KR20230099553A - Paecilomyces lilacinus NB265 strain, control composition comprising the same, and control method using the same - Google Patents

Abstract

The present invention relates to a Paecilomyces lilacinus NB265 strain, a pest control composition and control method comprising the same, and the strain and composition according to the present invention do not cause harm in crops, but strawberry leaf nematodes (Aphelenchoides fragariae) , it can be used as an insecticide against various pests.

Description

Paecilomyces lilacinus NB265 strain, control composition comprising the same and control method using the same {Paecilomyces lilacinus NB265 strain, control composition comprising the same, and control method using the same}

The present invention Paecilomyces lilacinus It relates to the NB265 strain, a control composition containing the same, and a control method using the same, and more specifically, a strain capable of effectively controlling pests caused by strawberry leaf nematodes ( Aphelenchoides fragariae ) without causing harm to crops, It relates to a control composition comprising the same, and a control method using the same.

Currently, the total strawberry cultivation area in Korea is 6,114 hectares and is continuously increasing, with an annual production of 203.8 thousand tons. In addition, the annual export of strawberries is more than 4,000 tons, and the export amount also reaches 53,747 thousand dollars, which is recognized as an important crop among domestic fruits.

Nematodes are small and slender animals belonging to the phylum Nematoda, and are the second largest group of animals after insects. Although nematodes adapt well to all environments and live, many nematodes parasitize on animals and plants. It is known that about 28,000 types of nematodes are distributed, including nematodes that parasitize animals such as roundworms and hookworms and nematodes that parasitize plants. Among them, it is known that there are 1,500 species of nematodes that parasitize and cause damage to plants, and it is estimated that crop losses due to nematode infection exceed 100 billion dollars annually.

Strawberry leaf nematodes ( Aphelenchoides fragariae ) are distributed worldwide, do not normally enter the strawberry leaf tissue, and externally parasitize on the inner part surrounded by several layers of leaves. The optimal temperature for growth is 20 to 23 degrees, which is similar to that of strawberries, and strawberries infected with strawberry leaf nematodes have atrophied and small leaves, new leaves are deformed, and leaves and petioles are hairless and glossy. During the seedling period, the growing point is mainly damaged, and when the damage is planted, the leaves and petioles are short and the entire plant is atrophied. Strawberry leaf nematode is the nematode that causes the most damage in strawberry cultivation, and it is known that about 10% of cultivated fields in Korea are infected.

Chemical pesticides such as phosthiazate are used as chemical control agents for strawberry leaf nematodes. However, it is known that chemical pesticides are not only toxic to humans and livestock, but also exhibit problems such as destruction of the ecosystem, residual toxicity of agricultural products, and induction of drug resistance to pests. In addition, when soil fumigation or drug spraying methods are used, it is not easy to use them due to the destruction of soil microorganisms and a great impact on the environment.

Recently, consumers of agricultural products tend to prefer low-pesticide, non-pesticide, or organic agricultural products according to changed consumption patterns, and crop growers are also pursuing eco-friendly agriculture in line with these changes. From the changed situation and environmental protection point of view, recently, biological control research has been progressing with great interest, and the need for microbial agents to control strawberry leaf nematodes in conjunction with the severity of strawberry leaf nematodes is on the rise.

Accordingly, the present inventors have found that the Paecilomyces lilacinus NB265 strain of the present invention has insecticidal activity against pests, and the strain and composition containing the same according to the present invention are effective against Aphelenchoides fragariae . It was confirmed that the control effect was excellent.

Accordingly, an object of the present invention is to provide a Paecilomyces lilacinus NB265 strain having insecticidal activity.

Another object of the present invention is Paecilomyces lilacinus ( Paecilomyces lilacinus ) NB265 strain, a culture of the strain, a concentrate of the culture, a pest, comprising at least one member selected from the group consisting of a dry matter of the culture and a culture supernatant of the strain It is to provide a composition for control.

Another object of the present invention is to provide a pest control method.

The present invention relates to a Paecilomyces lilacinus NB265 strain, a composition for controlling pests and a control method comprising the same, and the strain and composition according to the present invention can effectively control pests and diseases of plants caused by pests indicates possible effects.

Hereinafter, the present invention will be described in more detail.

One aspect of the present invention is Paecilomyces lilacinus ( Paecilomyces lilacinus ) NB265 strain having insecticidal activity.

In the present invention, the strain was isolated and identified using the 3rd instar larvae of honey bee larvae from domestic (Hwasun, Jeonnam) soil where entomopathogenic nematodes were classified, and named Paecilomyces lilacinus NB265.

In one embodiment of the present invention, Paecilomyces liracinus ( Paecilomyces lilacinus ) The ITS sequence of the NB265 strain may include the nucleotide sequence of SEQ ID NO: 1.

In the present invention, it was confirmed that Paecilomyces lilacinus NB265 strain has 99% homology with the public strain, Paecilomyces lilacinus , and the difference between the two strains was recognized. It became.

Paecilomyces lilacinus according to the present invention ( Paecilomyces lilacinus ) The homology of the NB265 strain with the previously published strain was confirmed through a Blast search of the NCBI database.

The present inventors named the obtained strain as Paecilomyces lilacinus NB265 strain, and deposited it at the Korean Agricultural Culture Collection (KACC) on March 05, 2021, and was given accession number KACC 83041BP. .

The term "pest" in the present specification refers to insects that cause pests, and pests may include agricultural pests, sanitary pests, and forest pests, but the types of pests are not limited. Insecticide targets include both adults and larvae. In one embodiment of the present invention, the pest may be strawberry leaf nematode ( Aphelenchoides fragariae ).

The term "strawberry leaf nematodes ( Aphelenchoides fragariae )" in the present specification belongs to the genus Aphelenchoides of the nematode order (Tylenchida) leaf nematodes (Aphelenchoididae), and the body length is around 1 mm, which often occurs in warm regions, and is mostly parasitic on the sprout part, especially in the center of the growth point. parasitize a lot Some infiltrate into leaf tissue, become endoparasites, and are propagated by runners. Strawberry leaf nematodes are parasitic on host plants such as violet, iris, and lily, and the initial symptoms of nematode infection are bent petiole, atrophy, and deformity of leaves. In addition, hairs on leaves and petioles are lost, luster is strengthened, side buds are increased, buds wither, and reddish light is lingering. If damaged during the flowering period, flowers and fruits become deformed or flower buds degenerate.

According to one embodiment of the present invention, the Paecilomyces lilacinus NB265 strain does not cause harm to crops such as strawberries, lettuce, cucumbers, Chinese cabbages, and tomatoes, and strawberry leaves from strawberries. It was confirmed that the control effect against nematodes ( Aphelenchoides fragariae ) was excellent (see Tables 8 and 12).

In addition, Paecilomyces lilacinus NB265 strain according to the present invention induces a synergistic effect when combined with an existing synthetic fungicide (synthetic pesticide), so even when using a synthetic pesticide at a commercial concentration or less, a level similar to that of a commercial concentration Or has more pest control effect. Therefore, it can be used to control pests and diseases in an environmentally friendly manner while reducing the amount of synthetic fungicides used at commercial concentrations.

Paecilomyces lilacinus ( Paecilomyces lilacinus ) Synthetic pesticides that can be used as a mixture with strain NB265 are carbofuran, ethoprophos, taboipje, fostiazet, azopoyuje, dazomet , Metam sodium, prochloaz manganese, fluxapyroxad, pyraclostrobin, Metalaxyl-M, pyribencarb, prothioconazole ), metconazole, tebuconazole, iprodione, fludioxonil, benomyl and/or difenoconazole, but are limited thereto It is not.

Another aspect of the present invention, Paecilomyces lilacinus ( Paecilomyces lilacinus ) NB265 strain, a culture of the strain, a concentrate of the culture, a dry matter of the culture, and a culture supernatant of the strain, Including one or more selected from the group consisting of, It is a composition for controlling pests.

In the present specification, "control" means any action to prevent or relieve plants from pests and diseases. Control can be applied without limitation if the control method for conventional plant pathogens or pests.

The term "cultivation" in this specification includes all activities performed to grow microorganisms under appropriately artificially controlled environmental conditions. In the present invention, the term "culture" as a concept including "fermentation" includes "fermented product", and the culture medium itself (ie, the culture medium containing bacteria) or the culture medium is subjected to heat treatment. It includes processed products derived from the culture medium itself, such as added processed products.

The composition according to the present invention is an active ingredient, a culture thereof, a culture thereof, a concentrate of the culture, a dried product of the culture, and / or a culture containing the cells in addition to the culture supernatant of the strain, an extract of the cells, a concentrate, a concentrate, and a dried product thereof , It may also include dilution, dilution, etc., if necessary, and may include culture medium and all conditions obtained by treating the culture.

In the present invention, the strain cultivation method, extraction method, separation method, concentration method, drying method, dilution method, etc. are not particularly limited.

A medium for culturing the strain may typically include milk proteins such as skim milk, whey, and casein, sugars, yeast extract, and the like. As the culture method, various general aerobic or anaerobic methods may be appropriately used, and after culturing the strain, the culture or the supernatant may be concentrated, dried, or diluted as necessary.

In addition, the supernatant of the culture and the cells may be separated using a centrifugal separation method or a membrane separation method, and the cells may be recovered in a concentrated state. In addition, the cells may be treated with ultrasonic waves or enzymes to extract components from the cells, or the cultures or supernatants thereof, or cells or extracts thereof may be dried. These can be used as active ingredients of the composition of the present invention.

The composition for controlling pests according to the present invention is sprayed over rice fields, fields, orchards, non-cultivated wastelands, houses, etc. using a known method, so that pests and nematodes come into contact with the composition of the present invention or ingest the composition of the present invention. By doing so, pests and nematodes can be eradicated.

The composition for controlling pests according to the present invention may be sprayed using the same method as a general pesticide spraying method. The time to spread the composition of the present invention may be before planting in the case of seeds, seed potatoes or bulbs, and in the case of soil treatment, it may be any time during the growth period after seedling planting, and for improved efficacy, sowing and raising seedlings Or it may be when seedlings are planted, and in the case of foliar distribution or division, it is good at any time during the seedling period and growth period on the farm, but is not limited thereto.

In the present invention, the composition for controlling pests may be a microbial preparation, and the microbial preparation may be formulated in a conventional manner, and may be prepared in the form of dry powder or liquid fertilizer. Specifically, the microbial agent according to the present invention may be prepared in liquid form, and may be used in the form of powder by adding an extender thereto, or may be formulated and granulated, but is not particularly limited to the formulation.

The term "microbial agent" in the present specification is a biological agent used to effectively control various plant diseases and pests that damage crops by directly using microorganisms themselves or by using agents containing microorganisms. In a specific embodiment of the present invention, the pest may be strawberry leaf nematode ( Aphelenchoides fragariae ), but is not limited thereto.

In the present invention, the microbial preparation may be prepared by adding additives such as additives, extenders, and nutrients to the strain or its culture. At this time, the additives include polycarboxylate, sodium lignosulfonate, calcium lignosulfonate, sodium dialkyl sulfosuccinate, sodium alkyl aryl sulfonate, polyoxyethylene alkyl phenyl ether, sodium tripolyphosphate, polyoxyethylene alkyl from the group consisting of aryl phosphoric esters, polyoxyethylene alkyl aryl ethers, polyoxyethylene alkyl aryl polymers, polyoxyalkylone alkyl phenyl ethers, polyoxyethylene nonyl phenyl ethers, sodium sulfonate naphthalene formaldehyde, Triton 100 and Tween 80 You may use one or more of your choice.

As the bulking agent and nutrient, one or two or more selected from the group consisting of skim milk (medium), soy flour, rice, wheat, red clay, diatomaceous earth, bentonite, dextrin, glucose, and starch may be used.

As the disintegrant, at least one selected from the group consisting of bentonite, talc, dialite, kaolin, and calcium carbonate may be used.

In the composition according to the present invention, the effective amount of the microorganisms contained in the composition may be included in the number of microorganisms of 1 to 1 X 10 ¹⁰⁰ per arable land area (m 2 ). When the composition is treated by spraying, the composition may contain strains at a microorganism concentration of 1 to 1 X 10 ¹⁰⁰ per ml, and when treated by soaking, the effective amount of the microorganisms contained in the composition is 1 to 1 X per ml. 10 ¹⁰⁰ microbes may be included.

Another aspect of the present invention is a pest control method comprising the following steps:

Paecilomyces lilacinus ( Paecilomyces lilacinus ) NB265 strain, a culture of the strain, a concentrate of the culture, a dry matter of the culture, and a contact step of contacting the plant with a composition comprising at least one member selected from the group consisting of a culture supernatant of the strain .

The term "plant" in this specification means a complete plant or a part separated from a complete plant.

In the present specification, when referred to as "plant", it may be interpreted as meaning including all plant cells, plant tissues, seeds, or plants, unless otherwise noted.

The term "plant" used herein refers to food crops including rice, wheat, barley, corn, soybean, potato, red bean, oat, and sorghum; vegetable crops including Arabidopsis, leek, bok choy, spinach, asparagus, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, cauliflower, melon, pumpkin, green onion, onion, carrot, and eggplant; special crops including gold, astragalus, ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut, and rapeseed; root vegetables including bellflower, lotus root; fruit trees including apple trees, pear trees, jujube trees, peaches, kiwi trees, grapes, tangerines, persimmons, plums, apricots, and bananas; flowers including dianthus, gypsophila, asters, roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; And it may be selected from the group consisting of feed crops including ryegrass, red clover, orchard grass, alfalfa, tall fescue, perennial ryegrass, and the like, but is not limited thereto.

The term "contact" in the present specification refers to one selected from the group consisting of Paecilomyces lilacinus NB265 strain, culture of the strain, concentrate of the culture, dry matter of the culture, and culture supernatant of the strain according to the present invention. It means exposing the composition containing the above to plants or pests. Contact can be made by spraying or applying a microbial agent, and the spraying or application method can be used without limitation as long as it is a method known in the art, and specifically, pests live around humans, animals, etc. or around plants and plants. It may be to place a microbial agent for control in a place where pests are expected to live.

The present invention relates to a Paecilomyces lilacinus NB265 strain, a pest control composition and control method comprising the same, and the strain and composition according to the present invention do not cause harm in crops, but strawberry leaf nematodes (Aphelenchoides fragariae) , it can be used as an insecticide against various pests.

1 is a photograph showing the results of a drug dissolution test on strawberries of a microbial preparation containing a Paecilomyces lilacinus NB265 strain according to an embodiment of the present invention.
Figure 2 is a photograph showing the results of the drug test for lettuce of the microbial preparation containing Paecilomyces lilacinus NB265 strain according to an embodiment of the present invention.
Figure 3 is a photograph showing the results of the phytotoxicity test on cucumber of a microbial preparation containing Paecilomyces lilacinus NB265 strain according to an embodiment of the present invention.
Figure 4 is a photograph showing the results of the drug dissolution test on Chinese cabbage of the microbial preparation containing the Paecilomyces lilacinus NB265 strain according to an embodiment of the present invention.
Figure 5 is a photograph showing the results of the phytotoxicity test on tomato of a microbial preparation containing Paecilomyces lilacinus NB265 strain according to an embodiment of the present invention.
Figure 6 is a photograph showing the results of the drug test for strawberry (variety: Seolhyang) of a microbial preparation containing Paecilomyces lilacinus NB265 strain according to an embodiment of the present invention.
Figure 7 is a photograph showing the drug efficacy test process in strawberry (variety: seolhyang) of a microbial preparation containing Paecilomyces lilacinus NB265 strain according to an embodiment of the present invention.
Figure 8 is a photograph showing the results of the drug dissolution test for strawberry (variety: Sukhyang) of a microbial preparation containing Paecilomyces lilacinus NB265 strain according to an embodiment of the present invention.
9 is a photograph showing the results of a drug dissolution test for strawberry (variety: Sukhyang) of a microbial preparation containing Paecilomyces lilacinus NB265 strain according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1: Paesillomyces liracinus ( Paecilomyces lilacinus ) sympathy

In domestic (Hwasun, Jeollanam-do) soil where entomopathogenic nematodes are classified, a single cell isolated and identified using the 3rd instar larvae of honey bee fantail moth is inoculated into a new PDA (Potato Dextrose Agar) medium using Platinum Lee at 25 ° C. After culturing for 4 days to secure a single strain, 30mL culture medium inoculated into 30ml PDB (Potato Dextrose Broth) medium and cultured with shaking (rotational speed 180rpm) for 4 days at 25 ° C. was used as the primary culture (3,000ml) inoculum. A 3,000mL culture medium cultured under the same culture conditions was used as an inoculum for the secondary culture (30,000ml). A 30,000mL culture medium cultured under the same culture conditions was used as an inoculum for the 3rd culture (300,000ml). A 300,000 mL culture medium cultured under the same culture conditions was used as an inoculum for the final (fourth) culture (3,000,000 ml).

The present inventors Paecilomyces lilacinus ( Paecilomyces lilacinus ) It was named NB265, and the strain was cultured. Strawberry leaf nematodes ( Aphelenchoides fragariae ) control composition (microbial agent) was prepared so as to include the concentration of the cultured strain as an active ingredient at a concentration of 5.1 x 10 ⁷ CFU/mL (g). The prepared composition was diluted 1:10 ⁵ , 100 μL each was inoculated into Difco ^™ Potato Dextrose Agar (Becton, Dickinson and Company) medium, cultured at 25° C. for 4 days, and dominant microbial colonies were selected. Among the selected colonies, colonies having the same type as the representative effective microorganisms were pure isolated. The gene sequence (ITS region) of the pure isolated colony was analyzed and homology of the analyzed sequence was compared with previously known strains. The nucleotide sequence of the ITS region of the cultured strain is shown in Table 1, and the homology analysis results are shown in Table 2.

sequence number denomination Sequence Listing (5'-> 3') note One ITS_sequence AAAATCGTAACAAGGTTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCTGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAA ACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCGC AGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCGTAAAACGCCCAACTTTCTTAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCA

Sequences producing significant alignments Accession Description Max score Total score Query cover E value Ident AB103380.1 Paecilomyces lilacinus gene for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence 1096 1096 100% 0.0 99.83%

As a result of nucleotide sequence and homology analysis of the ITS region, cultured Paecilomyces lilacinus ( Paecilomyces lilacinus ) The NB265 strain was identified as a strain having 99% similarity with Paecilomyces lilacinus .

Example 2: Seed plant phytotoxicity test

Paecilomyces lilacinus cultured in Example 1 ( Paecilomyces lilacinus ) Containing the NB265 strain as an active ingredient After transplantation of crops (strawberries, Chinese cabbage, lettuce, tomatoes, cucumbers) according to the application of the control composition, the effect on seedlings was examined.

Strawberries, Chinese cabbages, lettuce, tomatoes, and cucumbers, which are test crops, were drenched with the control composition after planting (seeding). The size of the pot was set to Φ 10cm, the soil (loam soil) + bed soil was set at a ratio of 5:5 for the soil used in the test, and the average temperature in the house was 22.7 ℃. The prepared control composition was treated with a standard amount (1000-fold dilution, 120 L / 100 pyeong, 100 ml / week) or double amount (500-fold dilution, 120 L / 100 pyeong, 100 ml / week). In addition, as shown in Table 3, strawberries, cabbages, lettuce, tomatoes and cucumbers of the control composition prepared by repeating the complete random arrangement method 3 times were drenched after planting, and after 7, 14, and 21 days three times, whether or not there was any apparent weakness A lunar survey was conducted.

division number of crops number of treatments number of iterations number of muzzles Ports per District Total number of required ports weakness test 5 3 3 45 5 ports 225 port

As can be seen in Table 4 and Figs. 1 to 5, as a result of the seedling toxicity test, there was no weakness (weakness criteria result: 0) for the reference amount and fold in all 5 test crops.

Test crop (variety) processing details Weakness (0-4) final result Day 7 after treatment Day 14 after treatment Day 21 after treatment Strawberry (Seolhyang) reference amount 0 0 0 no weakness Doubling 0 0 0 no weakness Cabbage (Bulam Plus) reference amount 0 0 0 no weakness Doubling 0 0 0 no weakness Lettuce (red skirt) reference amount 0 0 0 no weakness Doubling 0 0 0 no weakness Cucumber (Joeunbaekdadagi) reference amount 0 0 0 no weakness Doubling 0 0 0 no weakness Tomato (Ho Yong) reference amount 0 0 0 no weakness Doubling 0 0 0 no weakness

Example 3: Strawberry leaf nematode ( Aphelenchoides fragariae ) Confirm control effect - 1

3-1. weakness test

Paecilomyces lilacinus cultured in Example 1 ( Paecilomyces lilacinus ) Containing the NB265 strain as an active ingredient It was confirmed that the composition for control against strawberries (variety: Seolhyang).

After transplantation (seeding) of the test crop strawberry, the control composition was drenched. Mixed use and treatment with other drugs were not performed during the test period, and the planting distance was set at 20 X 15 cm and cultivated using a high snow bed in the facility. The prepared control composition was treated with a 1000-fold diluted reference amount (100ml/week) or a 500-fold diluted double amount (100ml/week). And, as shown in Table 5, the drug resistance of the prepared composition for controlling strawberries was evaluated by examining the appearance of weakness three times 7, 14, and 21 days after drug treatment through 3 repetitions of the egg mass method. The pesticide investigation was conducted according to the following criteria: 0: no damage to the naked eye, 1: very mild damage to the plant body and recovered within 7 days, 2: plant growth slightly inhibited or weak in a small area is recognized, 3: about 50% of the crop body is weakened, 4: it has received considerable damage, but there are still healthy parts, 5: it has been severely damaged and is in a state of death.

division number of treatments number of iterations number of muzzles area per ward required area total required area weakness test 3 3 9 5 m ² 45 m ² 105 m ²

As can be seen from the results of the drug test, Table 6 and FIG. 6, no drug harm was found in the standard amount and fold in strawberries (variety: Seolhyang).

test crop degree of weakness note reference amount Doubling Strawberry (Seolhyang) 0 0 no weakness

3-2. drug efficacy test

Paecilomyces lilacinus cultured in Example 1 ( Paecilomyces lilacinus ) Containing the NB265 strain as an active ingredient The efficacy of the control composition against strawberries (variety: Seolhyang) was confirmed.

After transplantation (seeding) of the test crop strawberry, the control composition was drenched. Mixed use and treatment with other drugs were not performed during the test period, and the planting distance was set at 20 X 15 cm. Strawberry leaf nematodes ( Aphelenchoides fragariae ) were induced in the treatment and non-treatment groups. The prepared control composition was diluted 1,000 times and treated with 100ml per week. And, as shown in Table 7, the number of parasites for 10 weeks per group was investigated once 64 days after drug treatment through 3 repetitions of the egg mass method, and the significant difference test between treatment groups was significant at the 95% level by Duncan's multiple range test (DMRT). was tested. At this time, as an evaluation criterion, the number of parasites after 64 days in the treated and untreated groups was compared with the minimum occurrence rate of 50 or more in the untreated group.

division number of treatments number of iterations number of muzzles area per ward required area total required area drug efficacy test 2 3 6 10m ² 60 m ² 105 m ²

As can be seen in Table 8, as a result of the test, the average incidence rate of untreated animals was 78.3 animals, which was a sufficient condition for evaluating the drug, and the control effect of the composition for control according to the present invention was 61.7% after 64 days and showed statistical significance compared to the untreated group. . As a result, Paecilomyces lilacinus ( Paecilomyces lilacinus ) The composition containing strain NB265 as an active ingredient showed a high control value, and the strain and composition are considered to be practical against strawberry leaf nematodes.

Test drug Insecticide (Marie) Significant difference (DMRT) Control (%) 1 repeat repeat 2 3 repetitions average treatment 31.0 21.0 38.0 30.0 b 61.7 untreated 86.0 71.0 78.0 78.3 a - C.V.(%) ------------------------------- 10.0

Example 4: Strawberry leaf nematode ( Aphelenchoides fragariae ) Confirm control effect - 2

4-1. weakness test

Paecilomyces lilacinus cultured in Example 1 ( Paecilomyces lilacinus ) Containing the NB265 strain as an active ingredient It was confirmed that the composition for control against strawberry (variety: Sukhyang).

After transplantation (seeding) of the test crop strawberry, the control composition was drenched. Mixed use and treatment with other drugs were not performed during the test period, and the planting distance was set at 20 X 20 cm, and soil cultivation was carried out in the facility. The prepared control composition was treated with a standard amount diluted 1000 times or a double amount diluted 500 times. And, as shown in Table 9, the drug resistance of the prepared composition for controlling strawberries was evaluated by examining the appearance of weakness three times 7, 14, and 21 days after drug treatment through three repetitions of the egg mass method. The pesticide investigation was conducted according to the following criteria: 0: no damage to the naked eye, 1: very mild damage to the plant body and recovered within 7 days, 2: plant growth slightly inhibited or weak in a small area is recognized, 3: about 50% of the crop body is weakened, 4: it has received considerable damage, but there are still healthy parts, 5: it has been severely damaged and is in a state of death.

division number of treatments number of iterations number of muzzles area per ward required area total required area weakness test 3 3 9 5 m ² 45 m ² 105 m ²

As a result of the drug test, as can be seen in Table 10 and FIG. 8, the strawberry (variety: Sukhyang) did not show any drug damage to the reference amount and fold.

test crop degree of weakness note reference amount Doubling Strawberry (Sukhyang) 0 0 no weakness

4-2. drug efficacy test

Paecilomyces lilacinus cultured in Example 1 ( Paecilomyces lilacinus ) Containing the NB265 strain as an active ingredient The medicinal effect of the control composition on strawberries (variety: Sukhyang) was confirmed.

After transplantation (seeding) of the test crop strawberry, the control composition was drenched. Mixed use and treatment with other drugs were not performed during the test period, and the planting distance was set at 20 X 20 cm. Strawberry leaf nematodes ( Aphelenchoides fragariae ) were induced in the treatment and non-treatment groups. The prepared control composition was diluted 1,000 times and treated with 100ml per week. And, as shown in Table 11, the number of parasites for 10 weeks per group was investigated once after 70 days after drug treatment through 3 repetitions of the egg mass method, and the significant difference test between treatment groups was significant at the 95% level by Duncan's multiple range test (DMRT). was tested. At this time, as an evaluation criterion, the number of parasites after 70 days in the treated and untreated groups was compared with the minimum occurrence rate of 50 or more in the untreated group.

division number of treatments number of iterations number of muzzles area per ward required area total required area drug efficacy test 2 3 6 10m ² 60 m ² 105 m ²

As can be seen in Table 12, the average incidence rate of untreated animals was 108.3, which was a sufficient condition for evaluating the drug, and the control effect of the control composition according to the present invention was 58.4% after 70 days and showed statistical significance compared to the untreated group. . As a result, Paecilomyces lilacinus ( Paecilomyces lilacinus ) The composition containing strain NB265 as an active ingredient showed a high control value, and the strain and composition are considered to be practical against strawberry leaf nematodes.

Test drug Insecticide (Marie) Significant difference (DMRT) Control (%) 1 repeat repeat 2 3 repetitions average treatment 32.0 49.0 54.0 45.0 b 58.4 untreated 95.0 123.0 107.0 108.3 a - C.V.(%) ------------------------------- 9.7

Agricultural Biotechnology Research Institute KACC83041BP 20210305

<110> Nambo Co., Ltd. <120> Paecilomyces lilacinus NB265 strain, control composition the same, and control method using the same <130> PN210268 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 596 <212> DNA <213> artificial sequence <220> <223> ITS_sequence <400> 1 aaaatcgtaa caaggtctcc gttggtgaac cagcggaggg atcattaccg agttatacaa 60 ctcccaaacc cactgtgaac cttacctcag ttgcctcggc gggaacgccc cggccgcctg 120 cccccgcgcc ggcgccggac ccaggcgccc gccgcaggga ccccaaactc tcttgcatta 180 cgcccagcgg gcggaatttc ttctctgagt tgcacaagca aaaacaaatg aatcaaaact 240 ttcaacaacg gatctcttgg ttctggcatc gatgaagaac gcagcgaaat gcgataagta 300 atgtgaattg cagaattcag tgaatcatcg aatctttgaa cgcacattgc gcccgccagc 360 attctggcgg gcatgcctgt tcgagcgtca tttcaaccct cgagcccccc cgggggcctc 420 ggtgttgggg gacggcacac cagccgcccc cgaaatgcag tggcgacccc gccgcagcct 480 cccctgcgta gtagcacaca cctcgcaccg gagcgcggag gcggtcacgc cgtaaaacgc 540 ccaactttct tagagttgac ctcggatcag gtaggaatac ccgctgaact taagca 596

Claims (12)

Paecilomyces lilacinus ( Paecilomyces lilacinus ) NB265 strain having insecticidal activity. The strain according to claim 1, wherein the internal transcribed spacer (ITS) sequence of the strain comprises the nucleotide sequence of SEQ ID NO: 1. The strain according to claim 1, wherein the strain is deposited under accession number KACC 83041BP. Paecilomyces lilacinus ( Paecilomyces lilacinus ) NB265 strain, a culture of the strain, a concentrate of the culture, a dry matter of the culture, and a pest control comprising at least one member selected from the group consisting of the culture supernatant of the strain. composition. The composition according to claim 4, wherein the pest is strawberry leaf nematode ( Aphelenchoides fragariae ). The composition of claim 4, wherein the strain's internal transcribed spacer (ITS) sequence comprises the nucleotide sequence of SEQ ID NO: 1. The composition according to claim 4, wherein the strain is deposited under accession number KACC 83041BP. A pest control method comprising the following steps:
Paecilomyces lilacinus ( Paecilomyces lilacinus ) NB265 strain, a culture of the strain, a concentrate of the culture, a composition comprising at least one selected from the group consisting of a dry matter of the culture and a culture supernatant of the strain to a plant contacting step. The method of claim 8, wherein the pest is strawberry leaf nematode ( Aphelenchoides fragariae ). The method of claim 8, wherein the internal transcribed spacer (ITS) sequence of the strain comprises the nucleotide sequence of SEQ ID NO: 1. The method according to claim 8, wherein the strain is deposited under accession number KACC 83041BP. The method of claim 8, wherein the plant is a strawberry.

Images