KR20230118928A - Marker combination for skin typing and its application - Google Patents

Abstract

The present invention provides the use of Moraxella osloensis for use in skin typing, characterization for a skin condition, or for use in the preparation of a reagent or kit for characterizing a skin condition, the present invention relates to Moraxella osloensis and Propionibacterium A marker combination comprising acne is further provided. The present invention further provides an application of the marker combination in skin typing and/or skin condition determination.

Description

Marker combination for skin typing and its application

The present invention relates to the field of biomedicine, and specifically to a marker combination for skin typing and its application.

With the introduction of the microbiome project, it has become increasingly recognized that the human body, like the intestines, has many microbes on its surface. Intestinal studies have suggested that strategies through microbe-host interactions and fecal microbiome transplantation, probiotics, and probiotics can alter the gut microecology and subsequently improve gut normality. Research progress in skin microecology is relatively lagging, especially with a lack of metagenome data from large populations. Metagenome data based on North American populations show that the composition of the skin microbiome varies greatly among individuals, but is highly stable, i.e., an individual's microbiome composition is relatively stable over time and spatial variation, with strong individual characteristics. Based on Chinese Han Chinese population data, this study once again confirmed the existence of individual differences, and also found a significant association between the microbial composition and the host's set of skin phenotypes, and the skin microbiome is a potential new potential for improving skin phenotypes. Sudan, a new target was discovered.

However, strong individual differences pose serious challenges to the development and design of universal skin care products and pharmaceuticals. Further statistical analysis found that although there are large individual differences, there are still some key features and rules at the population level, and the combination of these features solves the problem of large individual differences by typing the population. Skin typing is well suited for “precise”/“customized” care at low resolution. For example, currently common skin typing - “dry”, “neutral”, “oily” skin, that is, similar to typing according to the oil and moisture characteristics of the host skin, but different, this study is based on skin microbiome characteristics, not oil and moisture characteristics So, the population is typed. This will help the industry develop skin care products and medicines that are more suitable for specific populations for different skin types and achieve a certain degree of “precise”/“tailored” care to effectively improve skin normality.

Therefore, it is urgent in the art to provide a new diagnostic and typing means by developing a method for determining skin aging that is used for new skin typing.

The present invention aims to help the industry develop skin care products and pharmaceuticals better suited to specific populations for different skin types by typing populations based on skin microbiome characteristics. It is used for skin typing and provides a new method of determining skin conditions, thereby providing a new means of diagnosis and typing.

The present invention is based on two bacteria that dominate skin typing - Moraxella osloensis and Propionibacterium acnes, among bacterial colonies abundant in the skin that play an important role in the health and disease of the host. We focused on one, Staphylococcus epidermidis. First, in the metagenome data of a large-scale sample of the Han Chinese population, the correlation between the distribution abundance in the face of the three target skin commensals and the host skin phenotype was confirmed, and then QPCR experimental validation was performed to identify 1 that can promote skin aging. Species of bacteria - Moraxella osloensis (M.osloensis) was determined.

In a first aspect of the present invention, (a) skin typing; and/or (b) used to determine or characterize skin conditions; or (a) skin typing; and/or (b) the use of M.osloensis or a reagent for its detection used in preparing a kit or reagent used for characterization or judgment of a skin condition.

In another preferred embodiment, the skin condition includes skin age, skin moisture content, skin elasticity, skin color, and degree of skin aging.

In another preferred embodiment, the degree of aging of the skin is determined based on one or more phenotypes selected from the group consisting of porphyrin, fat, moisture content, gloss, pore area, skin yellowing value, pore size, and pigmentation.

In another preferred embodiment, the reagent or kit further comprises a reagent for detecting Propionibacterium acnes (C. acnes).

In another preferred embodiment, the reagent or kit further comprises a reagent for detecting Moraxella bovoculi and/or Psychrobacter sp.

In another preferred embodiment, the reagent or kit is Propionibacterium avidum, Propionibacterium granulosum, Staphylococcus, Propionibacterium acnes phage and/or Staphylococcus aureus A reagent for detecting the phage is further included.

In another preferred embodiment, the reagent or kit further comprises a reagent for detecting S. epidermidis.

A second aspect of the present invention provides a marker combination comprising Moraxella osloensis (M.osloensis) and Propionibacterium acnes (C.acnes).

In another preferred embodiment, the marker combination further comprises Moraxella bovoculi and/or Psychrobacter sp.

In another preferred embodiment, the marker combination is Propionibacterium avidum, Propionibacterium granulosum, Staphylococcus, Propionibacterium acnes phage and/or Staphylococcus aureus phage. more includes

In another preferred embodiment, the marker combination further comprises S. epidermidis.

In another preferred embodiment, the marker combination comprises (a) skin typing; and/or (b) used to determine a skin condition.

In another preferred embodiment, the skin condition includes skin age, skin moisture content, skin elasticity, skin color, and degree of skin aging.

In another preferred embodiment, the degree of aging of the skin is determined based on one or more phenotypes selected from the group consisting of porphyrin, fat, moisture content, gloss, pore area, skin yellowing value, pore size, and pigmentation.

In another preferred embodiment, the marker or combination of markers is derived from a skin sample, relatively preferably whole body skin or facial skin, more preferably cheek, forehead and bridge of the nose.

In another preferred embodiment, the marker or marker combination is derived from a skin sample of an Asian population.

In another preferred embodiment, the marker or combination of markers is derived from cheek, forehead and bridge of the nose samples.

In another preferred embodiment, the level of each marker in the marker combination is detected by at least one method from the group consisting of sequencing, PCR, and protein quantitative detection.

In another preferred embodiment, the marker combination level detection method further comprises one or more methods selected from the group consisting of feature gene quantitative PCR, qPCR, real-time quantitative PCR, metagenomic analysis, 16s RNA sequencing, mass spectrum analysis, and Western blot. do.

In another preferred embodiment, the ratio (M/ C) meets the conditions of M/C ≤ 1.3, relatively preferably M/C ≤ 0.8, more preferably M/C ≤ 0.4, the skin type is type C (or type I), and the phenotype is maintained. It includes high content, high moisture content, good skin elasticity, low degree of skin aging, and light skin color.

In another preferred embodiment, the ratio (M/ C) is 0.3≤M/C≤2.5, relatively preferably 0.3≤M/C≤2.3, more preferably 0.8≤M/C≤1.8, the skin type is mixed type (or type II) , the phenotype includes medium fat content, medium water content, normal skin elasticity, medium degree of skin aging, and medium skin color.

In another preferred embodiment, the ratio (M/ C) meets the conditions of M/C≥0.5, relatively preferably M/C≥1.8, more preferably M/C≥2.2, the skin type is type M (type III), and the phenotype is skin maintenance It includes those with low content, relatively low water content, low skin elasticity, high degree of skin aging, and dark skin color.

In another preferred example, the ratio of the level (eg content) (M) of said Moraxella ausloensis to the level (eg content) (C) of said Propionibacterium acnes, derived from a ball sample (M) ( M/C) meets the condition of M/C ≤ 0.8, relatively preferably M/C ≤ 0.75, the skin type is type C (or type I), and its phenotype is high in oil content and high in moisture. It includes those with good elasticity, low degree of skin aging, and light skin color.

In another preferred example, the ratio of the level (eg content) (M) of said Moraxella ausloensis to the level (eg content) (C) of said Propionibacterium acnes, derived from a ball sample (M) ( M/C) satisfies the condition of 0.75≤M/C≤2, relatively preferably 0.8≤M/C≤1.7, the skin type is mixed type (or type II), and its phenotype is medium oil content and moisture It includes those with medium content, normal skin elasticity, medium degree of skin aging, and medium skin color.

In another preferred example, the ratio of the level (eg content) (M) of said Moraxella ausloensis to the level (eg content) (C) of said Propionibacterium acnes, derived from a ball sample (M) ( M/C) meets the condition of M/C≥1.7, the skin type is type M (type III), and its phenotype is low in skin oil content, relatively low in moisture content, low in skin elasticity, high degree of skin aging, Including dark skin color.

In another preferred embodiment, the ratio of the level (eg content) of the Moraxella ausloensis (M) to the level (eg content) (C) of the Propionibacterium acnes when derived from a forehead sample. If (M/C) meets the condition of M/C≤1.5, relatively preferably M/C≤1.25, the skin type is type C (or type I), and its phenotype is high in oil content and high in moisture. It includes those with good skin elasticity, low degree of skin aging, and light skin color.

In another preferred embodiment, the ratio of the level (eg content) (M) of said Moraxella ausloensis to the level (eg content) (C) of said Propionibacterium acnes, derived from a forehead sample (M) ( M/C) satisfies the condition of 1.25≤M/C≤2.5, relatively preferably 1.3≤M/C≤2.2, the skin type is mixed type (or type II), and its phenotype is medium oil content and moisture It includes those with medium content, normal skin elasticity, medium degree of skin aging, and medium skin color.

In another preferred embodiment, the ratio of the level (eg content) (M) of said Moraxella ausloensis to the level (eg content) (C) of said Propionibacterium acnes, derived from a forehead sample (M) ( M/C) satisfies the condition of M/C≥2, relatively preferably ≥2.2, the skin type is type M (Type III), and its phenotype is low in skin oil content, relatively low in moisture content, and skin elasticity. This includes a high degree of skin aging and a dark skin color.

In another preferred embodiment, the ratio of the level (eg content) of the Moraxella osloensis (M) to the level (eg content) (C) of the Propionibacterium acnes when derived from a sample of the bridge of the nose If (M/C) meets the condition of M/C≤0.5, relatively preferably M/C≤0.35, the skin type is type C (or type I), and its phenotype is high in oil content and high in moisture. It includes those with good skin elasticity, low degree of skin aging, and light skin color.

In another preferred example, the ratio of the level (eg content) (M) of the Moraxella ausloensis to the level (eg content) (C) of the Propionibacterium acnes, derived from a sample of the bridge of the nose ( M/C) is 0.35≤M/C≤0.7, relatively preferably 0.35≤M/C≤0.6, more preferably 0.35≤M/C≤0.55, the skin type is mixed type (or type II) ), the phenotype includes medium oil content, medium water content, normal skin elasticity, medium degree of skin aging, and medium skin color.

In another preferred example, the ratio of the level (eg content) (M) of the Moraxella ausloensis to the level (eg content) (C) of the Propionibacterium acnes, derived from a sample of the bridge of the nose ( M/C) satisfies the conditions of M/C≥0.5, relatively preferably M/C≥0.55, the skin type is type M (Type III), and its phenotype is low in skin oil content and relatively low in moisture content. It includes those with low skin elasticity, high degree of skin aging, and dark skin color.

A third aspect of the present invention provides a skin typing or skin condition determination method, the method comprising:

(1) Provide a sample derived from the skin of a target to be detected, and detect the level (eg content) of each marker among sample marker combinations including Moraxella osloensis and Propionibacterium acnes, respectively, and Moraxella osloensis respectively Obtaining the level (eg content) of Ensis (M) and the level (eg content) of Propionibacterium acnes (C); and

(2) based on the level (eg content) of Moraxella osloensis (M), or the level (eg content) of Moraxella osloensis (M) and the level of Propionibacterium acnes in the sample Comparing (for example, content) (C) to perform typing on the skin of the object to be detected and/or determining the skin condition; includes.

In another preferred embodiment, the object to be detected is from an Asian population.

In another preferred example, the relative value of the level (eg content) (M) of Moraxella ausloensis and the level (eg content) (C) of Propionibacterium acnes (eg According to M/C), typing is performed on the skin or the skin condition of the sample is judged.

In another preferred embodiment, the skin condition includes skin age, skin moisture content, skin elasticity, skin color, and degree of skin aging.

In another preferred example, the level (eg content) of Moraxella osloensis (M) and Propionibacterium acnes in a sample of the subject to be detected by one or more methods selected from the group consisting of sequencing, PCR, and protein quantitative detection Determine the level (eg content) of (C).

In another preferred example, the detection method for the level (eg content) of Moraxella osloensis (M) and the level (eg content) (C) of Propionibacterium acnes in the sample is characterized gene quantitative PCR , qPCR, real-time quantitative PCR, metagenomics analysis, 16s RNA sequencing, mass spectrum analysis, and one or more methods selected from the group consisting of Western blots.

In another preferred example, the ratio (M/C) of the level (M) of the Moraxella ausloensis to the level (eg content) (C) of the Propionibacterium acnes in the sample is M/C≤ 1.3, relatively preferably M / C ≤ 0.8, more preferably M / C ≤ 0.4, if the condition is met, the skin type is type C (or type I), the phenotype is high in oil content and high in moisture It includes those with good skin elasticity, low degree of skin aging, and light skin color.

In another preferred example, the ratio (M/C) of the level (eg content) of Moraxella ausloensis (M) to the level (eg content) (C) of the Propionibacterium acnes in the sample. ) is 0.3≤M/C≤2.5, relatively preferably 0.3≤M/C≤2.3, more preferably 0.8≤M/C≤1.8, the skin type is mixed type (or type II), The phenotype includes medium oil content, medium water content, moderate skin elasticity, medium skin ageing, and medium complexion.

In another preferred example, the ratio (M/C) of the level (eg content) of Moraxella ausloensis (M) to the level (eg content) (C) of the Propionibacterium acnes in the sample. ) meets the conditions of M/C≥0.5, relatively preferably M/C≥1.8, more preferably M/C≥2.2, the skin type is type M (type III), and its phenotype is skin oil content It includes those with low skin tone, relatively low water content, low skin elasticity, high degree of skin aging, and dark skin color.

In another preferred example, the ratio of the level (eg content) of Moraxella ausloensis (M) to the level (eg content) (C) of the Propionibacterium acnes in the sample derived from a ball sample. If the ratio (M/C) meets the condition of M/C ≤ 0.8, relatively preferably M/C ≤ 0.75, the skin type is type C (or type I), and its phenotype is high in oil content and high in moisture. It includes those with high skin elasticity, low degree of skin aging, and light skin color.

In another preferred example, the ratio of the level (eg content) of Moraxella ausloensis (M) to the level (eg content) (C) of the Propionibacterium acnes in the sample derived from a ball sample. If the ratio (M/C) meets the condition of 0.75≤M/C≤2, relatively preferably 0.8≤M/C≤1.7, the skin type is mixed type (or type II), and its phenotype is medium oil content and medium water content, normal skin elasticity, medium degree of skin aging, and medium skin color.

In another preferred example, the ratio of the level (eg content) of Moraxella ausloensis (M) to the level (eg content) (C) of the Propionibacterium acnes in the sample derived from a ball sample. If the ratio (M/C) meets the condition of M/C≥1.7, the skin type is type M (type III), the phenotype of which is low skin oil content, relatively low moisture content, low skin elasticity, and degree of skin aging is high and includes dark skin color.

In another preferred example, when derived from a forehead sample, the level (eg content) of Moraxella osloensis relative to the level (eg content) (C) of the Propionibacterium acnes in the sample (M) If the ratio (M/C) meets the condition of M/C≤1.5, relatively preferably M/C≤1.25, the skin type is C type (or I type), and its phenotype is high oil content and water content This includes those with high skin elasticity, low degree of skin aging, and light skin color.

In another preferred example, the ratio of the level (eg content) of Moraxella osloensis (M) to the level (eg content) (C) of the Propionibacterium acnes in the sample, derived from a forehead sample. If the ratio (M/C) meets the condition of 1.25≤M/C≤2.5, relatively preferably 1.3≤M/C≤2.2, the skin type is mixed type (or type II), and its phenotype is medium oil content and medium water content, normal skin elasticity, medium degree of skin aging, and medium skin color.

In another preferred example, the ratio of the level (eg content) of Moraxella osloensis (M) to the level (eg content) (C) of the Propionibacterium acnes in the sample, derived from a forehead sample. If the ratio (M/C) meets the condition of M/C≥2, relatively preferably ≥2.2, the skin type is type M (type III), the phenotype is low in skin oil content and relatively low in moisture This includes low skin elasticity, high degree of skin aging, and dark skin color.

In another preferred example, the level (eg content) of Moraxella osloensis (M) relative to the level (eg content) (C) of the Propionibacterium acnes in the sample, when from a sample of the bridge of the nose If the ratio (M/C) meets the condition of M/C≤0.5, relatively preferably M/C≤0.35, the skin type is type C (or type I), and its phenotype is high oil content and water content This includes those with high skin elasticity, low degree of skin aging, and light skin color.

In another preferred example, the level (eg content) of Moraxella osloensis relative to the level (eg content) (C) of the Propionibacterium acnes in the sample, derived from a sample of the bridge of the nose (M) If the ratio (M/C) meets the condition of 0.35≤M/C≤0.7, relatively preferably 0.35≤M/C≤0.6, more preferably 0.35≤M/C≤0.55, the skin type is mixed (or Type II), the phenotype includes medium oil content, medium water content, normal skin elasticity, medium degree of skin aging, and medium skin color.

In another preferred example, the level (eg content) of Moraxella osloensis relative to the level (eg content) (C) of the Propionibacterium acnes in the sample, derived from a sample of the bridge of the nose (M) If the ratio (M/C) satisfies the condition of M/C≥0.5, relatively preferably M/C≥0.55, the skin type is type M (type III), and its phenotype is low in skin oil content and high in water content. It is relatively low, and skin elasticity is low, and the degree of skin aging is high, including dark skin color.

In another preferred example, the relative value satisfies the following condition, that is, when M/C≤1.3, the skin is type C, and when M/C≥0.5, the skin is type M.

In another preferred example, the relative value satisfies the following condition, that is, when 0.3 ≤ M/C ≤ 2.5, the skin is a mixed type.

In another preferred example, when the level (eg content) (M) of Moraxella osloensis is improved, the skin condition is increased skin age, dull and yellow skin color, reduced skin moisture content, sebum and porphyrin indicates a decrease in content.

A fourth aspect of the present invention provides a reagent combination for detecting skin typing and/or skin condition, wherein the reagent combination includes a reagent for detecting each marker of the combination according to the second aspect of the present invention.

In another preferred embodiment, the reagent is used to detect the level (eg content) of each marker.

In another preferred embodiment, the reagent includes a material for detecting the level of each marker in the combination according to the second aspect of the present invention by at least one method selected from the group consisting of sequencing, PCR, and protein quantitative detection.

In another preferred example, the method for detecting the level of the marker further includes feature gene quantitative PCR, qPCR, real-time quantitative PCR, metagenomic analysis, 16s RNA sequencing, mass spectrometry, and Western blot.

In another preferred embodiment, the reagent combination is

A first detection reagent for detecting the level (M) of Moraxella osloensis; and/or

A second detection reagent for detecting the level (C) of Propionibacterium acnes;

A fifth aspect of the present invention provides a kit comprising the reagent combination according to the second aspect of the present invention.

In another preferred embodiment, each marker in the combination according to the second aspect of the present invention is used as a standard.

A sixth aspect of the present invention provides a system for performing typing on the skin of an object to be detected and/or determining a skin condition of an object to be detected, the system comprising:

(a) a feature receiving module for receiving skin sample feature data, wherein the feature data includes quantitative information of Moraxella ausloensis (M) and Propionibacterium acnes (C) in the skin sample;

(b) calculating feature data from the feature receiving module to obtain a ratio of each feature or a ratio relationship between features; a calculation processing module for obtaining a skin typing and/or skin state determination result by comparing the acquired ratios or ratio relationships between respective features with reference values for skin typing or feature characterization; and

(c) a result output module for receiving and outputting a judgment result;

In another preferred embodiment, the subject is a human.

In another preferred embodiment, the subject is an Asian population.

In another preferred embodiment, the subjects include males and females.

In another preferred embodiment, the subject includes infants, young children or adults.

In another preferred embodiment, the quantitative information includes Moraxella osloensis (M) and Propionibacterium acnes (C) levels (eg content), respectively.

In another preferred embodiment, the ratio relationship comprises a relative value, for example M/C, of each level (eg content) of Moraxella osloensis (M) and Propionibacterium acnes (C) in the skin sample. do.

In another preferred example, the system can be divided into at least two types for skin conditions.

In another preferred example, the method for acquiring the quantitative information includes sequencing, PCR, and quantitative protein detection.

In another preferred example, the method for acquiring the quantitative information further includes feature gene quantitative PCR, qPCR, real-time quantitative PCR, metagenomics analysis, 16s RNA sequencing, mass spectrum analysis, and Western blot.

In another preferred embodiment, the feature receiving module includes a sample collector and a feature signal input end.

In another preferred example, the calculation processing module includes a processor and a memory, wherein the memory stores skin type and/or skin condition threshold information.

In another preferred example, the output module includes any terminal, preferably a monitor, printer, tablet computer (PAD), or smart phone.

In another preferred example, each module is connected in a wired or wireless manner.

A seventh aspect of the present invention provides a method for screening a substance or component that improves skin conditions,

(a) providing selected bacteria (mixed bacteria) that are Moraxella osloensis (M), Propionibacterium acnes (C), or contain Moraxella osloensis and/or Propionibacterium acnes;

(b) the material or component to be selected is co-cultured with the selected bacteria, and each level (eg content) of Moraxella ausloensis or Propionibacterium acnes; or detecting the relative level (eg relative content) (M/C) between Moraxella osloensis and Propionibacterium acnes; and

(c) the level (eg content) of Moraxella osloensis or Propionibacterium acnes, respectively, after culturing in step (b); Or judging that the material or ingredient to be screened is a material or ingredient that improves skin condition according to the relative level (eg relative content) (M/C) between Moraxella osloensis and Propionibacterium acnes includes;

In another preferred example, if the content of Moraxella osloensis or the relative level (eg relative content) (M/C) between Moraxella osloensis and Propionibacterium acnes is improved, the substance or component to be screened is Indicates that it is a substance used to treat acne.

In another preferred example, when the level (eg content) of Moraxella osloensis is reduced or the relative level (eg relative content) between Moraxella osloensis and Propionibacterium acnes (M/C) is reduced , Indicates that the substance or component to be screened is a skin aging prevention substance.

In another preferred embodiment, the level (eg content) of Propionibacterium acnes is improved or the relative level (eg relative content) between Propionibacterium acnes and Moraxella ausloensis (C/M) is improved. If it is improved, it indicates that the substance or ingredient to be screened is a skin anti-aging substance.

In another preferred embodiment, the level (eg content) of Propionibacterium acnes is reduced or the relative level (eg relative content) between Propionibacterium acnes and Moraxella ausloensis (C/M) is If it is reduced, it indicates that the substance or ingredient to be screened is a substance used to treat acne.

In an eighth aspect of the present invention, (a) skin typing; and/or (b) use of the marker combination according to the second aspect of the present invention or the reagent combination according to the fourth aspect of the present invention for preparing a kit for use in determining or characterizing a skin condition.

A ninth aspect of the present invention provides the use of the marker combination according to the second aspect of the present invention or the reagent combination according to the fourth aspect of the present invention for screening a substance or component that improves skin conditions.

It should be understood that within the scope of the present invention, each of the above technical features of the present invention and each of the technical features specifically described below (eg, in the examples) may be combined with each other, thereby forming a new or desirable technical solution. do. Due to the limitation of the width, we will not repeat them one by one here.

The present invention aims to help the industry develop skin care products and pharmaceuticals better suited to specific populations for different skin types by typing populations based on skin microbiome characteristics. It is used for skin typing and provides a new method of determining skin conditions, thereby providing a new means of diagnosis and typing.

1 shows a schematic diagram of a sampling skin site.
Figure 2 shows the microbial composition of the facial skin of a Han Chinese population.
Figure 3 shows the optimal cluster number analysis of different sites.
A and B of FIG. 4 show the forehead cluster results, where the box plots represent the average distance between samples in the two groups, respectively, and the red line represents the average distance between samples in different groups. A in FIG. 4 is the Jensen-Shannon divergence, and B in FIG. 4 is the Bray-Curtis dissimilarity.
4C and D show the relative levels of Propionibacterium acnes or Moraxella ausloensis in the forehead, and each dot represents one sample.
4E and F show the cluster results of balls, where the box plots represent the average distance between samples in two groups, respectively, and the red line represents the average distance between samples in different groups. E in FIG. 4 is the Jensen-Shannon divergence, and F in FIG. 4 is the Bray-Curtis dissimilarity.
Figure 4G, H shows the relative levels of Propionibacterium acnes or Moraxella ausloensis in the ball, and each dot represents one sample.
I and J of FIG. 4 show the cluster results of the bridge of the nose, where the box plots represent the average distance between samples in two groups, respectively, and the red line represents the average distance between samples in different groups. I in FIG. 4 is the Jensen-Shannon divergence, and J in FIG. 4 is the Bray-Curtis dissimilarity.
K and L in Fig. 4 show the relative levels of Propionibacterium acnes or Moraxella ausloensis on the bridge of the nose, and each dot represents one sample.
Figure 5 shows the differential microbes between the different skin types, with colors indicating relative levels of microbes, each row a sample and each row a microbe.
Figure 6 shows the characteristics of the microbial network of different skin types, the M-cutotype enriched microorganisms on the left and the C-cutotype enriched microorganisms on the right. Each dot represents one species and each colored bouquet represents one species. As can be seen from the figure, the enriched microorganisms within the skin types exhibit positive correlations with each other, and the enriched microorganisms of different skin types exhibit negative correlations, and different skin types exhibit different microbial network configurations.
Figure 7 shows the difference in functional enrichment of skin microbial genes of different skin types.
8 shows phenotypic differences between different skin types.
Figure 9 shows a correlation analysis between Moraxella osloensis and age and skin phenotype, with a corrected P-value less than 0.05.
10 shows that the aceA/aceB genes are enriched in the M-Cutotype.
11 shows that the beta-carotene synthesis pathway is enriched in M-Cutotype.
Figure 12 depicts functional enrichment analysis of RNAseq differentially expressed genes of human keratinocytes HaCaT treated with Moraxella osloensis supernatant and blank control.
Figure 13 shows the use of Moraxella ausloensis for various water-soluble carbon source compounds. The figure on the left is measured by CCK-8 kit and the figure on the right is measured by Dye mix A.
14 shows skin type verification results using Singapore Chinese skin metagenome data.
15 shows skin type verification results using skin metagenome data from the Philippines and Italy.
Figure 16 depicts a heatmap of the correlation between species level and host phenotype of three skin commensals.
Figure 17 shows Moraxella osloensis - HaCaT -QPCR results.
Figure 18 shows the results of Propionibacterium acnes - HaCaT -QPCR.
Figure 19 shows the results of Staphylococcus epidermidis - HaCaT -QPCR.

After extensive and deep research, the present inventors first discovered that Moraxella osloensis can be used for characterization of skin conditions or for skin typing, and the present invention also found a new marker combination: Moraxella osloensis and Propionibacterium acnes. first discovered. The marker combination of the present invention can be used for (a) skin typing; and/or (b) it can be used for skin condition determination, has the advantages of high sensitivity and high specificity, and has important application values. On this basis, the inventors completed the present invention.

Terms

Terms used herein have meanings commonly understood by those skilled in the art. However, in order to better understand the present invention, some definitions and interpretations of related terms are as follows.

According to the present invention, the term “marker combination” means a combination of two or more markers.

According to the present invention, the level of the marker substance is determined by the ratio of the presence content and/or expression level of two types of microorganisms.

According to the present invention, the term "subject" means an animal, in particular a mammal such as a primate, preferably a human.

In accordance with the present invention, terms such as "a", "an" and "this" mean singular entities as well as include general categories that may be used to describe a particular embodiment.

As used herein, when referring to a specifically recited value, the term "about" means that the value may vary from the recited value by no more than 1%. For example, as used herein, the expression “about 100” includes all values between 99 and 101 (eg, 99.1, 99.2, 99.3, 99.4, etc.).

As used herein, the terms "include" or "include" can be open, semi-closed and closed. In other words, the term also includes “consisting essentially of” or “consisting of”.

It should be noted that the interpretation of terms provided herein is intended to enable those skilled in the art to better understand the present invention and not to limit the present invention.

Moraxella Osloensis, Moraxella Osloensis, M.osloensis, hereinafter abbreviated as M.

Moraxella ausloensis, genus Moraxella, bacillus, gram-negative, chemoorganotrophic bacteria. Carbohydrates cannot be used to create acids.

Propionibacterium acnes, Cutibacterium acnes, C. acnes, hereinafter abbreviated as C bacteria

Propionibacterium acnes, Actinomycetes Actinomycetes Class Actinomycetes Propionibacteriaceae Propionibacterium, a kind of gram-negative bacillus. It is an important colony of human skin, participates in maintaining skin health and can also be used as a pathogen of common acne.

Staphylococcus epidermidis, Staphylococcus epidermidis, S. epidermidis

It is a gram-positive cocci that reproduces in the epidermis of organisms, and is present in human skin, vagina, etc., and is often called epidermal staphylococcus because it is piled up in bunches.

skin typing

In the present invention, the skin can be further divided into M-Cutotype type (abbreviated as M type), mixed type, and C-Cutotype type (abbreviated as C type).

C-Cutotype

As used herein, the terms “C-Cutotype” and “C type” may be used interchangeably and are a type of microbial-based skin typing that accumulates high levels of Propionibacterium acnes (C. acnes). characterized by

M-Cutotype

As used herein, the terms “M-Cutotype” and “M-type” may be used interchangeably and are a type of microbial-based skin typing characterized by high levels of M. osloensis accumulation. to be

skin elasticity

As used herein, skin elasticity is determined by, but not limited to, whether or not the content of skin moisture, collagen, elastin, and natural fat is satisfied.

skin color

As used herein, skin color is determined by, but is not limited to, skin radiance, skin color, yellowness value, and the like.

degree of skin aging

As used herein, skin aging is determined by, but is not limited to, phenomena such as increased skin porphyrins, decreased skin moisture content and radiance, increased pore size and area, skin maintenance imbalance, and dull skin.

detection method

Using a collector such as a sterile cotton swab, soak it in the bacteria collection solution and repeatedly rub the bacteria collection site to obtain a microbial sample. It is possible to characterize and examine the level (for example, content) of M bacteria or C bacteria by means of general molecular biology, and for example, the M / C ratio can be obtained by the following method. 1. 16sRNA sequencing; 2. Metagenome sequencing; 3. Primers can be designed for two characteristic sequences and then the M/C ratio can be obtained using qPCR; 4. The quantitative purpose is achieved by detecting the specific expression proteins or metabolites of the two strains by methods such as mass spectrometry and Western blotting.

kit

In the present invention, the kit of the present invention includes the combination according to the second aspect of the present invention and/or the reagent combination according to the fourth aspect of the present invention.

In another preferred embodiment, each marker in the combination according to the first aspect of the present invention is used as a standard.

The main advantages of the present invention include:

(1) The present invention uses Moraxella osloensis and Propionibacterium acnes as a marker combination for (a) skin typing; and/or (b) it is used to determine skin conditions such as moisture content, skin elasticity, and/or degree of aging, and has advantages of high sensitivity and high specificity, and has important application values.

(2) The present invention, for the first time, as a marker combination of Moraxella osloensis and Propionibacterium acnes in an Asian population (a) classifies skin typing into M-Cutotype, mixed and/or C-Cutotype; and/or (b) determining a skin condition.

(3) The present invention is the first to discover a new classification method that is different from the classification basis based on the existing physiological drive of the host (oily skin, dry skin, wet skin), and the new classification method uses skin microorganisms as the classification standard for three different Identify skin types with characteristics. Analysis of these three skin types suggests that nutritional differences in host physiology may be a driving force behind the different skin types. In addition, the microbiome populations contained in different skin types can respond to the host skin by exerting specific functions and have a certain influence on skin health and skin appearance. Therefore, further research on skin type may help develop personalized medicine to better maintain skin health.

(4) In the present invention, M bacteria is correlated with skin phenotype, shows a positive correlation with age, and is correlated with some skin aging phenotypes. For example, as the level of M bacteria increases, skin retention decreases and moisture content decreases. the gloss is reduced and the yellowness value (dull skin) is increased; Some of the typical features of acne are correlated, for example, as M bacteria increases, retention decreases, porphyrins (mostly metabolites of C bacteria, which promote inflammation) are reduced, and pore area decreases.

(5) The present invention found for the first time that M-type skin can be adjusted to C-type skin by improving the relative level (eg content) of Propionibacterium acnes and can be used for preventing skin aging.

(6) The present invention found for the first time that C-type skin can be adjusted to M-type skin by improving the relative level (eg content) of Moraxella osloensis and can be used for acne treatment.

(7) The present invention performs a correlation analysis on single bacteria and skin phenotypes to explore whether skin microorganisms can cause changes in host skin phenotypes, thereby providing a new perspective and a new angle in the study of the interaction between microorganisms and the host. was first discovered to provide

(8) The present invention was the first to discover that the host epidermal cells were treated with bacterial supernatant, and the interactive relationship between bacteria and the host was explored at the molecular level without being limited to correlation studies.

The present invention is further described by combining the specific examples below. It should be understood that these examples are for illustrative purposes only and do not limit the scope of the present invention. Experimental methods under specific conditions not indicated in the examples below generally follow general conditions or conditions recommended by manufacturers. Unless otherwise stated, percentages and copies are calculated by weight.

Unless otherwise specified, reagents and materials used in the examples of the present invention are all commercially available products.

normal way

1. Correlation analysis:

1) Skin microbial sample collection and metagenome sequencing

Residents of Shanghai were recruited as volunteers for this study. All volunteers participating in this study were examined by a dermatologist at Shanghai Dermatology Hospital to rule out skin lesions such as dermatitis, eczema, acne, psoriasis, infection, etc., and to confirm that they had not had any skin diseases in the past 6 months. Volunteers who received antibiotic treatment were excluded. Finally, 294 healthy subjects between the ages of 20 and 65 were recruited, including 46 males (M) and 248 females (F) (Table 1).

Subject Demographic Data age group male female Sum 21-35 16 58 74 36-50 19 112 131 51-65 11 78 89 Sum 46 248 294

Subjects should only wash their face with clean water on the day of sampling and avoid using skin care or cosmetics the day before sampling. The sampling site maintains the room temperature at 20 degrees Celsius and humidity at 50%. The experimenter repeatedly wipes an area of about 4 cm2 in three areas of the subject's forehead (Fh), cheek (Ch), and side of the nose (Ns) 20 times with a special sterile cotton swab dipped in 0.15M NaCl and 0.1% Tween 20 solution. Then, the cotton swab was broken and placed in a 1.5 ml sterile EP tube and stored frozen at -80 ° C to extract skin microbial genomic DNA, and a schematic diagram of the sampling part is shown in FIG. 1 .

After the samples were amplified by the whole genome amplification method, metagenome sequencing was performed to finally obtain sequencing data of 822 facial skin microbial samples. After calculating the relative abundance of each gene with SOAP2 (version 2.21), the sum of the relative abundances of genes from the same species was calculated according to the comparison results of each gene, and this value represents the relative abundance of the species.

2) Measurement of skin phenotype

All phenotypic measurements performed on 294 Han Chinese subjects were performed in an indoor environment with a temperature of 20 °C and a humidity of 50%. Before performing the test, the subject sits and rests for at least 30 minutes to allow blood circulation to return to normal after possible physical activity. The phenotype measurement area coincides with the microbial collection site. Skin sebum content (sebum), stratum corneum moisture content (hydration), transepidermal water loss rate (TEWL), skin pH value, porphyrin, skin color (L*a*b), pigment using the following instruments (Table 2) Phenotypes such as lentigines, pores (pores_area), telangiectasia, and elasticity were measured.

phenotypic instrument Phenotype to measure device sebum Sebumeter® SM815 Ph value Skin-pH-Meter PH 900 stratum corneum water content MositureMeterD Compact device Transepidermal water loss rate Vapometer® Porphyrin, skin color, pigmentation, pores, vasodilation, wrinkles VISIA-CR

3) Correlation analysis between bacterial abundance and skin phenotype

Species levels and sebum content, stratum corneum water content, transepidermal water loss rate, skin pH value, pigmentation, porphyrin, Correlation analysis (Spearman Rank method) for phenotypes such as skin color and pores is performed to evaluate the correlation between the strain level and the phenotype; The FDR test was performed on the P value of the correlation analysis result, and the difference was statistically significant as the P value <0.05 was shown after correction. A correlation heat map was drawn using the R package pheatmap (version 1.0.12) to display the results. blue, negative correlation; red: positive correlation; Spearman correlation significance level: *, p<0.05; **, p<0.01; **, p<0.001.

2. Matrix metalloproteinase (MMP) expression experiments:

1) Preparation of strain supernatant

i. The cryopreserved bacterial solution obtained from the skin was selected and cultured by pulling the plate to the corresponding culture dish by the 3-zone marking method. After a single colony grew on the plate, a single colony was selected and transferred to a corresponding culture dish, respectively, and liquid culture was performed.

ii. After 24 hours of culture, genomic DNA was extracted from the bacterial cultures and 16S rDNA detection was performed, confirming that the three bacterial cultures were still target strains and no bacterial infection situation existed.

iii. Liquid culture was performed on the identified bacteria, and a sterile inoculated pure medium was set as a control.

iv. The absorbance of the 600 nm portion of the cultured bacterial solution detected with a microplate reader was about 0.8.

v. The three bacterial strains were filtered twice with a 0.22 μm filter, and the bacterial cells were removed to retain the bacterial supernatant. The same operation was performed for the pure medium control.

vi. Filtered bacterial supernatants and pure medium supernatants were stored at -80 °C until use.

2) HaCaT cell culture using bacterial supernatant

i.1×10 ⁶ human keratinocytes (HaCaT cells) were cultured. A bacterial liquid supernatant treatment group (experimental group) and a pure medium control group were set, and each group was repeated three times. The culture plate was gently shaken so that the cells were evenly distributed, and then placed in a 37 °C, 5% CO ₂ cell incubator and cultured. Table 3 shows three types of bacteria used in the present invention.

ii. Incubation was continued for 24 hours in the incubator, and the cell culture medium was discarded and washed slightly by adding PBS. Then, trypsin was added to each plate, placed in a cell incubator for 5 minutes to digest, and cells were collected by centrifugation at 800×g for 5 minutes.

Bacterial medium list experimental group control group Moraxella ausloensis Bacterial supernatant: 10% DMEM = 1: 25 R2A Medium: 10% DMEM = 1:25 Propionibacterium acnes Bacterial supernatant: 10% DMEM = 1: 25 RCM Medium: 10% DMEM = 1:25 Staphylococcus epidermis Bacterial supernatant: 10% DMEM = 1: 25 LB Medium: 10% DMEM = 1:25

3) Cellular RNA extraction

i. The collected HaCaT cells or primary fibroblasts were added to Trizol reagent and left at room temperature for 10 minutes.

ii. Chloroform was put into a centrifuge tube, shaken, mixed well, and allowed to stand for 5 minutes.

iii. Centrifuged at 13200 rpm, 4 °C for 10 minutes and the upper aqueous phase (about 200 μL) was aspirated into another mL centrifuge tube.

iv. An equal volume of isopropanol was added, mixed upside down and evenly mixed, and allowed to stand at room temperature for 5 minutes.

v. Centrifugation was performed at 13200 rpm, 4° C. for 10 minutes and the supernatant was discarded to observe a white precipitate at the bottom of the tube.

vi. RNA precipitate was suspended at the bottom of the tube by adding 75% ethanol (prepared with absolute ethanol and DEPC water, which can be used immediately, and must be cooled at -20°C before use) and shaken gently.

vii. centrifuged at 13200 rpm, 4° C. for 10 minutes and discarded the supernatant; The above two steps were repeated.

viii. It was separated from air for 2 minutes, and the remaining ethanol was absorbed as much as possible using a pipette, the centrifuge tube was capped, and dried at room temperature for 5 minutes.

ix. After dissolving RNA by adding DEPC water, the purity and concentration of RNA were measured using NanoDrop, and the RNA concentration of each sample was adjusted to 200 ng/μL.

4) cDNA synthesis

i. In this experiment, cDNA was synthesized through reverse transcription PCR using Vazyme's HiScript III RT SuperMix for qPCR (+gDNA wiper) kit.

ii. For reverse transcription, 1 μg of total RNA was taken and the remaining RNA was stored at -80 °C.

iii. Genomic DNA that might be incorporated into the RNA sample was first removed prior to performing reverse transcription. Prepare genomic DNA removal reaction mix (RNA sample:4 × gDNA wiper Mix:RNase-free ddH2O=5:4:7) in an RNase-free 8-strip tube, mix by gently blowing with a pipette, and then add 5 × HiScript qRT Super Mix were mixed at a volume ratio of 0.25 times.

iv. The aforementioned products were placed in a PCR machine at 37 °C for 15 minutes and 85 °C for 5 seconds. The reverse transcription product was immediately used for qPCR reaction or stored at -20 °C.

5) Real-time PCR

i. In this experiment, real-time PCR was performed using QIAGEN's QuantiFast SYBR Green PCR Kit to detect the relative expression level of the gene.

ii. The primers in Table 4 below were prepared at 2 μM with DEPC water, mixed well, and stockpiled.

human primer sequences Primer Name Sequence (5’to 3’) MMP1 -F GGGGCTTTGATGTACCCTAGC (SEQ ID NO. 1) MMP1- R TGTCACACGCTTTTGGGGTTT (SEQ ID NO. 2) MMP10 -F CTCTGGAGTAATGTCACACCTCT (SEQ ID NO.3) MMP10 -R TGTTGGTCCACCTTTCATCTTC (SEQ ID NO.4) MMP12 -F CATGAACCGTGAGGATGTTGA (SEQ ID NO.5) MMP12 -R GCATGGGCTAGGATTCCACC (SEQ ID NO.6) MMP13 -F CCAGACTTCACGATGGCATTG (SEQ ID NO.7) MMP13 -R GGCATCTCCTCCATAATTTGGC (SEQ ID NO.8)

iii. A real-time PCR reaction system was prepared in a 384-well plate and Primers (2 μM): cDNA: SYBR Master Mix (2 ×) = 1:4:5.

iv. The 384-well plate was placed in a centrifuge and centrifuged at 4 °C and 3000 rpm for 3 minutes. Place the 384-well plate in the QuantStudioTM 7 Flex Real-Time PCR System and perform the RT-PCR reaction, and the reaction program is shown in Table 5 below.

Real-time PCR program Step Temperature(℃) Time Cycles One 95.0 4min One 2 95.0 15s 38 2 60.0 36s 38 3 95.0 15s One 3 60.0 15s One 3 95.0 15s One

v. The experimental results were statistically processed using QuantStudioTM Real-Time PCR Software, and the relative expression level of genes in each sample was calculated further according to the 2- ^ΔΔT method, and finally T-test was performed in GraphPad Prism 5.0 software. Methods were used to analyze and graph the experimental results. Significance level: *, p<0.05, **, p<0.01, ***, p<0.001.

Example 1 Construction of the facial skin microbiome of the Han Chinese population

Study Subjects: This study was approved by the Ethics Committee of the College of Life Sciences, Fudan University, and 294 healthy subjects residing in Shanghai were recruited as volunteers for this study. Among them, 46 were male (M) and 248 were female (F). Skin microbes were collected from three regions of the head and face: forehead (Fh), cheek (Ch), and side of the nose (Ns) (see FIG. 1).

Combining bioinformatic analysis with metagenome sequencing tools, we systematically elucidated the composition and functional characteristics of the healthy skin microbiome in a Han Chinese population. Compared to data from American skin microbiome samples from the Human Microbiome Project (HMP), significantly higher relative levels of bacterial-M. osloensis, Moraxella osloensis has a relatively high relative level among Singaporean Chinese, and this species may be one of the characteristic strains of the skin flora of East Asian populations (see Fig. 2).

Example 2 Skin microbiome-based colony typing analysis

The skin microbiome, like the gut microbiome, is influenced by many factors and has marked individual differences. In research, the present invention uses a gut-type method to perform typing on a population based on skin microbiome and explore the driving factors in which typing occurs, thereby finding potential rules behind the skin microbiome and new classification criteria for clinical diagnosis. provides

In the present invention, a total of 247 subjects with no missing skin microbiome data were selected.

Based on the skin microbiome data, skin type assessment was performed on these 247 subjects. First, the three sites were clustered using the PAM method, and the optimal number of clusters was determined by the CH index. Referring to FIG. 3, the results of the CH index show that the most desirable number of clusters in the three regions are two categories because the score of the CH index is highest when the number of clusters is 2.

Based on the results, the present invention performed typing analysis on the samples, classified them into two categories, and performed PCoA analysis on the typing results of the three samples using the JSD distance and the Bray-Curtis distance, respectively. Referring to A to L of FIG. 4, the results can effectively divide the typing results for the samples of the three sites into two categories, and the microorganisms that contribute the most to the classification are Propionibacterium acnes and Moraxella oslo, respectively. ensis, i.e. one enriched for Propionibacterium acnes and the other enriched for Moraxella ausloensis. According to this result, the two cutotypes were named C-Cutotype and M-Cutotype, respectively.

The present invention analyzed the differential population of C-Cutotype and M-Cutotype based on forehead skin microbiome data. Referring to Figure 5, the color represents the relative level (eg relative abundance) of the microbe, each row is a sample and each row is a microbe. As a result of the differential analysis, some microorganisms preferred the specified skin type more due to the mutual influence between the bacterial groups. For example, C-Cutotype is enriched with Propionibacterium avidum, Propionibacterium granulosum, Staphylococcus aureus, Propionibacterium acnes phage and Staphylococcus aureus phage. Moraxella bovoculi and Psychrobacter sp. are concentrated in M-Cutotype.

In the present invention, correlation analysis is performed based on the relative level of differential flora and presented in the form of a network diagram. Referring to FIG. 6 , the results show that there is a strong positive correlation between microorganisms enriched for the same skin type and a strong negative correlation between microorganisms enriched for different skin types. These analyzes suggest that microorganisms of the same skin type possibly occupy different ecological niches, form stable ecological networks among each other, and develop robust microbial communities to resist new colonization by other microorganisms, including opportunistic and potentially pathogenic microorganisms. was built.

Based on these 247 people and a total of 741 samples, as shown in Table 6, skin type typing is provided according to the ratio (M/C) of the level (eg content) of M bacteria to C bacteria.

type C mixed type M type cheek ≤ 0.75 0.75< M/C <1.68 ≥ 1.68 forehead ≤ 1.24 1.24< M/C <2.18 ≥ 2.18 ridge of the nose ≤ 0.34 0.34< M/C <0.55 ≥ 0.55

Depending on the source site of microorganisms, the reference value for specific typing is also different, and the skin typing sampling principle in clinical application is a facial skin area to be urgently improved, and typing is performed with reference to abnormal data.

In addition, the full name of C bacteria is Propionibacterium acnes, and its level (eg abundance) and skin acne are closely related. There are very few reports related to M bacteria, and the study of the present invention found for the first time that the correlation between M strain and skin phenotype showed a positive correlation with age and was related to some skin aging phenotypes.

The inventors performed experiments on subjects' skin quality and M/C change, and obtained the results in Table 2, showing that the M/C ratio is related to skin quality. As the level of M bacteria increases, skin retention decreases, water content decreases, gloss decreases, and yellowness value (skin dullness) increases; It has to do with some of the classic features of acne, such as reduced retention as M bacteria increases, porphyrins (mostly C bacteria metabolites, which can promote inflammation), and reduced pore area.

Table 7 lists the correlations of M/C values with related phenotypes, and all listed phenotypes are significantly correlated (p<0.05).

location variable 1 variable 2 correlation coefficient P value Fh (forehead) porphyrin M/C ratio -0.4788 2.30E-16 maintain M/C ratio -0.2592 2.24E-05 water content M/C ratio -0.1782 3.87E-03 shine M/C ratio -0.1585 1.03E-02 pore area M/C ratio -0.1405 2.32E-02 Ck (Ball) porphyrin M/C ratio -0.4103 1.65E-12 water content M/C ratio -0.2876 1.35E-06 maintain M/C ratio -0.2217 2.22E-04 Ns (next to the nose) porphyrin M/C ratio -0.3722 1.35E-10 skin yellowing value M/C ratio 0.1993 8.16E-04 pore size M/C ratio -0.1383 2.09E-02 pore area M/C ratio -0.1320 2.75E-02 maintain M/C ratio No measurement on the side of the nose water content M/C ratio No measurement on the side of the nose

Example 3 Biological Significance of Microbial Skin Types

PCoA analysis of the samples based on gene level (eg abundance) showed that the two skin types could be effectively separated, indicating that functionally there are significant differences between the two skin types. Specifically, the genes of the C-Cutotype are concentrated in the metabolism of carbohydrates and sterols and the synthesis of fatty acids, whereas the microbiome genes of the M-Cutotype are more related to the synthesis of amino acids, aromatic compounds, and some lipids such as inositol. According to previous research reports, Propionibacterium acnes can use carbohydrate compounds as a carbon source, and as a result of enrichment of gene functions, all 17 KEGG functional modules of C-Cutotype were found to be related to the phosphotransferase system (PTS). . In prokaryotes, this system is known to be responsible for the transport and phosphorylation of carbohydrates related to the metabolic capacity of glucose, maltose, lactose, fructose and cellobiose, which may reflect the dependence of the C-Cutotype on carbohydrates as a source of nutrition. can Conversely, previous studies on Moraxella osloensis found that the microorganism cannot utilize any carbohydrates and relies on fatty acids and alcohols as carbon sources. This also explains that the two skin types may constitute a population with two different nutritional requirements.

The skin microenvironment is the growth environment for skin microbes and therefore determines the nutritional substances that microbes can obtain. Therefore, the phenotypic differences between the two skin types were further analyzed to investigate whether the skin phenotype was a factor inducing different skin types. Referring to FIG. 7, as a result, the two skin types showed significant differences in stratum corneum moisture, oil content, and skin color. In contrast, the C-Cutotype has a higher retention, moisture content, while the M-Cutotype's skin is thinner. Since fat is a major source of nutrition for microbes, the above results further suggest that differences in our nutritional requirements are a factor in causing different skin types.

In addition, since the skin phenotypic characteristics of the M-Cutotype are similar to those of the elderly, we compared whether there is a difference in age between the two skin types. Referring to FIG. 8, it is consistent with expectations, and the age of the M-Cutotype group is significantly higher than that of the C-Cutotype, but as a result of further analysis, both the C-Cutotype and the M-Cutotype exist at different ages, that is, the C-Cutotype group is present in the elderly. It has been shown that M-Cutotype exists in young people. Therefore, we speculate that age is not a real determinant and that nutritional requirements are a direct determinant. The difference in age may suggest that the M-Cutotype is older as changes in host physiology during aging may affect the skin phenotype.

Example 4 Correlation between Moraxella osloensis and skin aging phenotype

In this study, the skin flora of 248 healthy female subjects living in Shanghai were collected from three areas: forehead (Fh), cheek (Ch), and side of the nose (Ns), and correlations between Moraxella ausloensis and age and skin phenotypes were investigated. The analysis was performed, the Spearman coefficient was calculated, the P value was corrected by the FDR method, and a corrected P value smaller than 0.05 was used as a selection criterion. Referring to FIG. 9, it was found that the levels of Moraxella ausloensis in the three sites showed a significant positive correlation with age and a significant negative correlation with porphyrin. In addition, it shows a positive correlation with cheek spots, and shows a negative correlation with moisture in the stratum corneum of the cheeks, oil and oil content of the forehead. In addition, Moraxella ausloensis also shows a weak positive correlation trend with other aging phenotypes.

Example 5 Potential Targets of M-Bacterial Skin Aging

We observed gene enrichment for isocitrate lyase (aceA) and malate synthase (aceB) in the skin microbiome in the M-Cutotype. The function of these genes is related to the glyoxylic acid cycle, and some studies have demonstrated that the glyoxylic acid cycle participates in the catalytic metabolism of ethoxy groups, suggesting that skin microbes are responsible for the production of octylphenol polyoxyethylene ethers (OPEs). It provided the basis for participating in the decomposition. Alkylphenols and short polyoxyl metabolites formed by OPE degradation have endocrine disrupting activity. Here, alkylphenol ethoxylates (APEs) have estrogen-like activity and experiments have demonstrated that these compounds can simulate the effects of estradiol both in vivo and in vitro and are referred to as environmental estrogens. Therefore, there is a possibility that skin microorganisms interfere with the production of estradiol, which is important for preventing and treating skin aging (see FIG. 10).

1. Referring to FIG. 11, as a result of gene function difference analysis, M-Cutotype is concentrated in the ß-carotene synthesis pathway, and this result explains that M-Cutotype can synthesize more ß-carotene. And β-carotene is associated with skin yellowing.

2. Keratinocytes were stimulated using the culture medium of M. strain, and the potential senescence-inducing mechanism of M. strain was explored by transcriptomics.

Signaling pathway enrichment analysis of RNA-Seq differentially expressed genes suggests that Moraxella ausloensis may affect skin cells primarily through signaling pathways involving the regulation of collagen synthesis and degradation. Referring to FIG. 12 , RNAseq results suggest that differential genes are enriched in large quantities in biological processes associated with aging phenotypes, such as collagen metabolism and extracellular matrix degradation.

Example 6 Method for controlling the level of Moraxella osloensis

From previous analyses, it is already known that Moraxella osloensis has a certain association with age and skin aging phenotype. In this study, by culturing Moraxella osloensis using a single skin surface compound and testing the number of active bacteria, the usage situation of microorganisms for different skin surface compounds and the toxicity of specific compounds to Moraxella osloensis were reflected. Finally, the purpose of delaying aging can be achieved by regulating the growth of Moraxella osloensis by controlling the amount of a compound favoring Moraxella osloensis or a toxic compound.

Referring to FIG. 13, in this study, the effects of 32 skin surface compounds on the growth of Moraxella osloensis were explored using two methods, CCK-8 and Dye mix A. The compounds are L-lysine, L-glutamine, L-histidine, L-arginine, taurocholic acid, and creatinine, respectively. ), D-glucose, L-lactic acid, glycerin, 2-carboxybenzaldehyde, urea, SDS, L-threonine, L -L-tryptophan, glycine, L-methionine, L-serine, L-glutamic acid, L-phenylalanine, L-cystine (L-cystine), L-tyrosine, L-leucine, L-isoleucine, L-ornithine hydrochloride, L-citrulline -citrulline), L-proline, L-valine, L-alanine, D-aspartic acid, trans-4-hydroxy-L -Proline (trans-4-hydroxy-L-proline), uric acid, and taurine. Here, L-glutamine, L-histidine, L-serine, and L-proline have a significant promoting effect on the growth of Moraxella ausloensis, whereas SDS has a remarkable inhibitory effect.

Example 7 Detection of Populations in Other Countries

In order to verify whether the obtained skin types exist widely, a plurality of public data were downloaded, and the presence of skin types was verified based on skin microbiome data of different races, different sites, and different health conditions.

First, we used skin metagenome data from states and regions (wet type) of Singaporean Chinese, including patients with atopic dermatitis (AD) and healthy individuals. As a result of referring to FIG. 14, the data samples can be effectively divided into two categories, the same as the previous results, one enriched in Propionibacterium acnes and the other enriched in Moraxella osloensis. Results suggest that the presence of skin type is not affected by skin health situation and site.

In addition, concordant results were found using public skin metagenome data of Filipino children (scalp and neck) and Italian psoriasis, and referring to FIG. Cutotype, the other is M-Cutotype.

Overall, the present invention demonstrated that skin types exist in a wide range and are not affected by skin site, race, health status, etc.

Example 8 Skin Condition Typing System

According to the above-described embodiment, a skin condition typing system was developed, and the system includes a feature receiving module, a calculation processing module, and a result output module, and each module is connected through a wired or wireless method, and the typing step thereof is as follows. .

(a) Collecting and detecting a skin microbial sample of the subject's face to further generate skin sample characteristic data. The skin sample characteristic data are the levels of Moraxella osloensis and Propionibacterium acnes, respectively. Here, the collection site is as described in Example 1 and the detection method is as described in the detection method above.

(b) inputting the skin sample feature data into the system from the feature receiving module;

(c) the processing module receives the skin sample feature data from the feature receiving module, calculates a ratio of each of the quantified Moraxella ausloensis and Propionibacterium acnes or a relative ratio between each other, and A judgment result of skin typing and/or skin condition is obtained by comparing with a reference value for skin typing or feature characterization based on the ratio or the relative ratio between them.

(d) The result output module receives and outputs the judgment result, and the output module may be an arbitrary terminal such as a display device, a printer, a tablet computer (PAD), and a smart phone.

The system includes a memory, wherein threshold value information of a reference value is stored in the memory.

Reference values corresponding to the skin typing and/or skin conditions are as follows.

Skin type is type C (or type I): the ratio of the level (eg content) (M) of the Moraxella ausloensis to the level (eg content) (C) of the Propionibacterium acnes ( M/C) satisfies the conditions of M/C≤1.3, relatively preferably M/C≤0.8, more preferably M/C≤0.4, the skin condition of the above phenotype: maintenance, higher moisture content and skin Elasticity is good.

Skin type is type M (type III): the level (eg content) of the Moraxella ausloensis relative to the level (eg content) (C) of the Propionibacterium acnes in the sample (M) If the ratio (M/C) meets the conditions of M/C≥0.5, relatively preferably M/C≥1.8, more preferably M/C≥2.2, the skin condition of the above phenotype: maintenance, moisture content is relatively Decreased skin elasticity and high degree of skin aging.

Skin type is mixed type (or type II): the ratio of the level (eg content) (M) of the Moraxella ausloensis to the level (eg content) (C) of the Propionibacterium acnes (M /C) satisfies the condition of 0.3≤M/C≤2.5, relatively preferably 0.3≤M/C≤2.3, more preferably 0.8≤M/C≤1.8, the skin condition of the phenotype is C and C It is between M.

Example 9 Correlation analysis between bacteria and skin phenotype

Species levels of Moraxella ausloensis, Propionibacterium acnes, and Staphylococcus epidermidis and cortical content, stratum corneum water content, transepidermal water loss rate, skin in three regions of the host face (cheek, forehead, and side of nose) based on R software Correlation analysis was performed on host skin phenotypes such as pH value, pigmentation, porphyrin, skin color, and pores to evaluate the correlation between strain level and phenotype.

Results, referring to FIG. 16, the correlation results between the bacterial abundance and phenotype of the three sites are consistent, that is, Moraxella ausloensis shows a positive correlation with age, dullness and yellowing of skin color, skin moisture content, cortex and a negative correlation with porphyrin content. Propionibacterium acnes and Moraxella ausloensis just showed opposite trends. Staphylococcus epidermidis showed a negative correlation with pigmentation and a positive correlation with epidermal water content. From the above, it can be seen that the three bacteria are related to the aging of the skin in a certain way.

Example 10 Molecular level verification of skin cells by bacterial supernatant treatment

Bacterial supernatants of Moraxella osloensis, Propionibacterium acnes, and Staphylococcus epidermidis were treated with the highest content of cells in the host epidermis - keratinocytes (HaCaT cell line), respectively, and changes in the expression spectrum of cultured cells through QPCR Exploring the situation, I was mainly interested in gene-matrix metalloproteinases (MMPs) involved in collagen degradation and extracellular matrix assembly. In particular, MMPs play a role in degrading extracellular matrix (ECM) proteins and promoting photoaging. Through molecular-level verification, the association between bacteria and host skin phenotypes was explored.

As a result of QPCR, referring to FIGS. 17-19, the expression levels of MMP1, MMP10, MMP12, and MMP13 in HaCaT cells after treatment with Moraxella ausloensis strain supernatant were significantly higher than those in the control group, but Propionibacterium acnes and Staphylococcus epidermidis supernatant There was no significant difference in the expression level of MMPs in HaCaT cells by treatment. This shows that Moraxella osloensis can accelerate host skin aging, and at the same time, it shows that the promotion of skin aging by skin microorganisms is not a general effect, but an effect possessed by a specific strain.

All documents mentioned herein are incorporated herein by reference as if a document were separately incorporated by reference. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and such equivalent forms likewise fall within the scope defined by the claims of the present invention.

<110> FUDAN UNIVERSITY <120> MARKER COMBINATION FOR SKIN TYPING AND USE THEREOF <130> P2021-3154 <150> CN202011444009.3 <151> 2020-12-08 <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 21 <212> DNA <213> <400> 1 ggggctttga tgtaccctag c 21 <210> 2 <211> 21 <212> DNA <213> <400> 2 tgtcacacgc ttttggggtt t 21 <210> 3 <211> 23 <212> DNA <213> <400> 3 ctctggagta atgtcacacc tct 23 <210> 4 <211> 22 <212> DNA <213> <400> 4 tgttggtcca cctttcatct tc 22 <210> 5 <211> 21 <212> DNA <213> <400> 5 catgaaccgt gaggatgttg a 21 <210> 6 <211> 20 <212> DNA <213> <400> 6 gcatgggcta ggattccacc 20 <210> 7 <211> 21 <212> DNA <213> <400> 7 ccagacttca cgatggcatt g 21 <210> 8 <211> 22 <212> DNA <213> <400> 8 ggcatctcct ccataatttg gc 22

Claims (13)

As a use of Moraxella osloensis or a detection reagent thereof,
(a) skin typing; and/or (b) used to determine or characterize skin conditions; or (a) skin typing; and/or (b) use in the preparation of reagents or kits for use in determining or characterizing skin conditions.
According to claim 1,
Wherein the skin condition includes skin age, skin moisture content, skin elasticity, skin color, and degree of skin aging.
As a marker combination,
Wherein the marker combination comprises Moraxella osloensis and Propionibacterium acnes.
According to claim 3,
The marker combinations are (a) Moraxella bovoculi and/or Psychrobacter sp.; and/or (b) further comprising Propionibacterium avidum, Propionibacterium granulosum, Staphylococcus, Propionibacterium acnes phage and/or Staphylococcus phage. A marker combination, characterized in that for.
As a skin typing or skin condition determination method,
The method,
(1) A sample derived from the skin of a subject to be detected is provided to detect the level of each marker among sample marker combinations including Moraxella osloensis and Propionibacterium acnes, and the level of each Moraxella osloensis (M) and obtaining a level (C) of Propionibacterium acnes; and
(2) based on the level (e.g. content) of Moraxella osloensis (M), or by comparing the level of Moraxella osloensis (M) and the level of Propionibacterium acnes (C) in the sample A method comprising the steps of performing typing on the skin of an object to be detected and/or determining a skin condition.
According to claim 5,
In step (2), typing is performed on the skin according to the relative value (e.g. M/C) of the level of Moraxella osloensis (M) and the level of Propionibacterium acnes (C), or the skin of the sample. A method characterized by determining a state.
As a combination of skin typing and/or skin condition detection reagents,
A combination of skin typing and/or skin condition detection reagents, characterized in that the reagent combination includes a reagent for detecting each marker among the combinations according to claim 3.
As a kit,
Characterized in that the kit comprises a reagent combination according to claim 7.
A system for performing typing on the skin of an object to be detected and/or determining the skin condition of an object to be detected,
The system,
(a) a feature receiving module for receiving skin sample feature data, wherein the feature data includes quantitative information of Moraxella ausloensis (M) and Propionibacterium acnes (C) in the skin sample;
(b) calculating feature data from the feature receiving module to obtain a ratio of each feature or a ratio relationship between features; a calculation processing module that obtains skin typing and/or skin state determination results by comparing the acquired ratios or ratio relationships between features with reference values for skin typing or feature characterization; and
(c) a result output module for receiving and outputting the judgment result;
According to claim 9,
The system characterized in that the method of acquiring the quantitative information includes sequencing, PCR, and protein quantitative detection.
As a method for screening a substance or component that improves skin conditions,
(a) providing a selected bacterium that is Moraxella osloensis (M), Propionibacterium acnes (C), or comprises Moraxella osloensis and/or Propionibacterium acnes;
(b) the material or component to be screened was co-cultured with the selected bacteria, and the levels of Moraxella ausloensis or Propionibacterium acnes, respectively; or detecting the relative level (M/C) between Moraxella osloensis and Propionibacterium acnes; and
(c) the level of Moraxella ausloensis or Propionibacterium acnes, respectively, after culturing in step (b); or determining that the material or ingredient to be screened is a material or ingredient that improves skin condition according to the relative level (M/C) between Moraxella osloensis and Propionibacterium acnes; A method for screening substances or ingredients that improve skin conditions.
According to claim 11,
In step (c), the level of Moraxella osloensis is improved, or the relative level (M/C) between Moraxella osloensis and Propionibacterium acnes is improved, or the level of Propionibacterium acnes is increased. reduced, or if the relative level (C/M) between Propionibacterium acnes and Moraxella ausloensis is reduced, then the substance or ingredient to be screened for is a substance used to treat acne; and/or in step (c) the level of Moraxella osloensis is reduced, or the relative level (M/C) between Moraxella osloensis and Propionibacterium acnes is reduced, or Propionibacterium acnes When the level of or the relative level (C / M) between Propionibacterium acnes and Moraxella ausloensis is improved, the substance or component to be screened is a skin anti-aging substance.
As a use of the marker combination according to claim 3 or the reagent combination according to claim 7,
(a) used in skin typing, and/or manufacturing kits for use in determining or characterizing skin conditions; and/or (b) for screening substances or ingredients that improve skin conditions.