KR20230115797A - Pharmaceutical composition for cancer treatment or suppression of metastasis comprising antibody specifically binding to SH3 domain of βPix - Google Patents

Abstract

The present invention relates to a novel use of an antibody that specifically binds to the SH3 domain of βPix, and more particularly, to an epitope within the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36 It relates to a pharmaceutical composition for cancer treatment or cancer metastasis inhibition comprising an antibody or functional fragment thereof that specifically binds to as an active ingredient. Antibodies that specifically bind to the SH3 domain of βPix provided in the present invention can regulate the growth, migration and invasion of colon cancer or breast cancer cells, and thus can be usefully used in the prevention and treatment of colon cancer or breast cancer. It is expected that there will be

Description

Pharmaceutical composition for cancer treatment or suppression of metastasis comprising an antibody specifically binding to SH3 domain of βPix {Pharmaceutical composition for cancer treatment or suppression of metastasis comprising antibody specifically binding to SH3 domain of βPix}

The present invention relates to a novel use of an antibody that specifically binds to the SH3 domain of βPix, and more particularly, to an epitope within the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36 It relates to a pharmaceutical composition for cancer treatment or cancer metastasis inhibition comprising an antibody or functional fragment thereof that specifically binds to as an active ingredient.

Cancer is divided into benign tumors and malignant tumors. Benign tumors have a relatively slow growth rate and do not metastasis from the original site of the tumor to other tissues, whereas malignant tumors do not. Tumors are life-threatening and a very important cause of death by leaving their original site of origin and infiltrating into other tissues and having a characteristic of rapid growth.

In the treatment of solid cancer such as colorectal cancer, conventional first-generation chemotherapy drugs have a treatment mechanism that attacks rapidly dividing cancer cells. According to this treatment mechanism, cells that divide normally and rapidly, such as intestinal epithelial cells, are also attacked, resulting in diarrhea. It causes serious side effects such as vomiting and vomiting, and long-term use causes resistance to anticancer drugs, making it difficult to treat cancer.

In order to overcome the side effects of such existing anticancer agents, there is a demand for the development of a target anticancer agent that selectively selects and attacks only cancer cells.

On the other hand, studies on the relationship between colorectal cancer and breast cancer and βPix gene have been reported, but no study has been reported on the mechanism for regulating cancer metastasis activity of βPix protein. Although it is used to detect βPix in methods such as immunofluorescence, enzyme immunoassay, etc., its use as an antibody therapeutic targeting βPix has not been reported.

Accordingly, the present inventors viewed βPix as a key factor inducing metastatic activity of colorectal cancer and breast cancer, and while studying cancer treatment and metastasis inhibitory effects by inhibiting βPix, using an antibody that specifically binds to the SH3 domain of βPix, βPix and The present invention was completed by confirming that growth, migration, and invasion of colon cancer or breast cancer cells could be inhibited by interfering with Dyn2 interaction.

Republic of Korea Patent No. 10-1834485

An object of the present invention is to treat cancer or cancer, comprising as an active ingredient an antibody or functional fragment thereof that specifically binds to an epitope in the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36 It is to provide a pharmaceutical composition for metastasis inhibition.

Another object of the present invention is to provide a screening method for a candidate substance for cancer treatment or cancer metastasis inhibition.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned can be clearly understood by those skilled in the art from the description below. There will be.

In order to achieve the object of the present invention as described above, the present invention is an antibody or functional fragment thereof that specifically binds to an epitope in the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36 It provides a pharmaceutical composition for cancer treatment or cancer metastasis inhibition comprising as an active ingredient.

In one embodiment of the present invention, the antibody or functional fragment thereof may inhibit the activity of βPix, but is not limited thereto.

In another embodiment of the present invention, the antibody or functional fragment thereof may inhibit the binding of βPix protein and Dyn2 (Dynamin 2) protein, but is not limited thereto.

In another embodiment of the present invention, the cancer may be any one or more selected from the group consisting of colorectal cancer and breast cancer, but is not limited thereto.

In addition, the present invention provides a method for screening a candidate substance for cancer treatment or cancer metastasis inhibition, comprising the following steps:

(S1) treating a test substance with a test substance in vitro ;

(S2) measuring the degree of binding between βPix and Dyn2 (Dynamin 2) of the test subject; and

(S3) selecting a test substance having a reduced degree of binding between βPix and Dyn2 compared to the test substance untreated group as a candidate substance for cancer treatment or metastasis inhibition.

In one embodiment of the present invention, the subject may be isolated from at least one selected from the group consisting of colon cancer and breast cancer, but is not limited thereto.

In addition, the present invention requires an antibody or a functional fragment thereof that specifically binds to an epitope in the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36 as an active ingredient, It provides a method for cancer treatment or cancer metastasis suppression comprising the step of administering to a subject to be treated.

In addition, the present invention is an antibody or functional fragment thereof that specifically binds to an epitope in the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36, or a composition containing as an active ingredient cancer treatment or A use for inhibiting cancer metastasis is provided.

In addition, the present invention is an antibody or a functional fragment thereof that specifically binds to an epitope in the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36, or a drug for cancer treatment or cancer metastasis inhibition provides a use for

The antibody specifically binding to the SH3 domain of βPix according to the present invention specifically binds to βPix, which is remarkably overexpressed in colorectal cancer or breast cancer, thereby inhibiting the activity of βPix and inhibiting the interaction between βPix and Dyn2. As it was confirmed that the growth, migration, and invasion of colon cancer or breast cancer cells were inhibited, and the metastasis activity was inhibited, the antibody that specifically binds to the SH3 domain of βPix can be used as a drug for treatment or metastasis inhibition of colon cancer or breast cancer cells. expected to be developed. In addition, the present invention is expected to be used as a screening method for a drug for the treatment of colorectal cancer or breast cancer or a metastasis inhibitor.

Figure 1a is a view showing the results of confirming paxillin-GFP expression using a time-lapse video microscope after EGF stimulation in colorectal cancer cells deficient in βPix expression (arrows indicate dynamic FA and static FA, respectively, scale bar = 10 μm).
Figure 1b is a diagram showing the results of confirming the FA assembly rate (left) and disassembly rate (right) after EGF stimulation in colorectal cancer cells deficient in βPix expression.
Figure 1c is a view showing the results of confirming the total number of FAs per cell (left) and the number of FAs of 1 μm ² or less (right) after EGF stimulation in colorectal cancer cells deficient in βPix expression.
1d is a diagram showing a DIC kymograph of the membrane edge after EGF stimulation in colorectal cancer cells lacking βPix expression.
Figure 1e shows the result of confirming the lamellipodia marker cortactin using immunostaining in colorectal cancer cells deficient in βPix expression after EGF stimulation (left, scale bar = 20 μm) and lamellipodia structure (cortactin-positive structure). ) It is a diagram showing the percentage of cells having (right).
Figure 1f shows the immunofluorescence results for colorectal cancer cells overexpressing βPix (flag-βPix) (left, yellow line (control) and red line (flag-βPix) represent the length of the membrane protrusion, scale bar = 20 μm) and a result of confirming the length of the membrane protrusion (right side).
Figure 1g shows immunofluorescence results for MT1-MMP in colorectal cancer cells deficient in βPix expression after EGF stimulation (left, arrow indicates MT1-MMP localized on the membrane, scale bar = 20 μm) and MT1 at the membrane edge. -This is a diagram showing the result (right) of confirming the fluorescence intensity of MMP.
Figure 2a is a diagram showing the results of performing GST pull-down using purified protein GST-SH3 (left) and immunoprecipitation using anti-βPix antibody (right).
Figure 2b shows the result of double staining of βPix and Dyn2 in colorectal cancer cells (left, upper scale bar = 20 μm, lower scale bar = 5 μm) and fluorescence intensity measured in the direction of the white arrow in the left drawing (right, black arrow) is a diagram showing membrane wrinkles).
Figure 2c is a diagram showing the results of immunoprecipitation analysis of HEK293T cells transfected with βPix-Myc or βPix-SH3 mutant-Myc and Flag-Dyn2 using an anti-Myc antibody.
3a is a diagram schematically showing the domains of βPix and Dyn2 (SH3: Src homology 3, DH: Dbl homology, PH: pleckstrin homology, PRD: proline-rich domain, GBD: GTPase binding domain, CC: coiled-coil region , MID: middle domain, GED: GTPase effector domain, hereinafter the same).
Figure 3b is a view showing the results of confirming the interaction between Dyn2-GFP or Dyn2 R834A-GFP and Flag-βPix by performing immunoprecipitation with an anti-Flag antibody.
Figure 4a is a diagram showing time-lapse images of colorectal cancer cells co-transfected with βPix-RFP and Dyn2-GFP after EGF stimulation (left scale bar = 20 μm, right scale bar = 5 μm, arrow indicates co-expression ( colocalization) and location of membrane folds).
Figure 4b is a view showing the result of Kymograph analysis of the membrane edge of colon cancer cells co-transfected with βPix-RFP and Dyn2-GFP.
Figure 5a is a diagram showing the results of confirming Rac1 activity using GST-PBD pull-down assay in HEK293T cells transfected with Flag-βPix SH3 mutant or DH mutant with/without Dyn2-GFP.
5B is a diagram showing the results of confirming Rac1 activity using GST-PBD pull-down assay in HEK293T cells transfected with Dyn2-GFP or Dyn2-R834A-GFP with or without Flag-βPix.
6 is a result of confirming the level of βPix protein in Dyn2-defective colon cancer cells (left) and a result of confirming the level of Dyn2 protein in βPix-deficient colon cancer cells (right) to confirm whether Dyn2 affects the stability of βPix. is a drawing showing
7 is a view showing the results of confirming the number of invasive cells (left) and the rate of formation of 3D spheres with a diameter of less than 0.1 mm (right) in Dyn2-deficient colon cancer cells.
Figure 8 shows the results of confirming the FA assembly rate and disassembly rate in Dyn2-deficient colon cancer cells after EGF stimulation (a), the total number of FAs per cell and the number of FAs of 1 μm ² or less (b), and cortactin, It is a diagram showing the immunofluorescence results for F-actin and nuclei and the percentage of cells having cortactin-positive structures (c, scale bar = 20 μm).
Figure 9 shows the immunofluorescence results for βPix in Dyn2-defective colorectal cancer cells after EGF stimulation (top, scale bar = 20 μm) and the fluorescence intensity along the yellow line (bottom, the black arrow means the edge of the membrane) is a drawing showing
10a is a view showing immunofluorescence results for MT1-MMP and cortactin in Dyn2-defective colorectal cancer cells after EGF stimulation (scale bar = 20 μm).
Figure 10b is a view showing the results of transwell analysis on GFP-positive invasive cells after overexpressing Dyn2-GFP, Dyn2 R834A mutant, and Dyn2 K44A mutant-GFP in Dyn2-defective colorectal cancer cells (GFP-positive invasive cells Percentages for were calculated by dividing GFP+ cells in the lower chamber by total GFP+ cells).
10c shows the results of Kymography analysis of the leading edge of Dyn2-defective colorectal cancer cells expressing LifeAct-RFP using GFP or βPix-GFP after stimulation with EGF (top, scale bar = 20 μm) and Dyn2-defective colorectal cancer It is a diagram showing the results of transwell analysis (bottom) for RFP-positive invasive cells in cells.
11a shows the result of immunoprecipitation of HEK293T cell lysates incubated in poly-L-lysine or fibronectin-coated culture conditions with an anti-βPix-GBD antibody (left, NRS: normal rabbit serum, PLL: poly-L-lysine). , FN: fibronectin, hereinafter the same) and immunofluorescence results for vinculin and F-actin (right, scale bar = 20 μm).
11B is a diagram showing the result of immunoprecipitation after treatment with PP2 in HEK293T cells transfected with Flag-Dyn2 and βPix-Myc.
11C is a diagram showing the result of immunoprecipitation using an anti-Flag antibody in HEK293T cells transfected with Flag-βPix and Dyn2-GFP (CA: constitutively active Src, DN: dominant-negative Src, hereinafter the same).
12a is a diagram showing the results of immunoblotting for Flag and p-Tyr (phospho-tyrosine) after immunoprecipitation of HEK293T cells transfected with Flag-βPix or Flag-βPix Y442F with an anti-Flag antibody.
12B is a diagram showing the result of immunoprecipitation using an anti-Flag antibody in HEK293T cells transfected with Flag-βPix or Flag-βPix Y442F and Dyn2-GFP.
12c is a view showing the results of immunofluorescence with Flag-βPix or Flag-βPix Y442F for endogenous Dyn2 in colon cancer cells after EGF stimulation (scale bar = 20 μm).
Figure 12d is a diagram showing the results of measurement using Pearson's coefficient to quantify the colocalization of Dyn2 and Flag-βPix wild type or Y442F.
12e is a diagram showing the results of immunofluorescence for endogenous Dyn2 and Flag-βPix Y442E in colon cancer cells after EGF stimulation (scale bar = 20 μm).
13 confirms whether colon cancer cell invasiveness is affected by phosphorylation of βPix Y442, Western blotting results for βPix-deficient colon cancer cells overexpressing Flag-βPix wild-type, Y442F, or Y442E (left), transwell It is a drawing showing the analysis result (middle) and the result of confirming the number of invasive cells (right) (F: Y442F, E: Y442E, hereinafter the same).
Figure 14a confirms whether the AuNP-SH3 conjugate can target βPix to inhibit cell invasion, schematically showing the AuNP-SH3 conjugate (upper left), and fluorescence imaging of AuNP-SH3-treated colon cancer cells. Figures shown (bottom left, green: AuNP-antibody conjugate, blue: nuclei, arrows indicate endogenous βPix signals, scale bar = 5 μm), and transwell analysis of AuNP-IgG or AuNP-SH3 treated colon cancer cells It is a drawing showing the result (upper right) and the result of confirming the number of invasive cells (lower right).
14b shows immunoprecipitation results using protein A/G agarose beads (left) and immunoprecipitation results using anti-βPix-GBD antibody in colorectal cancer cells expressing Flag-Dyn2 treated with AuNP-IgG or AuNP-SH3 (left). right) is shown.
Figure 14c is a diagram showing βPix-GFP expressing colon cancer cells with AuNP-IgG or AuNP-SH3 after EGF stimulation (Scale bar = 20 μm, dotted line means cells treated with AuNP-antibody conjugate, magnified image (magnification, scale bar=5 μm) indicates membrane localization of βPix-GFP).
14d is a time-lapse image of the membrane edge of Dyn2-GFP colorectal cancer cells treated with AuNP-IgG or AuNP-SH3 after EGF stimulation (arrows indicate localized Dyn2-GFP and membrane wrinkles, scale bar=10 μm).
15A is a diagram showing a correlation plot between βPix and Dyn2 (r is Pearson's correlation coefficient, p is calculated using r).
15b is a diagram showing the distribution of βPix-Dyn2 expression according to the lymph node status of colorectal cancer patients in the TCGA data set.
FIG. 15c is a diagram showing the results of Kaplan-Meier analysis on the overall survival rate of 33 colorectal cancer patients with high Dyn2 expression levels among βPix overexpression patients.
16 is a view showing the result of confirming the expression of βPix in breast cancer patients (a) and the result of confirming the invasiveness of breast cancer cells treated with AuNP-IgG or AuNP-SH3 using transwell analysis (b).
17 is a diagram showing a schematic view briefly showing the mechanism by which anti-βPix antibodies act on colon cancer cells according to an embodiment of the present invention.

The present inventors confirmed that βPix, which is overexpressed in colon cancer or breast cancer, promotes the growth, migration, and invasion of colon cancer or breast cancer cells through binding to Dyn2, and specific to the SH3 (Src homology 3) domain of βPix protein The present invention was completed by confirming that growth, migration, and invasion of colon cancer or breast cancer cells can be inhibited by inhibiting the activity of βPix protein and inhibiting the binding of βPix and Dyn2 using an antibody that binds to .

In one experimental example of the present invention, the present invention confirmed that βPix enhances invasive migration of colorectal cancer cells by promoting actin cytoskeleton remodeling and lamellipodia localization of MT1-MMP (see Experimental Example 1).

In another experimental example of the present invention, the present invention confirmed that βPix binds to the PRD of Dyn2 through the SH3 domain (see Experimental Example 2).

In another experimental example of the present invention, it was confirmed that the βPix-Dyn2 complex induces lamellipodia formation and activates Rac1 by promoting membrane ruffling at the leading edge (see Experimental Example 3). .

In another experimental example of the present invention, it was confirmed that the βPix-Dyn2 complex enhances the formation of lamellipodia and the localization of MT1-MMP in the periphery of the membrane, thereby increasing the invasion ability of cancer cells (see Experimental Example 4).

In another experimental example of the present invention, the present invention confirmed that Src-induced phosphorylation in βPix Y442 promotes cell invasion by promoting the interaction between βPix and Dyn2 (see Experimental Example 5).

In another experimental example of the present invention, it was confirmed that colon cancer cell invasion was inhibited when the interaction between βPix and Dyn2 was disrupted using an antibody targeting the SH3 domain of βPix (see Experimental Example 6). ).

In another experimental example of the present invention, the present invention confirmed that the expression of βPix was up-regulated in breast cancer, and that invasion of breast cancer cells was suppressed when breast cancer cells were treated with an antibody targeting the SH3 domain of βPix ( See Experimental Example 7).

Hereinafter, the present invention will be described in detail.

The present invention is a pharmaceutical composition for treating cancer or inhibiting cancer metastasis, comprising as an active ingredient an antibody that specifically binds to an epitope within the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36 provides

As used herein, the term “anti-βPix antibody” refers to an antibody that specifically binds to an epitope within the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36, and is an anti-βPix antibody. It may also be referred to as βPix-SH3 antibody.

As used herein, the term “βPix” or “βPix protein” is a guanine nucleotide exchange factor that acts as an enzyme that converts inactive forms of Rac and Cdc42 into active forms, and is a focal adhesion site (FA). It is known as one of the main proteins that regulate cell attachment and migration in ), and may be derived from mammals such as humans, monkeys, mice and rats, but preferably contains the amino acid sequence represented by SEQ ID NO: 36 in the SH3 domain it may be

The βPix protein may be, for example, a protein encoded by the nucleotide sequence provided in GenBank Aceession Number NM_001320851.2, or a protein characterized by comprising the amino acid sequence provided in GenBank Aceession Number NP_001307780.1, but is not limited thereto. don't

According to one embodiment of the present invention, the βPix protein binds to the Dyn2 protein to induce F-actin rearrangement, lamellipodia formation, FA (focal adhesion) dynamics, and MT1-MMT Invasion of colon cancer or breast cancer cells can be promoted by promoting localization and inducing invasion of colon cancer or breast cancer cells into surrounding tissues.

The term “antibody” as used herein is also called immunoglobulin (Ig), and is a generic term for proteins that selectively act on antigens and are involved in in vivo immunity. Whole antibodies found in nature usually consist of two pairs of light chains (LC) and heavy chains (HC), which are polypeptides made up of several domains, or two pairs of these HC/LC structure is the basic unit. There are five types of heavy chains constituting mammalian antibodies, represented by the Greek letters α, δ, ε, γ, and μ, and different types of heavy chains, such as IgA, IgD, IgE, IgG, and IgM to form antibodies. There are two types of light chains constituting mammalian antibodies, represented by λ and κ.

The heavy and light chains of antibodies are structurally divided into variable regions and constant regions according to the variability of amino acid sequences. The constant region of the heavy chain is composed of three or four heavy chain constant regions such as CH1, CH2, and CH3 (IgA, IgD, and IgG antibodies) and CH4 (IgE and IgM antibodies) depending on the type of antibody, and the light chain has one constant region. It is composed of phosphorus CL. The heavy chain and light chain variable regions each consist of one domain of a heavy chain variable region (VH) or a light chain variable region (VL). The variable and constant regions of the light chain and the heavy chain are aligned side by side and connected by one covalent disulfide bond, and the heavy chains of the two molecules bonded to the light chain are connected through two covalent disulfide bonds, forming a whole antibody. form A whole antibody specifically binds to an antigen through the variable regions of the heavy and light chains, and since a whole antibody is composed of two pairs of heavy and light chains (HC/LC), a whole antibody molecule contains two variable regions. It has a bivalent single specificity that binds to the same two antigens.

The variable region including the site where the antibody binds to the antigen is subdivided into a framework region (FR) with low sequence variability and a complementary determining region (CDR), which is a hypervariable region with high sequence variability. do. In VH and VL, three CDRs and four FRs are arranged in the order of FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 from the N-terminus to the C-terminus, respectively. It is the site where the CDR with the highest sequence variability within the variable region of the antibody directly binds to the antigen, and is the most important for the antigen specificity of the antibody.

As used herein, the term "epitope" refers to a specific part that determines the antigen-antibody reaction specificity among any target to which an antibody specifically binds. In the present invention, the epitope is within the SH3 domain of the βPix protein, and the specific sequence is not particularly limited as long as it is a contiguous region that (essentially) includes the amino acid sequence of SEQ ID NO: 36, and is usually 13 including the amino acid sequence of SEQ ID NO: 36. to 60, more preferably 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 , 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53 amino acid sequences.

Antibodies or functional fragments thereof of the present invention may be characterized in that they inhibit the activity of βPix protein through specific binding at the epitope and inhibit the binding between βPix protein and Dyn2 protein, but are not limited thereto.

In the present invention, as long as an antibody or functional fragment thereof that specifically binds to an epitope in the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36 or a functional fragment exhibits substantially the same physiological activity The specific sequence is not particularly limited.

The antibody of the present invention is meant to include all of monoclonal (monoclonal) antibodies, polyclonal (polyclonal) antibodies and recombinant antibodies. For the purpose of the present invention, which is intended to treat cancer or inhibit cancer metastasis, it may be preferable to use a monoclonal antibody, which is a group of antibodies having substantially identical amino acid sequences of heavy and light chains of an antibody that can be easily quality controlled as a therapeutic agent. Monoclonal antibodies can be prepared using the hybridoma method, which is well known in the art, or phage antibody library technology.

The antibody of the present invention may be derived from any animal, including mammals including humans, birds, etc., and is preferably derived from humans, or from an animal of a species different from the antibody portion derived from humans. It may be a chimeric antibody comprising portions of one antibody. That is, the present invention includes chimeric antibodies, humanized antibodies, and human antibodies, and preferably human antibodies.

Antibodies of the invention or functional fragments thereof may contain conservative amino acid substitutions (referred to as conservative variants of the antibody), deletions or additions that do not substantially alter their biological activity. In the present invention, "substantially homogeneous physiological activity" means inhibiting the growth, migration, and invasion of colon cancer or breast cancer cells by binding to the SH3 domain of βPix.

The antibody or functional fragment thereof of the present invention may be delivered into cells in a form bound to the surface of gold nanoparticles (AuNP) (AuNP-SH3), but if the antibody or functional fragment thereof can be delivered into cells, it may be used without limitation. there is.

The “gold nanoparticles (AuNP)” refers to gold metal particles having a nanometer diameter, and gold nanoparticles are not only easy to manufacture in the form of stable particles, but also have a variety of uses from 0.8 nm to 200 nm. The size can be changed to fit, and according to an embodiment of the present invention, it may be 15 nm. In addition, gold can modify its structure by combining with various types of molecules, such as peptides, proteins, nucleic acids, etc., and reflects light at various wavelengths, which can be used to easily identify its location in a cell. Furthermore, unlike heavy metals such as manganese, aluminum, cadmium, lead, mercury, cobalt, nickel, and beryllium, gold nanoparticles are harmless to the human body, have high biocompatibility, and have very little cytotoxicity.

As used herein, the term “cancer” refers to aggressive characteristics in which cells divide and grow beyond normal growth limits, invasive characteristics infiltrating surrounding tissues, and cancer cells that spread to other parts of the body. It refers to diseases caused by cells having metastatic characteristics. According to one embodiment of the present invention, the cancer may be colorectal cancer and/or breast cancer, preferably the breast cancer may be triple negative breast cancer, It is not limited thereto, and any cancer in which βPix is specifically expressed higher than normal cells can be applied without limitation.

In the present specification, “active ingredient” means a component that exhibits the desired activity alone or can exhibit the desired activity together with a carrier having no activity itself.

In the present invention, "protein" is used interchangeably with "polypeptide" and refers to a polymer of amino acid residues, eg as commonly found in proteins in nature.

In the present invention, "nucleic acid", "DNA sequence" or "polynucleotide" refers to deoxyribonucleotides or ribonucleotides in single- or double-stranded form. Unless otherwise limited, known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides are also included.

The pharmaceutical composition according to the present invention has an anticancer therapeutic effect together with an antibody or functional fragment thereof that specifically binds to an epitope in the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36 One or more known active ingredients may be further included.

In the present invention, "pharmaceutical composition" means prepared for the purpose of preventing or treating a disease, and may be formulated and used in various forms according to conventional methods. For example, it can be formulated into oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions and syrups, and can be formulated and used in the form of external preparations, suppositories and sterile injection solutions.

The pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions. The excipient may be, for example, one or more selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a moisturizer, a film-coating material, and a controlled release additive.

The pharmaceutical compositions according to the present invention are powders, granules, sustained-release granules, enteric granules, solutions, eye drops, elsilic agents, emulsions, suspensions, spirits, troches, perfumes, and limonadese, respectively, according to conventional methods. , tablets, sustained-release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusate, It can be formulated and used in the form of an external agent such as a warning agent, lotion, pasta agent, spray, inhalant, patch, sterile injection solution, or aerosol, and the external agent is a cream, gel, patch, spray, ointment, warning agent , lotion, liniment, pasta, or cataplasma may have formulations such as the like.

Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, di-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, phosphoric acid as additives for tablets, powders, granules, capsules, pills, and troches according to the present invention Calcium monohydrogen, calcium sulfate, sodium chloride, sodium bicarbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methylcellulose, sodium carboxymethylcellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropylmethyl Excipients such as cellulose (HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose phthalate acetate, carboxymethyl cellulose, calcium carboxymethyl cellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethyl cellulose, sodium methyl cellulose, methyl cellulose, microcrystalline cellulose, dextrin Binders such as hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, purified shellac, starch arc, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl alcohol, and polyvinylpyrrolidone may be used, Hydroxypropyl Methyl Cellulose, Corn Starch, Agar Powder, Methyl Cellulose, Bentonite, Hydroxypropyl Starch, Sodium Carboxymethyl Cellulose, Sodium Alginate, Calcium Carboxymethyl Cellulose, Calcium Citrate, Sodium Lauryl Sulfate, Silicic Anhydride, 1-Hydroxy Propyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde-treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, disintegrants such as amylopectin, pectin, sodium polyphosphate, ethyl cellulose, white sugar, magnesium aluminum silicate, di-sorbitol solution, and light anhydrous silicic acid; Calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopod, kaolin, petrolatum, sodium stearate, cacao butter, sodium salicylate, magnesium salicylate, polyethylene glycol (PEG) 4000, PEG 6000, liquid paraffin, hydrogen Added soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, silicic anhydride, higher fatty acid, higher alcohol, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, Lubricants such as starch, sodium chloride, sodium acetate, sodium oleate, dl-leucine, and light anhydrous silicic acid; may be used.

Additives for the liquid formulation according to the present invention include water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, sucrose monostearate, polyoxyethylene sorbitol fatty acid esters (tween esters), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, and the like may be used.

In the syrup according to the present invention, a solution of white sugar, other sugars, or a sweetener may be used, and aromatics, coloring agents, preservatives, stabilizers, suspending agents, emulsifiers, thickeners, etc. may be used as necessary.

Purified water may be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. may be used as needed.

Suspension agents according to the present invention include acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, HPMC 2910, etc. Agents may be used, and surfactants, preservatives, stabilizers, colorants, and fragrances may be used as needed.

Injections according to the present invention include distilled water for injection, 0.9% sodium chloride injection, IV injection, dextrose injection, dextrose + sodium chloride injection, PEG, lactated IV injection, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; solubilizing agents such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, twins, nijuntinamide, hexamine, and dimethylacetamide; buffers such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, and gums; tonicity agents such as sodium chloride; Stabilizers such as sodium hydrogen sulfite (NaHSO ₃ ) carbon dioxide gas, sodium metabisulfite (Na ₂ S ₂ O ₅ ), sodium sulfite (Na ₂ SO ₃ ), nitrogen gas (N ₂ ), ethylenediaminetetraacetic acid; Sulfating agents such as sodium bisulfide 0.1%, sodium formaldehyde sulfoxylate, thiourea, ethylenediamine disodium tetraacetate, acetone sodium bisulfite; analgesics such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; Suspending agents such as Siemesis sodium, sodium alginate, Tween 80, aluminum monostearate may be included.

The suppository according to the present invention includes cacao butter, lanolin, witapsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lannet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolen (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Buytyrum Tego-G -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxycote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hyde Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Masupol, Masupol-15, Neosupostal-N, Paramound-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), suppository type IV (AB, B, A, BC, BBG, E, BGF, C, D, 299), Supostal (N, Es), Wecobi (W, R, S, M, Fs), testosterone triglyceride base (TG-95, MA, 57) and The same mechanism can be used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient, for example, starch, calcium carbonate, sucrose, etc. ) or by mixing lactose and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. there is. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, activity of the drug, It may be determined according to factors including sensitivity to the drug, administration time, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field.

The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention belongs.

The pharmaceutical composition of the present invention can be administered to a subject by various routes. All modes of administration can be envisaged, eg oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, intrarectal insertion, vaginal It can be administered by intraoral insertion, ocular administration, otic administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, and the like.

The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient together with various related factors such as the disease to be treated, the route of administration, the age, sex, weight and severity of the disease of the patient.

In addition, the present invention requires an antibody or a functional fragment thereof that specifically binds to an epitope in the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36 as an active ingredient, It provides a method for cancer treatment or cancer metastasis suppression comprising the step of administering to a subject to be treated.

In addition, the present invention is an antibody or functional fragment thereof that specifically binds to an epitope in the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36, or a composition containing as an active ingredient cancer treatment or A use for inhibiting cancer metastasis is provided.

In addition, the present invention is an antibody or a functional fragment thereof that specifically binds to an epitope in the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36, or a drug for cancer treatment or cancer metastasis inhibition provides a use for

In the present invention, "individual" means a subject in need of treatment of a disease, and more specifically, a human or non-human primate, mouse, rat, dog, cat, horse, cow, etc. of mammals.

In the present invention, "administration" means providing a given composition of the present invention to a subject by any suitable method.

In the present invention, “prevention” refers to any action that suppresses or delays the onset of a desired disease, and “treatment” means that the desired disease and its resulting metabolic abnormality are improved or improved by administration of the pharmaceutical composition according to the present invention. All actions that are advantageously altered are meant, and "improvement" means any action that reduces a parameter related to a target disease, for example, the severity of a symptom, by administration of the composition according to the present invention.

In addition, the present invention (S1) βPix (Beta-Pix) processing the test substance in the cell line expressing the gene;

(S2) measuring the expression level of βPix gene or βPix protein in the cell line; and

(S3) Provides a method for screening a candidate substance for cancer treatment or cancer metastasis inhibition comprising the step of selecting a test substance in which the expression level of the βPix gene or the expression level of the βPix protein is reduced compared to a control group not treated with the test substance .

In the present invention, the cell line may be any one or more selected from the group consisting of SW480, LoVo, DLD-1, and MDA-MB-231, but is not limited thereto, and any cell line in which the βPix gene is expressed may be included. .

In the screening method, in the step (S2), the expression level of the βPix gene is determined by immunoprecipitation, reverse transcription-polymerase chain reaction, enzyme immunoassay (ELISA), immune cell It can be measured by any one method selected from the group consisting of chemistry (Immunocytochemistry), Western blotting (Western Blotting), and flow cytometry (FACS), but is not limited thereto.

In addition, in the screening method, in the step (S2), the level of expression of the βPix protein is determined by Western blotting, radioimmunoassay, radioimmunodiffusion, enzyme immunoassay, immunoprecipitation, flow cytometry, It can be measured by any one method selected from the group consisting of immunofluorescence, ouchterlony, complement fixation assay, reverse transcription polymerase chain reaction, and protein chip. It may, but is not limited thereto.

In addition, the present invention comprises the steps of (S1) treating a test substance to a test subject in vitro ;

(S2) measuring the degree of binding between βPix (Beta-Pix) and Dyn2 (Dynamin 2) of the test subject; and

(S3) A method for screening a candidate substance for cancer treatment or metastasis inhibition comprising the step of selecting a test substance in which the degree of binding between βPix and Dyn2 is reduced compared to the test substance untreated group as a candidate substance for cancer treatment or metastasis inhibition provides

In the present invention, in the step (S2), the degree of binding of βPix and Dyn2 is determined by polymerase chain reaction (PCR), microarray, northern blotting, Western blotting, It can be measured by any one method selected from the group consisting of enzyme immunoassay (ELISA), immunoprecipitation, immunochemical staining, and immunofluorescence, but is not limited thereto.

In the present invention, the subject is characterized in that it is isolated from at least one selected from the group consisting of colorectal cancer and breast cancer, and the subject is composed of tissues, cells, whole blood, blood, saliva, sputum, cerebrospinal fluid, and urine. It may be one or more selected from the group, but is not limited thereto.

Hereinafter, a preferred embodiment is presented to aid understanding of the present invention. However, the following examples are provided to more easily understand the present invention, and the content of the present invention is not limited by the following examples.

[Example]

Example 1. Clinical Data Mining

The expression profile of ARHGEF7 encoding βPix in colorectal cancer (CRC) patients was obtained from Oncomine (www.oncomine.org) and Gene Expression Omnibus (GEO) (www.ncbi.nlm.nih.gov). /geo) was obtained from the database. Data with p < 0.0001, fold change > 2, and gene rank < 10% were used for transcriptional analysis of Oncomine. Accession numbers GSE20916 and GSE32474 were selected for GEO analysis. Analysis of βPix protein expression in colorectal cancer patients was performed using Human Protein Atlas (www.proteinatlas.org). Additional genetic data sets (GSE29621 and GSE14333) for colorectal cancer were downloaded for overall survival and recurrence-free survival analysis. The distribution of βPix-Dyn2 expression in colorectal cancer patients across stage 3 lymph nodes was analyzed using The Cancer Genome Atlas (TCGA; Pan Cancer Atlas, 2018) from the cBioportal database.

Example 2. Antibodies and reagents

Monoclonal anti-βPix-SH3 and polyclonal anti-βPix-GBD antibodies against purified GST-SH3 (Src homology 3) and GST-GBD (GTPase-binding domain) proteins were produced. In addition, Dyn2 (C-18, #sc-6400; Santa Cruz Biotechnology, Dallas, Texas, USA), E-cadherin (24E10, #3195; Danvers, Massachusetts, USA, Cell Signaling Technology), MT1-MMP (L -15, #sc-12367; Santa Cruz Biotechnology), GAPDH (6C5, #sc-32233; Santa Cruz Biotechnology), Cortactin (H-191; #sc-11408; Santa Cruz Biotechnology), GST (B-14, # sc-138; Santa Cruz Biotechnology), c-Myc (9E10, #sc-40; Santa Cruz Biotechnology), FLAG (M2, #F1804; Sigma-Aldrich, St. Louis, MO, USA), GFP (B-2, #sc-9996; Santa Cruz Biotechnology), Rac1 (#610651; BD Transduction Laboratory, San Jose, CA, USA), and phosphotyrosine (4G10; #05-321; Millipore, Burlington, VT, USA) Antibodies were purchased. In addition, epidermal growth factor (EGF, E9644; Sigma Aldrich), Src kinase inhibitor PP2 (#529573; Calbiochem, La Jolla, California, USA), poly L-lysine hydrobromide (#P6282; Sigma- Aldrich), Fibronectin (#F2006; Sigma-Aldrich), and matrigel (#354234; Corning, New York, USA) were used.

Example 3. Plasmids

Dyn2-GFP was provided by Mark A. McNiven (Mayo Clinic and Foundation, MN, USA). Paxillin cloned into pME18S-FL3 was purchased from Korea Human Gene Bank (KHGB, #KU016281; Daejeon, Korea). Expression vectors include pFlagCMV2 (#E7033; Sigma-Aldrich), pcDNA3.1 myc/His A (#V800-20; Invitrogen, Carlsbad, NM, USA), pEGFP-C1 (#6084-1; CA, USA). Palo Alto, Clontech), and pEGFP-N1 (#6085-1; Clontech) vectors were generated by digestion with restriction enzymes. βPix mutations (i.e., SH3(W43K), DH, Y442F, Y442E), and Dyn2 (R834A and K44A) were prepared using the QuickChange™ Site-Directed Mutagenesis Kit (#200518; Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer's instructions. ) was produced using. The following lentiviral shRNA oligonucleotides were used: human βPix shRNA #1 (SEQ ID NO: 1, 5'-GCAAATGCTCGTACAGTCT-3') and shRNA #2 (SEQ ID NO: 2, 5'-CGACAGGAATGACAATCAC-3'), human βPix shRNA #3 targeting the 3'UTR (untranslated region) region of βPix (SEQ ID NO: 3, 5'-TGCGAATGGAGACGATCAAAC-3'), targeting the 3'UTR of Dyn2 human Dyn2 shRNA #1 (SEQ ID NO: 4, 5'-ATGTAGGGCAGGCCTTCTATA-3'), and shRNA #2 (SEQ ID NO: 5, 5'-CCCGTTGAGAAGAGGCTACAT-3') targeting the coding region of Dyn2. The above shRNA oligos were cloned into the pLKO.1 vector (#10878; Addgene, Cambridge, MA, USA). To overexpress Flag-βPix using a lentiviral system, the pLenti-G418 vector generated by pLenti-puro (#39481; Addgene) was used. All constructs were verified using DNA sequencing.

Example 4. Mammalian cell culture and transfection

LoVo, SW480 and DLD-1 cell lines, which are human colorectal adenocarcinoma, were donated by Eoksu Oh (Ewha Womans University). LoVo cells were maintained in Roswell Park Memorial Institute 1640 medium (RPMI-1640; #31800022; Gibco, Grand Island, Nebraska, USA), and SW480 cells were maintained in Dulbecco's modified Eagle's medium, Nutrient Mixture F-12 (DMEM/F- 12; #12500062; Gibco), DLD-1 cells were treated with 10% heat-inactivated fetal bovine serum (FBS; #US-FBS-500; GW Vitek, Seoul, Korea), 100 units/ml penicillin, and DMEM (#12100046; Gibco) supplemented with 100 μg/ml streptomycin (#LS202-02; WelGENE, Daegu, Korea). HEK293T cells were also maintained in DMEM supplemented with 10% FBS (#US-FBS-500; GW Vitek), 100 units/ml penicillin and 100 ug/ml streptomycin (#LS202-02; WelGENE). The cells were incubated at 37°C in a humidified incubator with 5% CO ₂ . For transient transfection, 1-3 μg of plasmid was transfected into HEK293T cells using calcium phosphate precipitation method. SW480 cells were transfected using Lipofectamine 3000 Reagent (#L3000015; Invitrogen) according to the manufacturer's instructions.

Example 5. Generation of stable cell lines using the lentiviral system

βPix and Dyn2 knockdown SW480 cell lines were generated using a lentiviral system. The shRNA construct was packaged with helper plasmids pMD2.G and psPAX2 (#12259 and #12260; Addgene) co-transfected into HEK293T cells. Lentiviral particles containing shRNA constructs were harvested from HEK293T cells after 72 hours and infected with SW480 cells using 8 μg/ml polybrene. To establish a stable knockdown cell line, cell selection was performed by treatment with 1 μg/ml puromycin (#P8833; Sigma-Aldrich). Defective expression of βPix and Dyn2 was confirmed using Western blotting. The absence of off-target shRNA effects was confirmed using quantitative reverse transcription polymerase chain reaction (RT-qPCR). Overexpression of Flag-βPix in LoVo cells was also performed using a lentiviral system, and cells were selected using 500 μg/ml OmniPur ^® G418 Sulfate (#5.09290; Calbiochem). Overexpression of Flag-βPix was confirmed using Western blotting.

Example 6. RT-qPCR

To isolate total RNA, SW480 cells were lysed using RNAiso Plus reagent (#9109; TaKaRa, Tokyo, Japan) according to the manufacturer's instructions. Briefly, 1 μg RNA was used to synthesize complementary DNA using PrimeScript™ reverse transcriptase (#2680; TaKaRa). qPCR was performed using SYBR Premix Ex Taq II (#RR820; TaKaRa) and QuantStudio 3 (Applied Biosystems, Foster City, CA, USA). Gene expression levels were calculated using the 2 ^-ΔΔCt method and normalized to the Ct value of GAPDH. Primers used for qPCR are shown in Table 1.

gene name Primer F/R Primer sequence (5'→3') PTCH2 F ATGACAGTGGAACTCTTTGGT (SEQ ID NO: 6) R ACTGTGAACTCAACGCCAA (SEQ ID NO: 7) TRADD F GAAATCTGAAGTGCGGCTC (SEQ ID NO: 8) R TGACCCTGGAACAGAAAAGT (SEQ ID NO: 9) CPSF3 F CGTTTACAGCAAGAGGTTGG (SEQ ID NO: 10) R TCCAAGTTAAGGTTGGCAGT (SEQ ID NO: 11) AKAP6 F CAATGCCACTACAAGCAACA (SEQ ID NO: 12) R TCCTGAGAGGAAGGACTTGA (SEQ ID NO: 13) FBXW2 F TGGCCAATTGGGAGAGAAAT (SEQ ID NO: 14) R GGTAGAGACCAAGTGCTGAA (SEQ ID NO: 15) SUV39H2 F AGCTGTGACCCAAATCTTCA (SEQ ID NO: 16) R TCAGCTCTTCTCCAGCATTT (SEQ ID NO: 17) CREG2 F GGTGGCTGATCTGATGAAGA (SEQ ID NO: 18) R TGAGCGTTAACTGGACACAT (SEQ ID NO: 19) NBAS F TGAAGAGAACCGCTACTGTC (SEQ ID NO: 20) R CTTTTCATAGGTGGCCAAGC (SEQ ID NO: 21) LIN7A F CTGCTATCAGTGAAACGGAGT (SEQ ID NO: 22) R GAACTTTTGGGTGTATCGC (SEQ ID NO: 23) PPIL2 F CCTACCTGGACAAGAAGCAT (SEQ ID NO: 24) R TCAGTTTTGGGGTCACTCTC (SEQ ID NO: 25) TBXAS1 F CAGCTTTCAGATTCACACGG (SEQ ID NO: 26) R CCTTTCAGGGTTGAAGGTCT (SEQ ID NO: 27) HOPX F GGTGGAAATCCTGGAGTACA (SEQ ID NO: 28) R GGGTCTCCTCCTCGGAAA (SEQ ID NO: 29) USP28 F TCCCCTGCATTCACCTTATC (SEQ ID NO: 30) R GTAGAAACTCCCCTAGGCAC (SEQ ID NO: 31) ANKFN1 F TAGACTGTCTTCCATCCCCA (SEQ ID NO: 32) R TGGAGTCGTAGTCACTGTTG (SEQ ID NO: 33) MBD2 F TCAGACCCACAACGAATGAA (SEQ ID NO: 34) R CTCCTTGAAGACCTTTGGGT (SEQ ID NO: 35)

Example 7. GST pull-down assay

GST and GST-SH3 proteins were expressed in Escherichia coli BL21 and as previously reported (Mol. Biol. Cell 18, 253-264 (2007) and J. Cell. Biochem. 94, 1010-1016 (2005)). , and purified using Glutathione Sepharose 4B (#17-0756-01; GE Healthcare, Buffalo Grove, IL, USA). HEK293T cells were washed with ice-cold phosphate-buffered saline (PBS) and washed in pull-down buffer (50 mM Tris-Cl, pH 7.4, 100 mM NaCl, 0.5% Triton X-100, 5% glycerol ( glycerol), 5 mM MgCl ₂ , 1 mM DTT, 20 mM NaF, 1 mM aprotinin, 1 mM leupeptin, and 1 mM pepstatin). After centrifugation at 21,000 xg for 15 min at 4 °C, the supernatant was incubated with 5 μg GST or GST-SH3 protein in pull-down buffer for 1 h at 4 °C and combined with 20 μl Glutathione Sepharose 4B. made it After incubation, beads were washed three times with pull-down buffer before Western blotting was performed. For the GST-PBD pull-down assay, GST-PBD purified protein, which is the p21 binding domain of PAK1, was used. HEK293T cells transfected with the indicated vectors were lysed with pull-down buffer and incubated with 5 μg GST-PBD protein for 1 hour at 4 °C followed by incubation with 20 μl Glutathione Sepharose 4B. Active Rac1 was pulled down and visualized using Western blotting with an anti-Rac1 antibody (#610651; BD Transduction Laboratory).

Example 8. Immunoprecipitation (IP)

Within 24-36 hours after transfection, cells were washed with ice-cold PBS and replenished in IP buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 0.5% NP 40, 1 mM EGTA, 1 mM EDTA, 20 mM NaF, 1 mM aprotinin, 1 mM leupeptin, and 1 mM pepstatin). Then, the whole cell lysate was centrifuged at 15,000 rpm for 15 minutes at 4 ° C, and the concentration of the lysate was determined using the Bradford protein assay (#5000006; Bio-Rad, Hercules, CA, USA) . Briefly, 1 mg of the lysate was incubated with the appropriate antibody for 2 hours, followed by incubation with Protein A-Sepharose (#P3391, Millipore) for 1 hour. Immunoprecipitates were washed with IP buffer and analyzed using Western blotting.

Example 9. Western blotting

SW480 cells were lysed with sodium dodecyl sulfate (SDS) lysis buffer (2% SDS, 1 mM Na ₃ VO ₄ , 50 mM NaF, 1 mM DTT, and 1 mM PMSF). Then, the PVDF membrane-transfer protein was incubated with the primary antibody for 12-16 hours at 4°C. Horseradish peroxidase-conjugated secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA, USA) was added for 1-2 hours at 24°C. Protein signals were detected using enhanced chemiluminescence (ECL; # 1705061; Bio-Rad) using a Fusion Solo S imaging system (VILBER, Collegian, France). The band density of the protein was measured using Evolution Capt software (VILBER).

Example 10. Immunocytochemistry

HEK293T cells were seeded on 0.1 mg/ml poly L-lysine and 10 μg/ml fibronectin-coated coverslips and incubated in the medium for 15 minutes. SW480 cells plated on Matrigel-coated coverslips were fixed with 3.7% paraformaldehyde for 15 minutes and permeabilized with 0.5% Triton X-100 in PBS for 10 minutes. To block non-specific signals, the samples were incubated with a blocking solution (2% bovine serum albumin (BSA) and 0.1% Triton X-100 in PBS). Samples were stained with the indicated primary antibodies for 1 hour at room temperature, washed with 0.1% Triton X-100 in PBS, and incubated with fluorescein-conjugated secondary antibodies for 1 hour at room temperature. Coverslips were mounted on slides using Fluoromount-G (#0100-01; Southern Biotechnology Associates, Birmingham, AL, USA). Samples were evaluated using an ECLIPSE 80i fluorescence microscope (Nikon, Tokyo, Japan) and a Zeiss LSM700 confocal microscope (Zeiss, Oberkochen, Germany). Images were captured using a digital camera (DS-Qi2, Nikon) and processed using NIS-Elements image analysis software (Nikon). Pearson's coefficients analysis to quantify protein colocalization was performed using NIS-Elements image analysis software (Nikon).

Example 11. 3D sphere formation assay

SW480 cells (1×10 ⁴ cells) were seeded in 6-well ultralow attachment plates (SPL 3D™ Cell Floater, #39706; SPL Life Sciences, Gyeonggi-do, Korea) and incubated with medium supplemented with 10% FBS. Sphere formation was observed after 7 days, and sphere diameter was measured using NIS-Elements image analysis software (Nikon). For immunocytochemistry, 3D spheres were fixed using 3.7% paraformaldehyde for 15 minutes, and spheroids were placed on adhesive microscope slides (HistoBond ^® microscope slides, #0810001; MARIENFELD, Lauda Königshofen, Germany). After addition, immunocytochemistry was performed.

Example 12. Scratch wound healing migration and Matrigel invasion assays

For the scratch wound healing assay, 2×10 ⁵ LoVo cells were seeded in 10 μg/ml Matrigel-coated 24-well culture plates with medium containing 10% FBS. After incubation for 16 hours, cells were scraped with a sterile 1-ml pipette tip and then incubated for 48 hours in medium containing 10% FBS. For the in vitro invasion assay, 2×10 ⁵ SW480 cells suspended in FBS-free medium were plated into a Transwell (#35224; SPL life Sciences) with 8 μm pore size and 6.5 mm diameter. ) of 10 μg/ml Matrigel-coated upper chamber membrane. Inserts were supplemented with medium containing 20% FBS. LoVo cells (2×10 ⁵ cells) suspended in FBS-free medium were seeded on the upper chamber membrane supplemented with 20% FBS. After incubation for 24 hours, the cells at the bottom of the insert were fixed with methanol and stained with 0.1% crystal violet. Cells (non-infiltrating cells) on the top of the transwell membrane were removed using a cotton swab, and imaged randomly at 10x magnification using an Olympus CKX53 inverted microscope (Olympus, Tokyo, Japan), and the number of infiltrating cells was Counted on images.

Subsequently, the activity of secreted MMP (matrix metalloproteinases) was measured. To this end, 2×10 ⁵ SW480 cells were incubated at 37°C for 16 hours in a 10 μg/ml Matrigel-coated 12-well culture plate with medium containing 10% FBS. After incubation, cells were washed with serum-free medium and incubated in fresh serum-free medium for 24 hours. The conditioned (supernatant) medium was harvested and centrifuged at 200 x g for 3 minutes at 24°C. Then, the supernatant was incubated with 10 μM fluorescent MMP substrate (Mca-PLGL-Dpa-AR-NH2; #ES001; R&D Systems, Minneapolis, MN, USA) at 37° C. for 2 hours. Fluorescent signals of the samples were measured at 320 nm excitation and 405 nm emission using a Synergy HTX Multi-Mode Reader (BioTek, Winooski, VT, USA). Fluorescence signals subtracted from background signals were normalized by the absorbance of cells stained with crystal violet at 550 nm, fixed using 3.7% paraformaldehyde and incubated in 2% SDS.

Example 13. Time-lapse imaging

.To observe lamellipodia formation and focal adhesion dynamics, 7×10 ⁴ SW480 cells were seeded on Matrigel-coated glass bottom plates 24 hours after transfection with the plasmid. Next, cells were serum-starved for 12 hours and stimulated with 100 ng/ml EGF in a 5% CO ₂ chamber at 37°C. Images were captured under the indicated conditions using a Nikon ECLIPSE Ti2 inverted microscope system (Plan Apo λ60X Oil) with a digital camera (DS-Qi2). To investigate the rate of assembly and disassembly of individual FAs, each FA was tracked and intensity measured over time, as previously described (Elife 5, e17440 (2016) and PLoS ONE. 2011;6:e22025). . Paxillin-GFP intensity over time was normalized using the intensity at the first point (intensity at each time point/initial intensity; assembly rate calculation) or last point (initial intensity/intensity at each time point; disassembly rate calculation), then Transformed using a log scale. Assembly and disassembly rates were calculated by fitting log-transformed values to a linear regression model. For cell migration assay, 1×10 ⁵ SW480 cells were plated on Matrigel-coated plates and monitored at 30-minute intervals for 12 hours. Cell motility was analyzed using NIS-Elements image analysis software (Nikon). The mean square displacement (MSD) was calculated using the formula: (r(t)-r(0)) ² =(x(t)-x(0)) ² +(y( t)-y(0)) ² , where r(t) is the position of the single cell at time t and r(0) is the initial position. Single-cell velocity was measured at different time points in the following way:

.

Example 14. Preparation of AuNP (gold nanoparticles) -SH3 antibody complex

AuNPs (diameter: 15 nm) were functionalized with an IgG aptamer (#NES002-01; NES, Seoul, Korea) as previously described (Biochem. Biophys. Res. Commun. 2015;464:392-395) and monoclonal. Bind with anti-βPix-SH3 or normal mouse IgG. AuNP-IgG and AuNP-SH3 conjugates were incubated with βPix-expressing SW480 cells or Dyn2-GFP-expressing SW480 cells on Matrigel-coated glass. Antibody-conjugated AuNPs were visualized using a fluorescein-conjugated secondary antibody. The localization of βPix was evaluated after 4 hours of serum starvation after EGF stimulation for 20 minutes. For time-lapse video imaging, Dyn2-GFP-expressing SW480 cells treated with AuNP-SH3 were monitored for 30 min at 1 min intervals under EGF stimulation.

Example 15. Statistical analysis

Statistical analysis was performed using GraphPad Prism 8.0 (GraphPad Software, San Diego, Calif., USA). A one-way ANOVA was performed to compare two or more groups. Student's unpaired t-test was used to compare the two groups. For all one-way ANOVAs, Tukey's multiple comparison test was used as post hoc test. The one-way ANOVA F value is indicated as F _{(DFn, Dfd)} in the figure (DFn is the df denominator and Dfd is the df denominator). Statistical significance was set at p<0.05 (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Data are expressed as mean ± standard deviation (SD).

[Experimental example]

Experimental Example 1. MT1-MMP (membrane-type 1 matrix metalloproteinase) promotes invasive migration of βPix through lamellipodia localization

βPix is known to regulate membrane dynamics through Rac1 small GTPase-mediated actin rearrangements during cell migration, and therefore, to investigate whether colon cancer cell invasion depends on βPix-mediated processes, we first employed time-lapse video microscopy was used to measure FA dynamics at the leading edge of shMock and βPix silenced SW480 cells. Considering that EGF stimulation promotes FA dynamics in cell migration, we monitored FA dynamics using paxillin-GFP under EGF stimulation. As shown in Figures 1a and 1b, after EGF stimulation, newly formed FAs at the leading edge were significantly suppressed in βPix silenced SW480 cells, greatly reducing the rate of FA assembly and disassembly. In particular, as shown in Fig. 1c, βPix silenced cells showed a decrease in the total number of FAs at the leading edge as well as a small number of initial FAs (in areas less than 1 mm ² ). As shown in Fig. 1d, EGF-induced lamellipodia formation was also suppressed in βPix silenced cells. As shown in Fig. 1e, immunostaining for cortactin, a marker of lamellipodia, showed that βPix deficiency significantly reduced the expansion of membrane protrusions. In contrast, as shown in Figure 1f, overexpression of Flag-βPix in LoVo cells enhanced cell migration and resulted in longer membrane protrusions in the direction of migration. In addition, upon EGF stimulation, MT1-MMP, which is responsible for extracellular matrix (ECM) degradation during cell invasion, was relocated to the membrane protruding regions of shMock cells. As shown in Fig. 1g, perimembrane MT1-MMP localization was impaired in βPix-silenced cells. These results indicate that βPix enhances the invasive migration of colorectal cancer cells by promoting actin cytoskeleton remodeling and lamellipodia localization of MT1-MMP.

Experimental Example 2. Binding with Dyn2 at the leading edge of the cell through the SH3 domain of βPix

βPix is a well-known guanine nucleotide exchange factor (GEF) that activates Rac1, and the GEF activity of βPix increases when it interacts with other binding proteins through its SH3 domain. Therefore, we tried to identify potential binding partners of βPix involved in colon cancer cell migration and invasion by proteomics through GST pull-down analysis using GST-βPix-SH3 purified protein. Proteins interacting with the GST-βPix-SH3 protein were visualized by silver staining and MALDI-TOF analysis was performed. Based on proteomics analysis, it was confirmed that Dyn2 is a major protein interacting with the SH3 domain of βPix. As shown in Figure 2a, the interaction between βPix and Dyn2 was confirmed by GST pull-down and immunoprecipitation using an anti-βPix antibody. Furthermore, as shown in Fig. 2b, the fluorescence images of the endogenous βPix and Dyn2 stained showed that they were colocalized around the plasma membrane, thereby supporting the results of the pull-down assay. As shown in Fig. 2c, functional mutation of the SH3 domain in βPix (substitution of Lys by Trp at position 43) impaired binding to Dyn2, indicating that the SH3 domain is involved in the interaction between βPix and Dyn2.

As shown in Figure 3a, the SH3 domain is known to be involved in protein binding through the PRD (proline-rich domain) of other proteins, so we investigated whether the PRD of Dyn2, which is relatively similar to the PAK isoform, interacts with the SH3 domain of βPix. . As shown in Figure 3b, mutation of Arg to Ala at position 834 in the PRD of Dyn2, which has been reported to induce defective binding to the SH3 domain, significantly reduced the interaction between βPix and Dyn2. The above result means that the PRD of Dyn2 binds to the SH3 domain of βPix.

Experimental Example 3. Enhancement of Rac 1-mediated lamellipodia formation by βPix-Dyn2 complex

Dyn2 is known to assist the GEF activity of Vav1 to increase lamellipodia formation and cell migration by regulating the stability of Vav1. Accordingly, we investigated whether Dyn2 induces Rac1 activation and lamellipodia formation by influencing the GEF activity of βPix. As shown in Fig. 4a, time-lapse microscopy showed significant colocalization between βPix and Dyn2-GFP in lamellipodia, and membrane ruffling was induced at the leading edge. Furthermore, as shown in Fig. 4b, time-lapse microscopy kymograph analysis indicated that the colocalization of βPix and Dyn2-GFP was enhanced at the membrane edge given the increased membrane looping. This means that the interaction of βPix and Dyn2 at the membrane periphery is required to promote membrane looping.

Membrane loopling is induced by Rac1, and since βPix is known to be a GEF for Rac1, it was assumed that Dyn2 promotes the GEF activity of βPix to induce Rac1-mediated membrane loopling. To confirm the hypothesis, evaluation of Rac1 activity was performed using the GST-PBD pull-down assay with various βPix and Dyn2 mutants. As a result, as shown in FIG. 5a, it was confirmed that βPix alone increased Rac1 activation 2-fold, whereas Dyn2 alone had minimal effect on Rac1 activation. Interestingly, overexpression of βPix and Dyn2 increased Rac1 activation approximately 3-fold. However, the SH3 mutation of βPix, which is known to impair the βPix-Dyn2 complex, reduced Rac1 activation by 50%, similar to a functional βPix mutation (DH domain mutation). In addition, as shown in Fig. 5b, the R834A mutation of Dyn2 lacking βPix binding reduced Rac1 activity. These results indicate that Dyn2 plays an important role in βPix-mediated Rac1 activation.

Experimental Example 4. Dyn2 required for βPix-mediated lamellipodia formation and MT1-MMP localization in the membrane periphery

To clarify the involvement of Dyn2 in βPix-induced lamellipodia formation and cell invasion, Dyn2-silenced SW480 cells were generated with two separate shRNA oligos. As previously reported, we first investigated whether Dyn2 regulates βPix protein stability upon Rac1 activation. As a result, as shown in Figure 6, it was confirmed that the protein level of βPix did not change in Dyn2-silenced SW480 cells and vice versa, indicating that Dyn2 does not affect the stability of βPix.

In addition, as shown in Figure 7, invasion and 3D sphere formation were significantly reduced in Dyn2-silenced cells, and as shown in Figure 8, upon EGF stimulation, βPix levels were normal, but lamellipodia formation and FA dynamics were not. suppressed in Dyn2-silenced cells. This suggests that the interaction between Dyn2 and βPix can induce cell invasion and sphere formation in colorectal cancer cells. Interestingly, the reduced membrane localization of βPix in Dyn2-silenced cells was restored by overexpression of wild-type Dyn2. As shown in Figure 9, the Dyn2 R834A mutation was observed at the membrane periphery but did not induce βPix localization at this site. In addition, Dyn2 K44A lacking GTPase activity did not recruit βPix to the membrane periphery, indicating that the enzymatic activity of Dyn2 may affect the function of βPix in cell invasion.

Furthermore, we investigated whether MT1-MMP localization in lamellipodia depends on the βPix-Dyn2 complex. As a result, as shown in Figure 10a, the localization of lamellipodia MT1-MMP was suppressed in Dyn2-silenced cells, and overexpression of Dyn2 PRD mutant (R834A) or GTPase-defective mutant (K44A) except for wild type was suppressed. It was confirmed that it did not restore the peripheral localization of MT1-MMP. Consistent with this, as shown in FIG. 10B , invasion of Dyn2-silenced cells was not restored by the R834A or K44A Dyn2 mutants, except for wild-type Dyn2. In addition, to monitor membrane expansion in βPix overexpressing Dyn2-silenced SW480 cells after EGF stimulation, kymograph analysis of LifeAct-RFP was performed. As a result, as shown in FIG. 10c , it was confirmed that membrane expansion and cell invasion were remarkably reduced despite the overexpression of βPix. The above results indicate that Dyn2 is required for the membrane localization of βPix mediated by the interaction with the Dyn2 PRD and the enzymatic activity of Dyn2. Therefore, it was found that the βPix-Dyn2 complex increased cell invasion by enhancing lamellipodia formation and MT1-MMP localization in the membrane periphery.

Experimental Example 5. βPix-Dyn2 complex enhanced by Src-induced βPix Y442 phosphorylation

Tumor cell invasion mainly requires adhesion to the ECM via cell surface receptors such as integrins. Therefore, we aimed to determine whether βPix and Dyn2 binding is dependent on cell-substrate adhesion. To this end, immunoprecipitation experiments for βPix and Dyn2 interactions were performed using cells incubated in poly L-lysine-coated or fibronectin-coated culture conditions, respectively. Interestingly, as shown in Fig. 11a, the interaction between βPix and Dyn2 significantly enhanced FA and lamellipodia formation in the fibronectin condition. As shown in FIG. 11b, the interaction between βPix and Dyn2 was significantly inhibited after treatment with PP2, a selective inhibitor of Src family kinases. In addition, it was confirmed that constitutive activation of Src kinase promotes the interaction between βPix and Dyn2. Conversely, as shown in Figure 11c, overexpression of a dominant-negative mutant of Src kinase inhibited the interaction between βPix and Dyn2. These results indicate that the activation of Src kinase promotes the formation of βPix-Dyn2 complexes under fibronectin culture conditions.

Phosphorylation of the tyrosine residue at position 442 by Src kinase has been reported to contribute to the regulation of protein interactions. Therefore, we sought to determine whether Src-induced phosphorylation of tyrosine at position 442 (Y442) of βPix is important for interacting with Dyn2. To this end, as previously reported, as shown in Fig. 12a, it was first demonstrated that Y442 of βPix is phosphorylated by a constitutively activated Src kinase, which could not phosphorylate the βPix mutant (Y442F). In particular, as shown in Fig. 12b, the Y442F mutant of βPix showed a reduced interaction with Dyn2. As shown in Figure 12c, additional immunofluorescence imaging showed that βPix Y442F was rarely colocalized with endogenous Dyn2 at the membrane periphery compared to wild-type βPix. Consistent with this, as shown in Fig. 12d, colocalization in the lamellipodia region quantified using Pearson's coefficient was greatly reduced in the βPix Y442F-expressing mutant. On the other hand, as shown in Fig. 12e, the phosphorylation-mimetic mutant Y442E restored membrane colocalization of βPix and Dyn2, indicating that phosphorylation of Y442 in βPix promotes the interaction with Dyn2.

Transwell assay was used to determine whether colon cancer cell invasiveness was affected by the βPix Y442 phosphorylation status. We confirmed that βPix shRNA targeting the 3'UTR downregulated colon cancer cell invasion, which was subsequently restored by overexpression of wild-type βPix or βPix Y442E mutant. However, as shown in Figure 13, exogenous expression of the βPix Y442F mutant failed to restore suppressed invasion. These results indicate that Src-induced phosphorylation of the tyrosine residue at position 442 of βPix is essential for the interaction between βPix and Dyn2 at the leading edge of the membrane, thereby promoting cell invasion.

Experimental Example 6. Impairment of Membrane Dynamics and Cancer Cell Invasion by Disruption of βPix-Dyn2 Interaction

These results indicated that the βPix-Dyn2 complex is required for lamellipodia formation and invasion in colorectal cancer cells. To confirm the important role of the interaction between βPix and Dyn2 in regulating membrane dynamics, an anti-βPix antibody-conjugated AuNP delivery system was utilized to disrupt the interaction between βPix and Dyn2 by targeting the SH3 domain of βPix. As shown in Figure 14a, fluorescence imaging of SW480 cells incubated with AuNP-SH3 showed a strong green fluorescence signal in a dot-like structure near the periphery, unlike the cells treated with AuNP-IgG without a signal, which was AuNP- This means that SH3 can specifically target endogenous βPix. In addition, as a result of confirming whether disruption of the βPix-Dyn2 complex by AuNP-SH3 inhibits cell invasion, SW480 cells incubated with AuNP-SH3 exhibited reduced invasiveness compared to AuNP-IgG treated cells. Furthermore, as shown in FIG. 14B, in a further immunoprecipitation assay using only protein A/G agarose beads, internalized AuNP-SH3 targeted βPix in Flag-Dyn2-expressing SW480 cells, whereas anti- Immunoprecipitation using the βPix-SH3 antibody showed that the interaction of the βPix-Dyn2 complex was significantly reduced by AuNP-SH3. Also, as shown in Fig. 14c, after EGF stimulation, the membrane localization of βPix was reduced by AuNP-SH3 delivery. To confirm whether AuNP-SH3 interferes with the cellular function of the βPix-Dyn2 complex, membrane looping was monitored in Dyn2-GFP-expressing SW480 cells treated with AuNP-SH3. As a result, as shown in FIG. 14d, time-lapse video imaging showed reduced membrane ruffles in AuNP-SH3-treated SW480 cells compared to active membrane ruffles rich in Dyn2 in AuNP-IgG-treated cells. gave. These results imply that the interaction of βPix and Dyn2 is essential for the downstream effect. The above result means that interfering with the interaction between βPix and Dyn2 can exert an antitumor effect by inhibiting colon cancer cell invasion.

In addition, we tried to establish a correlation between βPix and Dyn2 expression to demonstrate the clinical relevance of the βPix-Dyn2 complex in primary colorectal cancer samples, but unexpectedly, Dyn2 expression was not different between normal and colorectal cancer tissues in the Oncomine database. βPix expression was upregulated in colorectal cancer tissues. In addition, Dyn2 transcript levels did not correlate with βPix levels, as shown in the data from the TCGA database shown in Figure 15a. However, as shown in FIG. 15B , patients with colorectal cancer and high βPix and Dyn2 expression significantly increased the rate of lymph node metastasis. According to survival analysis of patients with colorectal cancer and elevated βPix expression, as shown in FIG. 15C , increased Dyn2 expression was closely related to poor survival.

From the above results, it was thought that high levels of βPix-Dyn2 complex could predict poor prognosis of colorectal cancer patients, which could be applied as a combination marker for targeted therapy.

Experimental Example 7. Inhibition of βPix function in breast cancer

As shown in FIG. 16, it was confirmed using TCGA that the expression of the βPix gene was increased in breast cancer patients, particularly in patients with basal-like breast cancer, a triple-negative type with high metastasis. Furthermore, in MDA-MB-231, a triple-negative breast cancer cell line, a monoclonal antibody targeting the SH3 domain of βPix was delivered intracellularly to inhibit the function of βPix. As a result, the metastatic activity of breast cancer cells in MDA-MB-231 was reduced. confirmed that it has been The above results indicate that the antitumor effect can be exerted by suppressing the metastatic activity of breast cancer cells by inhibiting the βPix function.

The above description of the present invention is for illustrative purposes, and those skilled in the art can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Pharmaceutical composition for cancer treatment or suppression of metastasis comprising antibody specifically binding to SH3 domain of BETAPix <130> MP21-226 <160> 36 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> artificial sequence <220> <223> BETAPix shRNA <400> 1 gcaaatgctc gtacagtct 19 <210> 2 <211> 19 <212> DNA <213> artificial sequence <220> <223> BETAPix shRNA <400> 2 cgacaggaat gacaatcac 19 <210> 3 <211> 21 <212> DNA <213> artificial sequence <220> <223> BETAPix shRNA <400> 3 tgcgaatgga gacgatcaaa c 21 <210> 4 <211> 21 <212> DNA <213> artificial sequence <220> <223> Dyn2 shRNA <400> 4 atgtagggca ggccttctat a 21 <210> 5 <211> 21 <212> DNA <213> artificial sequence <220> <223> Dyn2 shRNA <400> 5 cccgttgaga agaggctaca t 21 <210> 6 <211> 21 <212> DNA <213> artificial sequence <220> <223> PTCH2_F <400> 6 atgacagtgg aactctttgg t 21 <210> 7 <211> 19 <212> DNA <213> artificial sequence <220> <223> PTCH2_R <400> 7 actgtgaact caacgccaa 19 <210> 8 <211> 19 <212> DNA <213> artificial sequence <220> <223> TRADD_F <400> 8 gaaatctgaa gtgcggctc 19 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> TRADD_R <400> 9 tgaccctgga acagaaaagt 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> CPSF3_F <400> 10 cgtttacagc aagaggttgg 20 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> CPSF3_R <400> 11 tccaagttaa ggttggcagt 20 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> AKAP6_F <400> 12 caatgccact acaagcaaca 20 <210> 13 <211> 20 <212> DNA <213> artificial sequence <220> <223> AKAP6_R <400> 13 tcctgagagg aaggacttga 20 <210> 14 <211> 20 <212> DNA <213> artificial sequence <220> <223> FBXW2_F <400> 14 tggccaattg ggagagaaat 20 <210> 15 <211> 20 <212> DNA <213> artificial sequence <220> <223> FBXW2_R <400> 15 ggtagagacc aagtgctgaa 20 <210> 16 <211> 20 <212> DNA <213> artificial sequence <220> <223> SUV39H2_F <400> 16 agctgtgacc caaatcttca 20 <210> 17 <211> 20 <212> DNA <213> artificial sequence <220> <223> SUV39H2_R <400> 17 tcagctcttc tccagcattt 20 <210> 18 <211> 20 <212> DNA <213> artificial sequence <220> <223> CREG2_F <400> 18 ggtggctgat ctgatgaaga 20 <210> 19 <211> 20 <212> DNA <213> artificial sequence <220> <223> CREG2_R <400> 19 tgagcgttaa ctggacacat 20 <210> 20 <211> 20 <212> DNA <213> artificial sequence <220> <223> NBAS_F <400> 20 tgaagagaac cgctactgtc 20 <210> 21 <211> 20 <212> DNA <213> artificial sequence <220> <223> NBAS_R <400> 21 cttttcatag gtggccaagc 20 <210> 22 <211> 20 <212> DNA <213> artificial sequence <220> <223> LIN7A_F <400> 22 ctgctatcag tgaacggagt 20 <210> 23 <211> 20 <212> DNA <213> artificial sequence <220> <223> LIN7A_R <400> 23 gaacttttgg ggtgtatcgc 20 <210> 24 <211> 20 <212> DNA <213> artificial sequence <220> <223> PPIL2_F <400> 24 cctacctgga caagaagcat 20 <210> 25 <211> 20 <212> DNA <213> artificial sequence <220> <223> PPIL2_R <400> 25 tcagttttgg ggtcactctc 20 <210> 26 <211> 20 <212> DNA <213> artificial sequence <220> <223> TBXAS1_F <400> 26 cagctttcag attcacacgg 20 <210> 27 <211> 20 <212> DNA <213> artificial sequence <220> <223> TBXAS1_R <400> 27 cctttcaggg ttgaaggtct 20 <210> 28 <211> 20 <212> DNA <213> artificial sequence <220> <223> HOPX_F <400> 28 ggtgggaaatc ctggagtaca 20 <210> 29 <211> 18 <212> DNA <213> artificial sequence <220> <223> HOPX_R <400> 29 gggtctcctc ctcggaaa 18 <210> 30 <211> 20 <212> DNA <213> artificial sequence <220> <223> USP28_F <400> 30 tcccctgcat tcaccttatc 20 <210> 31 <211> 20 <212> DNA <213> artificial sequence <220> <223> USP28_R <400> 31 gtagaaactc ccctaggcac 20 <210> 32 <211> 20 <212> DNA <213> artificial sequence <220> <223> ANKFN1_F <400> 32 tagactgtct tccatcccca 20 <210> 33 <211> 20 <212> DNA <213> artificial sequence <220> <223> ANKFN1_R <400> 33 tggagtcgta gtcactgttg 20 <210> 34 <211> 20 <212> DNA <213> artificial sequence <220> <223> MBD2_F <400> 34 tcagacccac aacgaatgaa 20 <210> 35 <211> 20 <212> DNA <213> artificial sequence <220> <223> MBD2_R <400> 35 ctccttgaag acctttgggt 20 <210> 36 <211> 53 <212> PRT <213> artificial sequence <220> <223> epitope in SH3 domain of betapix <400> 36 Gln Leu Val Val Arg Ala Lys Phe Asn Phe Gln Gln Thr Asn Glu Asp 1 5 10 15 Glu Leu Ser Phe Ser Lys Gly Asp Val Ile His Val Thr Arg Val Glu 20 25 30 Glu Gly Gly Trp Trp Glu Gly Thr Leu Asn Gly Arg Thr Gly Trp Phe 35 40 45 Pro Ser Asn Tyr Val 50

Claims (7)

A pharmaceutical product for cancer treatment or cancer metastasis inhibition comprising an antibody or functional fragment thereof that specifically binds to an epitope within the SH3 (Src homology 3) domain of the βPix protein represented by the amino acid sequence of SEQ ID NO: 36 as an active ingredient composition.
According to claim 1,
Characterized in that the antibody or functional fragment inhibits the activity of the βPix protein, the pharmaceutical composition.
According to claim 1,
The antibody or functional fragment thereof is characterized in that for inhibiting the binding of βPix protein and Dyn2 (Dynamin 2) protein, a pharmaceutical composition.
According to claim 1,
The cancer is characterized in that at least one selected from the group consisting of colon cancer and breast cancer, a pharmaceutical composition.
A method for screening a candidate for cancer treatment or cancer metastasis inhibition, comprising the following steps:
(S1) treating a test substance with a test substance in vitro ;
(S2) measuring the degree of binding between βPix and Dyn2 (Dynamin 2) of the test subject; and
(S3) selecting a test substance having a reduced degree of binding between βPix and Dyn2 compared to the test substance untreated group as a candidate substance for cancer treatment or metastasis inhibition.
According to claim 5,
Characterized in that the subject is separated from at least one selected from the group consisting of colon cancer and breast cancer, screening method.
According to claim 5,
The cancer is characterized in that at least one selected from the group consisting of colorectal cancer and breast cancer, screening method.