KR20230096564A - Antigen protein against hepatitis a virus and vaccine composition comprising the same - Google Patents

Abstract

The present invention relates to recombinant antigen proteins 3R and 3D2-3R based on the immunodominant epitope of hepatitis A virus VP3 envelope proteins and a hepatitis A virus vaccine composition containing the same. The hepatitis A virus antigen proteins and vaccine composition according to the present invention is a new type of recombinant antigen protein material that exhibits an excellent antibody induction response to the hepatitis A virus and is effective in inhibiting the proliferation of the hepatitis A virus. In addition, the hepatitis A virus antigen proteins and vaccine composition is a vaccine material that improves the stability and productivity of existing killed vaccines and has improved functionality of the recombinant antigen protein material and can be usefully used for the prevention and treatment of the hepatitis A virus.

Description

Hepatitis A virus antigen protein and vaccine composition containing the same

The present invention relates to hepatitis A virus antigen proteins 3R, 3D2-3R and a hepatitis A virus vaccine composition comprising them.

This patent is funded by the Ministry of Health and Welfare, and the health and medical technology of the Korea Health Industry Development Institute

This was done with support for R&D projects (assignment identification number: HV20C0033).

Hepatitis A is a type of acute hepatitis that accounts for more than 70% of acute viral hepatitis in adults in Korea. Hepatitis A virus is a 27 nm RNA virus belonging to the Picornaviridae and Hepatovirus genus. , anorexia, nausea and vomiting, abdominal discomfort, and jaundice. Symptoms are rare in young children and become more severe with age. The main route of infection of hepatitis A is fecal-oral infection, and the hepatitis A virus excreted from the body through feces can survive for several months or more even at room temperature. Hepatitis A is mainly transmitted by contact with a patient infected with the hepatitis A virus, ingestion of water or food contaminated with the feces of an infected person, and in the case of a group outbreak, it occurs due to contaminated drinking water sources or meals. In addition, although not a direct cause, a mother infected with hepatitis A virus can be transmitted to a fetus during childbirth, and it can also be infected by blood transfusion and parenteral infection in male homosexuals.

Hepatitis A is on the rise worldwide, with about 114 million infected each year, about 14 million showing symptoms, and 11,200 deaths from hepatitis A in 2015. In particular, it occurs frequently in underdeveloped countries where personal hygiene management is poor, and about 90% of children are infected before the age of 10, and most develop immunity. Recently, the incidence rate has increased rapidly even in people in their 20s and 40s who have grown up in a hygienic environment, and it mainly occurs in adults who have not been vaccinated as children. In Korea, the incidence of hepatitis A has increased significantly recently, especially among young people in their 20s and 30s without immunity, with 1,804 cases in 2015, 4,679 cases in 2016, 4,419 cases in 2017, 2,437 cases in 2018, 17,598 cases in 2019, and 2020 3,989 cases were reported. In particular, the number of cases of hepatitis A in 2019 soared to 17,598, and this was caused by the consumption of spoiled seafood, and 86.5% of the total cases occurred in people in their 20s and 40s. The hepatitis A fatality rate is 2 per 1,000 in the non-chronic liver disease group and increases to 46 per 1,000 in the chronic liver disease group. From January 2020, the Korea Centers for Disease Control and Prevention (KCDC) started providing free hepatitis A vaccination to high-risk groups with a high mortality rate due to complications from hepatitis A infection, such as chronic hepatitis B patients and liver cirrhosis patients. Hepatitis A was designated as a Group 1 legal infectious disease in 2021, and all children aged 12 to 23 months, high-risk children/adolescents or adults without immunity to hepatitis A, close contacts of patients, and high-risk groups are vaccinated. are doing

Currently, hepatitis A vaccines distributed in Korea are GlaxoSmithKline's Havrix (Havrix, GlaxoSmithKline, UK), Sanofi Pasteur's Avaxim (Sanofi pasteur, France), Merck Sharp & Dohme's Bacta (VAQTA, Merck Sharp & Dohme, USA) account for most of them, and no domestic products have been developed, and all of them are dependent on imports. Starting with Habrix, the first hepatitis A vaccine in 1992, Bacta was commercialized as the second hepatitis A vaccine in 1995, followed by Avaxim. These Habrix, Avaxim, and Bacta are inactivated vaccines obtained by culturing attenuated HAV strains in cells, purifying them, and inactivating them with formalin. It is based on a killed vaccine platform containing as an adjuvant. However, due to the nature of the inactivated vaccine material, a high unit cost is required for manufacturing, and thus the development of a new type of vaccine material for hepatitis A virus infection is required. Recently, recombinant protein vaccine materials using antigen genes are positioned as next-generation vaccine materials because they have advantages in safety and production cost over killed vaccine materials.

The VP3 protein, one of the capsid proteins of the hepatitis A virus, has an immunodominant epitope that induces the production of neutralizing antibodies that inhibit the proliferation of the hepatitis A virus, making it a useful envelope for the development of recombinant hepatitis A vaccine materials. It is protein. Although the entire amino acid region of the 246 amino acid VP3 protein can be used to develop recombinant hepatitis A vaccine materials, not all epitopes of the VP3 protein produce neutralizing antibodies that inhibit the growth of hepatitis A virus. Recombinant proteins composed of a limited number of immunodominant epitopes that induce the production of antibodies that inhibit the proliferation of hepatitis A virus are considered more efficient vaccine materials for the development of recombinant unit vaccine materials. However, no study has been reported on the development of vaccine materials using only the immunodominant epitope of the VP3 protein.

The recombinant VP1-3N protein composed of 100 amino acids at the N-terminal region of the hepatitis A virus envelope protein VP1 was repeated 3 times, and the C-terminal region of the VP1 envelope protein and the N-terminal region of the 2A protein It was confirmed that the recombinant 3D2 protein, in which the constructed D2 protein was repeated three times, induces the production of antibodies with excellent neutralizing ability against hepatitis A virus when compared to the VP1 protein (Patent No. 10-1635672, Patent No. 10-1635672). 1635673). In animal immunization experiments using mice, mouse serum containing antibodies induced by recombinant VP1-3N and 3D2 protein vaccine materials reduced the proliferation of HM175/18f hepatitis A virus by 33.7% and 22.5%, respectively. These recombinant VP1-3N and 3D2 protein vaccine materials have high neutralizing ability against hepatitis A virus compared to recombinant VP1 envelope protein vaccine materials, and are considered useful vaccine materials. In order to develop a next-generation recombinant protein vaccine material to replace the existing inactivated vaccine, which is evaluated as low, the development of a recombinant protein vaccine material with improved neutralization ability is required.

[Prior patent literature]

(Patent Document 1) Korea Patent Registration No. 10-1635672

(Patent Document 2) Korean Patent Registration No. 10-1635673

The present invention has been made in response to the above needs, and an object of the present invention is to provide a hepatitis A virus antigen protein that can be used as a novel hepatitis A virus vaccine material.

Another object of the present invention is to provide a novel hepatitis A virus vaccine composition.

Another object of the present invention is to provide a vector for expressing a novel hepatitis A virus antigen protein.

Another object of the present invention is to provide a method for preparing a hepatitis A virus antigen protein.

In order to achieve the above object, the present invention provides a hepatitis A virus antigen protein comprising a sequence in which the polypeptide represented by SEQ ID NO: 4 is repeated 1 to 9 times.

In one embodiment of the present invention, the protein is preferably one in which the polypeptide is repeated three times, but is not limited thereto.

In another embodiment of the present invention, the repeating sequence is preferably linked by a linker sequence, and the linker sequence is more preferably a GGGGS sequence, but is not limited thereto.

In one embodiment of the present invention, the polypeptide repeated three times is preferably a polypeptide represented by SEQ ID NO: 6, but is not limited thereto.

In addition, the present invention provides a hepatitis A virus antigen protein in which another protein is fused to an antigen protein in which the polypeptide represented by SEQ ID NO: 4 is repeated three times.

In one embodiment of the present invention, the amino acid sequence of the fusion protein is preferably represented by SEQ ID NO: 8, but is not limited thereto.

In addition, the present invention provides a hepatitis A virus vaccine composition comprising the antigenic protein of the present invention as an active ingredient.

In addition, the present invention provides a vector for expressing the hepatitis A virus antigen protein represented by SEQ ID NO: 6 or SEQ ID NO: 8.

In another aspect, the present invention comprises the steps of obtaining a polynucleotide encoding a repeating sequence in which the polypeptide represented by SEQ ID NO: 4 is repeated three or more times;

constructing an expression vector containing the obtained polynucleotide;

introducing the expression vector into a host cell;

Provided is a method for producing a recombinant hepatitis A virus antigen protein comprising the step of recovering and purifying the expressed protein by culturing the host cell.

The present invention will be described below.

While the present inventors were researching to develop a new hepatitis A virus vaccine material, a recombinant protein composed of a limited number of immunodominant epitopes that induce the production of neutralizing antibodies that inhibit the proliferation of hepatitis A virus was developed as a recombinant unit vaccine material. After confirming that it is a more efficient vaccine material for hepatitis A virus, a recombinant 3R protein made by repeating the R protein region consisting of 34 to 143 amino acid regions of the hepatitis A virus VP3 envelope protein three times was produced through a microbial expression system, and for hepatitis A virus We tried to confirm the possibility of using it as a new vaccine material by confirming the neutralization ability.

In addition, the recombinant 3D2-3R protein fused with the 3D2 protein composed of the immunodominant epitope of the VP1 envelope protein reported to inhibit the proliferation of hepatitis A virus in an existing patent was produced through a microbial expression system and neutralized against hepatitis A virus By confirming the ability, the present invention, which can be used as a new hepatitis A vaccine material, was completed.

The present invention provides a hepatitis A virus antigen protein comprising a repetitive sequence in which the polypeptide represented by SEQ ID NO: 4 is repeated three or more times.

In addition, the present invention provides the hepatitis A virus antigen protein represented by SEQ ID NO: 8 in which the polypeptide represented by SEQ ID NO: 4 is repeated three times and fused to recombinant antigen protein 3D2.

The hepatitis A virus antigen protein according to the present invention shows an excellent antibody-inducing response against hepatitis A virus.

The "hepatitis A virus" is a single-stranded RNA virus that causes hepatitis A, and belongs to the Picornaviridae and Hepatovirus genus. It has a single-stranded RNA of about 7.5 kbp in size, and its entire gene sequence is disclosed in NCBI GenBank: M14707.1. The hepatitis A virus may include all viruses having a total of seven genotypes, from I to VII, without limitation, and subtypes of the genotype, such as IA, may also be included without limitation.

The "antigenic protein" includes both proteins obtained by identifying antigens involved in disease defense based on gene and DNA sequence analysis and directly purified from pathogens and recombinant proteins produced by expressing antigen genes, and acting as antigens to appropriately A protein capable of inducing a specific antibody response.

The "polypeptide represented by SEQ ID NO: 4" is a sequence corresponding to 34 to 143 amino acids of the capsid protein VP3 among the known sequences of hepatitis A virus, and at least 80% or more, preferably 90% or more, more Polypeptides having substantially the same biological properties, such as antigenicity or immunogenicity, while preferably having 95% or more homology, may also be included in the polypeptides of the present invention.

The polypeptide represented by SEQ ID NO: 4 may exist in the form of three or more repeated sequences, and they may be directly linked to each other or linked by a linker sequence to form a repetitive repeating sequence. The polypeptide represented by SEQ ID NO: 4 in such a repeating sequence may preferably be repeated 3 times or more, more preferably 3, 6 or 9 times. That is, the polypeptide represented by SEQ ID NO: 4, which is an antigen protein portion capable of inducing an antibody response, may be present repeatedly in the antigen protein at least three times.

As the number of repetitions increases, the antibody induction ability may increase, but if the size of the polypeptide increases excessively, it may be difficult to produce the hepatitis A virus vaccine material protein intended by the present invention.

The polypeptide represented by SEQ ID NO: 4 may be repeated three times, and its sequence is at least 80% or more, preferably 90% or more, more preferably 95% or more of the sequence represented by SEQ ID NO: 6, or thereto. It may be a polypeptide sequence that is homologous and has substantially the same biological properties, such as antigenicity or immunogenicity.

The repetitive sequences of the present invention may be connected by a "linker sequence", and the linker sequence refers to an amino acid sequence that can play a role in interconnecting genes for antigen protein expression in order to produce a recombinant antigen protein. As the linker sequence, an amino acid sequence capable of producing a target recombinant antigen protein may be used without limitation, and preferably a linker sequence composed of GGGGS may be used. Since the GGGGS linker sequence does not affect the linear structure of a recombinant protein having a repetitive sequence, a target recombinant antigen protein can be produced.

In addition, the present invention is a hepatitis A virus antigen protein consisting of a repeating sequence in which the polypeptide represented by SEQ ID NO: 4 is repeated three or more times, and a sequence in which the polypeptide represented by SEQ ID NO: 4 is repeated three times and fused to recombinant antigen protein 3D2 It relates to a hepatitis A virus vaccine composition comprising the hepatitis A virus antigen protein represented by No. 8.

The "vaccine composition" includes at least a repeating sequence in which the polypeptide represented by SEQ ID NO: 4 is repeated three or more times and/or SEQ ID NO: 8 in which the polypeptide represented by SEQ ID NO: 4 is repeated three times and is fused to recombinant antigen protein 3D2. A vaccine composition for preventing or treating hepatitis A virus infection in mammals comprising at least one pharmaceutically acceptable carrier and/or adjuvant.

The vaccine composition of the present invention can be used alone or as part of another composition for treatment or prevention, optionally containing a pharmaceutically acceptable carrier, such as a release rate modifier. The carrier may further contain a pharmaceutically acceptable vector or diluent suitable for administration for the treatment and/or prophylaxis of hepatitis A virus. By appropriate pharmaceutically acceptable vector is meant a biologically inactive and/or non-toxic vector. Various vectors known in the art can be selected for this purpose.

In addition, if necessary, the vaccine composition of the present invention may further contain other therapeutic/preventive drugs for preventing or treating hepatitis A virus. For example, the composition may include a “cocktail mixture” of several agents useful for the treatment or prevention of hepatitis A virus infection. Such cocktail mixtures may further include other agents such as interferons, nucleotide analogs and/or N-acetyl-cysteine.

In addition, the present invention relates to a vector for expressing the hepatitis A virus antigen protein represented by SEQ ID NO: 2.

The "vector" includes an assembly capable of inducing expression of a desired sequence or gene, and may include regulatory elements such as a promoter operably linked to induce transcription thereof.

The "vector" is capable of delivering a nucleic acid sequence to a target cell. Typically, "vector construct", "expression vector" and "gene transfer vector" refer to any nucleic acid construct capable of directing the expression of a nucleic acid of interest and capable of delivering a nucleic acid sequence to a target cell, wherein prokaryotic expression It may be a vector or a eukaryotic expression vector.

The vector of the present invention can be used without limitation any vector that can transfer the gene encoding the desired antigen protein so as to express it in recombinant microbial cells, but preferably the pET-28a vector can be used.

In addition, the present invention comprises the steps of obtaining a polynucleotide encoding a repeating sequence in which the polypeptide represented by SEQ ID NO: 4 is repeated three or more times; constructing an expression vector containing the obtained polynucleotide; introducing the expression vector into a host cell; It relates to a method for producing a recombinant hepatitis A virus antigen protein comprising the steps of recovering and purifying the protein expressed by culturing the host cell.

Any expression vector known in the art may be used without limitation, and a host cell that can be used to express the recombinant protein may be, for example, Escherichia coli or yeast cells, and preferably Escherichia coli .

Since the hepatitis A virus recombinant antigen protein and vaccine composition according to the present invention show an excellent antibody induction response to hepatitis A virus and have an effect of neutralizing infection and proliferation of hepatitis A virus, stability and productivity of existing inactivated vaccines It can be usefully used as a vaccine material for the prevention of hepatitis A virus, a new type of improved hepatitis A virus.

1 is a result of comparing the nucleotide sequence of hepatitis A virus (HM175/18f) envelope protein VP3 and the nucleotide sequence of sVP3 optimized for the frequency of microbial codon usage.
2 is a schematic diagram of microbial expression vectors pET-28a/VP3-His, pET-28a/3R-His, and pET-28a/3D2-3R-His for producing recombinant VP3, 3R, and 3D2-3R proteins.
Figure 3 shows the results of confirming the expression of recombinant VP3, 3R, and 3D2-3R proteins in recombinant microbial cells by Coomassie blue staining after SDS-PAGE.
4 is a result of confirming the water solubility of recombinant VP3, 3R, and 3D2-3R proteins.
Figure 5 shows the recombinant VP3 (A), 3R (B), and 3D2-3R (C) proteins were separated and purified from the water-insoluble protein fraction of recombinant microorganisms by affinity chromatography using Ni-NTA agarose resin, and after SDS-PAGE This is the result confirmed by Coomassie blue staining method.
6 shows that antibodies against VP3, 3R, and 3D2-3R proteins were produced in the serum of mice injected intraperitoneally with VP3, 3R, and 3D2-3R vaccine compositions, showing that recombinant VP3-His (A), 3R (B), and 3D2-3R (C) This is the result confirmed through ELISA using a protein-coated plate.
Figure 7 is the result of confirming the hepatitis A virus proliferation inhibitory effect by serum of mice injected intraperitoneally with VP3, 3R, and 3D2-3R vaccine compositions.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are intended to illustrate the present invention by way of example, and the scope of the present invention is not limited to these examples.

Example 1: Securing the hepatitis A virus envelope protein VP3 gene

In order to express the hepatitis A virus VP3 envelope protein in microbial cells, the gene for the previously known VP3 protein (SEQ ID NO: 1) was optimized according to the frequency of microbial codon usage, and the mutated gene information (SEQ ID NO: 2) was obtained and the gene synthesizing institution to secure the E-VP gene.

In the E-VP3 gene represented by SEQ ID NO: 2 (hereinafter referred to as VP3), 551 of the 738 nucleotide sequences encoding the VP3 protein are identical to the wild-type VP3 gene nucleotide sequence (SEQ ID NO: 1) (sequence similarity 74.7%). ), and the remaining 187 base sequences are composed of different sequences (sequence difference 25.3%) (FIG. 1).

Example 2: Construction of microbial expression vectors pET-28a/VP3-His, pET-28a/3R-His, pET-28a/3D2-3R-His

To construct a microbial expression vector for expressing the VP3 protein in microbial cells, the VP3 gene was amplified by PCR to obtain a DNA product having an NcoI restriction enzyme site at the N-terminus of the VP3 gene and an XhoI site at the C-terminus of the VP3 gene. The sequences of the forward and reverse PCR primers used for this are as follows.

PCR product Sequence (5′ → 3′) VP3 forward ACCATGGGTATGATGCGTAACGAATTTC (SEQ ID NO: 9) reverse CTCGAGCTGGGTGGTAACATCCATC (SEQ ID NO: 10)

The VP3 DNA product amplified by PCR was cloned into the NcoI and XhoI restriction enzyme sites of pET-28a (Novagen), a microbial expression vector, to construct the pET-28a/VP3-His vector (FIG. 2A). The His6 tag-linked VP3 protein produced by the pET-28a/VP3-His vector was defined as a recombinant VP3 protein.

Among the VP3 proteins, the gene encoding the 34 to 143 amino acid region known to have high antibody and immune responses in the serum of hepatitis A virus-infected patients was called the R gene, and PCR was performed using the pET-28a/VP3-His vector as a template. secured. The R gene is repeated three times, and to secure the 3R gene linked by the GGGGS (Gly-Gly-Gly-Gly-Ser) linker, an NcoI restriction enzyme site at the N-terminus of the R gene, a GGGGS linker and an EcoRI restriction enzyme site at the C-terminus of the R gene were added. Genie's R1 gene was obtained through PCR, and the pET-28a/R1 vector was constructed by cloning into the NcoI and EcoRI restriction enzyme sites of the microbial expression vector pET-28a. The R2 gene, which has an EcoRI restriction enzyme site at the N-terminus of the R gene and a GGGGS linker and HindIII restriction enzyme site at the C-terminus, was obtained through PCR, and cloned into the EcoRI and HindIII restriction enzyme sites of the pET-28a/R1 vector to pET-28a/R1. A 28a/2R vector was constructed. The R3 gene, which has a HindIII restriction enzyme site at the N-terminus of the R gene, a GGGGS linker and an XhoI restriction enzyme site at the C-terminus, was obtained through PCR, and cloned into the HindIII and XhoI restriction enzyme sites of the pET-28a/2R vector to pET-28a/2R vector. A 28a/3R-His vector was constructed (FIG. 2B). A protein having three R sequences linked by the GGGGS linker and a His6 tag produced by the pET-28a/3R-His vector was defined as a recombinant 3R protein.

The sequences of the forward and reverse PCR primers used in PCR to amplify the R1, R2, and R3 genes are as follows.

PCR product Sequence (5′ → 3′) R1 forward CCATGGAAGATTGGAAATCTGATCCGAGC (SEQ ID NO: 11) reverse GAATTCTGAGCCTCCGCCTCCATCAATCAGTTCGTTACCCGGAAC (SEQ ID NO: 12) R2 forward GAATTCGAAGATTGGAAATCTGATCCGAGC (SEQ ID NO: 13) reverse AAGCTTTGAGCCTCCGCCTCCATCAATCAGTTCGTTACCCGGAAC (SEQ ID NO: 14) R3 forward AAGCTTGAAGATTGGAAATCTGATCCGAGC (SEQ ID NO: 15) reverse CTCGAGTGAGCCTCCGCCTCCATCAATCAGTTCGTTACCCGGAAC (SEQ ID NO: 16)

Expression of 3D2-3R protein fused with 3D2 protein secured as hepatitis A vaccine material in the existing patent (10-1635672, hepatitis A virus vaccine material protein 3D2 and vaccine composition) to increase the immunogenicity of the recombinant 3R protein A microbial expression vector was constructed to do this.

The 3D2 gene having an NcoI restriction enzyme site at the N-terminus of the 3D2 gene and a KpnI restriction enzyme site at the C-terminus was obtained through PCR using the pET-21a/3D2-His vector (patent 10-1635672) as a template, and pET-28a The pET-28a/3D2 vector was constructed by cloning into the NcoI and KpnI restriction enzyme sites of the vector. A 3R gene having a KpnI restriction enzyme site at the N-terminus of the 3R gene and an XhoI restriction enzyme site at the C-terminus was obtained through PCR, cloned into the KpnI and XhoI restriction enzyme sites of the pET-28a/3D2 vector, and pET-28a/3D2 -3R-His vector was constructed (Fig. 2C). The protein produced by the pET-28a/3D2-3R-His vector and having three D2 and three R sequences linked by the GGGGS linker was defined as a recombinant 3D2-3R protein.

The sequences of the forward and reverse PCR primers used in PCR to amplify the 3D2 and 3R genes are as follows.

PCR product Sequence (5′ → 3′) 3D2 forward CCATGGAATGAGCAGAATTGCAGCTGGAGAC (SEQ ID NO: 17) reverse GGTACCAGAACCACCACCGCCAAAAAGAGAAATTTTGGCTTG (SEQ ID NO: 18) 3R forward CCATGGGAAGATTGGAAATCTGATCCGAGC (SEQ ID NO: 19) reverse CTCGAGTGAGCCTCCGCCTCCATCAATCAGTTCGTTACCCGGAAC (SEQ ID NO: 20)

Example 3: Verification of recombinant VP3, 3R, 3D2-3R protein expression

The pET-28a/VP3-His, pET-28a/3R-His, and pET-28a/3D2-3R-His expression vectors prepared in Example 2 were transfected into Escherichia coli Rosetta2(DE3)pLysS (Rosetta2; Novagen) cells. Recombinant Rosetta2 cells transfected with each vector were obtained by selection in Luria-Bertani (LB) medium containing 50 μg/mL ampicilin and 34 μg/mL chloramphenicol antibiotics. Recombinant Rosetta2 cells were cultured in LB medium containing 50 μg/mL ampicilin and 34 μg/mL chloramphenicol, and when the OD ₆₀₀ value was 0.8, isopropyl β-D-1-thiogalactopyranoside (IPTG, final concentration 1 mM) was added. Expression of recombinant VP3, 3R, and 3D2-3R proteins was induced. After culturing for 3 hours in a 37°C incubator, cells were recovered by centrifugation (3,000 rpm, 15 min), suspended in PBS (pH 7.4) buffer, and 5X sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE) loading buffer. After mixing, the protein extract was collected by boiling for 5 minutes and centrifugation (12,000 rpm, 20 min). After SDS PAGE, the samples were stained with Coomassie blue, and the expression of recombinant VP3, 3R, and 3D2-3R proteins was confirmed.

As shown in FIG. 3 , the recombinant VP3, 3R, and 3D2-3R proteins were expressed at 27, 40, and 65 kDa, respectively, in recombinant microbial cells.

Example 4: Production, isolation and purification of recombinant VP3, 3R, 3D2-3R proteins

To produce recombinant VP3, 3R, and 3D2-3R proteins, recombinant Rosetta2 cells were cultured in LB medium containing 50 μg/mL ampicilin and 34 μg/mL chloramphenicol until the OD ₆₀₀ value reached 0.8, and 0.1 mM IPTG was added. expression of the recombinant protein was induced and incubated at 20 °C for 16 hours. The cell culture medium was centrifuged (3,000 rpm, 15 min) to recover the cells, disrupted with an ultrasonic disruptor (Vibra Cell, Sonics; 10 sec pulse & 10 sec rest, 20 min), and then centrifuged (12,000 rpm, 20 min) A water-soluble protein extract and a water-insoluble protein extract were obtained. Each protein extract was mixed with SDS PAGE loading buffer, boiled for 5 minutes, and then centrifuged (12,000 rpm, 20 min) to collect protein extracts. After SDS PAGE, Coomassie blue was used to detect recombinant VP3, 3R, and 3D2-3R proteins. Confirmed. As shown in FIG. 4, most of the recombinant VP3 and 3R proteins were present in the water-insoluble protein fraction.

Therefore, in order to isolate and purify the recombinant VP3, 3R, and 3D2-3R proteins, a water-insoluble protein fraction was obtained from recombinant microbial cells in which expression of the recombinant protein was induced, and affinity chromatography using Ni-NTA agarose resin (Qiagen) was performed. As a result, recombinant VP3, 3R, and 3D2-3R proteins were isolated and purified.

Buffer A (100 mM NaH ₂ PO ₄ , 10 mM Tris-Cl, 8 M urea, pH 8) was added to the water-insoluble protein fraction containing recombinant VP3, 3R, and 3D2-3R proteins and incubated at 4°C for 12 hours. The protein was dissolved by reacting for a while, and the protein mixture was collected by centrifugation (12,000 rpm, 20 min). The protein mixture was added to a chromatographic column containing Ni-NTA agarose resin equilibrated with buffer A to induce binding of the recombinant VP3, 3R, and 3D2-3R proteins. Proteins weakly bound to the Ni-NTA agarose resin were washed with Buffer B (100 mM NaH ₂ PO ₄ , 10 mM Tris-Cl, 8 M urea, pH 6.3), and buffered with Buffer C (100 mM NaH ₂ PO ₄ , 10 M urea). Protein bound to Ni-NTA agarose resin was eluted with buffer solution D (100 mM NaH ₂ PO ₄ , 10 mM Tris-Cl, 8 M urea, pH 5.9) and buffer solution D (10 mM Tris-Cl, 8 M urea, pH 4.5). . The protein fractions obtained in the separation and purification process were subjected to SDS PAGE and then stained with Coomassie blue to confirm recombinant VP3, 3R, and 3D2-3R proteins.

As shown in FIG. 5, the recombinant VP3 protein was present in the form of a single protein in the Elute 2-1 and 2-2 fractions eluted with buffer D (FIG. 5A). Recombinant 3R and 3D2-3R proteins were present in the form of single proteins in the Elute 2-1 fraction eluted with buffer D (FIGS. 5B and 5C).

Refolding of the isolated and purified recombinant VP3, 3R, and 3D2-3R proteins was induced by dialysis in a buffer solution in which the urea concentration was gradually reduced.

A dialysis tube (Cellulose membrane, molecular weight cut-off 10,000; Sigma-Aldrich) supplemented with recombinant VP3, 3R, and 3D2-3R proteins (20 mL) was mixed with 2 L dialysis buffer A (1 mM oxidized glutathione, 5 mM reduced glutathione, 6 M urea, pH 7.4) and stirred at 4°C for 24 hours. Then, the dialysis tube contains 2 L dialysis buffer B (1 mM oxidized glutathione, 5 mM reduced glutathione, 4 M urea, pH 7.4), and dialysis buffer C (1 mM oxidized glutathione, 5 mM reduced glutathione, 0.2 M arginine). , 2 M urea, pH 7.4) and dialysis buffer D (1 mM oxidized glutathione, 5 mM reduced glutathione, 0.2 M arginine, pH 7.4) for 24 hours, respectively, to refold recombinant VP3, 3R, and 3D2-3R proteins. induced.

Example 5: Preparation of hepatitis A VP3, 3R, 3D2-3R vaccine composition

The separated and purified recombinant VP3, 3R, and 3D2-3R proteins were concentrated by ultrafiltration using Vivaspin20 (MW 10,000 Da; Sartorius) and PBS (pH 7.4) buffered using a PD10 desalting column (Sephadex G-25; GE Healthcare). It was exchanged with a solution and filtered with a syringe filter (Pall Corporation) having a 0.2 μm pore size. The concentration of the recombinant protein in the buffer solution was determined by DC Protein Assay Kit (Bio-Rad).

Alhydrogel (aluminum hydroxide gel adjuvant; InvivoGen) was used as an adjuvant for preparing hepatitis A VP3, 3R, and 3D2-3R vaccine compositions. Hepatitis A VP3, 3R, 3D2-3R vaccine composition was prepared by adjusting the concentration of recombinant VP3, 3R, and 3D2-3R proteins in the vaccine composition to 50 μg/mL and diluting Alhydrogel so that the aluminum hydroxide concentration was 0.5 mg/mL. did

Example 6: Analysis of animal immunity and antibody production of hepatitis A VP3, 3R, and 3D2-3R vaccine compositions

In order to confirm the antigenicity of the hepatitis A VP3, 3R, and 3D2-3R vaccine compositions prepared in Examples 4 to 5, the immune response was confirmed in BALB/c mice (Nara Biotech, Seoul). The mice were allowed to eat freely, and were bred in a sterile and 12-hour light/dark cycle environment. 5-week-old female BALB/c mice were divided into 5 groups of 8 each [control group (PBS with Alhydrogel), Havrix ^™ GlaxoSmithKline vaccine administration group, VP3 vaccine composition, 3R vaccine composition, 3D2-3R vaccine composition administration group] 400 μL of each vaccine composition was intraperitoneally administered three times at 2-week intervals, and blood was collected by orbital vein blood sampling 2 weeks after administration of the third vaccine composition. Blood samples were coagulated for 1 hour at room temperature, and serum was collected after centrifugation (10,000 rpm, 10 min) and stored at -70 °C. Enzyme-linked immunosorbent assay (ELISA) was performed to detect recombinant VP3, 3R, and 3D2-3R specific IgG antibodies present in serum. Add 100 μL/well of 0.05 M carbonate-bicarbonate buffer (pH 9.6) containing recombinant VP3, 3R, and 3D2-3R proteins (0.2 μg/100 μL) to a 96-well ELISA plate and react overnight at 4°C. to coat the recombinant VP3, 3R, and 3D2-3R proteins, and washed three times with PBS-T (PBS with 0.05% Tween-20). 100 μL of serum sample diluted 1/1,000 to 1/100,000 with PBS (pH 7.4) buffer was added to each well, reacted at room temperature for 2 hours, and washed three times with PBS-T buffer. 100 μL of Goat anti-mouse IgG horseradish peroxidase (HRP) conjugate (1/10,000 dilution in PBS-T) was added, reacted for 1 hour at room temperature, washed three times with PBS-T buffer, and then the TMB One Component HRP Microwell Substrate ( 100 μL of 3,3′,5,5′-tetramethylbenzidine; SurModics) was added and reacted for 30 minutes to induce color development. After the reaction was terminated by the addition of 100 μL 0.2 MH ₂ SO ₄ , absorbance was measured at 450 nm. .

As shown in Figure 6, the VP3, 3R, and 3D2-3R vaccine compositions were tested in ELISA in which the serum of mice immunized with the VP3, 3R, and 3D2-3R vaccine compositions was applied to plates coated with recombinant VP3, 3R, and 3D2-3R proteins. The absorbance of the immunized mouse serum was greatly increased compared to the PBS control group. Serum obtained from mice immunized with the 3R vaccine composition on plates coated with recombinant VP3 and 3R proteins was found to have the most IgG antibodies recognizing recombinant VP3 and 3R proteins (FIGS. 6A and 6B). In the plate coated with the recombinant 3D2-3R protein, serum obtained from mice immunized with the 3D2-3R vaccine composition showed the highest amount of IgG antibodies (FIG. 6C). Through these results, it was confirmed that the intraperitoneal injection of the VP3, 3R, and 3D2-3R vaccine compositions could effectively induce the production of IgG antibodies recognizing the recombinant VP3, 3R, and 3D2-3R proteins in mice. In other words, these results indicate that the recombinant VP3, 3R, and 3D2-3R proteins produced, isolated, and purified from recombinant microbial cells have antigenicity that induces the production of IgG antibodies recognizing VP3, 3R, and 3D2-3R. do.

Example 7: Evaluation of immunogenicity (hepatitis A virus neutralizing ability) of hepatitis A VP3, 3R, 3D2-3R vaccine composition

An immunogenicity study was performed to evaluate the hepatitis A virus neutralization ability of antibodies generated by intraperitoneal injection of VP3, 3R, and 3D2-3R vaccine compositions. Serum obtained from mice administered with VP3, 3R, and 3D2-3R vaccine compositions was reacted at 55 ° C for 30 minutes, and after centrifugation (10,000 rpm, 20 min), the supernatant was recovered and used for immunogenicity experiments. 200 μL of hepatitis A virus (HM175/18f strain; ATCC) was mixed with 20 μL of serum obtained from mice administered with PBS control, VP3, 3R, 3D2-3R vaccine composition and Habrix vaccine, and incubated at 37°C for 2 hours. reacted while Remove the medium from a 24-well plate in which FRhK-4 ( Macaca mulatta embryonic kidney cell; Elabscience) cells have grown to more than 90% of the well surface, add the hepatitis A virus serum mixture, and incubate at 37°C for 2 hours to obtain type A cells. Infection with hepatitis virus was induced. After removing the hepatitis A virus serum mixture and adding 0.5 mL of DMEM (Gibco) medium supplemented with 2% FBS, the hepatitis A virus was grown for 5 days. The well plate was freeze-thawed 3 times (-70°C frozen, 37°C thawed) to induce cell disruption, and after centrifugation (10,000 rpm, 10 min), the supernatant containing hepatitis A virus was recovered and type A Hepatitis virus content was analyzed using the HAV-antigen ELISA Kit (E12; Mediagnost).

As shown in FIG. 7, in the experimental group and the positive control group in which the VP3, 3R, and 3D2-3R vaccine compositions and the positive control Habrix vaccine were reacted with the serum of mice intraperitoneally injected, the proliferation of HM175/18f hepatitis A virus was not increased in the control PBS. decreased compared to (FIG. 7A). Serum from mice intraperitoneally injected with the positive control Habrix vaccine reduced hepatitis A virus growth by 55.4%, and VP3, 3R, and 3D2-3R vaccine compositions reduced hepatitis A virus growth by 22.9, 36.1, and 45.5% ( Figure 7B). Through these results, it was confirmed that antibodies produced by the recombinant VP3, 3R, and 3D2-3R proteins produced, isolated, and purified from recombinant microbial cells had neutralizing ability to inhibit hepatitis A virus proliferation.

The novel recombinant 3R protein vaccine material using the immunodominant epitope of the hepatitis A virus VP3 envelope protein developed in this patent reduced the proliferation of HM175/18f hepatitis A virus by 36.1% (FIG. 7B). This reduced the proliferation of HM175/18f hepatitis A virus by 33.7% and 22.5% compared to recombinant VP1-3N and 3D2 protein vaccine materials using immunodominant epitopes of the existing VP1 envelope protein, which were confirmed to reduce the proliferation of hepatitis A virus by 33.7% and 22.5%, respectively. The improved neutralization ability means that the recombinant 3R protein vaccine material can be used as a better vaccine material than the recombinant VP1-3N and 3D2 protein vaccine materials.

In addition, the novel recombinant 3D2-3R protein vaccine material, which is a fusion of the 3R protein composed of the immunodominant epitope of the VP3 envelope protein and the 3D2 protein composed of the immunodominant epitope of the VP1 envelope protein developed in this patent, inhibits the proliferation of HM175/18f hepatitis A virus. 45.5% reduction (FIG. 7B). Compared to the recombinant 3R protein vaccine material confirmed to reduce the proliferation of HM175/18f hepatitis A virus by 36.1% and the recombinant 3D2 protein vaccine material reported to reduce the proliferation of hepatitis A virus by 22.5% in previous patents, A The improved neutralization ability to inhibit the proliferation of hepatitis virus means that the recombinant 3D2-3R protein vaccine material can be used as a better vaccine material than the recombinant 3R and 3D2 protein vaccine materials.

As described above, the recombinant 3R, 3D2-3R protein vaccine material developed in the present invention uses a 3R protein composed of an immunodominant epitope of VP3 envelope protein, which has not been used in previous hepatitis A recombinant protein vaccine material development studies. It has superiority as a new recombinant protein vaccine material with improved neutralization ability to inhibit the proliferation of hepatitis A virus.

<110> GENEMATRIX Inc. University-Industry Cooperation Group of Kyunghee University <120> Antigen Protein Against Hepatitis a Virus and Vaccine Composition Comprising The Same <130> p21-0042 HS <160> 20 <170> kopatentin 3.0 <210> 1 <211> 738 <212> DNA <213> Hepatitis A virus <400> 1 atgatgagaa atgaatttag ggtcagtact actgagaatg tggtgaatct gtcaaattat 60 gaagatgcaa gagcaaagat gtcttttgct ttggatcagg aagatggaa atctgatccg 120 tcccagggtg gtgggatcaa aattactcat tttaactactt ggacatctat tccaactttg 180 gctgctcagt ttccatttaa tgcttcagac tcagttggtc aacaaattaa agttattcca 240 gttgacccat attttttcca aatgacaaat acaaatcctg accaaaaatg tataactgct 300 ttggcttcta tttgtcagat gt tttgtttt tggagaggag atcttgtctt tgattttcaa 360 gtttttccca ccaaatatca ttcaggtaga ttactgtttt gttttgttcc tggcaatgag 420 ctaatagatg tttctggaat cacattaaag caagcaacta ctgctccttg tgcagtaatg 480 gatattacag gagtgcagtc aactttgaga tttcgtgttc cctggatttc tgacactcct 540 tacagagtga acaggtatac aaagtcagca catcagaaag gtgagtacac tgccattggg 600 aagcttattg tgtattgtta taacagattg acctctcctt ctaacgttgc ttcccatgtc 660 agagtgaatg tttatctttc ag caattaac ttggaatgtt ttgctcctct ttatcatgct 720 atggatgtta ctacacaa 738 <210> 2 <211> 738 <212> DNA <213> Artificial Sequence <220> <223> Optimized sVP3 gene <400> 2 atgatgcgta acgaatttcg tgtttccacc accgaaaacg ttgttaacct gagcaactac 60 gaagatgcgc gtgctaaaat gtctttcgcg ctgg atcagg aagatggaa atctgatccg 120 agccagggtg gcggtattaa aatcacccat ttcaccacct ggacctctat cccgaccctg 180 gcagcgcagt tcccgtttaa cgcgtctgat tctgttggtc agcagattaa agttatcccg 240 gttgatccgt acttcttcca gatgaccaac accaacccgg atcagaaatg catcaccgcg 300 ctggcatcta tctgccagat gttctgcttc tggcgtggtg atctggtttt cgatttccag 360 gttt tcccga ccaaatatca ctctggtcgt ctgctgttct gcttcgttcc gggtaacgaa 420 ctgattgatg tttctggtat caccctgaaa caggcaacca ccgcaccgtg cgctgttatg 480 gatatcaccg gtgttcagag caccctgcgt ttccgtgttc cgtggatctc t gataccccg 540 tatcgtgtta accgttatac caaatctgct caccagaaag gtgaatatac cgctatcggt 600 aaactgatcg tttatgcta caaccgtctg acctctccgt ctaacgttgc atctcacgtt 660 cgtgttaacg tttatctgag cgcgatcaac ctggaatgct tcgcgccgct gtaccacgcg 720 atggatgtta ccacccag 738 <210> 3 <211> 330 <212> DNA <213> Hepatitis A virus <400> 3 gaagattgga aatctgatcc gagccagggt ggcggtatta aaatcaccca tttcaccacc 60 tggacctcta tcccgaccct ggcagcgcag ttcccgttta acgcgtctga ttctgttggt 120 cagcagatta aagttatccc ggttgatccg tacttcttcc agatgaccaa caccaacccg 180 gatcagaaat gcatcaccgc gctggcatct atctgccaga tgttctgctt ctggcgtggt 240 gatctggttt tcgatttcca ggttttcccg accaaatatc actctggtcg t ctgctgttc 300 tgcttcgttc cgggtaacga actgattgat 330 <210> 4 <211> 110 <212> PRT <213> Hepatitis A virus <400> 4 Glu Asp Trp Lys Ser Asp Pro Ser Gln Gly Gly Gly Ile Lys Ile Thr 1 5 10 15 His Phe Thr Thr Trp Thr Ser Ile Pro Thr Leu Ala Ala Gln Phe Pro 20 25 30 Phe Asn Ala Ser Asp Ser Val Gly Gln Gln Ile Lys Val Ile Pro Val 35 40 45 Asp Pro Tyr Phe Phe Gln Met Thr Asn Thr Asn Pro Asp Gln Lys Cys 50 55 60 Ile Thr Ala Leu Ala Ser Ile Cys Gln Met Phe Cys Phe Trp Arg Gly 65 70 75 80 Asp Leu Val Phe Asp Phe Gln Val Phe Pro Thr Lys Tyr His Ser Gly 85 90 95 Arg Leu Leu Phe Cys Phe Val Pro Gly Asn Glu Leu Ile Asp 100 105 110 <210> 5 <211> 1071 <212> DNA <213> Artificial Sequence <220> <223> 3R gene <400> 5 gaagattgga aatctgatcc gagccagggt ggcggtatta aaatcaccca tttcaccacc 60 tggacctcta tcccgaccct ggcagcgcag ttcccgttta acgcgtctga ttctgttggt 120 cagcagatta aagttatccc ggttgatcc g tacttcttcc agatgaccaa caccaacccg 180 gatcagaaat gcatcaccgc gctggcatct atctgccaga tgttctgctt ctggcgtggt 240 gatctggttt tcgatttcca ggttttcccg accaaatatc actctggtcg tctgctgttc 300 tgcttcgttc cgggtaacga actgattgat ggaggcggag gctcagaatt cgaagattgg 360 aaatctgatc cgagccaggg tggcggtatt aaaatcaccc atttcaccac ctggacctct 420 atcccgaccc tggcagcgca gttcccgttt aacgcgtctg attctgttgg tcagcagatt 480 aaagttatcc cggttgatcc gtacttcttc cagatgacca acacca accc ggatcagaaa 540 tgcatcaccg cgctggcatc tatctgccag atgttctgct tctggcgtgg tgatctggtt 600 ttcgatttcc aggttttccc gaccaaatat cactctggtc gtctgctgtt ctgcttcgtt 660 ccgggtaacg aactgattga tggaggcg ga ggctcaaagc ttgaagattg gaaatctgat 720 ccgagccagg gtggcggtat taaaatcacc catttcacca cctggacctc tatcccgacc 780 ctggcagcgc agttcccgtt taacgcgtct gattctgttg gtcagcagat taaagttatc 840 ccggttgatc cgtacttctt ccagatgacc aacaccaacc cggatcagaa atgcatcacc 900 gcgctggcat ctatctgcca gatgttctgc ttctggcgtg gtgatctggt t PRT <213> Artificial Sequence <220> <223> 3R protein <400> 6 Glu Asp Trp Lys Ser Asp Pro Ser Gln Gly Gly Gly Ile Lys Ile Thr 1 5 10 15 His Phe Thr Thr Trp Thr Ser Ile Pro Thr Leu Ala Ala Gln Phe Pro 20 25 30 Phe Asn Ala Ser Asp Ser Val Gly Gln Gln Ile Lys Val Ile Pro Val 35 40 45 Asp Pro Tyr Phe Phe Gln Met Thr Asn Thr Asn Pro Asp Gln Lys Cys 50 55 60 Ile Thr Ala Leu Ala Ser Ile Cys Gln Met Phe Cys Phe Trp Arg Gly 65 70 75 80 Asp Leu Val Phe Asp Phe Gln Val Phe Pro Thr Lys Tyr His Ser Gly 85 90 95 Arg Leu Leu Phe Cys Phe Val Pro Gly Asn Glu Leu Ile Asp Gly Gly 100 105 110 Gly Gly Ser Glu Arg Glu Asp Trp Lys Ser Asp Pro Ser Gln Gly Gly 115 120 125 Gly Ile Lys Ile Thr His Phe Thr Thr Trp Thr Ser Ile Pro Thr Leu 130 135 140 Ala Ala Gln Phe Pro Phe Asn Ala Ser Asp Ser Val Gly Gln Gln Ile 145 150 155 160 Lys Val Ile Pro Val Asp Pro Tyr Phe Phe Gln Met Thr Asn Thr Asn 165 170 175 Pro Asp Gln Lys Cys Ile Thr Ala Leu Ala Ser Ile Cys Gln Met Phe 180 185 190 Cys Phe Trp Arg Gly Asp Leu Val Phe Asp Phe Gln Val Phe Pro Thr 195 200 205 Lys Tyr His Ser Gly Arg Leu Leu Phe Cys Phe Val Pro Gly Asn Glu 210 215 220 Leu Ile Asp Gly Gly Gly Gly Gly Ser Lys Leu Glu Asp Trp Lys Ser Asp 225 230 235 240 Pro Ser Gln Gly Gly Gly Ile Lys Ile Thr His Phe Thr Thr Trp Thr 245 250 255 Ser Ile Pro Thr Leu Ala Ala Gln Phe Pro Phe Asn Ala Ser Asp Ser 260 265 270 Val Gly Gln Gln Ile Lys Val Ile Pro Val Asp Pro Tyr Phe Phe Gln 275 280 285 Met Thr Asn Thr Asn Pro Asp Gln Lys Cys Ile Thr Ala Leu Ala Ser 290 295 300 Ile Cys Gln Met Phe Cys Phe Trp Arg Gly Asp Leu Val Phe Asp Phe 305 310 315 320 Gln Val Phe Pro Thr Lys Tyr His Ser Gly Arg Leu Leu Phe Cys Phe 325 330 335 Val Pro Gly Asn Glu Leu Ile Asp Gly Gly Gly Gly Ser Leu Glu His 340 345 350 His His His His His 355 <210> 7 <211> 1818 <212> DNA <213> Artificial Sequence <220> <223> 3D2-3R <400> 7 atgagcagaa ttgcagctgg agacttggag tcatcagtgg atgatcctag atcagaggaa 60 gataaaagat ttgagagtca tatagaatgc aggaagccat ataaagaact gagattagaa 12 0 gttgggaaac aaagactcaa gtatgctcag gaagaactgt caaatgaagt acttccaccc 180 cctaggaaaa tgaagggact gttttcacaa gccaatattt ctctttttgg aggcggaggc 240 tcagtcgaca tgagcagaat tgcagctgga gacttggagt catcagtgga tgatcctaga 300 tcagaggaag ataaaagatt tgagagtcat atagaatgca ggaagccata taaagaactg 360 agattagaag ttgggaaaca aagactcaag tatgctcagg aagaactgtc aaatgaagta 4 60 0 aaagaactga gattagaagt tgggaaacaa agactcaagt atgctcagga agaactgtca 660 aatgaagtac ttccaccccc taggaaaatg aagggactgt tttcacaagc caatatttct 720 cttttggag gcggaggctc aggtaccgaa gattggaaat ctgatccgag ccagggtggc 780 ggtattaaaa tcacccattt caccacctgg acctctatcc cgaccctggc agcgca gttc 840 ccgtttaacg cgtctgattc tgttggtcag cagattaaag ttatcccggt tgatccgtac 900 ttcttccaga tgaccaacac caacccggat cagaaatgca tcaccgcgct ggcatctatc 960 tgccagatgt tctgcttctg gcgtggtgat ctggtttt cg atttccaggt tttcccgacc 1020 aaatatcact ctggtcgtct gctgttctgc ttcgttccgg gtaacgaact gattgatgga 1080 ggcggaggct cagaattcga agattggaaa tctgatccga gccagggtgg cggtattaaa 1140 atcacccatt tcaccacctg gacctctatc ccgaccctgg cagcgcagtt cccgtttaac 1200 gcgtctgatt ctgttggtca gcagattaaa gttatcccgg ttgatccgta cttcttccag 1260 atgaccaaca ccaacccgga tcagaaatgc atcaccgcgc tggcatctat ctgccagatg 1320 ttctgcttct ggcgtggtga tctggttttc gatttccagg ttttcccgac caaatatcac 1380 tctggtcgtc tgctgttctg cttcgttccg ggtaac gaac tgattgatgg aggcggaggc 1440 tcaaagcttg aagattggaa atctgatccg agccagggtg gcggtattaa aatcacccat 1500 ttcaccacct ggacctctat cccgaccctg gcagcgcagt tcccgtttaa cgcgtctgat 1560 tctgttggtc agcagattaa agttatcccg gttgatccgt acttcttcca gatgaccaac 1620 accaacccgg atcagaaatg catcaccgcg ctggcatcta tctgccagat gttctgcttc 1680 t ggcgtggtg atctggtttt cgatttccag gttttcccga ccaaatatca ctctggtcgt 1740 ctgctgttct gcttcgttcc gggtaacgaa ctgattgatg gaggcggagg ctcactcgag 1800 caccaccacc accaccac 1818 <210> 8 <211> 606 < 212> PRT <213 > Artificial Sequence <220> <223> 3D2-3R <400> 8 Met Ser Arg Ile Ala Ala Gly Asp Leu Glu Ser Ser Val Asp Asp Pro 1 5 10 15 Arg Ser Glu Glu Asp Lys Arg Phe Glu Ser His Ile Glu Cys Arg Lys 20 25 30 Pro Tyr Lys Glu Leu Arg Leu Glu Val Gly Lys Gln Arg Leu Lys Tyr 35 40 45 Ala Gln Glu Glu Leu Ser Asn Glu Val Leu Pro Pro Pro Arg Lys Met 50 55 60 Lys Gly Leu Phe Ser Gln Ala Asn Ile Ser Leu Phe Gly Gly Gly Gly Gly 65 70 75 80 Ser Val Asp Met Ser Arg Ile Ala Ala Gly Asp Leu Glu Ser Ser Val 85 90 95 Asp Asp Pro Arg Ser Glu Glu Asp Lys Arg Phe Glu Ser His Ile Glu 100 105 110 Cys Arg Lys Pro Tyr Lys Glu Leu Arg Leu Glu Val Gly Lys Gln Arg 115 120 125 Leu Lys Tyr Ala Gln Glu Glu Leu Ser Asn Glu Val Leu Pro Pro Pro 130 135 140 Arg Lys Met Lys Gly Leu Phe Ser Gln Ala Asn Ile Ser Leu Phe Gly 145 150 155 160 Gly Gly Gly Ser Lys Leu Met Ser Arg Ile Ala Ala Gly Asp Leu Glu 165 170 175 Ser Ser Val Asp Asp Pro Arg Ser Glu Glu Asp Lys Arg Phe Glu Ser 180 185 190 His Ile Glu Cys Arg Lys Pro Tyr Lys Glu Leu Arg Leu Glu Val Gly 195 200 205 Lys Gln Arg Leu Lys Tyr Ala Gln Glu Glu Leu Ser Asn Glu Val Leu 210 215 220 Pro Pro Pro Arg Lys Met Lys Gly Leu Phe Ser Gln Ala Asn Ile Ser 225 230 235 240 Leu Phe Gly Gly Gly Gly Ser Gly Thr Glu Asp Trp Lys Ser Asp Pro 245 250 255 Ser Gln Gly Gly Gly Ile Lys Ile Thr His Phe Thr Thr Trp Thr Ser 260 265 270 Ile Pro Thr Leu Ala Ala Gln Phe Pro Phe Asn Ala Ser Asp Ser Val 275 280 285 Gly Gln Gln Ile Lys Val Ile Pro Val Asp Pro Tyr Phe Phe Gln Met 290 295 300 Thr Asn Thr Asn Pro Asp Gln Lys Cys Ile Thr Ala Leu Ala Ser Ile 305 310 315 320 Cys Gln Met Phe Cys Phe Trp Arg Gly Asp Leu Val Phe Asp Phe Gln 325 330 335 Val Phe Pro Thr Lys Tyr His Ser Gly Arg Leu Leu Phe Cys Phe Val 340 345 350 Pro Gly Asn Glu Leu Ile Asp Gly Gly Gly Gly Ser Glu Phe Glu Asp 355 360 365 Trp Lys Ser Asp Pro Ser Gln Gly Gly Gly Ile Lys Ile Thr His Phe 370 375 380 Thr Thr Trp Thr Ser Ile Pro Thr Leu Ala Ala Gln Phe Pro Phe Asn 385 390 395 400 Ala Ser Asp Ser Val Gly Gln Gln Ile Lys Val Ile Pro Val Asp Pro 405 410 415 Tyr Phe Phe Gln Met Thr Asn Thr Asn Pro Asp Gln Lys Cys Ile Thr 420 425 430 Ala Leu Ala Ser Ile Cys Gln Met Phe Cys Phe Trp Arg Gly Asp Leu 435 440 445 Val Phe Asp Phe Gln Val Phe Pro Thr Lys Tyr His Ser Gly Arg Leu 450 455 460 Leu Phe Cys Phe Val Pro Gly Asn Glu Leu Ile Asp Gly Gly Gly Gly 465 470 475 480 Ser Lys Leu Glu Asp Trp Lys Ser Asp Pro Ser Gln Gly Gly Gly Ile 485 490 495 Lys Ile Thr His Phe Thr Thr Trp Thr Ser Ile Pro Thr Leu Ala Ala 500 505 510 Gln Phe Pro Phe Asn Ala Ser Asp Ser Val Gly Gln Gln Ile Lys Val 515 520 525 Ile Pro Val Asp Pro Tyr Phe Phe Gln Met Thr Asn Thr Asn Pro Asp 530 535 540 Gln Lys Cys Ile Thr Ala Leu Ala Ser Ile Cys Gln Met Phe Cys Phe 545 550 555 560 Trp Arg Gly Asp Leu Val Phe Asp Phe Gln Val Phe Pro Thr Lys Tyr 565 570 575 His Ser Gly Arg Leu Leu Phe Cys Phe Val Pro Gly Asn Glu Leu Ile 580 585 590 Asp Gly Gly Gly Gly Ser Leu Glu His His His His His His 595 600 605 <210> 9 <211 > 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 accatgggta tgatgcgtaa cgaatttc 28 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ctcgagctgg gtggtaacat ccatc 25 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 ccatggaaga ttggaaatct gatccgagc 29 <210> 12 <211> 45 <212 > DNA <213> Artificial Sequence <220> <223> primer <400> 12 gaattctgag cctccgcctc catcaatcag ttcgttaccc ggaac 45 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400 > 13 gaattcgaag attggaaatc tgatccgagc 30 <210> 14 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 aagctttgag cctccgcctc catcaatcag ttcgttaccc ggaac 45 <210> 15 <21 1> 30 < 212 > DNA <213> Artificial Sequence <220> <223> primer <400> 15 aagcttgaag attggaaatc tgatccgagc 30 <210> 16 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ctcgagtgag cctccgcctc catcaatcag ttcgttaccc ggaac 45 <210> 17 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ccatggaatg agcagaattg cagctggaga c 31 <210> 18 <211> 42 <2 12> DNA <213> Artificial Sequence <220> <223> primer <400> 18 ggtaccagaa ccaccaccgc caaaaagaga aattttggct tg 42 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 ccatgggaag attggaaatc tgatccgagc 30 <210> 20 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer<400> 20 ctcgagtgag cctccgcctc catcaatcag ttcgttaccc ggaac 45

Claims (12)

A hepatitis A virus antigen protein comprising a sequence in which the polypeptide represented by SEQ ID NO: 4 is repeated 1 to 9 times. The hepatitis A virus antigen protein according to claim 1, wherein the protein is the polypeptide repeated three times. The hepatitis A virus antigen protein according to claim 1, wherein the repeating sequence is linked by a linker sequence. The hepatitis A virus antigen protein according to claim 4, wherein the linker sequence is a GGGGS sequence. The hepatitis A virus antigen protein according to any one of claims 1 to 3, wherein the three-time repeated polypeptide is a polypeptide represented by SEQ ID NO: 6. A hepatitis A virus antigen protein in which another protein is fused to an antigen protein in which the polypeptide represented by SEQ ID NO: 4 of claim 2 is repeated three times. The hepatitis A virus antigen protein according to claim 6, wherein the amino acid sequence of the protein is represented by SEQ ID NO: 8. A hepatitis A virus vaccine composition comprising the antigenic protein of claim 1 as an active ingredient. A hepatitis A virus vaccine composition comprising the antigenic protein of claim 2 as an active ingredient. A hepatitis A virus vaccine composition comprising the antigenic protein of any one of claims 6 to 7 as an active ingredient. A vector for expressing the hepatitis A virus antigen protein represented by SEQ ID NO: 6 or SEQ ID NO: 8. Obtaining a polynucleotide encoding a repeating sequence in which the polypeptide represented by SEQ ID NO: 4 is repeated three or more times;
constructing an expression vector containing the obtained polynucleotide;
introducing the expression vector into a host cell;
A method for producing a recombinant hepatitis A virus antigen protein comprising the steps of culturing host cells to recover and purify the expressed protein.

Images