³ is C ₁ -C ₁₂ alkyl, C ₂ -C ₁₂ alkenyl, or C ₃ -C ₈ cycloalkyl. 16. A compound according to any one of claims 1 to 15, wherein moieties of R ³ , G ¹ or G ¹ together with the nitrogen to which they are attached form a cyclic moiety. 18. The compound of claim 17, which is a compound of formula (VII) or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof:

In the formula, s is an integer from 2 to 12,
u is 1, 2, or 3;
v is 1, 2, or 3;
y' is an integer from 0 to 10;
z is an integer from 2 to 12; 16. A compound according to any one of claims 1 to 15, wherein moieties of R ³ , G ³ or G ³ together with the nitrogen to which they are attached form a cyclic moiety. 20. The compound of claim 19 of formula (VIII-A), (VIII-B), (VIII-C), (VIII-D), (VIII-E), (VIII-F), or (VIII-G). A compound, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, that is:

In the formula, s' is an integer from 0 to 10,
u is 1, 2, or 3;
v is 1, 2, or 3;
y is an integer from 2 to 12;
z is an integer from 2 to 12;
y0 is an integer from 1 to 11;
z0 is an integer from 1 to 11;
y1 is an integer from 0 to 9;
z1 is an integer from 0 to 9; The compound according to claim 1, wherein formula (IX-A), (IX-B), (IX-C), (IX-D), (IX-E), (IX-F), (IX-G), ( (IX-H), (IX-I), (IX-J), (IX-K), (IX-L), (IX-M), (IX-N), (IX-O), (IX- P), (IX-Q), (IX-R), (IX-S), (IX-T), (IX-U), (IX-V), (IX-W), (IX-X) A compound of , (IX-Y), (IX-Z), or (IX-AA), or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof:

In the formula, s is an integer from 2 to 12,
y is an integer from 2 to 12;
z is an integer from 2 to 12;
y0 is an integer from 1 to 11;
z0 is an integer from 1 to 11;
y1 is an integer from 0 to 9;
z1 is an integer from 0 to 9;
y2 is an integer from 2 to 5;
y3 is an integer from 2 to 6;
y4 is an integer from 0 to 3;
y5 is an integer from 1 to 5;
z2 is an integer from 2 to 5;
z3 is an integer from 2 to 6;
z4 is an integer from 0 to 3;
z5 is an integer from 1 to 5; 22. The compound of claim 21, wherein L ¹ is -OR ¹ , -OC(=0)OR ¹ , -C(=0)OR ¹ , or -C(=0)NR ^b R ^c ; L ² is -OR ² , -OC(=O)R ² , -C(=O)OR ² , or -C(=O)NR ^e R ^f . 23. A compound according to any one of claims 1 to 22, wherein R ³ is unsubstituted. 24. The compound of any one of claims 1 to 23, wherein R ⁴ is substituted C ₁ -C ₁₂ alkyl. 25. The compound of claim 24, wherein R ⁴ is -CH ₂ CH ₂ OH. 25. The method of claim 24, wherein R ⁴ is -(CH ₂ ) _p Q, -(CH ₂ ) _p CHQR, -CHQR, or -CQ(R) ₂ wherein Q is C ₃ -C ₈ cycloalkyl, C ₃ -C ₈ cycloalkenyl, C ₃ -C ₈ cycloalkynyl, 4- to 8-membered heterocyclyl, C ₆ -C ₁₀ aryl, 5- to 10-membered heteroaryl, -OR, -O(CH ₂ ) _p N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -N(R) ₂ , -C(O) N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C (S)N(R) ₂ , -N(R)R ^{2 2} , -O(CH ₂ ) _p OR, -N(R)C(=NR ²³ )N(R) ₂ , -N(R)C( =CHR ²³ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S( O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O)N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR) )C(=NR ²³ )N(R) ₂ , -N(OR)C(=CHR ²³ )N(R) ₂ , -C(=NR ²³ )N(R) ₂ , -C(=NR ²³ ) R, -C(O)N(R)OR, or -C(R)N(R) ₂ C(O)OR, each p being independently 1, 2, 3, 4, or 5;
R ²² is C ₃ -C ₈ cycloalkyl, C ₃ -C ₈ cycloalkenyl, C ₃ -C ₈ cycloalkynyl, 4- to 8-membered heterocyclyl, C ₆ -C ₁₀ aryl, or 5- to 10-membered heteroaryl;
R ²³ is H, -CN, -NO ₂ , C ₁ -C ₆ alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C ₂ -C ₆ alkenyl; C ₃ -C ₈ cycloalkyl, C ₃ -C ₈ cycloalkenyl, C ₃ -C ₈ cycloalkynyl, 4- to 8-membered heterocyclyl, C ₆ -C ₁₀ aryl, or 5- to 10-membered heteroaryl;
each R is independently H, C ₁ -C ₃ alkyl, or C ₂ -C ₃ alkenyl; In the N(R) ₂ moiety, the two R together with the nitrogen to which they are attached form a cyclic moiety;
wherein each X is independently F, CI, Br, or I. 27. The compound of any one of claims 1-26, wherein R ¹ , R ² , R ^c , and R ^f are each independently linear C ₆ -C ₁₈ alkyl, linear C ₆ -C ₁₈ alkenyl, or -R ⁷ -CH(R ⁸ )(R ⁹ ), wherein R ⁷ is C ₀ -C ₅ alkylene, and R ⁸ and R ⁹ are independently C ₂ -C ₁₀ alkyl or C ₂ -C ₁₀ alkenyl; compound. 28. The method of claim 27, wherein R ¹ , R ² , R ^c , and R ^f are each independently linear C ₇ -C ₁₅ alkyl, linear C ₇ -C ₁₅ alkenyl, or -R ⁷ -CH(R ⁸ )( R ⁹ ), wherein R ⁷ is C ₀ -C ₁ alkylene, and R ⁸ and R ⁹ are independently C ₄ -C ₈ alkyl or C ₆ -C ₁₀ alkenyl. 29. The compound according to any one of claims 1 to 28, wherein R ^a , R ^b , R ^d , and R ^e are each independently H. A compound in Table 1 or Table 1A, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof. Compounds of Formula (X):

or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:
G ¹ is a bond, C ₂ -C ₁₂ alkylene, or C ₂ -C ₁₂ alkenylene;
Each L ¹ is independently -OC(=O)R ¹ , -C(=O)OR ¹ , -OC(=O)OR ¹ , -C(=O)R ¹ , -OR ¹ , -S(O ) _x R ¹ , -S-SR ¹ , -C(=O)SR ¹ , -SC(=O)R ¹ , -NR ^a C(=O)R ¹ , -C(=O)NR ^b R ^c , -NR ^a C(=O)NR ^b R ^c , -OC(=O)NR ^b R ^c , -NR ^a C(=O)OR ¹ , -SC(=S)R ¹ , -C(=S )SR ¹ , -C(=S)R ¹ , -CH(OH)R ¹ , -P(=O)(OR ^b )(OR ^c ), -(C ₆ -C ₁₀ arylene)-R ¹ , -(6- to 10-membered heteroarylene)-R ¹ , or R ¹ ;
R ¹ is C ₆ -C ₂₄ alkyl or C ₆ -C ₂₄ alkenyl;
R ^a and R ^b are each independently H, C ₁ -C ₁₂ alkyl, or C ₂ -C ₁₂ alkenyl;
R ^c is C ₁ -C ₂₄ alkyl or C ₂ -C ₂₄ alkenyl;
R ³ is hydrogen, C ₁ -C ₁₂ alkyl, C ₂ -C ₁₂ alkenyl, C ₂ -C ₁₂ alkynyl, C ₃ -C ₈ cycloalkyl, C ₃ -C ₈ cycloalkenyl, C ₃ -C ₈ cycloalkynyl, 4- to 8-membered heterocyclyl, C ₆ -C ₁₀ aryl, or 5- to 10-membered heteroaryl; The moiety of R ³ , G ¹ or G ¹ together with the nitrogen to which they are attached form a cyclic moiety;
x is 0, 1, or 2;
n is 1 or 2;
Z is -OH or halogen;
each of alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocyclylene , wherein the arylene, heteroarylene, and cyclic moieties are independently optionally substituted. A composition comprising the compound of any one of claims 1 to 31 and a therapeutic or prophylactic agent. 33. The composition of claim 32, further comprising one or more structural lipids. 34. The composition of claim 33, wherein the one or more structural lipids are DSPC. 35. The composition of claim 33 or 34, wherein the molar ratio of the compound to the structural lipid ranges from about 2:1 to about 8:1. 36. The composition of any one of claims 32-35, further comprising a steroid. 37. The composition of claim 36, wherein the steroid is cholesterol. 38. The composition of claim 36 or 37, wherein the molar ratio of the compound to the steroid ranges from about 5:1 to about 1:1. 39. The composition of any one of claims 32-38, wherein the composition further comprises one or more polymer conjugated lipids. 40. The composition of claim 39, wherein the polymer conjugated lipid is DMG-PEG2000 or DMPE-PEG2000. 41. The composition of claim 39 or 40, wherein the molar ratio of the compound to the polymer conjugated lipid ranges from about 100:1 to about 20:1. 42. The composition of any one of claims 32 to 41, wherein the therapeutic or prophylactic agent comprises at least one mRNA encoding an antigen or fragment or epitope thereof. 43. The composition of claim 42, wherein the mRNA is a monocistronic mRNA. 43. The composition of claim 42, wherein the mRNA is a multicistronic mRNA. 45. The composition of any one of claims 42-44, wherein the antigen is a pathogenic antigen. 45. The composition of any one of claims 42-44, wherein the antigen is a tumor associated antigen. 47. The composition of any one of claims 42-46, wherein the mRNA comprises one or more functional nucleotide analogues. 48. The composition of claim 47, wherein the functional nucleotide analogue is at least one selected from pseudouridine, 1-methyl-pseudouridine and 5-methylcytosine. 49. The composition of any one of claims 32-48, wherein the composition is a nanoparticle. A lipid nanoparticle comprising the compound of any one of claims 1 - 31 , or the composition of any one of claims 32 - 48 . A pharmaceutical composition comprising the compound of any one of claims 1 to 31, the composition of any one of claims 32 to 48, or the lipid nanoparticle of claim 50, and a pharmaceutically acceptable excipient or diluent. .