KR20230099414A - Recombinant Yarrowia lipolytica for producing isopropanol and method for preparing isopropanol using thereof - Google Patents

Abstract

The present invention relates to a recombinant Yarrowia lipolytica strain for producing isopropanol and a method for mass-producing isopropanol using the same, and specifically, the present invention relates to a thl (thiolase) or nphT7 (acetoacetyl CoA synthase) gene; atoDA (acetoacetyl-CoA transferase) gene; adh (alcohol dehydrogenases) gene; And adc (acetoacetate decarboxylase) gene is sequentially linked to a recombinant Yarrowia lipolytica strain for producing isopropanol transformed with a recombinant expression vector and a method for mass-producing isopropanol from the recombinant Yarrowia lipolytica strain. .

Description

Recombinant Yarrowia lipolytica strain for producing isopropanol and method for mass production of isopropanol using the same

The present invention relates to a recombinant Yarrowia lipolytica strain for isopropanol production and a method for mass production of isopropanol using the same.

Isopropanol, a structurally simple secondary alcohol, plays an important role industrially as a fuel and a precursor for bioplastics. In addition, since it is strongly soluble in various types of organic solvents, it is mixed with gasoline fuel and used in various fields such as ice removers, external alcohol and detergents, disinfectants, hand sanitizers, and pharmaceuticals. am.

The production of general isopropanol has a problem in that it causes environmental pollution because it is mostly produced by chemical methods. On the other hand, the production of isopropanol through microorganisms has the advantage of being environmentally friendly, but it is mainly produced through Clostridium sp. there is a problem.

Therefore, studies to solve this problem are being continued, but there is still no technology capable of effectively producing only isopropanol using microorganisms.

Korea Patent Registration 10-1466223 Korea Patent No. 10-1346615

Accordingly, the present inventors use a Yarrowia lipolytica strain, which is a type of yeast, to synthesize acetoacetyl-CoA in lipid metabolism, enhance lipid production pathways, and introduce foreign genes into isopropanol production pathways in the strains. An introduced recombinant Yarrowia lipolytica strain was prepared, and the present invention was completed by confirming that isopropanol could be effectively mass-produced when the strain was used.

Therefore, an object of the present invention is thl (thiolase) or nphT7 (acetoacetyl CoA synthase) gene; atoDA (acetoacetyl-CoA transferase) gene; adh (alcohol dehydrogenases) gene; and adc (acetoacetate decarboxylase) genes are sequentially linked to provide a recombinant Yarrowia lipolytica strain transformed with a recombinant expression vector for producing isopropanol.

Another object of the present invention is to provide a method for mass-producing isopropanol using the recombinant Yarrowia lipolytica strain of the present invention.

Therefore, the present invention is a thl (thiolase) or nphT7 (acetoacetyl CoA synthase) gene; atoDA (acetoacetyl-CoA transferase) gene; adh (alcohol dehydrogenases) gene; and adc (acetoacetate decarboxylase) gene valency is sequentially linked to provide a recombinant Yarrowia lipolytica strain transformed with a recombinant expression vector for isopropanol production.

In one embodiment of the present invention, the thl gene may consist of the nucleotide sequence of SEQ ID NO: 13.

In one embodiment of the present invention, the nphT7 gene may consist of the nucleotide sequence of SEQ ID NO: 14.

In one embodiment of the present invention, the atoDA gene may consist of the nucleotide sequence of SEQ ID NO: 2.

In one embodiment of the present invention, the adc gene may consist of the nucleotide sequence of SEQ ID NO: 1.

In one embodiment of the present invention, the adh gene may consist of the nucleotide sequence of SEQ ID NO: 3.

In one embodiment of the present invention, the recombinant expression vector thl (thiolase) gene; atoDA (acetoacetyl-CoA transferase) gene; adh (alcohol dehydrogenases) gene; and adc (acetoacetate decarboxylase) gene may be sequentially linked to each other and include a pYLEX1THLIPA expression vector.

In one embodiment of the present invention, the recombinant expression vector nphT7 (acetoacetyl CoA synthase) gene; atoDA (acetoacetyl-CoA transferase) gene; adh (alcohol dehydrogenases) gene; and adc (acetoacetate decarboxylase) gene may be sequentially connected and included in the pYLEX1NphT7IPA expression vector.

In addition, the present invention comprises the steps of culturing the recombinant Yarrowia lipolytica strain for isopropanol production of the present invention; And it provides a method for mass production of isopropanol, comprising the step of obtaining isopropanol produced from the recombinant Yarrowia lipolytica strain.

In one embodiment of the present invention, obtaining the isopropanol may be obtained from the strain itself, a culture of the strain, or a culture medium of the strain.

In one embodiment of the present invention, the culture may be to use glycerol or glucose as a carbon source.

In one embodiment of the present invention, the glycerol or glucose may be contained in 2 to 10% by weight in the culture medium.

The recombinant Yarrowia lipolytica strain for producing isopropanol according to the present invention has a thl (thiolase) or nphT7 (acetoacetyl CoA synthase) gene; atoDA (acetoacetyl-CoA transferase) gene; adh (alcohol dehydrogenases) gene; and adc (acetoacetate decarboxylase) gene, which can sustainably maintain acetylCoA expression in the recombinant strain and overexpress genes of the isopropanol production pathway, so that the wild-type Yarrowia lipolytica strain is In contrast to the inability to produce isopropanol, the recombinant Yarrowia lipolytica strain has the effect of being able to mass-produce isopropanol in an environmentally friendly manner with excellent efficiency.

1 is a schematic diagram of a recombinant pYLEX1IPA expression vector into which adc , adh and atoDA genes are introduced for introduction of an isopropanol production pathway into a Yarrowia lipolytica strain in one embodiment of the present invention.
Figure 2 shows a schematic diagram of a recombinant pYLEX1THLIPA expression vector and a pYLEX1NphT7IPA expression vector into which a thl or nphT7 gene was introduced to enhance the acetoacetyl-CoA production pathway into Yarrowia lipolytica strains in one embodiment of the present invention.
Figure 3 is a schematic diagram showing the isopropanol production pathway in the recombinant Yarrowia lipolytica strain in which the isopropanol production pathway was introduced and the acetoacetyl-CoA production pathway was enhanced according to the present invention. In Figure 3, the purple color shows the isopropanol production pathway introduced, and the yellow and pink colors show the gene introduction pathway related to the enhancement of acetoacetyl-CoA production, and the introduced foreign genes are inserted into the genomic DNA of Yarrowia lipolytica. exist.
Figure 4 shows the results of analyzing the isopropanol production from the recombinant Yarrowia lipolytica strain prepared in the present invention, A is a graph showing the growth over time of each strain, B is the result of measuring the isopropanol production of each strain it is shown
Figure 5 shows the results of measuring isopropanol production from the recombinant Yarrowia lipolytica strain of the present invention in the state of using glycerol or glucose as a carbon source, A is a graph showing the growth of each strain over time, B is each strain It shows the result of measuring isopropanol production.

The present invention is characterized by providing a recombinant microorganism for producing isopropanol capable of mass-producing isopropanol with high efficiency.

As a way to solve the problem of environmental pollution in isopropanol production technology, research on producing isopropanol from microorganisms is being conducted, but most of the isopropanol production through microorganisms developed so far is a technology using Clostridium strains, There was a problem that other types of alcohol such as butanol were mixed.

Accordingly, while the present inventors were studying the development of microorganisms capable of effectively mass-producing only isopropanol while using microorganisms, the recombinant Yarrowia lipolytica introduced a foreign gene into a strain of Yarrowia lipolytica , a type of yeast. A strain of tika was prepared, and it was confirmed that isopropanol could be effectively mass-produced therefrom. The Yarrowia lipolytica strain selected in the present invention is a yeast recognized for its stability and is known as fat-producing yeast.

Specifically, the recombinant microorganism for isopropanol production provided by the present invention is a Yarrowia lipolytica strain, thl (thiolase) or nphT7 (acetoacetyl CoA synthase) gene related to acetoacetyl CoA production pathway enhancement, isopropanol production pathway related gene, AtoDA (acetoacetyl-CoA transferase) gene, adh (alcohol dehydrogenases) gene, and adc (acetoacetate decarboxylase) gene are introduced.

The thl gene, which is a foreign gene introduced to prepare a recombinant Yarrowia lipolytica strain for isopropanol production, may consist of the nucleotide sequence of SEQ ID NO: 13, and the nphT7 gene may consist of the nucleotide sequence of SEQ ID NO: 14.

In addition, the atoDA gene may have the nucleotide sequence of SEQ ID NO: 2, the adc gene may have the nucleotide sequence of SEQ ID NO: 1, and the adh gene may have the nucleotide sequence of SEQ ID NO: 3.

According to one embodiment of the present invention, atoDA (acetoacetyl-CoA transferase) gene, which is an isopropanol production pathway-related gene, in pYLEX1 vector for the production of a recombinant Yarrowia lipolytica strain for isopropanol production; adh (alcohol dehydrogenases) gene; and adc (acetoacetate decarboxylase) genes were cloned to prepare pYLEX1IPA, a recombinant expression vector into which the genes were introduced.

Then, a recombinant expression vector was prepared by additionally introducing thl (thiolase) or nphT7 (acetoacetyl CoA synthase) genes, which are factors related to acetoacetyl CoA production pathway enhancement, into the pYLEX1IPA vector into which the atoDA , adc , and adh genes were introduced. As a result, , pYLEX1THLIPA recombinant expression vector into which the thl gene was introduced and pYLEX1NphT7IPA recombinant expression vector into which the nphT7 gene was introduced were respectively prepared.

Then, each of the Yarrowia lipolytica strains was transformed with the recombinant expression vector to prepare a transformant, a recombinant Yarrowia lipolytica strain for isopropanol production, respectively.

Therefore, the present invention is a thl (thiolase) or nphT7 (acetoacetyl CoA synthase) gene; atoDA (acetoacetyl-CoA transferase) gene; adh (alcohol dehydrogenases) gene; And adc (acetoacetate decarboxylase) genes can be provided with a recombinant Yarrowia lipolytica strain for producing isopropanol transformed with a recombinant expression vector containing sequentially linked genes.

The recombinant Yarrowia lipolytica strain of the present invention can sustainably maintain the expression of AcetylCoA within the strain and can overexpress the genes of the isopropanol production pathway, ultimately not producing isopropanol Wild-type Yarrowia lipolytica Compared to the Tica strain, the recombinant Yarrowia lipolytica strain can mass-produce isopropanol with excellent new efficiency.

Furthermore, the present invention can provide a method for mass production of isopropanol using the Yarrowia lipolytica strain according to the present invention.

The method preferably comprises: (1) culturing the recombinant Yarrowia lipolytica strain for producing isopropanol of the present invention; and (2) obtaining isopropanol produced from the recombinant Yarrowia lipolytica strain.

The recombinant Yarrowia lipolytica strain for isopropanol production in step (1) has a thl (thiolase) or nphT7 (acetoacetyl CoA synthase) gene for the above-described isopropanol production enhancement; atoDA (acetoacetyl-CoA transferase) gene; adh (alcohol dehydrogenases) gene; and a recombinant Yarrowia lipolytica strain into which an acetoacetate decarboxylase ( adc ) gene has been introduced.

In addition, the culture may be cultured using a medium using glycerol or glucose as a carbon source, and the glycerol or glucose may be contained in the culture medium at 2 to 10% by weight. Preferably, a medium containing the glycerol or glucose at 8% by weight may be used.

In one embodiment of the present invention, after culturing the recombinant Yarrowia lipolytica strain of the present invention using a medium containing glycerol or glucose, the production of isopropanol was analyzed. However, it was confirmed that a significant amount of isopropanol was produced even when a glycerol-containing medium was used.

Therefore, when using the recombinant strain according to the present invention, it was found that relatively worthless waste glycerol could be used as a carbon source, and isopropanol could be economically produced.

In the step (2), isopropanol may be obtained by recovering the recombinant strain itself or the culture medium of the strain or the culture medium of the strain.

In the present invention, the term "vector" means a DNA preparation containing DNA sequences operably linked to suitable regulatory sequences capable of expressing the DNA in a suitable host. Vectors can be plasmids, phage particles, or simply latent genomic inserts. Once transformed into a suitable host, the vector can replicate and function independently of the host genome or, in some cases, can integrate into the genome itself. As the plasmid is currently the most commonly used form of vector, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. However, the present invention includes other forms of vectors having functions equivalent to those known or becoming known in the art.

In the present invention, "amplification" means to increase the activity of a corresponding enzyme by mutating, substituting, or deleting some bases of a corresponding gene, introducing some bases, or introducing a gene derived from another microorganism encoding the same enzyme. It is a concept that encompasses

In the present invention, the expression “expression control sequence” means a DNA sequence essential for the expression of an operably linked coding sequence in a specific host organism. Such regulatory sequences include promoters for effecting transcription, optional operator sequences for regulating such transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences regulating termination of transcription and translation. For example, regulatory sequences suitable for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells include promoters, polyadenylation signals and enhancers. The factor most influencing the amount of expression of a gene in a plasmid is a promoter.

In order to express the DNA sequence of the present invention, any of a wide variety of expression control sequences can be used in the vector. Useful expression control sequences include, for example, SV40 or adenovirus early and late promoters, lac system, trp system, TAC or TRC system, T3 and T7 promoters, major operator and promoter regions of phage lambda, fd code regulatory regions of proteins, promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, promoters of said phosphatases, e.g. Pho5, promoters of yeast alpha-mating systems and prokaryotic or eukaryotic cells or their viruses. Other sequences, both constitutive and inducible, known to modulate the expression of a gene, and various combinations thereof, are included.

A nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. This may be a gene and regulatory sequence(s) linked in such a way that when a suitable molecule (eg, transcriptional activating protein) is bound to the regulatory sequence(s), it enables gene expression. For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a pre-protein that participates in secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence if it affects transcription of the sequence; or the ribosome binding site is operably linked to a coding sequence if it affects transcription of the sequence; or the ribosome binding site is operably linked to a coding sequence when positioned to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading frame. However, enhancers do not have to contact. Linkage of these sequences is accomplished by ligation (linkage) at convenient restriction enzyme sites. If such a site does not exist, a synthetic oligonucleotide adapter or linker according to a conventional method is used.

As used herein, the term “expression vector” usually refers to a double-stranded DNA fragment as a recombinant carrier into which a heterologous DNA fragment is inserted. Here, heterologous DNA refers to heterologous DNA, which is DNA not found naturally in the host cell. Once in a host cell, an expression vector can replicate independently of the host chromosomal DNA and several copies of the vector and its inserted (heterologous) DNA can be produced.

As is well known in the art, in order to increase the expression level of a transfected gene in a host cell, the gene must be operably linked to transcriptional and translational expression control sequences that function in the selected expression host. Preferably, the expression control sequence and the corresponding gene are included in one expression vector that includes a bacterial selectable marker and a replication origin together. When the expression host is a eukaryotic cell, the expression vector must further contain an expression marker useful in the eukaryotic expression host.

Host cells transformed or transfected with the expression vectors described above constitute another aspect of the present invention. As used herein, the term “transformation” means introducing DNA into a host so that the DNA becomes replicable as an extrachromosomal factor or by completion of chromosomal integration. As used herein, the term “transfection” refers to acceptance of an expression vector by a host cell, whether or not any coding sequences are actually expressed.

Host cells of the invention may be prokaryotic or eukaryotic cells. In addition, a host with high efficiency of DNA introduction and high expression efficiency of the introduced DNA is usually used. Known eukaryotic and prokaryotic hosts such as Escherichia coli, Pseudomonas, Bacillus, Streptomyces, fungi, and yeast are examples of host cells.

Of course, it should be understood that not all vectors and expression control sequences function equally well in expressing the DNA sequences of the present invention. Likewise, not all hosts function equally well for the same expression system. However, those skilled in the art can appropriately select among various vectors, expression control sequences, and hosts without undue experimental burden and without departing from the scope of the present invention. For example, in selecting a vector, consideration must be given to the host, since the vector must replicate within it. The vector's copy number, ability to control copy number, and expression of other proteins encoded by the vector, such as antibiotic markers, should also be considered.

Even in selecting expression control sequences, various factors must be considered. For example, relative strength of the sequence, controllability and compatibility with the DNA sequences of the present invention should be considered, particularly with respect to potential secondary structures. A unicellular host is a selected vector, the toxicity of the product encoded by the DNA sequence of the present invention, the secretion characteristics, the ability to correctly fold proteins, culture and fermentation requirements, and the product encoded by the DNA sequence of the present invention into the host. It must be selected in consideration of factors such as ease of purification from

Hereinafter, the present invention will be described in more detail through examples. These examples are intended to explain the present invention in more detail, and the scope of the present invention is not limited to these examples.

<Example 1>

Preparation of recombinant Yarrowia lipolytica strain endowed with isopropanol production ability

The present inventors prepared a recombinant microorganism in the following manner using Yarrowia lipolytica for the production of a recombinant microorganism capable of mass-producing isopropanol.

<1-1> Preparation of recombinant vector for introduction of isopropanol production route and preparation of transformed Yarrowia lipolytica strain

As shown in Figure 1, for the production of isopropanol in the Yarrowia lipolytica strain, atoDA , adc , and adh genes were prepared as follows. A recombinant pYLEX1IPA vector was prepared by introducing the atoDA , adc , and adh genes into the pYLEX1 vector. To prepare the recombinant pYLEX1IPA vector, the atoDA gene was amplified using the genomic DNA of E. coli K12 as a template, and the adc gene was Clostridium acetobutylly The genomic DNA of Clostridium acetobutylicum ATCC 842 was amplified as a template, and the adh gene sequence derived from Clostridium beijerinckii NRRL B593 was amplified through cosmo GENTECH for yeast codon optimization. It was finally synthesized through codon optimization.

Specifically, the amplification of the adc gene was performed by PCR using forward and reverse primers (Xcm1_adc_F, Kpn1_adc_R) containing the corresponding restriction enzyme sequence of the vector for cloning into the pYLEX1 vector, resulting in 735 bp of the adc gene of SEQ ID NO: 1. The sequence was obtained, and then the atoDA and adh genes were ligated by overlap PCR and introduced into the pYLEX1 vector. For cloning of the atoDA and adh genes into vectors, PCR was performed using forward and reverse primers (SpeI_atoDA_F, ClaI_atoDA_R; Sac1_adh_F, Pac1_adh_R) containing restriction enzyme sequences, resulting in 1313 bp of the atoDA gene sequence of SEQ ID NO: 2 and The adh gene sequence of SEQ ID NO: 3 of 1056 bp was obtained. In addition, the atoDA - adh linkage sequence was subjected to PCR using forward and reverse primers (Pmel1_atoDAadh_F, BamH1_atoDAadh_R) containing restriction enzyme sequences for cloning, and as a result, a 2411 bp atoDA - adh linkage sequence of SEQ ID NO: 4 was obtained. . Each of the prepared genes was treated with a restriction enzyme in the pYLEX1 vector, and then a recombinant pYLEX1IPA vector was prepared through a ligation reaction, and transformed into an E. coli DH5a strain and a Yarrowia lipolytica strain, respectively, to prepare a transformed microorganism. . In addition, the primer sequences used to secure each gene sequence are listed in Table 1 below.

primer sequence Primer name Sequence (5‘->3’) sequence number Xcm1_adc_F ATCCAGTCCGACTCTGGATGTTAAAGGATGAAGTAATTAAACAAATTAGCAC 5 Kpn1_adc_R CCGGTACCTTACTTAAGATAATCATATATAACTTCAGCTCTAGGC 6 speI_atoDA_F GCGCACTAGTATGAAAACAAAATTGATGACAT 7 ClaI_atoDA_R TTTAATCGATTCATAAATCACCCCG 8 Sac1_adh_F GCGCCACAATGAAAACAAATTGATGACAT 9 Pac1_adh_R CTTAATTAATTACAGGATAACCACTGCCTT 10 Pmel1_atoDAadh_F GCGCCACGTGATGAAAACAAAATTGATGACAT 11 BamH1_atoDAadh_R TAAGGATCCTTACAGGATAACCACTGCCTT 12

<1-2> Preparation of recombinant vector for enhancing acetoacetyl-CoA production pathway and preparation of transformed Yarrowia lipolytica strain

As shown in Figure 2 based on the recombinant pYLEX1IPA vector prepared in Example <1-1>, the Yarrowia lipolytica strain overexpresses the acetoacetyl CoA synthesis pathway gene, thl or nphT7 , to enhance the isopropanol production pathway. The pYLEX1THLIPA vector and the pYLEX1NphT7IPA vector, which can be recombinant expression vectors, were respectively constructed, and a transformed Yarrowia lipolytica strain having an enhanced isopropanol production pathway was prepared.

Specifically, to prepare the recombinant pYLEX1THLIPA expression vector, the thl gene was amplified using the genomic DNA of Clostridium acetobutylicum ATCC 842 as a template, and to prepare the recombinant pYLEX1NphT7IPA expression vector, the nphT7 gene was cosmo Streptomyces sp. Based on the nphT7 gene sequence derived from (strain CL190), it was finally synthesized by optimizing codons for yeast.

For cloning of the thl gene, PCR was performed using forward and reverse primers (Xcm1_thl_F, Kpn1_thl_R) containing the corresponding restriction enzyme sequence of the vector, and as a result, the thl gene sequence of SEQ ID NO: 13 of 1179 bp was obtained. The thl gene and the pYLEX1IPA vector amplified through PCR were treated with restriction enzymes, and then ligation was performed to prepare a recombinant pYLEX1THLIPA expression vector, which was then transformed into Escherichia coli DH5a and Yarrowia lipolytica strains, respectively. converted.

In addition, PCR was performed on the nphT7 gene using primers (Gibson_nphT7_F, Gibson_nphT7_R), and as a result, the nphT7 gene of SEQ ID NO: 14 of 1027 bp was obtained. The restriction enzyme DpnI-treated nphT7 sequence and the YLEX1IPA vector were subjected to a ligation reaction using a Gibson assembly kit to prepare a recombinant pYLEX1NphT7IPA expression vector, which was transformed into Escherichia coli DH5a and Yarrowia lipolytica strains, respectively. . The nucleotide sequence of each primer used to prepare each of the recombinant expression vectors is as shown in Table 2 below.

primer sequence Primer name Sequence (5‘->3’) sequence number Gibson_nphT7_F TACAACCACACACATCCACAATGACGGATGTTCGATTCC 15 Gibson_nphT7_R CAATTTTGTTTTCATCACCTACCACTCGATAAGTGCG 16 Xcm1_thl_F ATCCAGTCCGACTCTGGATGAAAGAAGTTGTAATAGCTAGTG 17 Kpn1_thl_R CCGGTACCTTACTTAAGATAATCATATATAACTTCAGCTCTAGGC 18

<Example 2>

Confirmation of mass production of isopropanol using the recombinant Yarrowia lipolytica strain of the present invention

The present inventors analyzed the production of isopropanol in the Yarrowia lipolytica strains transformed with the pYLEX1THLIPA expression vector and the pYLEX1NphT7IPA expression vector prepared in Example 1, respectively.

<2-1> Analysis of isopropanol production

The production of isopropanol was analyzed for the recombinant Yarrowia lipolytica strain having an enhanced acetoacetyl-CoA production pathway prepared in Example 1. To this end, all transformants were cultured in a 250 ml shaking flask containing 50 ml of YPD medium at 30 ° C and 200 rpm for 120 hours. Afterwards, the amount of isopropanol produced was measured.

As a result, as shown in FIG. 4, it was confirmed that about 347.709 mg/L of isopropanol was produced in the strain into which the pYLEX1THLIPA expression vector containing the thl gene was introduced, and the pYLEX1NphT7IPA expression vector containing the nphT7 gene was introduced into the strain. It was confirmed that about 504.4631 mg/L of isopropanol was produced. Through this, it was found that the strain overexpressing the nphT7 gene could increase the maximum production of isopropanol by about 1.45 times more than the strain overexpressing the thl gene.

On the other hand, isopropanol production was not confirmed in the pYLEX1IPA strain in which the acetoacetyl-CoA production pathway was not enhanced.

<2-2> Analysis of carbon source medium for isopropanol production from recombinant Yarrowia lipolytica strains

Furthermore, the inventors of the present invention, in order to determine whether isopropanol production using waste glycerol (crude glycerol) from the recombinant Yarrowia lipolytica strain into which the pYLEX1NphT7IPA expression vector according to the present invention was introduced, the strain was prepared in 50 ml of YPD (8 % Glucose) and YPG (8% Glycerol) media, respectively, in a 250ml shaker flask and cultured at 30°C temperature and 200 rpm for 120 hours, and then the production of isopropanol was analyzed.

As a result, as shown in FIG. 5, when 8% glucose was used as a carbon source, it was confirmed that about 508.7 mg/L of isopropanol was biosynthesized, and when 8% glycerol was used as a carbon source, about 282.4 mg/L of isopropanol was obtained. was confirmed to be biosynthetic.

From these results, the present inventors found that isopropanol can be effectively mass-produced from the recombinant Yarrowia lipolytica strain of the present invention when waste glycerol, which is worthless in addition to glucose, is used as a carbon source.

So far, the present invention has been looked at with respect to its preferred embodiments. Those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent scope will be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Korea University <120> Recombinant Yarrowia lipolytica for producing isopropanol and method for preparing isopropanol using its <130> NPDC100450 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 735 <212> DNA <213> artificial sequence <220> <223> adc DNA sequence <400> 1 atgttaaagg atgaagtaat taaacaaatt agcacgccat taacttcgcc tgcatttcct 60 agaggaccct ataaatttca taatcgtgag tattttaaca ttgtatatcg tacagatatg 120 gatgcacttc gtaaagttgt gccagagcct ttagaaattg atgagccctt agtcaggttt 180 gaaattatgg caatgcatga tacgagtgga cttggttgtt atacagaaag cggacaggct 240 attcccgtaa gctttaatgg agttaaggga gattatcttc atatgatgta tttagataat 300 gagcctgcaa ttgcagtagg aagggaatta agtgcatatc ctaaaaagct cgggtatcca 360 aagctttttg tggattcaga tactttagta ggaactttag actatggaaa acttagagtt 420 gcgacagcta caatggggta caaacataaa gccttagatg ctaatgaagc aaaggatcaa 480 atttgtcgcc ctaattatat gttgaaaata atacccaatt atgatggaag ccctagaata 540 tgtgagctta taaatgcgaa aatcacagat gttaccgtac atgaagcttg gacaggacca 600 actcgactgc agttatttga tcacgctatg gcgccactta atgatttgcc agtaaaagag 660 attgtttcta gctctcacat tcttgcagat ataatattgc ctagagctga agttatatat 720 gattatta agtaa 735 <210> 2 <211> 651 <212> DNA <213> artificial sequence <220> <223> atoDA DNA sequence <400> 2 atggatgcga aacaacgtat tgcgcgccgt gtggcgcaag agcttcgtga tggtgacatc 60 gttaacttag ggatcggttt acccacaatg gtcgccaatt atttaccgga gggtattcat 120 atcactctgc aatcggaaaa cggcttcctc ggtttaggcc cggtcacgac agcgcatcca 180 gatctggtga acgctggcgg gcaaccgtgc ggtgttttac ccggtgcagc catgtttgat 240 agcgccatgt catttgcgct aatccgtggc ggtcatattg atgcctgcgt gctcggcggt 300 ttgcaagtag acgaagaagc aaacctcgcg aactgggtag tgcctgggaa aatggtgccc 360 ggtatgggtg gcgcgatgga tctggtgacc gggtcgcgca aagtgatcat cgccatggaa 420 cattgcgcca aagatggttc agcaaaaatt ttgcgccgct gcaccatgcc actcactgcg 480 caacatgcgg tgcatatgct ggttactgaa ctggctgtct ttcgttttat tgacggcaaa 540 atgtggctca ccgaaattgc cgacgggtgt gatttagcca ccgtgcgtgc caaaacagaa 600 gctcggtttg aagtcgccgc cgatctgaat acgcaacggg gtgatttatg a 651 <210> 3 <211> 1056 <212> DNA <213> artificial sequence <220> <223> adh DNA sequence <400> 3 atgaaaggat ttgctatgct aggcataaac aagttaggtt ggatcgaaaa ggaacgtccg 60 gtagcaggaa gttatgacgc aattgttaga ccattggcag tgagcccatg tacatcagac 120 atacacactg tgtttgaggg tgcactgggc gatagaaaaa atatgatctt aggccatgaa 180 gctgtcggag aagtcgtgga ggttgggagt gaagtcaagg attttaagcc aggagataga 240 gtaattgttc cttgtactac cccagactgg cgtagtttgg aggtccaagc agggtttcaa 300 caacactcca atggcatgtt ggcggggtgg aagttctcta atttcaaaga tggtgttttt 360 ggtgagtatt tccacgtcaa tgatgcggat atgaatttgg cgatccttcc taaagacatg 420 ccgcttgaaa atgctgttat gattactgat atgatgacca cgggatttca tggggcagaa 480 cttgctgata tccaaatggg ctcatctgtt gtagtgattg gtataggagc tgttggcctt 540 atgggtatcg ccggggcgaa gttaaggggc gctggccgta taataggggt aggctctagg 600 cccatttgcg ttgaggctgc taagttttat ggagcaactg acattcttaa ttacaagaat 660 ggtcatatag tagaccaagt tatgaagctt accaacggta agggtgtaga tagggtgatc 720 atggcgggtg gaggtagcga aactttaagt caggctgtat ctatggtcaa gccaggaggc 780 attattagca acataaacta tcatggctcc ggcgacgcgt tgttaattcc aagagtcgag 840 tggggttgcg ggatggcaca caaaacaatc aaaggtggat tgtgccccgg gggccgtcta 900 cgtgctgaga tgttgcgtga tatggtggtc tataatcgtg tcgatttgag taagttagtc 960 acccatgtgt accatggatt tgaccatata gaagaggcac tgttactaat gaaggacaaa 1020 ccgaaagatt tgataaaggc agtggttatc ctgtaa 1056 <210> 4 <211> 2410 <212> DNA <213> artificial sequence <220> <223> atoDA-adh DNA sequence <400> 4 atgaaaacaa aattgatgac attacaagac gccaccggct tctttcgtga cggcatgacc 60 atcatggtgg gcggatttat ggggattggc actccatccc gcctggttga agcattactg 120 gaatctggtg ttcgcgacct gacattgata gccaatgata ccgcgtttgt tgataccggc 180 atcggtccgc tcatcgtcaa tggtcgagtc cgcaaagtga ttgcttcaca tatcggcacc 240 aacccggaaa caggtcggcg catgatatct ggtgagatgg acgtcgttct ggtgccgcaa 300 ggtacgctaa tcgagcaaat tcgctgtggt ggagctggac ttggtggttt tctcacccca 360 acgggtgtcg gcaccgtcgt agaggaaggc aaacagacac tgacactcga cggtaaaacc 420 tggctgctcg aacgcccact gcgcgccgac ctggcgctaa ttcgcgctca tcgttgcgac 480 acacttggca acctgaccta tcaacttagc gcccgcaact ttaaccccct gatagccctt 540 gcggctgata tcacgctggt agagccagat gaactggtcg aaaccggcga gctgcaacct 600 gaccatattg tcacccctgg tgccgttatc gaccacatca tcgtttcaca ggagagcaaa 660 taatggatgc gaaacaacgt attgcgcgcc gtgtggcgca agagcttcgt gatggtgaca 720 tcgttaactt agggatcggt ttaccccacaa tggtcgccaa ttatttaccg gagggtattc 780 atatcactct gcaatcggaa aacggcttcc tcggtttagg cccggtcacg acagcgcatc 840 cagatctggt gaacgctggc gggcaaccgt gcggtgtttt acccggtgca gccatgtttg 900 atagcgccat gtcatttgcg ctaatccgtg gcggtcatat tgatgcctgc gtgctcggcg 960 gtttgcaagt agacgaagaa gcaaacctcg cgaactgggt agtgcctggg aaaatggtgc 1020 ccggtatggg tggcgcgatg gatctggtga ccgggtcgcg caaagtgatc atcgccatgg 1080 aacattgcgc caaagatggt tcagcaaaaa ttttgcgccg ctgcaccatg ccactcactg 1140 cgcaacatgc ggtgcatatg ctggttactg aactggctgt ctttcgtttt attgacggca 1200 aaatgtggct caccgaaatt gccgacgggt gtgatttagc caccgtgcgt gccaaaacag 1260 aagctcggtt tgaagtcgcc gccgatctga atacgcaacg gggtgattta tgaatcgatg 1320 gattacaagg atgacgacga taagatctga gctcatgaaa ggatttgcta tgctaggcat 1380 aaacaagtta ggttggatcg aaaaggaacg tccggtagca ggaagttatg acgcaattgt 1440 tagaccattg gcagtgagcc catgtacatc agacatacac actgtgtttg agggtgcact 1500 gggcgataga aaaaatatga tcttaggcca tgaagctgtc ggagaagtcg tggaggttgg 1560 gagtgaagtc aaggatttta agccaggaga tagagtaatt gttccttgta ctaccccaga 1620 ctggcgtagt ttggaggtcc aagcagggtt tcaacaacac tccaatggca tgttggcggg 1680 gtggaagttc tctaatttca aagatggtgt ttttggtgag tatttccacg tcaatgatgc 1740 ggatatgaat ttggcgatcc ttcctaaaga catgccgctt gaaaatgctg ttatgattac 1800 tgatatgatg accacgggat ttcatggggc agaacttgct gatatccaaa tgggctcatc 1860 tgttgtagtg attggtatag gagctgttgg ccttatgggt atcgccgggg cgaagttaag 1920 gggcgctggc cgtataatag gggtaggctc taggcccatt tgcgttgagg ctgctaagtt 1980 ttatggagca actgacattc ttaattacaa gaatggtcat atagtagacc aagttatgaa 2040 gcttaccaac ggtaagggtg tagatagggt gatcatggcg ggtggaggta gcgaaacttt 2100 aagtcaggct gtatctatgg tcaagccagg aggcattatt agcaacataa actatcatgg 2160 ctccggcgac gcgttgttaa ttccaagagt cgagtggggt tgcgggatgg cacacaaaac 2220 aatcaaaggt ggattgtgcc ccgggggccg tctacgtgct gagatgttgc gtgatatggt 2280 ggtctataat cgtgtcgatt tgagtaagtt agtcacccat gtgtaccatg gatttgacca 2340 tatagaagag gcactgttac taatgaagga caaaccgaaa gatttgataa aggcagtggt 2400 tatcctgtaa 2410 <210> 5 <211> 52 <212> DNA <213> artificial sequence <220> <223> Xcm1_adc_F primer sequence <400> 5 atccagtccg actctggatg ttaaaggatg aagtaattaa acaaattagc ac 52 <210> 6 <211> 45 <212> DNA <213> artificial sequence <220> <223> Kpn1_adc_R primer sequence <400> 6 ccggtacctt acttaagata atcatatata acttcagctc taggc 45 <210> 7 <211> 32 <212> DNA <213> artificial sequence <220> <223> speI_atoDA_F primer sequence <400> 7 gcgcactagt atgaaaacaa aattgatgac at 32 <210> 8 <211> 25 <212> DNA <213> artificial sequence <220> <223> ClaI_atoDA_R primer sequence <400> 8 tttaatcgat tcataaatca ccccg 25 <210> 9 <211> 30 <212> DNA <213> artificial sequence <220> <223> Sac1_adh_F primer sequence <400> 9 gcgccacaat gaaaacaaaa ttgatgacat 30 <210> 10 <211> 30 <212> DNA <213> artificial sequence <220> <223> Pac1_adh_R primer sequence <400> 10 cttaattaat tacaggataa ccactgcctt 30 <210> 11 <211> 32 <212> DNA <213> artificial sequence <220> <223> Pmel1_atoDAadh_F primer sequence <400> 11 gcgccacgtg atgaaaacaa aattgatgac at 32 <210> 12 <211> 30 <212> DNA <213> artificial sequence <220> <223> BamH1_atoDAadh_R primer sequence <400> 12 taaggatcct tacaggataa ccactgcctt 30 <210> 13 <211> 1179 <212> DNA <213> artificial sequence <220> <223> thl DNA sequence <400> 13 atgaaagaag ttgtaatagc tagtgcagta agaacagcga ttggatctta tggaaagtct 60 cttaaggatg taccagcagt agatttagga gctacagcta taaaggaagc agttaaaaaa 120 gcaggaataa aaccagagga tgttaatgaa gtcattttag gaaatgttct tcaagcaggt 180 ttaggacaga atccagcaag acaggcatct tttaaagcag gattaccagt tgaaattcca 240 gctatgacta ttaataaggt ttgtggttca ggacttagaa cagttagctt agcagcacaa 300 attataaaag caggagatgc tgacgtaata atagcaggtg gtatggaaaa tatgtctaga 360 gctccttaact tagcgaataa cgctagatgg ggatatagaa tgggaaacgc taaatttgtt 420 gatgaaatga tcactgacgg attgtgggat gcatttaatg attaccacat gggaataaca 480 gcagaaaaca tagctgagag atggaacatt tcaagagaag aacaagatga gtttgctctt 540 gcatcacaaa aaaaagctga agaagctata aaatcaggtc aatttaaaga tgaaatagtt 600 cctgtagtaa ttaaaggcag aaagggagaa actgtagttg atacagatga gcaccctaga 660 tttggatcaa ctatagaagg acttgcaaaa ttaaaacctg ccttcaaaaa agatggaaca 720 gttacagctg gtaatgcatc aggattaaat gactgtgcag cagtacttgt aatcatgagt 780 gcagaaaaag ctaaagagct tggagtaaaa ccacttgcta agatagtttc ttatggttca 840 gcaggagttg acccagcaat aatgggatat ggacctttct atgcaacaaa agcagctatt 900 gaaaaagcag gttggacagt tgatgaatta gatttaatag aatcaaatga agcttttgca 960 gctcaaagtt tagcagtagc aaaagattta aaatttgata tgaataaagt aaatgtaaat 1020 ggaggagcta ttgcccttgg tcatccaatt ggagcatcag gtgcaagaat actcgttact 1080 cttgtacacg caatgcaaaa aagagatgca aaaaaaggct tagcaacttt atgtataggt 1140 ggcggacaag gaacagcaat attgctagaa aagtgctag 1179 <210> 14 <211> 990 <212> DNA <213> artificial sequence <220> <223> nphT7 DNA sequence <400> 14 atgacggatg ttcgattccg aattattggt accggtgcct atgttcccga acgaatcgtc 60 tctaatgacg aagtggggagc acctgctggc gtggatgacg attggattac aagaaagaca 120 ggaattagac aacggcggtg ggcagctgac gatcaggcaa cgtctgatct tgcaactgcc 180 gccggtcgag cagcactgaa ggctgctggc attacccctg aacagcttac tgtgatcgca 240 gtggccactt ccacacccga cagaccccaa cctcctacgg cagcttacgt tcaacatcac 300 ctcggtgcta ctggaactgc cgcatttgat gtcaacgctg tgtgttccgg cacggtcttc 360 gccctttcct cggtggcagg tacgctcgtc tatcgtggag gctacgccct cgtcattggt 420 gccgaccttt attcgcggat cctgaacccc gcagatcgga agaccgttgt gctctttgga 480 gatggtgccg gtgcaatggt cctcggccct acatccactg gaactggtcc tattgtccgt 540 cgggtcgctc tccacacctt cggaggactc acagatctga ttagagtgcc cgccggaggt 600 tcccgtcagc ctctcgatac agatggactc gatgcaggtc tgcagtattt tgcaatggat 660 ggacgggaag tgcgacggtt cgttactgaa catcttcctc aactcattaa aggatttctg 720 catgaagcag gcgttgatgc tgccgacatt agccacttcg tcccccatca ggcaaatgga 780 gttatgctcg acgaggtttt tggagagctc catcttccca gagccactat gcaccggacc 840 gtcgagactt atggaaacac tggagccgca tcgatcccca ttacaatgga cgctgccgtt 900 cgagctggtt cctttcgtcc cggcgagctg gttcttctgg ctggatttgg tggtggcatg 960 gctgccagct tcgcacttat cgagtggtag 990 <210> 15 <211> 39 <212> DNA <213> artificial sequence <220> <223> Gibson_nphT7_F primer sequence <400> 15 tacaaccaca cacatccaca atgacggatg ttcgattcc 39 <210> 16 <211> 37 <212> DNA <213> artificial sequence <220> <223> Gibson_nphT7_R primer sequence <400> 16 caattttgtt ttcatcacct accactcgat aagtgcg 37 <210> 17 <211> 42 <212> DNA <213> artificial sequence <220> <223> Xcm1_thl_F primer sequence <400> 17 atccagtccg actctggatg aaagaagttg taatagctag tg 42 <210> 18 <211> 45 <212> DNA <213> artificial sequence <220> <223> Kpn1_thl_R primer sequence <400> 18 ccggtacctt acttaagata atcatatata acttcagctc taggc 45

Claims (12)

thl (thiolase) or nphT7 (acetoacetyl CoA synthase) genes; atoDA (acetoacetyl-CoA transferase) gene; adh (alcohol dehydrogenases) gene; And adc (acetoacetate decarboxylase) gene is transformed with a recombinant expression vector containing sequentially linked,
Recombinant Yarrowia lipolytica strains for isopropanol production. According to claim 1,
The thl gene is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 13, recombinant Yarrowia lipolytica strain for producing isopropanol. According to claim 1,
The recombinant Yarrowia lipolytica strain for isopropanol production, characterized in that the nphT7 gene consists of the nucleotide sequence of SEQ ID NO: 14. According to claim 1,
The atoDA gene is a recombinant Yarrowia lipolytica strain for isopropanol production, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 2. According to claim 1,
The adc gene is a recombinant Yarrowia lipolytica strain for isopropanol production, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 1. According to claim 1,
The adh gene is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 3, recombinant Yarrowia lipolytica strain for producing isopropanol. According to claim 1,
The recombinant expression vector includes a thl (thiolase) gene; atoDA (acetoacetyl-CoA transferase) gene; adh (alcohol dehydrogenases) gene; And adc (acetoacetate decarboxylase) gene is sequentially linked to the pYLEX1THLIPA expression vector, characterized in that, a recombinant Yarrowia lipolytica strain for isopropanol production. According to claim 1,
The recombinant expression vector includes nphT7 (acetoacetyl CoA synthase) gene; atoDA (acetoacetyl-CoA transferase) gene; adh (alcohol dehydrogenases) gene; And adc (acetoacetate decarboxylase) gene is sequentially linked to the pYLEX1NphT7IPA expression vector, characterized in that, a recombinant Yarrowia lipolytica strain for isopropanol production. (1) culturing the recombinant Yarrowia lipolytica strain for producing isopropanol according to any one of claims 1 to 8; and
(2) obtaining isopropanol produced from the recombinant Yarrowia lipolytica strain,
Method for mass production of isopropanol. According to claim 9,
Obtaining the isopropanol is characterized in that obtained from the strain itself, the culture of the strain or the culture medium of the strain, isopropanol mass production method. According to claim 9,
The culturing is a method for mass production of isopropanol, characterized in that using glycerol or glucose as a carbon source. According to claim 11,
A method for mass production of isopropanol, characterized in that the group glycerol or glucose is contained in the culture medium in an amount of 2 to 10% by weight.

Images