KR20230109307A - PRDX1 mutant for the prevention or treatment of bone diseases and uses thereof - Google Patents

Abstract

The present invention relates to a PRDX1 mutant and its use for the prevention or treatment of bone disease. Specifically, the present invention relates to a PRDX1 (Peroxiredoxin 1) mutant protein represented by the amino acid sequence of SEQ ID NO: 3, and a mutant protein encoding the PRDX1 mutant protein. It relates to a pharmaceutical composition and health functional food for preventing or treating bone diseases comprising a PRDX1 mutant gene, the PRDX1 mutant protein or a PRDX1 mutant gene encoding the protein as an active ingredient. The PRDX1 mutant protein according to the present invention has an excellent ability to inhibit the differentiation and formation of osteoclasts, and thus can be usefully used as medicines and health functional foods that can prevent, improve, or treat various bone diseases caused by hyperdifferentiation of osteoclasts.

Description

PRDX1 mutant for the prevention or treatment of bone diseases and uses thereof {PRDX1 mutant for the prevention or treatment of bone diseases and uses thereof}

The present invention relates to PRDX1 mutants and their use for the prevention or treatment of bone diseases.

Bone is a calcified connective tissue associated with muscle, and its surface is a thick and hard calcified tissue that serves as a support to balance the body and protects organs. The inside of the bone is bone marrow tissue and is the center of calcium metabolism. Bone is composed of organic substances such as collagen, osteocalcin, and osteonectin, and inorganic substances such as calcium, phosphorus, and fluorine, and water. Bone formation and bone resorption are always occurring in living organisms. Bone formation is promoted by small amounts of parathyroid hormone, androgens, estrogens, fluorine, phosphorus, etc., and bone resorption is promoted by physical decompression, weightlessness, large amounts of parathyroid hormone, cortical steroids, and the like. Therefore, the balance between them is important for bone metabolism. Therefore, bone homeostasis is maintained through continuous regulation of bone remodeling by equal actions of bone resorption by osteoclasts and bone formation by osteoblasts. do.

It is known that two types of cells are largely involved in bone remodeling, that is, the remodeling process. One of the two cells is osteoblast, which creates bone, and the other is osteoclast, which destroys bone. . However, an imbalance between these two cells, in particular excessive bone decomposition due to excessive formation or activation of osteoclasts, is a major cause of various bone diseases including osteoporosis.

In particular, osteoclastogenesis is multinucleated by fusion of osteoclast progenitor cells with each other by stimulation of cytokines such as M-CSF (machrophage colony-stimulating factor) and RANKL (receptor activator of nuclear factor-κB ligand). This is the process by which osteoclasts are formed. Mature osteoclasts undergo a process of cytoskeleton, in which actin of osteoclasts becomes one large ring to separate the extracellular space and the space for resorbing bone while osteoclasts attach to the bone. It refers to the process by which bone is resorbed by being organized into a ring.

Therefore, inhibiting bone resorption by inhibiting the differentiation, maturation, or activity of osteoclasts can be an effective method for developing therapeutic agents for various bone diseases.

To date, several substances have been developed as therapeutic agents for bone diseases. Among them, estrogen, which is most often used as a treatment for osteoporosis, has a disadvantage that its practical efficacy has not yet been verified and must be taken continuously throughout life, and has a side effect of increasing breast cancer or uterine cancer when administered for a long period of time. Alendronate, a bisphosphonate-based drug, has problems such as not having clear efficacy, slow absorption in the digestive tract, and causing inflammation in the gastric and esophageal mucosa. Calcium preparations are known to be highly effective with fewer side effects, but they are more of a preventive than a cure. In addition, vitamin D preparations such as calcitonin are known, but studies on efficacy and side effects have not yet been sufficiently conducted.

Therefore, there is a demand for the development of new therapeutic agents for bone diseases with fewer side effects and excellent effects.

Korean Patent Publication No. 10-2018-0091715 Korean Patent Publication No. 10-2018-0037399

Accordingly, while the present inventors were researching to develop a new therapeutic agent for bone disease, the PRDX1 4CS mutant, in which four specific cysteine residues in the amino acid sequence of the PRDX1 protein were substituted with serine, exhibited superior differentiation of osteoclasts compared to the PRDX1 wild-type protein. It was confirmed that there was an inhibitory activity. Therefore, the present invention was completed by confirming that the PRDX1 4CS mutant prepared in the present invention can be used as a new therapeutic agent for preventing or treating bone diseases caused by hyperdifferentiation of osteoclasts.

Accordingly, an object of the present invention is to provide a PRDX1 (Peroxiredoxin 1) mutant protein represented by the amino acid sequence of SEQ ID NO: 3.

Another object of the present invention is to provide a PRDX1 (Peroxiredoxin 1) mutant gene encoding the PRDX1 (Peroxiredoxin 1) mutant protein.

Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of bone diseases, comprising a PRDX1 (Peroxiredoxin 1) mutant protein or a PRDX1 mutant gene encoding the protein as an active ingredient.

Another object of the present invention is to provide a health functional food for preventing or improving bone disease, comprising PRDX1 (Peroxiredoxin 1) mutant protein or PRDX1 mutant gene encoding the protein as an active ingredient. .

In order to achieve the object of the present invention as described above, the present invention provides a PRDX1 (Peroxiredoxin 1) mutant protein represented by the amino acid sequence of SEQ ID NO: 3.

In one embodiment of the present invention, the PRDX1 (Peroxiredoxin 1) mutant protein may inhibit the differentiation or formation of osteoclasts.

In addition, the present invention provides a PRDX1 (Peroxiredoxin 1) mutant gene encoding PRDX1 (Peroxiredoxin 1) mutant protein.

In one embodiment of the present invention, the gene may be represented by the nucleotide sequence of SEQ ID NO: 4.

In addition, the present invention provides a pharmaceutical composition for preventing or treating bone diseases, comprising the PRDX1 (Peroxiredoxin 1) mutant protein of the present invention or the PRDX1 mutant gene encoding the protein as an active ingredient.

In one embodiment of the present invention, the gene may be represented by the nucleotide sequence of SEQ ID NO: 4.

In one embodiment of the present invention, the bone disease is osteoporosis due to hyperdifferentiation of osteoclasts, facet bone disease, rickets, osteomalacia, renal osteodystrophy in patients with renal failure, rheumatic bone disease, degenerative bone disease, bone metastasis It may be selected from the group consisting of a bone metastatic lesion, a primary bone tumor, periodontal disease, inflammatory alveolar bone resorption disease, and inflammatory bone resorption disease.

In addition, the present invention provides a health functional food for preventing or improving bone disease, comprising a PRDX1 (Peroxiredoxin 1) mutant protein or a PRDX1 mutant gene encoding the protein as an active ingredient.

In one embodiment of the present invention, the gene may be represented by the nucleotide sequence of SEQ ID NO: 4.

In one embodiment of the present invention, the bone disease is osteoporosis due to hyperdifferentiation of osteoclasts, facet bone disease, rickets, osteomalacia, renal osteodystrophy in patients with renal failure, rheumatic bone disease, degenerative bone disease, bone metastasis It may be selected from the group consisting of a bone metastatic lesion, a primary bone tumor, periodontal disease, inflammatory alveolar bone resorption disease, and inflammatory bone resorption disease.

In the present invention, a PRDX1 mutant protein was prepared that was significantly superior to the wild-type PRDX1 protein in inhibiting osteoclast differentiation, and the PRDX1 mutant protein prepared in the present invention was significantly superior in the ability to inhibit the differentiation and formation of macrophages into osteoclasts compared to the wild-type PRDX1 protein. As confirmed, it was found that it can be usefully used as a medicine and health functional food for the prevention, improvement, or treatment of various bone diseases caused by hyperdifferentiation of osteoclasts. Furthermore, the present invention identifies that the PRDX1 mutant protein of the present invention exists in the form of a monomer, unlike the wild-type PRDX1 protein that exists as an oligomer in cells. It was found that it can represent

Figure 1 shows the form of protein according to DTT treatment for each of the wild-type PRDX1 protein expressed from Escherichia coli, isolated and purified, and the PRDX1 mutant protein of the present invention, according to SDS-PAGE electrophoresis and Coomassie blue The staining results are shown.
Figure 2 is a result of confirming the osteoclast differentiation and formation inhibitory ability of wild-type PRDX1 protein and PRDX1 mutant protein of the present invention. TRAP-stained photos of differentiated osteoclasts according to treatment concentrations are shown, and B shows the result of quantitatively measuring and comparing the number of TRAP-positive cells.

The present invention is characterized by providing a new PRDX1 mutant and its novel use as a therapeutic agent for bone diseases.

Conventional PRDX1 (Peroxiredoxin 1) protein is known as an antioxidant enzyme, and recently, studies on PRDX1 gene-defective mice have reported that PRDX1 is a tumor suppressor and plays an important role in antioxidant defense of red blood cells. However, research on the relationship between PRDX1 protein and bone disease is insufficient.

Meanwhile, the present inventors prepared a new mutant of PRDX1 (Peroxiredoxin 1) protein while researching to develop a new therapeutic agent for bone disease, and found that the mutant had excellent osteoclast differentiation inhibitory activity.

Accordingly, the present invention may provide a new PRDX1 (Peroxiredoxin 1) mutant protein, and the PRDX1 mutant protein may consist of the amino acid sequence of SEQ ID NO: 3.

In addition, the present invention may provide a PRDX1 mutant gene encoding the PRDX1 (Peroxiredoxin 1) mutant protein, and the PRDX1 mutant gene may consist of the nucleotide sequence of SEQ ID NO: 4.

The PRDX1 mutant protein provided in the present invention is a mutant in which four specific cysteine residues in the amino acid sequence of the wild-type PRDX1 protein are substituted with serine residues, specifically, in the amino acid sequence of the wild-type PRDX1 protein of SEQ ID NO: 1, the 52nd, 71st, It is a mutant in which both cysteine (C; cysteine) located at positions 83 and 173 are substituted with serine (S).

Preferably, the PRDX1 (Peroxiredoxin 1) mutant protein according to the present invention consists of the amino acid sequence of SEQ ID NO: 3.

The present inventors compared and analyzed the PRDX1 mutant protein according to the present invention with the wild-type protein. As a result, in terms of protein morphology, the wild-type PRDX1 protein exists in cells in the form of oligomers including dimers, whereas the present invention It was shown that the PRDX1 mutant protein of was present in a monomeric form.

In addition, it was confirmed that the PRDX1 mutant protein having a monomeric form of the present invention does not exhibit the antioxidant activity of the wild-type protein.

Accordingly, the present inventors predicted that the PRDX1 mutant protein of the present invention may have a completely different intracellular function from that of the wild-type PRDX1 protein.

In this aspect, in one embodiment of the present invention, the effect of the PRDX1 mutant protein of the present invention on osteoclast differentiation was analyzed. When mouse-derived macrophages were treated with RANKL to induce differentiation into osteoclasts, PRDX1 After treating the mutant protein and the wild-type PRDX1 protein, respectively, the degree of osteoclast differentiation by these proteins was analyzed.

As a result, it was confirmed that the PRDX1 mutant protein of the present invention exhibits a remarkably high osteoclast differentiation inhibitory effect compared to the wild-type PRDX1 protein.

In addition, the PRDX1 mutant protein of the present invention was found to have excellent osteoblast differentiation promoting activity, and the wild-type PRDX1 protein was found to have insufficient osteoblast differentiation promoting activity.

Furthermore, it was found that the PRDX1 mutant protein of the present invention exists in the form of a monomer in cells and acts as a ligand for TLR4 (Toll-like receptor 4), suppressing the differentiation of osteoclasts.

Osteoclasts are cells specialized for the function of bone catabolism and together with osteoblasts are important for bone growth, bone remodeling and fracture healing. play a role These cells are generated from monocytes/macrophages, a lineage of hematopoietic cells, through a very complex differentiation program. It has been reported that these osteoclasts can cause bone diseases when an imbalance with osteoblasts occurs in bone or when they are excessively differentiated into osteoclasts.

The "osteoblasts" are cells that make bone cells of vertebrates, and are formed from mesenchymal stem cells. Mineralization such as calcium formation by differentiation of osteoblasts not only maintains bone strength, but also provides calcium and It also plays a very important role in the homeostasis of hormone metabolism. Calcium formation by differentiation of osteoblasts is regulated by vitamin D and parathyroid hormone, etc., and bone formation by differentiation of osteoblasts involves bone morphogenetic protein (BMP), Wnt, and MAP within cells. Alkaline phosphatase (alkaline After phosphatase (ALP) is synthesized in the initial differentiation stage, it is known that osteopontin, osteocalcin, type 1 collagen, etc. related to mineralization are synthesized. Therefore, when abnormalities in the differentiation and formation of these osteoblasts occur, problems in bone formation occur, resulting in bone disease.

Therefore, the present inventors found that, unlike the wild-type PRDX1 protein, the PRDX1 mutant protein of the present invention has a very good activity of inhibiting the differentiation or formation of osteoclasts, and thus can prevent, improve, or treat various bone diseases caused by hyperdifferentiation of osteoclasts. could

Therefore, the present invention can provide a pharmaceutical composition for preventing or treating bone diseases, comprising a PRDX1 (Peroxiredoxin 1) mutant protein or a PRDX1 mutant gene encoding the protein as an active ingredient.

The pharmaceutical composition for preventing or treating bone disease according to the present invention is a pharmaceutical composition capable of treating bone disease and may further include a pharmaceutically acceptable carrier. In the above, "pharmaceutically acceptable" refers to a composition that is physiologically acceptable and does not cause an allergic reaction such as gastrointestinal disorder, dizziness, or similar reaction when administered to humans. Pharmaceutically acceptable carriers include, for example, carriers for oral administration such as lactose, starch, cellulose derivatives, magnesium stearate and stearic acid, and carriers for parenteral administration such as water, suitable oil, saline, aqueous glucose and glycol, etc. and the like, and may further include a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. As other pharmaceutically acceptable carriers, reference may be made to those described in the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

The pharmaceutical composition according to the present invention may be formulated in a suitable form according to a method known in the art together with a pharmaceutically acceptable carrier as described above. That is, the pharmaceutical composition of the present invention can be prepared in various forms for parenteral or oral administration according to known methods, and a representative formulation for parenteral administration is an isotonic aqueous solution or suspension for injection. Formulations for injection may be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. For example, it can be formulated for injection by dissolving each component in saline or buffer. In addition, dosage forms for oral administration include, but are not limited to, powders, granules, tablets, pills, and capsules.

The pharmaceutical composition formulated in the above way may be administered in an effective amount through various routes including oral, transdermal, subcutaneous, intravenous or intramuscular. This means that the route of administration of the substance may be administered through any general route as long as it can reach the target tissue.

In addition, the above effective amount refers to an amount that exhibits a preventive or therapeutic effect when administered to a patient. The dosage of the pharmaceutical composition according to the present invention may vary depending on various factors such as the type and severity of the patient's disease, age, sex, weight, sensitivity to drugs, the type of current treatment, administration method, target cells, etc. can be easily determined by experts in In addition, the pharmaceutical composition of the present invention may be administered in combination with conventional therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple times. Preferably, considering all of the above factors, it is possible to administer an amount that can obtain the maximum effect with the minimum amount without side effects, more preferably 1 to 10000 μg/kg body weight/day, and even more preferably 10 to 1000 mg It can be administered repeatedly several times a day at an effective dose of /kg body weight /day.

The bone disease to be prevented, improved, treated, or diagnosed in the present invention refers to a disease that is caused by hyperdifferentiation of osteoclasts and causes bone tissue disorder or destroys bone tissue, but the bone disease is not limited thereto. , osteoporosis, facet bone disease, rickets, osteomalacia, renal osteodystrophy in patients with renal failure, rheumatoid bone disease, degenerative bone disease, bone metastatic lesion, primary bone tumor, periodontal disease, inflammatory alveolar bone resorptive diseases and inflammatory bone resorption diseases.

In addition, the present invention can provide a health functional food for preventing or improving bone disease, comprising a PRDX1 (Peroxiredoxin 1) mutant protein or a PRDX1 mutant gene encoding the protein as an active ingredient.

The health functional food of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills and the like.

In the present invention, "health functional food" refers to food manufactured and processed using raw materials or ingredients having useful functionalities for the human body according to Act No. It refers to intake for the purpose of obtaining useful effects for health purposes such as regulating or physiological functions.

The health functional food of the present invention may contain ordinary food additives, and the suitability as a food additive is determined according to the general rules of the Food Additive Code and General Test Methods approved by the Food and Drug Administration, unless otherwise specified. It is judged according to standards and standards.

Examples of the items listed in the “food additives code” include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, kaoliang pigment, and guar gum; and mixed preparations such as sodium L-glutamate preparations, noodle-added alkali preparations, preservative preparations, and tar color preparations.

For example, a health functional food in the form of a tablet is obtained by granulating a mixture obtained by mixing the active ingredient of the present invention with an excipient, a binder, a disintegrant, and other additives in a conventional manner, and then adding a lubricant or the like to compression molding, or as described above. The mixture can be directly compression molded. In addition, the health functional food in the form of a tablet may contain a flavoring agent and the like as needed.

Among health functional foods in the form of capsules, hard capsules can be prepared by filling a mixture in which the active ingredient of the present invention is mixed with additives such as excipients in a normal hard capsule. It can be prepared by filling the mixture mixed with gelatin in a capsule base. The soft capsule may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary.

The health functional food in the form of a pill can be prepared by molding a mixture of the active ingredient of the present invention mixed with an excipient, a binder, a disintegrant, etc. by a conventionally known method, and can be coated with sucrose or other coating agent if necessary, Alternatively, the surface may be coated with a material such as starch or talc.

Health functional food in the form of granules can be prepared in granular form by a previously known method of mixing the active ingredient of the present invention with excipients, binders, disintegrants, etc., and may contain flavoring agents, flavoring agents, etc., if necessary. there is.

As confirmed in the following examples, the health functional food containing the active ingredient of the present invention has excellent osteoclast differentiation and inhibition activity, and is effective in preventing or improving bone diseases.

The health functional food may be beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, chewing gum, candy, ice cream, alcoholic beverages, vitamin complexes, and health supplements.

Hereinafter, the present invention will be described in more detail through examples. These examples are intended to explain the present invention in more detail, and the scope of the present invention is not limited to these examples.

<Example 1>

Preparation of PRDX1 4CS mutant gene

We prepared a PRDX1 4CS mutant in which four single amino acids were mutated (four cysteines were replaced with serine) in the wild-type PRDX1 protein amino acid sequence. Specifically, PCR was performed using the wild-type (WT) PRDX1 gene of SEQ ID NO: 2 as a template and using the PCR reaction solution shown in Table 1 below. PCR conditions were denatured at 95 ° C for 3 minutes, followed by reaction cycles of 95 ° C for 30 seconds, 55 ° C for 60 seconds and 68 ° C for 6 minutes and 30 seconds, a total of 15 repetitions. Then, 1ul of DpnI was added to the PCR product and reacted for 1 hour.

PCR reaction solution ingredient Amount added (ul) nPfu Forte (2.5U/ul) One 10X nPfu-Forte buffer 5 DNA (50ng/ul) 2 dNTPs (10 mM) 5 Primer F (10ng/ul) One Primer R (10ng/ul) One D.W. 35

In addition, the nucleotide sequences of the primers used in Table 1 are as shown in Table 2 below.

Primer name Base sequence (5'->3') sequence number mouse PRDX1-C52S-F CTCTTGACTTTACTTTTGTGAGTCCCACGGAGATCAT 5 mouse PRDX1-C52S-R ATGATCTCCGTGGGACTCACAAAAGTAAAGTCAAGAG 6 mouse PRDX1-C71S-F ATGAATTTAAGAAACTCAACAGCCAAGTGATTGGCGCTTC 7 mouse PRDX1-C71S-R GAAGCGCCAATCACTTGGCTGTTGAGTTTCTTAAATTCAT 8 mouse PRDX1-C83S-F CTGTGGATTCTCACTTCAGTCATCTGGCATGGATT 9 mouse PRDX1-C83S-R AATCCATGCCAGATGACTGAAGTGAGAATCCACAG 10 mouse PRDX1-C173S-F CAAACATGGTGAAGTGAGTCCAGCTGGCTGGAA 11 mouse PRDX1-C173S-R TTCCAGCCAGCTGGACTCACTTCACCATGTTTG 12

30ul of the DpnI-added reaction mixture was introduced into Top10 water-soluble cells, left on ice for 30 minutes, and then treated in water at 42° C. for 45 seconds in a water bath. Thereafter, the cells were left on ice for 2 minutes, 500ul of LB medium without antibiotics was added, and cultured in a shaking incubator at 37° C. for 1 hour. Thereafter, by centrifugation at 5000 rpm for 1 minute, 300 ul of the supernatant was removed, and the remaining 200 ul of the supernatant was mixed with the E. coli pellet, and then spread evenly on the LB plate to which ampicillin was added. And incubated for 12 hours in a 37 ℃ incubator, inoculated into 5 ml of LB medium per E. coli cells formed on the plate, and then cultured in a 37 ℃ incubator for one day. The next day, 1.5 ml was collected from the culture medium and centrifuged at 12000 rpm for 1 minute to obtain an E. coli pellet. Thereafter, 150ul of Qiagen's P1 buffer was added to completely release the pellet, 150ul of P2 buffer was added, and then immediately after addition of P3 buffer, the tube was shaken lightly and placed on ice for 5 minutes. Thereafter, the centrifuge was centrifuged at 12000 rpm for 30 minutes with a centrifuge set at 4 ° C, and only the supernatant was transferred to a new tube, and then 900 ul of 100% ethanol was added and mixed, and then left at -80 ° C for 30 minutes. After centrifugation at 12000 rpm for 30 minutes, the supernatant was discarded, leaving only the pellet and washing the pellet with 70% ethanol. After evaporating ethanol, 30ul of tertiary distilled water was added to obtain DNA.

Then, the restriction enzyme of Table 3 was treated, and the enzyme treatment reaction was performed at 37 ° C. for 1 hour. Thereafter, 2ul of 6X DNA loading buffer (Cat.# B004) was added, mixed well, and electrophoresis was performed using an agarose gel. When the site cut with the restriction enzyme matched the size of the insert, sequencing was requested to confirm whether the desired mutant DNA base sequence matched, thereby securing the DNA of the PRDX1 4CS mutant. PRDX1 4CS mutant DNA consisting of the nucleotide sequence of SEQ ID NO: 4 in which four cysteines were substituted with serine in the wild-type PRDX1 protein amino acid sequence was prepared by the same method as described above.

Restriction enzyme treatment reaction solution ingredient Amount added (ul) DNA 8 NdeI 0.5 BamHI 0.5 10X EZ buffer IV (Cat.#RB004) One

<Example 2>

Purification and conformational analysis of PRDX1 4CS mutant protein

In Example 1, the transformed E. coli into which the PRDX1 4CS mutant DNA consisting of the nucleotide sequence of SEQ ID NO: 4 was introduced was inoculated into 150 ml of LB medium and cultured in a shaking incubator at 37 ° C for one day. Then, E. coli cultured in a medium containing ampicillin was inoculated with 1/10 of the amount, and cultured while measuring absorbance in a shaking incubator. When the absorbance value reached 0.6 to 0.9, 1 mM IPTG was added and cultured for 4 hours. cultured. Thereafter, centrifugation was performed at 5000 rpm for 30 minutes in a centrifuge at 4° C., and the supernatant was discarded to obtain a pellet. To this, 40 ml of lysis buffer (Lysis buffer; 300 mM NaCl; 50 mM NaH2PO4, pH 8.0; 5 mM Imidazle; 10% glycerol; 0.2 mM PMSF; 1 μg/ml) was added to loosen the pellet, followed by 59/59 for 3 minutes. Ultrasonic treatment was performed by setting pulse, 21 to 23% Amp. Thereafter, E. coli was completely dissolved by treatment with 1% Tritan X-100. Then, only the supernatant was obtained by centrifugation at 12000 rpm at 4° C. for 30 minutes. Through this process, an E. coli lysate containing the PRDX1 4CS mutant protein of the present invention was obtained. Then, the mutant protein of the present invention was purified through a Ni-NTA column. Specifically, the Ni-NTA beads washed with the lysis buffer were reacted with the E. coli lysate containing the PRDX1 4CS mutant protein, that is, the supernatant at 4 ° C. , so that the Ni-NTA beads and the PRDX1 4CS mutant protein could bind.

Thereafter, only the supernatant except for the beads was removed by centrifugation at 1500 rpm at 4° C. for 1 minute, and the beads were transferred to a Biorad column and washed in a wash buffer (20 mM Tris, pH 7.9; 20% glycerol; 300 mM KCl, 1 mM DTT). Column chromatography was performed three times with 10 ml of 0.5 mM MPMSF; 0.1% NP40; 20 mM Imidazole). Then, 2ml of elution buffer (20mM Tris, pH 7.9; 20% glycerol; 300mM KCl, 1mM DTT; 0.5mMPMSF; 0.1% NP40; 250mM Imidazole) was loaded on column chromatography four times to obtain eluted samples, respectively. did

The obtained sample was then dialyzed in BC50 buffer (1M Tris, pH7.9; 0.1M EDTA; 50mM NaCl) for 3 hours. Then, centrifugation was performed at 12000 rpm at 4° C. for 30 minutes, and a precipitate was obtained and stored at -80° C.

Next, Endotoxin Removal Resin (REF88270) was added to the Biorad column tube and centrifugation was performed at 500 g. After that, the column tube 0.2N NaOH was added and mixed by rotation for one day, centrifuged at 500g at 4°C for 1 minute, 2M NaCl was added, mixed by rotation at 4°C for 10 minutes, and then centrifuged at 500g at 4°C for 1 minute. separated. dPBS was added here and the same process was repeated three times. Then, the PRDX1 4CS mutant protein-containing sample of the present invention stored at -80 ° C was added to the column, rotated at 4 ° C for 1 hour, and then centrifuged at 500 g at 4 ° C for 1 minute to achieve the present invention. A PRDX1 4CS mutant protein consisting of amino acids of SEQ ID NO: 3 was obtained. In addition, as a control, the wild-type PRDX1 gene was transduced into E. coli, and then the wild-type PRDX1 protein was purified through the same purification method as described above.

The PRDX1 4CS mutant protein and the wild-type PRDX1 protein of the present invention purified through the above process were subjected to SDS-PAGE electrophoresis to analyze the protein morphology. As a result, as shown in FIG. 1, when DTT (Dithiothreitol) was not added , The wild-type PRDX1 protein was found to exist in the form of an oligomer including monomers and dimers, whereas the PRDX1 4CS mutant protein prepared in the present invention was a monomer (monomer) regardless of whether DTT was added or not. ) was confirmed to exist in the form of

Therefore, through these results, the present inventors found that the PRDX1 4CS mutant protein according to the present invention exists in a different form in cells from the wild-type PRDX1 protein.

<Example 3>

Confirmation of inhibition of osteoclast differentiation by PRDX1 4CS mutant protein treatment

Furthermore, the present inventors analyzed the effect on the differentiation of osteoclasts known as the main cause of bone disease in order to confirm whether the recombinant PRDX1 4CS mutant protein prepared in the present invention can be used as a new therapeutic agent for bone disease.

To this end, 6-week-old male BALB/c mice were euthanized using 100% carbon dioxide, and the femur and tibia were separated. After cutting both ends of the separated tibia and femur, cells in the bone marrow cavity were collected with a 1 mL syringe, and red blood cells were lysed and removed using a red blood cell lysis buffer. Then, the obtained bone marrow cells were cultured for 3 days in α-MEM medium containing 10% FBS and M-CSF (30 ng/mL). After 3 days of culture, the attached cells were used for experiments as bone marrow-derived macrophages (BMMs). After the BMMs cells were seeded in a 48-well culture plate, differentiation into osteoclasts was induced by the addition of RANKL (100 ng/ml). At this time, the recombinant PRDX1 4CS mutant protein and the wild-type PRDX1 protein of the present invention were treated at concentrations of 50 and 100 nM, respectively, and 4 days later, TRAP staining was performed to analyze whether osteoclasts were formed.

As a result, as shown in FIG. 2, it was confirmed that the group treated with the recombinant PRDX1 4CS mutant protein of the present invention (4CS) had an activity to significantly inhibit osteoclast differentiation compared to the wild-type PRDX1 protein-treated group (WT). (Figures 2A and 2B). In particular, when the recombinant PRDX1 4CS mutant protein of the present invention was treated at a concentration of 50 nM, the formation of TRAP-positive cells, that is, osteoclasts, was almost inhibited (FIG. 2B).

Therefore, through these results, the present inventors found that the PRDX1 4CS mutant protein provided in the present invention can be usefully used as a new therapeutic agent for various bone diseases including osteoporosis caused by hyperdifferentiation of osteoclasts.

So far, the present invention has been looked at with respect to its preferred embodiments. Those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent scope will be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Chungbuk National University <120> PRDX1 mutant for the prevention or treatment of bone diseases and uses it <130> NPDC-0101662 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 199 <212> PRT <213> artificial sequence <220> <223> PRDX1 WT amino acid sequence <400> 1 Met Ser Ser Gly Asn Ala Lys Ile Gly Tyr Pro Ala Pro Asn Phe Lys 1 5 10 15 Ala Thr Ala Val Met Pro Asp Gly Gln Phe Lys Asp Ile Ser Leu Ser 20 25 30 Glu Tyr Lys Gly Lys Tyr Val Val Phe Phe Phe Tyr Pro Leu Asp Phe 35 40 45 Thr Phe Val Cys Pro Thr Glu Ile Ile Ala Phe Ser Asp Arg Ala Asp 50 55 60 Glu Phe Lys Lys Leu Asn Cys Gln Val Ile Gly Ala Ser Val Asp Ser 65 70 75 80 His Phe Cys His Leu Ala Trp Ile Asn Thr Pro Lys Lys Gln Gly Gly 85 90 95 Leu Gly Pro Met Asn Ile Pro Leu Ile Ser Asp Pro Lys Arg Thr Ile 100 105 110 Ala Gln Asp Tyr Gly Val Leu Lys Ala Asp Glu Gly Ile Ser Phe Arg 115 120 125 Gly Leu Phe Ile Ile Asp Asp Lys Gly Ile Leu Arg Gln Ile Thr Ile 130 135 140 Asn Asp Leu Pro Val Gly Arg Ser Val Asp Glu Ile Ile Arg Leu Val 145 150 155 160 Gln Ala Phe Gln Phe Thr Asp Lys His Gly Glu Val Cys Pro Ala Gly 165 170 175 Trp Lys Pro Gly Ser Asp Thr Ile Lys Pro Asp Val Asn Lys Ser Lys 180 185 190 Glu Tyr Phe Ser Lys Gln Lys 195 <210> 2 <211> 600 <212> DNA <213> artificial sequence <220> <223> PRDX1 WT cDNA sequence <400> 2 atgtcttcag gaaatgcaaa aattgggtat cctgctccca acttcaaagc tacagctgtt 60 atgccagatg gacaattcaa agatatcagc ctaagtgaat acaaaggaaa atatgttgtg 120 ttcttctttt accctcttga ctttactttt gtgtgtccca cggagatcat tgctttcagt 180 gatagagccg atgaatttaa gaaactcaac tgccaagtga ttggcgcttc tgtggattct 240 cacttctgtc atctggcatg gattaacaca cccaagaaac aaggaggatt gggacccatg 300 aacattccct taatatcaga tcccaagcgc accattgctc aggattatgg agtcttaaag 360 gctgatgaag gtatctcttt caggggcctt tttattattg atgataaagg tatccttcga 420 cagataacaa taaacgatct tcccgttggc cgctctgtgg atgagattat acgactagtc 480 caggccttcc agttcactga caaacatggt gaagtgtgtc cagctggctg gaaacctggc 540 agtgatacca tcaagcctga tgtcaataag agcaaagagt atttctctaa gcagaagtga 600 600 <210> 3 <211> 199 <212> PRT <213> artificial sequence <220> <223> PRDX1 4CS mutant amino acid sequence <400> 3 Met Ser Ser Gly Asn Ala Lys Ile Gly Tyr Pro Ala Pro Asn Phe Lys 1 5 10 15 Ala Thr Ala Val Met Pro Asp Gly Gln Phe Lys Asp Ile Ser Leu Ser 20 25 30 Glu Tyr Lys Gly Lys Tyr Val Val Phe Phe Phe Tyr Pro Leu Asp Phe 35 40 45 Thr Phe Val Ser Pro Thr Glu Ile Ile Ala Phe Ser Asp Arg Ala Asp 50 55 60 Glu Phe Lys Lys Leu Asn Ser Gln Val Ile Gly Ala Ser Val Asp Ser 65 70 75 80 His Phe Ser His Leu Ala Trp Ile Asn Thr Pro Lys Lys Gln Gly Gly 85 90 95 Leu Gly Pro Met Asn Ile Pro Leu Ile Ser Asp Pro Lys Arg Thr Ile 100 105 110 Ala Gln Asp Tyr Gly Val Leu Lys Ala Asp Glu Gly Ile Ser Phe Arg 115 120 125 Gly Leu Phe Ile Ile Asp Asp Lys Gly Ile Leu Arg Gln Ile Thr Ile 130 135 140 Asn Asp Leu Pro Val Gly Arg Ser Val Asp Glu Ile Ile Arg Leu Val 145 150 155 160 Gln Ala Phe Gln Phe Thr Asp Lys His Gly Glu Val Ser Pro Ala Gly 165 170 175 Trp Lys Pro Gly Ser Asp Thr Ile Lys Pro Asp Val Asn Lys Ser Lys 180 185 190 Glu Tyr Phe Ser Lys Gln Lys 195 <210> 4 <211> 600 <212> DNA <213> artificial sequence <220> <223> PRDX1 4CS mutant cDNA sequence <400> 4 atgtcttcag gaaatgcaaa aattgggtat cctgctccca acttcaaagc tacagctgtt 60 atgccagatg gacaattcaa agatatcagc ctaagtgaat acaaaggaaa atatgttgtg 120 ttcttctttt accctcttga ctttactttt gtgagtccca cggagatcat tgctttcagt 180 gatagagccg atgaatttaa gaaactcaac agccaagtga ttggcgcttc tgtggattct 240 cacttcagtc atctggcatg gattaacaca cccaagaaac aaggaggatt gggacccatg 300 aacattccct taatatcaga tcccaagcgc accattgctc aggattatgg agtcttaaag 360 gctgatgaag gtatctcttt caggggcctt tttattattg atgataaagg tatccttcga 420 cagataacaa taaacgatct tcccgttggc cgctctgtgg atgagattat acgactagtc 480 caggccttcc agttcactga caaacatggt gaagtgagtc cagctggctg gaaacctggc 540 agtgatacca tcaagcctga tgtcaacaag agcaaagagt atttctctaa gcagaagtga 600 600 <210> 5 <211> 37 <212> DNA <213> artificial sequence <220> <223> mouse PRDX1-C52S-F primer <400> 5 ctcttgactt tacttttggg agtcccacgg agatcat 37 <210> 6 <211> 37 <212> DNA <213> artificial sequence <220> <223> mouse PRDX1-C52S-R primer <400> 6 atgatctccg tgggactcac aaaagtaaag tcaagag 37 <210> 7 <211> 40 <212> DNA <213> artificial sequence <220> <223> mouse PRDX1-C71S-F primer <400> 7 atgaatttaa gaaactcaac agccaagtga ttggcgcttc 40 <210> 8 <211> 40 <212> DNA <213> artificial sequence <220> <223> mouse PRDX1-C71S-R primer <400> 8 gaagcgccaa tcacttggct gttgagtttc ttaaattcat 40 <210> 9 <211> 35 <212> DNA <213> artificial sequence <220> <223> mouse PRDX1-C83S-F primer <400> 9 ctgtggattc tcacttcagt catctggcat ggatt 35 <210> 10 <211> 35 <212> DNA <213> artificial sequence <220> <223> mouse PRDX1-C83S-R primer <400> 10 aatccatgcc agatgactga agtgagaatc cacag 35 <210> 11 <211> 33 <212> DNA <213> artificial sequence <220> <223> mouse PRDX1-C173S-F primer <400> 11 caaacatggt gaagtgagtc cagctggctg gaa 33 <210> 12 <211> 33 <212> DNA <213> artificial sequence <220> <223> mouse RDX1-C173S-R primer <400> 12 ttccagccag ctggactcac ttcaccatgt ttg 33

Claims (10)

PRDX1 (Peroxiredoxin 1) mutant protein represented by the amino acid sequence of SEQ ID NO: 3. According to claim 1,
The PRDX1 (Peroxiredoxin 1) mutant protein is characterized by inhibiting the differentiation or formation of osteoclasts, PRDX1 (Peroxiredoxin 1) mutant protein. A PRDX1 (Peroxiredoxin 1) mutant gene encoding the PRDX1 (Peroxiredoxin 1) mutant protein of claim 1. According to claim 3,
Characterized in that the gene is represented by the nucleotide sequence of SEQ ID NO: 4, PRDX1 (Peroxiredoxin 1) mutant gene. A pharmaceutical composition for preventing or treating bone diseases, comprising the PRDX1 (Peroxiredoxin 1) mutant protein of claim 1 or the PRDX1 mutant gene encoding the protein as an active ingredient. According to claim 5,
The gene is characterized in that represented by the nucleotide sequence of SEQ ID NO: 4, a pharmaceutical composition for preventing or treating bone disease. According to claim 5,
The bone disease is osteoporosis due to hyperdifferentiation of osteoclasts, facet bone disease, rickets, osteomalacia, renal osteodystrophy in patients with renal failure, rheumatoid bone disease, degenerative bone disease, bone metastatic lesion, primary A pharmaceutical composition for preventing or treating bone diseases, characterized in that it is selected from the group consisting of bone tumors, periodontal diseases, inflammatory alveolar bone resorption diseases and inflammatory bone resorption diseases. A health functional food for preventing or improving bone disease, comprising the PRDX1 (Peroxiredoxin 1) mutant protein of claim 1 or the PRDX1 mutant gene encoding the protein as an active ingredient. According to claim 8,
The gene is characterized in that represented by the nucleotide sequence of SEQ ID NO: 4, health functional food for preventing or improving bone disease. According to claim 8,
The bone disease is osteoporosis due to hyperdifferentiation of osteoclasts, facet bone disease, rickets, osteomalacia, renal osteodystrophy in patients with renal failure, rheumatoid bone disease, degenerative bone disease, bone metastatic lesion, primary A functional health food for preventing or improving bone diseases, characterized in that it is selected from the group consisting of bone tumors, periodontal diseases, inflammatory alveolar bone resorption diseases, and inflammatory bone resorption diseases.