KR20230095307A - Novel Multiple Recombinant Brucella canis Immunogenic Protein and Uses Thereof - Google Patents

Abstract

The present invention relates to novel multiplex recombinant Brucella canis immunogenic proteins and uses thereof. Multiple recombinant Brucella canis immunogenic proteins, recombinant of the three Brucella canis-derived immunogenic proteins (OMP2b, BP26 and OMP31) according to the present invention, exhibit significant Brucella canis-specific immune reactivity, thus preventing brucellosis , In particular, it can be used for the diagnosis of canine brucellosis.

Description

Novel Multiple Recombinant Brucella canis Immunogenic Protein and Uses Thereof

The present invention relates to novel multiplex recombinant Brucella canis immunogenic proteins and uses thereof.

Brucellosis is a second-class statutory infectious disease characterized by miscarriage and infertility by causing inflammation in the reproductive organs and fetal membranes of cattle, pigs, goats, sheep, and dogs. It is a zoonotic infectious disease (group 3 forensic infectious disease) that also infects humans and causes tetanus, malaise, arthritis and osteomyelitis, causing serious public health and economic problems both domestically and globally. Recently, as the demand for companion animals such as dogs is rapidly increasing in Korea, there is a possibility of brucellosis infection in animals or humans through this medium, and countermeasures against this are urgently needed.

Twelve species of brucellosis that cause brucellosis have been known so far, and among them, Brucella abortus (cattle), B. melitensis (sheep, goats), B. canis (dogs), and B. suis (pigs) all infect humans. In Korea, B. abortus and B. canis have been isolated and reported. When the Brucella group is infected with humans, it shows continuous fever (undulating fever), headache, anorexia, and weakness, and as it continues chronically, it progresses to severe diseases such as endocarditis, encephalomyelitis, and arthritis, with a mortality rate of less than 1-3%. It is showing. It is known that animals infected with Brucellosis cause miscarriage due to placenta, endometritis, etc. in females and infertility due to orchitis, deformed sperm, etc. in males without any special external symptoms. In particular, the infected animal continuously discharges Brucella bacteria to the outside while harboring Brucella bacteria for a long time without clear symptoms. In order to treat brucellosis, antibiotic treatment for several weeks to several years is required, and improvement of treatment methods is urgently needed because of the aftereffects caused by taking a large amount of antibiotics. In addition, even if brucellosis is judged to be cured, it often recurs within several years, so continuous observation is required. Brucellosis is an intracellular parasitic bacterium, and even when infected in the body, it is difficult to form immune cells due to low immunogenicity, so there is a problem that eradication of brucellosis is very difficult.

Brucellosis is mainly monitored using serological diagnostic methods, and the main diagnostic methods used here are various agglutination methods using cell antigens, purified lipopolysaccharide (LPS) or lipid-removed O-polysaccharide Diagnosis is made using indirect ELISA (enzyme-linked immunosorbent assay), competitive ELISA, or fluorescence polarization assay (FPA) using O-polysaccharide (OPS) as an antigen.

However, since B. canis , the cause of canine brucellosis, is a rough strain lacking OPS on the surface of the cells, it is difficult to use antigens applied to diagnosis of brucellosis. Until now, methods known as canine brucellosis diagnosis methods include 2ME (Mercaptoethanol)-RSAT (rapid slide agglutination test) using bacterial cells or immunochromatography test kit (ICT) using antigen extracted by HS (hot saline) method ) is being used. In addition, it is known that an agar gel immunodiffusion test (AGID) and ELISA using cytoplasmic antigens can also be used. However, the above method has limitations such as low sensitivity or many non-specific reactions, and thus, development of a new diagnostic method with high diagnostic efficiency is required.

Under this circumstance, the present inventors have endeavored to develop a highly sensitive specific antigen capable of increasing both sensitivity and specificity in the diagnosis of canine brucellosis. As a result, the present inventors have identified three types of multiple antigens through nano scale gene synthesis using sequences of three types of immunogenic proteins (OMP2b, BP26 and OMP31) of canine brucellosis and a linker sequence (EAAAK) connecting them. The gene (LJJ-3recomb) was recombined. In addition, a cloning product into which the recombinant gene was inserted and a transformant mass-producing the same were prepared, and from this, not only three types of multi-antigen recombinant proteins of canine brucellosis were mass-produced, but also a remarkable specificity against actual canine brucellosis-positive serum. By elucidating the immunogenicity, the present invention was completed.

Therefore, one object of the present invention is a multiplex recombinant Brucella canis prepared by genetically combining three types of immunogenic proteins (OMP2b, BP26 and OMP31) of Canine Brucella strains. It is to provide a construct.

Another object of the present invention is to provide a recombinant expression vector for producing multiple recombinant Brucella canis immunogenic proteins.

In addition, another object of the present invention is to provide a transformant strain that produces multiple recombinant Brucella canis immunogenic proteins.

Still another object of the present invention is to provide multiple recombinant Brucella canis immunogenic proteins.

In addition, another object of the present invention is to provide a composition for diagnosing brucellosis, comprising multiple recombinant Brucella canis immunogenic proteins.

In addition, another object of the present invention is to provide a diagnostic kit for canine brucellosis comprising a composition for diagnosing brucellosis.

In addition, another object of the present invention is to provide a method for providing information on brucellosis diagnosis.

In addition, another object of the present invention is to provide a method for producing multiple recombinant Brucella canis immunogenic proteins.

Other objects and advantages of the present invention will become more apparent from the following detailed description and claims.

The terms used herein are used for descriptive purposes only and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, terms such as "include" or "have" are intended to designate that there is a feature, number, step, operation, component, part, or combination thereof described in the specification, but one or more other features It should be understood that the presence or addition of numbers, steps, operations, components, parts, or combinations thereof is not precluded.

In addition, unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiment belongs. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related art, and unless explicitly defined in the present application, they should not be interpreted in an ideal or excessively formal meaning. don't

Hereinafter, the present invention will be described in detail.

According to one aspect of the present invention, the present invention is a multiple recombinant Brucella canis recombinant three types of immunogenic proteins (OMP2b, BP26 and OMP31) of Canine Brucella canis ( Brucella canis ) Gene construct for producing immunogenic proteins ( construct), wherein the gene construct comprises: a gene encoding Brucella canis-derived OMP2b (outer membrane protein 2b); a gene encoding Brucella canis-derived outer membrane protein BP26/OMP28 (BP26); a gene encoding OMP31 (outer membrane protein 31) derived from Brucella canis; And a linker, characterized in that the linker is inserted and connected between the respective genes.

As long as the gene construct of the present invention can achieve the object of the present invention, any Brucella canis-derived OMP2b-encoding gene; Genes encoding any Brucella canis-derived BP26; Genes encoding any Brucella canis-derived OMP31; And it can be used including the nucleotide sequence of an arbitrary linker.

According to a preferred embodiment of the present invention, the gene construct may consist of the codon-optimized nucleotide sequence represented by SEQ ID NO: 4, but is not limited thereto. In addition, homologues of the above nucleotide sequences are included within the scope of the present invention. Specifically, the gene is a base sequence having a sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% with the base sequence of SEQ ID NO: 4. can include The "percentage of sequence homology" for polynucleotides is determined by comparing two optimally aligned sequences with a comparison region, wherein a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. may include additions or deletions (i.e., gaps) compared to (not including).

According to one embodiment of the present invention, the gene construct is a gene encoding 5'-Brucella canis-derived OMP2b (outer membrane protein 2b); linker; a gene encoding Brucella canis-derived outer membrane protein BP26/OMP28 (BP26); linker; It consists of gene-3' encoding OMP31 (outer membrane protein 31) derived from Brucella canis.

According to one embodiment of the present invention, the Brucella canis-derived OMP2b-encoding gene consists of the codon-optimized nucleotide sequence represented by SEQ ID NO: 1; The Brucella canis-derived gene encoding BP26 consists of the codon-optimized nucleotide sequence represented by SEQ ID NO: 2; The Brucella canis-derived gene encoding OMP31 consists of the codon-optimized nucleotide sequence represented by SEQ ID NO: 3; And the gene encoding the linker may consist of the nucleotide sequence represented by SEQ ID NO: 6, 7 or 8, but is not limited thereto. In addition, homologues of the above nucleotide sequences are included within the scope of the present invention.

In the present invention, the "codon optimization" means to change the codon of a polynucleotide encoding a protein to be preferentially used in a specific organism so that the encoded protein is more efficiently expressed in the organism. While the genetic code is degenerate, in that most amino acids are represented by several codons, called "synonymous" or "synonymous" codons, codon usage by particular organisms is not arbitrary and is biased toward particular codon triplets. This codon usage bias can be higher with respect to certain genes, genes of common function or ancestral origin, highly expressed versus low copy number proteins, and collective protein coding regions of an organism's genome. The nucleotide sequence of the present invention is a sequence optimized for the codon of E. coli so that the recombinant gene of the present invention can be expressed in E. coli.

In particular, when genes encoding three types of immunogenic proteins (OMP2b, BP26, and OMP31) of canine Brucella are introduced into the construct of the present invention and linker sequences are inserted between each gene, Upon introduction, it was first discovered that multiple recombinant Brucella canis immunogenic proteins, which are novel Brucella canis antigens, could be mass-produced, and a specific immune response against Brucella was demonstrated.

The term " Brucella spp." of the present invention refers to a bacterium belonging to 1 genus of obligate anaerobic gram-negative bacteria that causes brucellosis infection, which infects humans and various animals to cause brucellosis. may cause disease.

The term "brucellosis" or "brucellosis infection" of the present invention refers to an infectious disease caused by infection with the bacterium Brucella. In infected animals, there are no special external symptoms, but miscarriage due to placenta, endometritis, etc. in females and males It is known to cause infertility due to orchitis and deformed sperm in humans, and when infected in humans, the mortality rate is less than 1-3%, and it shows persistent fever, headache, anorexia, and weakness, followed by endocarditis, encephalomyelitis, arthritis, etc. progresses to serious illness.

The gene construct of the present invention can target all strains belonging to the genus Brucella as long as it can achieve the purpose of the present invention, diagnosis of brucellosis infection, that is, the effect of detecting brucellosis. Canis ( B. canis ), Brucella melitensis ( B. melitensis ), Brucella abortus ( B. abortus ), Brucella suis ( B. suis ), Brucella ovis ( B. ovis ) and Brucella neotoma ( B. abortus) neotomae ), but may be one or more species selected from the group consisting of, but is not limited thereto.

In the present invention, the brucellosis can be interpreted as meaning canine brucellosis, which is a legally infectious disease caused in dogs by Brucella canis .

In addition, according to another aspect of the present invention, the present invention provides a recombinant expression vector for producing multiple recombinant Brucella canis immunogenic proteins comprising the above-described gene construct; And it provides a transformed strain transformed with the recombinant expression vector.

The transformed strain is characterized by producing multiple recombinant Brucella canis immunogenic proteins represented by the amino acid sequence of SEQ ID NO: 5, and may be, for example, a transformed E. coli deposited under accession number KCTC14341BP.

In one embodiment of the present invention, an E. coli strain ( Escherichia coli BL21 LJJ-3recomb), which is a transformant transformed to mass-produce B. canis -derived three multiple antigens (BP26, OMP31 and OMP2b) by introducing the above-described recombinant gene, ) was deposited at the Biological Resource Center (KCTC) of the Research Institute of Bioscience and Biotechnology on October 21, 2020, and was given the accession number KCTC14341BP.

The term “recombinant” refers to a cell that replicates, expresses a heterologous nucleic acid, or expresses a peptide, a protein encoded by a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the cell's native form, either in sense or antisense form. A recombinant cell may also express a gene found in the cell in its natural state, but the gene has been reintroduced into the cell by artificial means as a modified one.

The term “recombinant expression vector” refers to a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In general, any plasmid and vector may be used provided that it is capable of replicating and stabilizing in the host. An important characteristic of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element.

An expression vector containing the gene sequence and appropriate transcription/translation control signals can be constructed by methods well known to those skilled in the art. The method includes in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombinant technology, and the like. The DNA sequence can be effectively linked to a suitable promoter in an expression vector to direct mRNA synthesis. In addition, the expression vector may include a ribosome binding site and a transcription terminator as a translation initiation site.

Any host cell known in the art can be used as a host cell capable of continuously cloning and expressing the vector of the present invention while being stable in prokaryotic cells, such as E. coli BL21, E. coli Rosetta , and E. coli JM109. , E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus strains such as Bacillus thuringiensis, and Salmonella typhimurium, Serratia enteric bacteria and strains such as Marcessons and various Pseudomonas species; and the like.

In addition, when the vector of the present invention is transformed into a eukaryotic cell, as a host cell, yeast ( Saccharomyce cerevisiae ), insect cell, human cell (eg, CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293 , HepG2, 3T3, RIN and MDCK cell lines) and plant cells, etc. may be used.

The method of delivering the vector of the present invention into a host cell, when the host cell is a prokaryotic cell, may be performed by the CaCl ₂ method, the Hanahan method, the electroporation method, and the like. In addition, when the host cell is a eukaryotic cell, the vector can be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, and gene bombardment. can

The target gene can be cloned through a restriction enzyme site, and when a polynucleotide encoding a protein cleavage enzyme recognition site is used, it is linked in frame with the polynucleotide, and the protein is cleaved after secretion of the target protein. When digested with an enzyme, it is possible to produce foreign proteins in their original form.

The term "operably linked" of the present invention means a state in which a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein or RNA of interest are functionally linked to perform a general function. . For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the coding sequence. Operational linkage with the expression vector can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage can be performed using enzymes generally known in the art.

In addition, according to another aspect of the present invention, the present invention provides a multiple recombinant Brucella canis immunogenic protein represented by the amino acid sequence of SEQ ID NO: 5. In addition, the present invention provides a method for preparing the immunogenic protein.

The multiple recombinant Brucella canis immunogenic protein of the present invention is obtained by culturing the transformed Escherichia coli ( E. coli BL21-LJJ-3recomb) deposited with the above accession number KCTC14341BP, multiple recombinant Brucella canis immunogenic protein After obtaining, it is prepared according to the steps of isolating and purifying it.

The multiplex recombinant Brucella canis immunogenic protein of the present invention thus produced is artificial such that Brucella canis-derived OMP2b and Brucella canis-derived OMP31 are bound to the N-terminus and C-terminus of Brucella canis-derived BP26, respectively. It means a fusion protein recombinant (fusion), and is used interchangeably with "three types of immunogenic multiple antigen proteins", "immunogenic protein" or "recombinant protein" in the present specification.

In the present invention, the multiple recombinant Brucella canis immunogenic protein of the present invention is a novel protein antigen consisting of the amino acid sequence represented by SEQ ID NO: 5, and exhibits a Brucella strain, such as canine Brucella-specific immune response effect.

In the present invention, the Brucella canis ( Brucella canis ) is a causative agent of brucellosis in dogs, and according to the agglutination reaction, there are no A and M antigens, but there are R antigens. Accordingly, unlike the R-type strain, Brucella canis, which is a smooth strain, such as Brucella abortus and Brucella melitensis , S-LPS (smooth-lipopolysaccharide) There are many difficulties in serological diagnosis.

The term "smooth or rough LPS (lipopolysaccharide)" of the present invention is a type of LPS and refers to a lipopolysaccharide composed of O-antigen, which is a core oligopolysaccharide, and lipid A.

In the present invention, the Brucella canis is a mutant strain with low consistency and is preferably an M(-) strain used as a diagnostic strain.

In the present invention, immunogenicity refers to the strength of an antigen used for immunization to stimulate an immune response, and varies depending on the size and epitope of the antigen. In addition, even the same antigen may have different immunogenicity depending on the method of administration and the species of animal to be administered.

In an embodiment of the present invention, the multiple recombinant Brucella canis immunogenic protein preferably has a molecular weight of 93.4 kDa.

The range of multiple recombinant Brucella canis immunogenic proteins according to the present invention includes the protein having the amino acid sequence of SEQ ID NO: 5 and functional equivalents of said protein.

The functional equivalent is at least 80% or more, preferably 90% or more preferably 95% or more sequence homology (i.e., identity with the amino acid sequence represented by SEQ ID NO: 5) as a result of addition, substitution or deletion of amino acids. ), for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, including those having sequence homology of 100%, and substantially homologous physiological activity with the multiple recombinant Brucella canis immunogenic protein of SEQ ID NO: 5 represents a peptide.

In addition, multiple recombinant Brucella canis immunogenic proteins of the present invention include proteins having their native amino acid sequences as well as amino acid sequence variants thereof within the scope of the present invention. Multiple variants of recombinant Brucella canis immunogenic protein are proteins having a sequence different from the native amino acid sequence of the recombinant Brucella canis immunogenic protein by deletion, insertion, non-conservative or conservative substitution of one or more amino acid residues, or a combination thereof. it means. Amino acid exchanges in proteins and peptides that do not entirely alter the activity of the molecule are known in the art. The multiple recombinant Brucella canis immunogenic proteins or variants thereof are naturally extracted or synthesized (Merrifeld, J. Amer. chem. Soc. 85:2149-2156, 1963) or prepared by genetic recombination based on DNA sequences. (Sambrook et al, Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, 2nd Edition, 1989).

In the above, substantially homogeneous physiological activity means immunogenicity against Brucella canis.

Also within the scope of the functional equivalents are derivatives in which some of the chemical structures of constituting amino acids are modified while maintaining the backbone of the multiple recombinant Brucella canis immunogenic protein represented by the amino acid sequence of SEQ ID NO: 5 and immunogenicity against Brucella canis. included This includes, for example, structural changes to alter the stability, storage, volatility or solubility of proteins.

In the present invention, the linker is not particularly limited as long as it exhibits an effect of enhancing the activity of the recombinant protein of the present invention, but is preferably glycine, alanine, leucine, isoleucine, proline, serine, threonine, asparagine. , can be linked using amino acids such as aspartic acid, cysteine, glutamine, glutamic acid, lysine, arginic acid, etc., more preferably using several valine, leucine, aspartic acid, glycine, alanine, proline, etc. Most preferably, considering the ease of genetic manipulation, 1 to 5 amino acids such as glycine, valine, leucine, and aspartic acid may be connected and used.

According to another aspect of the present invention, the present invention provides a composition for diagnosing brucellosis comprising the multiple recombinant Brucella canis immunogenic protein.

The causative bacteria of Brucellosis are Brucella canis ( B. canis ), Brucella melitensis ( B. melitensis ), Brucella abortus ( B. abortus ), Brucella suis ( B. suis ), Brucella ovis ( B. ovis ) and Brucella neotoma ( B. neotomae ), and may be one or more species selected from the group consisting of, preferably Brucella canis ( B. canis ), but is not limited thereto.

In the present invention, the diagnosis means confirming the presence or characteristics of a pathological condition. For the purposes of the present invention, diagnosis is to determine whether canine brucellosis is present.

In one embodiment of the present invention, as a result of diagnosing canine brucellosis by performing Western blot using the multiple recombinant Brucella canis immunogenic protein of the present invention, when using the multiple recombinant Brucella canis immunogenic protein of the present invention, the sensitivity and It was confirmed that the multiplex recombinant Brucella canis immunogenic protein according to the present invention is effective in diagnosing canine brucellosis by identifying a high specificity and a very high correlation with brucellosis.

The diagnostic composition of the present invention may further include reagents known in the art used for immunological analysis in addition to multiple recombinant Brucella canis immunogenic proteins. The reagent may include a label capable of generating a detectable signal, a dissolving agent, and a detergent. In addition, when the labeling substance is an enzyme, it may include a substrate capable of measuring enzyme activity and a reaction terminating agent.

The label capable of generating a detectable signal above enables qualitative or quantitative measurement of the formation of an antigen-antibody complex, and examples thereof include enzymes, fluorescent substances, ligands, luminescent substances, microparticles, and redox molecules. and radioactive isotopes. Enzymes include β-glucuronidase, β-D-glucosidase, urease, peroxidase, alkaline phosphatase, acetylcholinesterase, glycosyloxidase, hexokinase, malate dehydrogenase, glucose-6 -Phosphate dehydrogenase, invertase, etc. can be used. As the fluorescent material, fluorescein, isothiocyanate, rhodamine, phycoerytherin, phycocyanin, allophycocyanine, fluorine isothiocyanate, and the like may be used. Ligands include biotin derivatives and the like, and luminescent materials include acridinium esters, luciferin, and luciferase. Microparticles include colloidal gold and colored latex, and redox molecules include ferrocene, ruthenium complex, biologen, quinone, Ti ion, Cs ion, diimide, 1,4-benzoquinone, and hydroquinone. Radioactive isotopes include ³ H, ¹⁴ C, ³² P, ³⁵ S, ³⁶ Cl, ⁵¹ Cr, ⁵⁷ Co, ⁵⁸ Co, ⁵⁹ Fe, ⁹⁰ Y, ¹²⁵ I, ¹³¹ I, and ¹⁸⁶ Re. However, any material that can be used for immunological assays other than those exemplified above may be used.

In addition, the diagnostic composition of the present invention may be provided in an immobilized state on a suitable carrier or support using various methods known in the art to increase the speed and convenience of diagnosis. Examples of suitable carriers or supports include agarose, cellulose, nitrocellulose, dextran, sephadex, sepharose, liposomes, carboxymethyl cellulose, polyacrylamide, polysterine, gabbro, filter paper, ion exchange resin, plastic film, plastic tubes. , glass, polyamine-methyl vinyl-ether-maleic acid copolymers, amino acid copolymers, ethylene-maleic acid copolymers, nylon, cups, flat packs, and the like. Other solid substrates include cell culture plates, ELISA plates, tubes and polymeric membranes. The support may have any conceivable shape, for example spherical (bead), cylindrical (inside a test tube or well), planar (sheet, test strip).

In addition, since the composition of the present invention includes the above-described multiple recombinant Brucella canis immunogenic proteins of the present invention, redundant descriptions thereof are omitted to avoid excessive complexity of the present specification.

According to another aspect of the present invention, a brucellosis diagnostic kit comprising the composition for diagnosing brucellosis is provided.

The diagnostic kit of the present invention may further include reagents known in the art used for immunological analysis. In addition, the diagnostic kit of the present invention may further include a user guide describing optimal performance conditions. Instructions are printed materials that explain how to use the kit, e.g., suggested reaction conditions. The guide includes a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

In addition, since the kit of the present invention includes the above-described composition of the present invention, redundant information is omitted to avoid excessive complexity of the present specification.

According to another aspect of the present invention, the present invention provides an information providing method for diagnosing brucellosis, comprising the step of antigen-antibody reaction of the multiple recombinant Brucella canis immunogenic protein and a biological sample isolated from the subject. .

The term "subject" of the present invention refers to a living organism that can develop brucellosis, preferably a higher vertebrate that can show symptoms of brucellosis, and more preferably is susceptible to brucellosis. livestock such as dogs, cows, pigs, sheep, goats, etc., and humans that can be infected therefrom, and most preferably dogs and people that can be infected therefrom.

In the present invention, the antigen-antibody reaction is Western blot, Indirect ELISA (Enzyme Linked Immunoabsorbent assay), Direct ELISA, Sandwich ELISA, competitive ELISA, radioimmunoassays, Farr assay, immunoprecipitation, latex It is preferable to use at least one analysis method selected from the group consisting of agglutination, hemagglutination, nephelometry, immunodiffusion, counter-current electrophoresis, single radical immunodiffusion, immunochromatography, protein chip, and immunofluorescence, but is not limited thereto. don't

As a result of the antigen-antibody reaction, it is possible to provide information on the diagnosis of brucellosis, especially canine brucellosis, that is, objective basic information necessary for diagnosis, such as presence or absence, pathological condition, etc., and a doctor's clinical judgment or opinion. is excluded.

Since the multiple recombinant Brucella canis immunogenic proteins recombinant with the three Brucella canis-derived immunogenic proteins (OMP2b, BP26 and OMP31) according to the present invention exhibit significant Brucella canis-specific immunoreactivity, they are therefore resistant to brucellosis, especially , can be used for the diagnosis of canine brucellosis.

Figure 1 shows the results of cloning the three recombinant genes (LJJ-3recomb) of B. canis using the pET151/D-TOPO expression system, and the synthesized gene has 4 bases (CACC) at the 5'-end. ), the gene synthesized with more than 90% efficiency was stabilized in the right direction because it annealed with the overhang part of the cloning vector.
Figure 2 is a result showing the structure of three types of recombinant genes (LJJ-3recomb) prepared by combining three types of genes (OMP2b, BP26, OMP31) of B. canis , and a linker that is a link between three types of single antigen genes and antigens (GAA GCT GCA GCA AAG) gene fragments were synthesized and assembled with maximum sequencing accuracy.
Figure 3 shows the results of immunoreactivity analysis through Western blotting using canine brucellosis-positive serum after expressing and purifying three recombinant genes (LJJ-3recomb) of B. canis , showing strong immunoreactivity. A specific reactive band with a size of 93.4 kDa was identified.

Hereinafter, the examples are only for explaining the present invention in more detail, and those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention It will be self-evident for

Example 1. Construction of three novel canine Brucella multi-antigen genes

Canine brucellosis is an infectious disease that causes reproductive disorders mainly in dogs caused by a bacterium called Brucella canis (Brucella (B.) canis), and is a zoonotic disease that also infects humans. Unlike other brucella species, canine brucellosis is an R type (rough strain) that lacks the O-antigen (OPS) in the Lipopolysaccharide (LPS) structure. The sex is low, and there is no specific antigen widely used yet. Until now, diagnostic methods using cell antigens or cytoplasmic antigens have been developed, but there are various limitations in serological diagnosis, such as low sensitivity and specificity, because non-specific reactions are induced by rough-LPS remaining on the surface of cells. Therefore, a specific antigen capable of improving this is required.

Accordingly, the inventors of the present invention prepared three types of canine brucellosis multi-antigen genes in order to obtain a high-sensitivity specific antigen that can be used for diagnosis of canine brucellosis ( B. canis ).

Briefly, in order to combine the three protein antigens (BP26, Omp31 and Omp2b) of B. canis , the target gene DNA sequences for these antigens are linked between each antigen using a linker. At this time, the linker was determined as a sequence (GAAGCTGCAGCAAAG) (SEQ ID NO: 6) that does not affect each other in the structure by having a distance when connecting the two proteins, and considering GC% optimization, the final translation result (EAAAK) is the same Sequences were optimized to be able to (SEQ ID NOs: 7 and 8).

In addition, through the design work, the nucleotide sequence was optimized by inserting SacI (GAGCTC) at the 5'-end and BamHI (GGATCC) at the 3'-end, and the GeneAssembler process was performed by synthesizing and manufacturing gene fragments. The gene (LJJ-3recomb) (SEQ ID NO: 4) was assembled.

The structure of the recombinant gene of the present invention is shown in Figure 2.

sequence name order OMP2b Nucleotide (SEQ ID NO: 1) ATGAACATTAAAAGCCTGCTGCTGGGTAGCGCAGCAGCACTGGTTGCAGCAAGCGGTGCACAGGCAGCAGATGCAATTGTTGCACCGGAACCGGAAGCAGTTGAATATGTTCGTGTTTGTGATGCATATGGTGCCGGTTATTTCTATATTCCGGGTACAGAAACCTGTCTGCGTGTTCATGGTTATGTTCGTTATGATGTTAAAGGCGGTGATGATGTTTACCGGTAGCGATCGTAAAGGTTG GGATAAAAGCGCACGTTTTGCACTGCGTGTTAGCACCGGTAGTGAAACCGAACTGGGCACCCTGAAAACCTTTACCGAACTGCGTTTTAACTATGCAGCAAATAATAGCGGTGTGGATGGCAAATATGGTAATGAAACCAGCAGCGGCACCGTTATGGAATTTGCATATATTCAGTTAGGTGGTCTGCGCGTTGGTATTGATGAAAGCGAATTTCATACCTTTACGGGCTATCTGGGTGATGTGATTAAC GATGATGTTATTAGCGCAGGTAGCTATCGTACCGGTAAAATCAGCTATACATTTACCGGTGGTAATGGTTTTAGCGCAGTTATTGCCCTGGAACAAGGTGGTGATAATGATGGTGGCTATACCGGCACAACCAACTATCATATTGATGGTTATATGCCGGATGTTGTTGGTGGTCTGAAATATGCCGGTGGTTGGGGTAGCATTGCGGGTGTTGTTGCATATGATAGCGTTATTGAAGAATGGGCAGCAA AAGTTCGTGGTGACGTGAATATTACCGATCAGTTTAGCGTTTGGCTGCAGGGTGCATATAGCAGCGCAGCAACACCGGATCAGAATTATGGTCAGTGGGGTGGTGATTGGGCAGTTTGGGGAGGCCTGAAATATCAGGCAACCCAGAAAGCAGCATTTAATCTGCAGGCAGCACATGATGATTGGGGTAAAACCGCAGTTACCGCAAATGTTGCCTATGAACTGGTTCCGGGTTTTACCGTTACACC GGAAGTTAGCTATACAAAATTTGGTGGCGAATGGAAAAATACCGTGGCCGAAGATAATGCATGGGGTGGCATTGTT BP26
Nucleotide (SEQ ID NO: 2) TTTAGTACCATTATGCTGGTTGGTGCATTTAGCCTGCCTGCATTTGCACAAGAAAATCAGATGACCACACAGCCTGCACGTATTGCCGTTACCGGTGAAGGTATGATGACCGCAAGTCCGGATATGGCAATTCTGAATCTGAGCGTTCTGCGTCAGGCAAAAACCGCACGTGAAGCAATGACCGCCAATAATGAAGCCATGACCAAAGTTCTGGATGCCATGAAAAAAGCCGGTATTGAAGATCGT GATCTGCAGACCGGTGGCATTAACATTCAGCCGATTTATGTTTATCCGGATGACAAAAACAACCTGAAAGAACCGACCATTACCGGTTATAGCGTTAGCACCAGCCTGACCGTTCGTGTGCGTGAACTGGCCAATGTTGGTAAAATTCTGGATGAAAGTGTTACCCTGGGTGTTAATCAAGGTGGCGATCTGAACCTGGTTAATGATAATCCGAGCGCAGTGATTAATGAAGCACGTAAACGTGC AGTTGCAAATGCCATTGCAAAAGCAAAAAACCCTGGCAGATGCAGCCGGTGTTGGTCTGGGTCGTGTTGTTGAAATTAGCGAACTGAGCCGTCCGCCTATGCCGATGCCGATTGCACGTGGTCAGTTTCGTACCATGCTGGCAGCCGCACCGGATAATTCAGTTCCGATTGCAGCGGGTGAAAACAGCTATAATGTTAGCGTTAACGTC OMP31 Nucleotide (SEQ ID NO: 3) ATGAAAAGCGTTATTCTGGCAAGCATTGCAGCCATGTTTGCAACCAGCGCAATGGCAGCCGATGTTGTGGTGAGCGAACCGAGCGCACCGACCGCAGCACCGGTTGATACCTTTAGCTGGACCGGTGGTTATATTGGTATTAATGCAGGTTATGCAGGCGGTAAATTCAAACATCCGTTTAGCAGCTTTGACAAAGAAGATAACGAGCAGGTTAGCGGTAGCCTGGATGTTACCGCAGGCGG TTTTGTTGGCGGTGTTCAGGCAGGTTATAATTGGCAGCTGGATAATGGTGTTGTGCTGGGTGCAGAAACCGATTTTCAGGGCAGCAGCGTGACCGGTCCGATTAGTGCCGGTGCAAGCGGTCTGGAAGGTAAAGCAGAAACCAAAGTTGAATGGTTTGGTACAGTCGTGCACGTCTGGGTTATACCGCAACCGAACGTCTGATGGTTTATGGCACCGGTGGTCTGGCATATGGTAAAGTTAAAAG TGCCTTTAATCTGGGAGATGATGCAAGCGCACTGCATACCTGGTCAGATAAAACCAAAGCAGGTTGGACCTTAGGTGCGGGTGCCGAATATGCAATTAACAATAATTGGACGCTGAAAAGCGAGTATCTGTATACCGATCTGGGTAAACGTAATCTGGTGGATGTTGATAACAGCTTCCTGGAAAGCAAAGTGAATTTTCATACAGTTCGCGTGGGCCTGAACTACAAATTTGA LJJ-3recomb
Nucleotide (SEQ ID NO: 4) GAAGCAGCAGCAAAA GAAGCCGCAGCCAAA LJJ-3recombAmino acid (SEQ ID NO: 5) MNIKSLLLGSAAALVAASGAQ AADAIVAPEPEAVEYVRVCDA YGAGYFYIPGTETCLRVHGYV RYDVKGGDDVYTGSDRKGWDK SARFALRVSTGSETELGTLKT FTELRFNYAANNSGVDGKYGN ETSSGTVMEFAYIQLGGLRVG IDESEFHTFTGYLGDVINDDV ISAGSYRTGKISYTFTGGNGF SAVIALEQGGDNDGGYTGTTN YHIDGYMPDVVGGLKYAGGWG SIAGVVAYDSVIEEWAAKVRG DVNITDQFSVWLQGAYSSAAT PDQNYGQWGGDWAVWGGLKYQ ATQKAAFNLQAAHDDWGKTAV TANVAYELVPGFTVTPEVSYT KFGGEWKNTVAEDNAWGGIV EAAAK FSTIMLVGAFSLPAFAQENQM TTQPARIAVTGEGMMTASPDM AILNLSVLRQAKTAREAMTAN NEAMTKVLDAMKKAGIEDRDL QTGGINIQPIYVYPDDKNNLK EPTITGYSVSTSLTVRVRELA NVGKILDESVTLGVNQGGDLN LVNDNPSAVINEARKRAVANA IAKAKTLADAAGVGLGRVVEI SELSRPPMPMPIAR GQFRTML AAAPDNSVPIAAGENSYNVSV NV EAAAK MKSVILASIAAMFATSAMAAD VVVSEPSAPTAAPVDTFSWTG GYIGINAGYAGGKFKHPFSSF DKEDNEQVSGSLDVTAGGFVG GVQAGYNWQLDNGVVLGAETD FQGSSVTGPISAGASGLEGKA ETKVEWFGTVRARLGYTATER LMVYGTGGLAYGKVKSAFNLG DDASALHTWSDKTKAGWTLGA GAEYA INNNWTLKSEYLYTDL GKRNLVDVDNSFLESKVNFHT VRVGLNYKF

Bold font indicates linkers.

Example 2. Cloning of three novel canine Brucella multi-antigen recombinant genes

The present inventors added 4 bases (CACC) to the 5'-end of the gene (LJJ-3recomb) synthesized in Example 1, and using Topoisomerase I, the overhang portion (GTGG) of the pET151 / D-TOPO vector and Engineered to anneal, it stabilized the gene synthesized in the right direction with greater than 90% efficiency. After cloning into the pET151/D-TOPO vector and purifying the selected clone, the desired gene was obtained using the NGS sequencing method (FIG. 1).

Example 3. Recombinant protein production using E. coli expression system

The present inventors, the B. canis -derived recombinant gene for the production of recombinant protein of three types of multiple antigens obtained in Example 2, His-tagged recombinant protein using an E. coli expression system ( E. coli BL21) Expression and purification (6xHis Ni-NTA Agarose system) were performed.

In addition, as shown in Table 2, the expression system of the target combination gene was constructed and purification conditions for mass production of proteins were established. In order to increase the binding efficiency during protein purification, the buffer pH was screened for the highest efficiency buffer conditions (pH 5.2) was established.

On the other hand, the present inventors introduced the recombinant gene to B. canis -derived three types of multiple antigens (OMP2b, BP26 and OMP31) transformed to mass-produce Escherichia coli ( Escherichia coli BL21 LJJ-3recomb), It was deposited at the Institute of Biological Resources Center (KCTC) on October 21, 2020, and was given the accession number KCTC14341BP.

Example 4. Confirmation of immunogenicity of the novel canine Brucella-derived three-type multi-antigen recombinant protein

In order to confirm the immunogenicity of the purified three-type polyantigen recombinant protein (rLJJ-3recomb), the present inventors analyzed the immune response through SDS-PAGE and Western blotting using dog brucellosis-positive serum.

At this time, the canine brucellosis true-positive serum information used in this example is shown in Table 3, the canine brucellosis true-negative serum information is shown in Table 4, and the canine brucellosis test method is shown in Table 5.

2-ME RSAT: 2-mercaptoethanol rapid slide agglutination test

The immune response analysis results are shown in FIG. 3 . At this time, lane 1 is the molecular weight marker; Lane 2 shows the results of SDS-PAGE of total protein extracts obtained from non-induced E. coli BL21 LJJ-3recomb; Lane 3 shows the result of SDS-PAGE of the total protein extract obtained from E. coli BL21 LJJ-3recomb after 18 hours of induction with 1 mM IPTG; Lane 4 shows the result of SDS-PAGE with the purified recombinant protein; Lane 5 shows the result of SDS-PAGE with the same recombinant protein used in lane 4, transferred to a membrane, and Western blotting with antiserum pooled from positive dogs infected with B. canis ; Lane 6 shows the results of Western blotting with antiserum pooled from normal dogs negative for B. canis infection.

As a result, as shown in lane 4 of FIG. 3, it was confirmed through SDS-PAGE that the purified three-type polyantigen recombinant protein (rLJJ-3recomb) of the present invention had a size of 93.4 kDa.

In addition, as shown in lane 5 of FIG. 3, in order to investigate the immunogenicity of the purified three-type multi-antigen recombinant protein (rLJJ-3recomb) of the present invention, the purified three-type multi-antigen recombinant protein (rLJJ-3recomb) of the present invention -3 recomb) was reacted with the serum of a Brucellosis-positive dog (dog infected with Brucella) and Western blotting was performed. reaction was confirmed.

Therefore, these results demonstrate that the novel three-type polyantigenic recombinant protein (rLJJ-3recomb) of the present invention can accurately diagnose canine brucellosis.

Overall, the present inventors recombined B. canis -derived three multiple antigens (BP26, OMP31 and OMP2b) to construct transformants that mass-produce them, and novel canine Brucella-derived three multiple antigen recombinants. A protein (rLJJ-3recomb) was obtained. When the canine Brucella-derived three-type multi-antigen recombinant protein of the present invention was used, it was confirmed that it showed specific and significant immune reactivity to canine Brucella-positive serum.

Therefore, it is expected that the novel canine brucellosis-derived three-type multi-antigen recombinant protein (rLJJ-3recomb) of the present invention can be used in various ways in the field of canine brucellosis diagnosis.

Although the present invention has been described in terms of the preferred embodiments mentioned above, various modifications and variations are possible without departing from the spirit and scope of the invention. The appended claims also cover such modifications and variations as fall within the subject matter of this invention.

Korea Research Institute of Bioscience and Biotechnology KCTC14341BP 20201021

<110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Novel Multiple Recombinant Brucella canis Immunogenic Protein and Uses Thereof <130> QIA1-111P <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 1068 <212> DNA 213 <br><br><br> <400> 1 atgaacatta aaagcctgct gctgggtagc gcagcagcac tggttgcagc aagcggtgca 60 caggcagcag atgcaattgt tgcaccggaa ccggaagcag ttgaatatgt tcgtgtttgt 120 gatgcatatg gtgccggtta tttctatatt ccgggtacag aaacctgtct gcgtgttcat 180 ggttatgttc gttatgatgt taaaggcggt gatgatgttt ataccggtag cgatcgtaaa 240 ggttgggata aaagcgcacg ttttgcactg cgtgttagca ccggtagtga aaccgaactg 300 ggcaccctga aaacctttac cgaactgcgt tttaactatg cagcaaataa tagcggtgtg 360 gatggcaaat atggtaatga aaccagcagc ggcaccgtta tggaatttgc atatattcag 420 ttaggtggtc tgcgcgttgg tattgatgaa agcgaatttc atacctttac gggctatctg 480 ggtgatgtga ttaacgatga tgttattagc gcaggtagct atcgtaccgg taaaatcagc 540 tatacattta ccggtggtaa tggttttagc gcagttattg ccctggaaca aggtggtgat 600 aatgatggtg gctataccgg cacaaccaac tatcatattg atggttatat gccggatgtt 660 gttggtggtc tgaaatatgc cggtggttgg ggtagcattg cgggtgttgt tgcatatgat 720 agcgttattg aagaatgggc agcaaaagtt cgtggtgacg tgaatattac cgatcagttt 780 agcgtttggc tgcagggtgc atatagcagc gcagcaacac cggatcagaa ttatggtcag 840 tggggtggtg attgggcagt ttggggaggc ctgaaatatc aggcaaccca gaaagcagca 900 tttaatctgc aggcagcaca tgatgattgg ggtaaaaccg cagttaccgc aaatgttgcc 960 tatgaactgg ttccgggttt taccgttaca ccggaagtta gctatacaaa atttggtggc 1020 gaatgggaaaa ataccgtggc cgaagataat gcatggggtg gcattgtt 1068 <210> 2 <211> 699 <212> DNA 213 <br><br><br> <400> 2 tttagtacca ttatgctggt tggtgcattt agcctgcctg catttgcaca agaaaatcag 60 atgaccacac agcctgcacg tattgccgtt accggtgaag gtatgatgac cgcaagtccg 120 gatatggcaa ttctgaatct gagcgttctg cgtcaggcaa aaaccgcacg tgaagcaatg 180 accgccaata atgaagccat gaccaaagtt ctggatgcca tgaaaaaagc cggtattgaa 240 gatcgtgatc tgcagaccgg tggcattaac attcagccga tttatgttta tccggatgac 300 aaaaacaacc tgaaagaacc gaccattacc ggttatagcg ttagcaccag cctgaccgtt 360 cgtgtgcgtg aactggccaa tgttggtaaa attctggatg aaagtgttac cctgggtgtt 420 aatcaaggtg gcgatctgaa cctggttaat gataatccga gcgcagtgat taatgaagca 480 cgtaaacgtg cagttgcaaa tgccattgca aaagcaaaaa ccctggcaga tgcagccggt 540 gttggtctgg gtcgtgttgt tgaaattagc gaactgagcc gtccgcctat gccgatgccg 600 attgcacgtg gtcagtttcg taccatgctg gcagccgcac cggataattc agttccgatt 660 gcagcgggtg aaaacagcta taatgttagc gttaacgtc 699 <210> 3 <211> 723 <212> DNA 213 <br><br><br> <400> 3 atgaaaagcg ttattctggc aagcattgca gccatgtttg caaccagcgc aatggcagcc 60 gatgttgtgg tgagcgaacc gagcgcaccg accgcagcac cggttgatac ctttagctgg 120 accggtggtt atattggtat taatgcaggt tatgcaggcg gtaaattcaa acatccgttt 180 agcagctttg acaaagaaga taacgagcag gttagcggta gcctggatgt taccgcaggc 240 ggttttgttg gcggtgttca ggcaggttat aattggcagc tggataatgg tgttgtgctg 300 ggtgcagaaa ccgattttca gggcagcagc gtgaccggtc cgattagtgc cggtgcaagc 360 ggtctggaag gtaaagcaga aaccaaagtt gaatggtttg gtacagttcg tgcacgtctg 420 ggttataccg caaccgaacg tctgatggtt tatggcaccg gtggtctggc atatggtaaa 480 gttaaaagtg cctttaatct gggagatgat gcaagcgcac tgcatacctg gtcagataaa 540 accaaagcag gttggacctt aggtgcgggt gccgaatatg caattaacaa taattggacg 600 ctgaaaagcg agtatctgta taccgatctg ggtaaacgta atctggtgga tgttgataac 660 agcttcctgg aaagcaaagt gaattttcat acagttcgcg tgggcctgaa ctacaaattt 720 tga 723 <210> 4 <211> 2532 <212> DNA <213> artificial sequence <220> <223> LJJ-3recomb <400> 4 gagctcatga acattaaaag cctgctgctg ggtagcgcag cagcactggt tgcagcaagc 60 ggtgcacagg cagcagatgc aattgttgca ccggaaccgg aagcagttga atatgttcgt 120 gtttgtgatg catatggtgc cggttatttc tatattccgg gtacagaaac ctgtctgcgt 180 gttcatggtt atgttcgtta tgatgttaaa ggcggtgatg atgtttatac cggtagcgat 240 cgtaaaggtt gggataaaag cgcacgtttt gcactgcgtg ttagcaccgg tagtgaaacc 300 gaactgggca ccctgaaaac ctttaccgaa ctgcgtttta actatgcagc aaataatagc 360 ggtgtggatg gcaaatatgg taatgaaacc agcagcggca ccgttatgga atttgcatat 420 attcagttag gtggtctgcg cgttggtatt gatgaaagcg aatttcatac ctttacgggc 480 tatctgggtg atgtgattaa cgatgatgtt attagcgcag gtagctatcg taccggtaaa 540 atcagctata catttaccgg tggtaatggt tttagcgcag ttattgccct ggaacaaggt 600 ggtgataatg atggtggcta taccggcaca accaactatc atattgatgg ttatatgccg 660 gatgttgttg gtggtctgaa atatgccggt ggttggggta gcattgcggg tgttgttgca 720 tatgatagcg ttattgaaga atgggcagca aaagttcgtg gtgacgtgaa tattaccgat 780 cagtttagcg tttggctgca gggtgcatat agcagcgcag caacaccgga tcagaattat 840 ggtcagtggg gtggtgattg ggcagtttgg ggaggcctga aatatcaggc aacccagaaa 900 gcagcattta atctgcaggc agcacatgat gattggggta aaaccgcagt taccgcaaat 960 gttgcctatg aactggttcc gggttttacc gttacaccgg aagttagcta tacaaaattt 1020 ggtggcgaat ggaaaaatac cgtggccgaa gataatgcat ggggtggcat tgttgaagca 1080 gcagcaaaat ttagtaccat tatgctggtt ggtgcattta gcctgcctgc atttgcacaa 1140 gaaaatcaga tgaccacaca gcctgcacgt attgccgtta ccggtgaagg tatgatgacc 1200 gcaagtccgg atatggcaat tctgaatctg agcgttctgc gtcaggcaaa aaccgcacgt 1260 gaagcaatga ccgccaataa tgaagccatg accaaagttc tggatgccat gaaaaaagcc 1320 ggtattgaag atcgtgatct gcagaccggt ggcattaaca ttcagccgat ttatgtttat 1380 ccggatgaca aaaacaacct gaaagaaccg accattaccg gttatagcgt tagcaccagc 1440 ctgaccgttc gtgtgcgtga actggccaat gttggtaaaa ttctggatga aagtgttacc 1500 ctgggtgtta atcaaggtgg cgatctgaac ctggttaatg ataatccgag cgcagtgatt 1560 aatgaagcac gtaaacgtgc agttgcaaat gccattgcaa aagcaaaaac cctggcagat 1620 gcagccggtg ttggtctggg tcgtgttgtt gaaattagcg aactgagccg tccgcctatg 1680 ccgatgccga ttgcacgtgg tcagtttcgt accatgctgg cagccgcacc ggataattca 1740 gttccgattg cagcgggtga aaacagctat aatgttagcg ttaacgtcga agccgcagcc 1800 aaaatgaaaa gcgttattct ggcaagcatt gcagccatgt ttgcaaccag cgcaatggca 1860 gccgatgttg tggtgagcga accgagcgca ccgaccgcag caccggttga tacctttagc 1920 tggaccggtg gttatattgg tattaatgca ggttatgcag gcggtaaatt caaacatccg 1980 tttagcagct ttgacaaaga agataacgag caggttagcg gtagcctgga tgttaccgca 2040 ggcggttttg ttggcggtgt tcaggcaggt tataattggc agctggataa tggtgttgtg 2100 ctgggtgcag aaaccgattt tcagggcagc agcgtgaccg gtccgattag tgccggtgca 2160 agcggtctgg aaggtaaagc agaaaccaaa gttgaatggt ttggtacagt tcgtgcacgt 2220 ctgggttata ccgcaaccga acgtctgatg gtttatggca ccggtggtct ggcatatggt 2280 aaagttaaaa gtgcctttaa tctgggagat gatgcaagcg cactgcatac ctggtcagat 2340 aaaaccaaag caggttggac cttaggtgcg ggtgccgaat atgcaattaa caataattgg 2400 acgctgaaaa gcgagtatct gtataccgat ctgggtaaac gtaatctggt ggatgttgat 2460 aacagcttcc tggaaagcaa agtgaatttt catacagttc gcgtgggcct gaactacaaa 2520 ttttgaggat cc 2532 <210> 5 <211> 839 <212> PRT <213> artificial sequence <220> <223> LJJ-3recomb <400> 5 Met Asn Ile Lys Ser Leu Leu Leu Gly Ser Ala Ala Ala Leu Val Ala 1 5 10 15 Ala Ser Gly Ala Gln Ala Ala Asp Ala Ile Val Ala Pro Glu Pro Glu 20 25 30 Ala Val Glu Tyr Val Arg Val Cys Asp Ala Tyr Gly Ala Gly Tyr Phe 35 40 45 Tyr Ile Pro Gly Thr Glu Thr Cys Leu Arg Val His Gly Tyr Val Arg 50 55 60 Tyr Asp Val Lys Gly Gly Asp Asp Val Tyr Thr Gly Ser Asp Arg Lys 65 70 75 80 Gly Trp Asp Lys Ser Ala Arg Phe Ala Leu Arg Val Ser Thr Gly Ser 85 90 95 Glu Thr Glu Leu Gly Thr Leu Lys Thr Phe Thr Glu Leu Arg Phe Asn 100 105 110 Tyr Ala Ala Asn Asn Ser Gly Val Asp Gly Lys Tyr Gly Asn Glu Thr 115 120 125 Ser Ser Gly Thr Val Met Glu Phe Ala Tyr Ile Gln Leu Gly Gly Leu 130 135 140 Arg Val Gly Ile Asp Glu Ser Glu Phe His Thr Phe Thr Gly Tyr Leu 145 150 155 160 Gly Asp Val Ile Asn Asp Asp Val Ile Ser Ala Gly Ser Tyr Arg Thr 165 170 175 Gly Lys Ile Ser Tyr Thr Phe Thr Gly Gly Asn Gly Phe Ser Ala Val 180 185 190 Ile Ala Leu Glu Gln Gly Gly Asp Asn Asp Gly Gly Tyr Thr Gly Thr 195 200 205 Thr Asn Tyr His Ile Asp Gly Tyr Met Pro Asp Val Val Gly Gly Leu 210 215 220 Lys Tyr Ala Gly Gly Trp Gly Ser Ile Ala Gly Val Val Ala Tyr Asp 225 230 235 240 Ser Val Ile Glu Glu Trp Ala Ala Lys Val Arg Gly Asp Val Asn Ile 245 250 255 Thr Asp Gln Phe Ser Val Trp Leu Gln Gly Ala Tyr Ser Ser Ala Ala 260 265 270 Thr Pro Asp Gln Asn Tyr Gly Gln Trp Gly Gly Asp Trp Ala Val Trp 275 280 285 Gly Gly Leu Lys Tyr Gln Ala Thr Gln Lys Ala Ala Phe Asn Leu Gln 290 295 300 Ala Ala His Asp Asp Trp Gly Lys Thr Ala Val Thr Ala Asn Val Ala 305 310 315 320 Tyr Glu Leu Val Pro Gly Phe Thr Val Thr Pro Glu Val Ser Tyr Thr 325 330 335 Lys Phe Gly Gly Glu Trp Lys Asn Thr Val Ala Glu Asp Asn Ala Trp 340 345 350 Gly Gly Ile Val Glu Ala Ala Ala Lys Phe Ser Thr Ile Met Leu Val 355 360 365 Gly Ala Phe Ser Leu Pro Ala Phe Ala Gln Glu Asn Gln Met Thr Thr 370 375 380 Gln Pro Ala Arg Ile Ala Val Thr Gly Glu Gly Met Met Thr Ala Ser 385 390 395 400 Pro Asp Met Ala Ile Leu Asn Leu Ser Val Leu Arg Gln Ala Lys Thr 405 410 415 Ala Arg Glu Ala Met Thr Ala Asn Asn Glu Ala Met Thr Lys Val Leu 420 425 430 Asp Ala Met Lys Lys Ala Gly Ile Glu Asp Arg Asp Leu Gln Thr Gly 435 440 445 Gly Ile Asn Ile Gln Pro Ile Tyr Val Tyr Pro Asp Asp Lys Asn Asn 450 455 460 Leu Lys Glu Pro Thr Ile Thr Gly Tyr Ser Val Ser Thr Ser Leu Thr 465 470 475 480 Val Arg Val Arg Glu Leu Ala Asn Val Gly Lys Ile Leu Asp Glu Ser 485 490 495 Val Thr Leu Gly Val Asn Gln Gly Gly Asp Leu Asn Leu Val Asn Asp 500 505 510 Asn Pro Ser Ala Val Ile Asn Glu Ala Arg Lys Arg Ala Val Ala Asn 515 520 525 Ala Ile Ala Lys Ala Lys Thr Leu Ala Asp Ala Ala Gly Val Gly Leu 530 535 540 Gly Arg Val Val Glu Ile Ser Glu Leu Ser Arg Pro Pro Met Pro Met 545 550 555 560 Pro Ile Ala Arg Gly Gln Phe Arg Thr Met Leu Ala Ala Ala Pro Asp 565 570 575 Asn Ser Val Pro Ile Ala Ala Gly Glu Asn Ser Tyr Asn Val Ser Val 580 585 590 Asn Val Glu Ala Ala Ala Lys Met Lys Ser Val Ile Leu Ala Ser Ile 595 600 605 Ala Ala Met Phe Ala Thr Ser Ala Met Ala Ala Asp Val Val Val Ser 610 615 620 Glu Pro Ser Ala Pro Thr Ala Ala Pro Val Asp Thr Phe Ser Trp Thr 625 630 635 640 Gly Gly Tyr Ile Gly Ile Asn Ala Gly Tyr Ala Gly Gly Lys Phe Lys 645 650 655 His Pro Phe Ser Ser Phe Asp Lys Glu Asp Asn Glu Gln Val Ser Gly 660 665 670 Ser Leu Asp Val Thr Ala Gly Gly Phe Val Gly Gly Val Gln Ala Gly 675 680 685 Tyr Asn Trp Gln Leu Asp Asn Gly Val Val Leu Gly Ala Glu Thr Asp 690 695 700 Phe Gln Gly Ser Ser Val Thr Gly Pro Ile Ser Ala Gly Ala Ser Gly 705 710 715 720 Leu Glu Gly Lys Ala Glu Thr Lys Val Glu Trp Phe Gly Thr Val Arg 725 730 735 Ala Arg Leu Gly Tyr Thr Ala Thr Glu Arg Leu Met Val Tyr Gly Thr 740 745 750 Gly Gly Leu Ala Tyr Gly Lys Val Lys Ser Ala Phe Asn Leu Gly Asp 755 760 765 Asp Ala Ser Ala Leu His Thr Trp Ser Asp Lys Thr Lys Ala Gly Trp 770 775 780 Thr Leu Gly Ala Gly Ala Glu Tyr Ala Ile Asn Asn Asn Trp Thr Leu 785 790 795 800 Lys Ser Glu Tyr Leu Tyr Thr Asp Leu Gly Lys Arg Asn Leu Val Asp 805 810 815 Val Asp Asn Ser Phe Leu Glu Ser Lys Val Asn Phe His Thr Val Arg 820 825 830 Val Gly Leu Asn Tyr Lys Phe 835 <210> 6 <211> 15 <212> DNA <213> artificial sequence <220> <223> linker <400> 6 gaagctgcag caaag 15 <210> 7 <211> 15 <212> DNA <213> artificial sequence <220> <223> linker <400> 7 gaagcagcag caaaa 15 <210> 8 <211> 15 <212> DNA <213> artificial sequence <220> <223> linker <400> 8 gaagccgcag ccaaa 15

Claims (17)

Multiple recombinant Brucella canis ( Brucella canis ) As a genetic construct for the production of immunogenic proteins,
The gene construct includes a gene encoding Brucella canis-derived OMP2b (outer membrane protein 2b); a gene encoding Brucella canis-derived outer membrane protein BP26/OMP28 (BP26); a gene encoding OMP31 (outer membrane protein 31) derived from Brucella canis; And characterized in that it comprises a linker,
Gene construct.
According to claim 1,
Characterized in that the gene encoding OMP2b (outer membrane protein 2b) derived from Brucella canis consists of the nucleotide sequence represented by SEQ ID NO: 1,
Gene construct.
According to claim 1,
Characterized in that the gene encoding the Brucella canis-derived BP26 (outer membrane protein BP26/OMP28) consists of the nucleotide sequence represented by SEQ ID NO: 2,
Gene construct.
According to claim 1,
Characterized in that the gene encoding OMP31 (outer membrane protein 31) derived from Brucella canis consists of the nucleotide sequence represented by SEQ ID NO: 3,
Gene construct.
According to claim 1,
Characterized in that the linker consists of the nucleotide sequence represented by SEQ ID NO: 6, 7 or 8,
Gene construct.
According to claim 1,
The gene construct includes a gene encoding 5'-Brucella canis-derived OMP2b (outer membrane protein 2b); linker; a gene encoding Brucella canis-derived outer membrane protein BP26/OMP28 (BP26); linker; Characterized in that it consists of a gene-3 'encoding OMP31 (outer membrane protein 31) derived from Brucella canis,
Gene construct.
According to claim 1,
Characterized in that the gene construct consists of the nucleotide sequence represented by SEQ ID NO: 4, the gene construct (construct).
A recombinant expression vector for the production of multiple recombinant Brucella canis immunogenic proteins comprising the gene construct of any one of claims 1 to 7.
A transformed strain transformed by the recombinant expression vector of claim 8.
According to claim 9,
The transformant strain, which produces multiple recombinant Brucella canis immunogenic proteins represented by the amino acid sequence of SEQ ID NO: 5, is a transformed E. coli deposited under accession number KCTC14341BP ( E. coli BL21-LJJ-3recomb) Characterized in that, the transformed strain.
Multiple recombinant Brucella canis immunogenic protein represented by the amino acid sequence of SEQ ID NO: 5.
According to claim 11,
The multiple recombinant Brucella canis immunogenic protein is characterized in that Brucella canis-derived OMP2b and Brucella canis-derived OMP31 are fused to the N-terminus and C-terminus of Brucella canis-derived BP26, respectively.
Multiple recombinant Brucella canis immunogenic proteins.
A composition for diagnosing brucellosis, comprising the multiple recombinant Brucella canis immunogenic protein of claim 11.
According to claim 13,
The causative bacteria of Brucellosis are Brucella canis ( B. canis ), Brucella melitensis ( B. melitensis ), Brucella abortus ( B. abortus ), Brucella suis ( B. suis ), Brucella ovis ( B. ovis ) and Brucella Neotoma ( B. neotomae ) Characterized in that at least one species selected from the group consisting of,
A composition for diagnosing brucellosis.
A diagnostic kit for brucellosis comprising the composition for diagnosing brucellosis according to claim 13.
multiple recombinant Brucella canis immunogenic proteins of claim 11; and performing an antigen-antibody reaction of the biological sample isolated from the subject to determine whether or not he or she is infected with brucellosis.
A method for producing multiple recombinant Brucella canis immunogenic proteins, comprising culturing the transformed strain of claim 9.

Images