KR20230091592A - Recombinant protein comprising endolysin and cecropin A, and composition comprising the same - Google Patents

Abstract

The present invention relates to a recombinant protein containing endolysin and cecropin A having an ability to kill pathogenic bacteria having multidrug resistance to antibiotics, and a composition containing the same. The recombinant protein according to the present invention is endolysin and cecropin A. By including A, it exhibits superior antibacterial activity against antibiotic-resistant bacteria compared to endolysin alone, so it can effectively prevent or treat infectious diseases caused by infection with antibiotic-resistant bacteria, and can be used for various purposes such as antibiotics and disinfectants. do.

Description

Recombinant protein comprising endolysin and cecropin A, and composition comprising the same

The present invention relates to a recombinant protein containing endolysin and cecropin A having the ability to kill pathogenic bacteria having multi-drug resistance to antibiotics, and to a composition containing the same, and more specifically, to a composition containing endolysin and cecropin A. It relates to a recombinant protein, and a polynucleotide encoding the same, a pharmaceutical composition for preventing or treating a pathogenic bacterial infection including the same, and antibiotics and disinfectants.

Acinetobacter baumannii is a gram-negative bacterium belonging to Gammaproteobacteria, which is widely distributed in natural environments such as soil and water, and shows weak pathogenicity to healthy people with strong immunity, but whose immune system is damaged or It is an opportunistic pathogen that is highly virulent in weakened individuals. In particular, due to multiple drug resistance (MDR), which is resistant to antibiotics such as carbapenems, aminoglycosides, and fluoroquinolones, in-hospital infections such as intensive care unit patient infections Acinetobacter baumani infection causes various infections, including pneumonia, endocarditis, bloodstream infection, urinary tract infection, and peritonitis. In addition to Acinetobacter baumani, bacteria that cause clinically serious problems due to antibiotic resistance include vancomycin-resistant Enterococcus faecium , methicillin-resistant Staphylococcus aureus , and multidrug-resistant Klebsiella new There are Klebsiella pneumonia , capapenem-resistant Pseudomonas aeruginosa , multidrug-resistant Enterobacter cloacae , and the like, and these six types of bacteria are called ESKAPE.

Recently, the use of bacteriophage (bacteriophage) has attracted great attention as a countermeasure against bacterial infectious diseases. Bacteriophages proliferate inside bacterial cells after infection with bacteria, and have the ability to kill bacteria by destroying the cell wall of the host bacteria when progeny bacteriophages come out of the bacteria after proliferation. Bacteriophage secretes an enzyme called endolysin to degrade the cell wall of bacteria, which hydrolyzes only peptidoglycan in the cell wall of bacteria, so it can be used as an antibacterial substance against Gram-negative bacteria with cell walls. there is. However, bacteriophages have high specificity and exhibit antibacterial effects only against specific bacteria, and since the level of antibacterial activity of endolysin is different depending on the type of bacteriophage, it is necessary to develop an antibacterial substance capable of exhibiting non-specific and improved antibacterial activity using endolysin. A lot of research is needed.

Republic of Korea Patent Registration No. 10-2189126 Republic of Korea Patent No. 10-2228999

An object of the present invention is to provide a recombinant protein containing endolysin and cecropin A.

Another object of the present invention is to provide a polynucleotide encoding the recombinant protein.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating a pathogenic bacterial infection comprising the recombinant protein.

In addition, an object of the present invention is to provide an antibiotic comprising the recombinant protein.

In addition, an object of the present invention is to provide a disinfectant containing the recombinant protein.

One aspect of the present invention provides a recombinant protein comprising endolysin and cecropin A consisting of the amino acid sequence represented by SEQ ID NO: 1.

As used in the present invention, "endolysin" is a hydrolytic enzyme produced by bacteriophage, which uses peptidoglycan, a component of bacterial cell walls, as a substrate to decompose and disintegrate cell walls to kill bacteria. Since the peptidoglycan exists only in bacteria and does not exist in humans or animals, such endolysin does not affect humans and animals, so it is safe and can be applied to the pharmaceutical industry and biotechnology, as well as without problems with multi-drug resistance to antibiotics. It has the advantage of effectively killing bacteria at the target site or target material.

According to one embodiment of the present invention, the endolysin may be derived from bacteriophage Ab1656-2.

The bacteriophage Ab1656-2 is isolated from the domestic clinical isolation strain, antibiotic-resistant Acinetobacter baumannii (Multidrug-resistant A. baumannii ) 1656-2 strain, killed against Acinetobacter baumanni standard strain (ATCC 17978) It was confirmed that it has the ability and was deposited at the Korean Collection for Type Cultures of the Korea Research Institute of Bioscience and Biotechnology on September 17, 2020 (accession number KCTC 14314BP).

Endolysin derived from the bacteriophage Ab1656-2 is an Acinetobacter baumani-specific enzyme that causes a lytic action only in Acinetobacter baumannii.

According to one embodiment of the present invention, the endolysin may include the nucleotide sequence represented by SEQ ID NO: 2.

"Cecropin" used in the present invention is a protein isolated from the larva (cocoon) of the moth (Cecropia moth), and is an insect-specific protein synthesized through the immune response of body fluids when non-pathogenic bacteria are injected into the larvae. There are subtypes such as Cecropin A, Cecropin B, and Cecropin P1. These cecropins pierce the cell membrane of bacteria, thereby exhibiting functional disorders such as inhibition of material transport, and exhibit antibacterial effects at concentrations low enough to be harmless to animal cells.

According to one embodiment of the present invention, the cecropin A may consist of the amino acid sequence represented by SEQ ID NO: 3.

The Cecropin A refers to sequence information (accession no. PRF: 0708214A) provided by NCBI GenBank, and may include the nucleotide sequence represented by SEQ ID NO: 4.

According to one embodiment of the present invention, the recombinant protein may include the amino acid sequence represented by SEQ ID NO: 5.

The recombinant protein including endolysin and cecropin A is not harmful to eukaryotes or eukaryotic cells such as humans or animals, and the antibacterial activity of endolysin can be further improved by including cecropin A.

In one embodiment of the present invention, the recombinant protein including endolysin and cecropin A has improved antibacterial activity against Acinetobacter baumani compared to endolysin alone, and staphylococcus, an antibiotic-resistant bacterium that is not killed only by endolysin. It was confirmed that the antibacterial activity was also exhibited against Coccus aureus.

In addition, another aspect of the present invention provides a polynucleotide encoding the recombinant protein.

The polynucleotide may include sequences encoding endolysin and cecropin A.

According to one embodiment of the present invention, the polynucleotide may have the nucleotide sequence represented by SEQ ID NO: 6.

Such polynucleotides can be provided as recombinant vectors or recombinant cells containing them.

After the recombinant vector is transformed into a suitable host cell, it can be replicated independently of the genome of the host cell or can be sutured to the genome itself, and can be used as an expression vector. Here, "a suitable host cell" is a vector capable of replicating, and may include a replication origin, which is a specific nucleotide sequence at which replication is initiated.

The recombinant vector may be any one selected from the group consisting of a plasmid vector, a viral vector and a cosmid vector.

In the case of the plasmid, it may be a plasmid capable of delivery and replication by conjugation to prokaryotic or eukaryotic cells. For example, the plasmid may be a pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based or pET-based plasmid. Specifically, it may be pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pUC18, pBAD, pJK001, pCM, or pAWP, but is not limited thereto.

According to one embodiment of the present invention, the recombinant vector may include the nucleotide sequence represented by SEQ ID NO: 7.

The recombinant cell includes cells transfected, transformed, or infected with the above-described recombinant vector or polynucleotide in vivo or in vitro, and refers to a recombinant host cell or a recombinant microorganism. Here, "transformation" means introducing an expression vector containing a polynucleotide encoding a protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. Host cells are called transformants. As such a host cell, those known in the art may be used without limitation.

The recombinant protein according to the present invention can be produced through such a recombinant vector or recombinant cell.

In addition, another aspect of the present invention provides a pharmaceutical composition for preventing or treating pathogenic bacterial infections comprising the recombinant protein as an active ingredient.

As used in the present invention, "pathogenic bacterial infection" means a disease caused by bacterial infection that can cause clinical problems.

"Prevention" or "treatment" used in the present invention means prevention, suppression and alleviation of infections caused by pathogenic bacteria.

According to one embodiment of the present invention, the pathogenic bacteria may be antibiotic-resistant bacteria.

More specifically, the antibiotic-resistant bacteria are bacteria of the genus Enterococcus , bacteria of the genus Staphylococcus, bacteria of the genus Klebsiella , bacteria of the genus Acinetobacter , bacteria of the genus Pseudomonas And Enterobacter ( Enterobacter ) It may be a genus bacteria, etc., but is not limited thereto.

According to one embodiment of the present invention, the pathogenic bacteria may be at least one selected from the group consisting of bacteria of the genus Acinetobacter and bacteria of the genus Staphylococcus.

In one embodiment of the present invention, recombinant protein P, in which endolysin and cecropin A are fused, exhibits excellent antibacterial activity against clinical isolates having multidrug resistance to antibiotics as well as Acinetobacter baumani standard strain compared to endolysin alone. , it was confirmed that it had excellent antibacterial activity against Staphylococtus aureus.

Therefore, the pharmaceutical composition containing the recombinant protein according to the present invention as an active ingredient can effectively prevent or treat infections caused by pathogenic bacteria, that is, bacteria of the genus Acinetobacter and bacteria of the genus Staphylococcus.

According to one embodiment of the present invention, the pharmaceutical composition may further include Zn ²⁺ as a cofactor.

The cofactor corresponds to a substance necessary to exhibit the enzymatic action of endolysin.

For administration, the pharmaceutical composition according to the present invention may include pharmaceutically acceptable carriers, excipients or diluents in addition to the above-described active ingredients. The carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but are not limited thereto.

In addition, the pharmaceutical composition according to the present invention is formulated in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories or sterile injection solutions according to conventional methods, respectively. can be used Specifically, when formulated, it may be prepared using diluents or excipients such as commonly used fillers, weighting agents, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like. Such a solid preparation may be prepared by mixing at least one or more excipients, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc., in addition to the active ingredient. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. It may be prepared by adding various excipients, for example, wetting agents, sweeteners, aromatics, and preservatives, in addition to liquids and liquid paraffin for oral use. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations and tablets. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. As a base for the suppository, Witepsol, Macrosol, Tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

A suitable dose of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the drug type, and the time, but can be appropriately selected by a person skilled in the art, and the daily dose of the composition is preferably 0.001 mg/kg to 1,000 mg/kg, and may be divided and administered once a day to several times as needed.

In addition, another aspect of the present invention provides an antibiotic comprising a recombinant protein as an active ingredient.

"Antibiotics" used in the present invention is a generic term for cosmetic or pharmaceutical preservatives, bactericides and antibacterial agents.

The recombinant protein according to the present invention, by including endolysin and cecropin A, exhibits improved killing ability of Acinetobacter baumani compared to endolysin alone, as well as excellent killing ability against Staphylococtus aureus. , When using such a recombinant protein as an antibiotic, unlike using conventional antibiotics, it has an important advantage of not inducing antibiotic resistance or resistance, so it is a new antibiotic with a longer life cycle than existing antibiotics. can be provided. While most antibiotics face increasing resistance, their use range is inevitably reduced, whereas the antibiotic containing the recombinant protein as an active ingredient according to the present invention can fundamentally solve the problem of antibiotic resistance, so the product lifespan as an antibiotic will be extended to that extent. It is expected that

In addition, another aspect of the present invention provides a disinfectant comprising the recombinant protein as an active ingredient.

The disinfectant of the present invention includes the recombinant protein according to the present invention, which exhibits an effective killing ability against pathogenic bacteria having antibiotic resistance, such as Acinetobacter baumani and Staphylococtus aureus, thereby preventing hospital acquired infections. ) can be usefully used as a disinfectant for hospitals and health care.

Since the recombinant protein according to the present invention contains endolysin and cecropin A, it exhibits superior antibacterial activity against antibiotic-resistant bacteria compared to endolysin alone, and thus can effectively prevent or treat infectious diseases caused by infection with antibiotic-resistant bacteria. It can be used for various purposes such as antibiotics and disinfectants.

1 is a result of electrophoresis confirming PCR products of (a) endolysin and cecropin A, and (b) cecropin A-endolysin in 1% agarose according to an embodiment of the present invention. am.
Figure 2 is a schematic diagram of the recombinant plasmid pB4_cecropin A-endolysin according to an embodiment of the present invention.
Figure 3 relates to the cecropin A-endolysin recombinant protein produced and purified from the recombinant plasmid pB4_cecropin A-endolysin according to an embodiment of the present invention, (a) shows 1 of the cecropin A-endolysin recombinant protein FPLC (Fast protein liquid chromatography) graph according to primary Ni-NTA column purification, (b) is a strain homogenate (soni) obtained by disrupting the transformed strain with an ultrasonicator, supernatant (sup) and pellets obtained by centrifugation ( pel), unbound substances (Unbound, U) not attached to the Ni-NTA column during protein purification, and purified fractions (2, 7-10) bound to the Ni-NTA column were confirmed by electrophoresis on 10% SDS-PAGE This is the result.
Figure 4 relates to the cecropin A-endolysin recombinant protein produced and purified from the recombinant plasmid pB4_cecropin A-endolysin according to an embodiment of the present invention. FPLC (fast protein liquid chromatography) graph following secondary Ni-NTA column purification of Finn A-endolysin recombinant protein, and (b) fractions containing target proteins not attached to the Ni-NTA column during protein purification (U1, U2 ) and the purified fractions (8, 9, 14, 15) bound to the Ni-NTA column were confirmed by electrophoresis on 10% SDS-PAGE.
Figure 5 is a result of comparative analysis of the antibacterial activity of recombinant protein P against clinical isolates of A. baumannii with endolysin according to an embodiment of the present invention.
Figure 6 is a result of comparative analysis of the antibacterial activity of recombinant protein P against the ESKAPE strain with endolysin according to an embodiment of the present invention.
7 is a result of comparative analysis of the morphological change of A. baumannii standard strain by recombinant protein P according to an embodiment of the present invention with endolysin.

Hereinafter, the present invention will be described in more detail with reference to the accompanying drawings. However, these descriptions are merely presented as examples to aid understanding of the present invention, and the scope of the present invention is not limited by these exemplary descriptions.

Example 1. Preparation of recombinant protein P

1-1. endolysin

The genome of bacteriophage Ab1656-2 (accession number KCTC14314BP) isolated from domestic clinical isolates, antibiotic-resistant Acinetobacter baubani (Multidrug-resistant A. baumannii ) 1656-2 strain, was analyzed using Phage DNA isolation kit (NORGEN). After purification according to the manufacturer's protocol, Macrogen was commissioned to perform full sequence analysis through Next Generation Sequencing. As a result, it was confirmed that the genome of the bacteriophage Ab1656-2 is about 51 kb in size as double-stranded DNA and includes an endolysin gene composed of the nucleotide sequence represented by SEQ ID NO: 2. Hereafter, endolysin of SEQ ID NO: 2 was used.

1-2. Cecropin A

Referring to the sequence information of Cecropin A provided by NCBI GenBank (accession no. PRF: 0708214A), Cecropin A having the nucleotide sequence represented by SEQ ID NO: 4 was used.

1-3. Recombinant protein P production and purification

PCR of endolysin (588 bp) using the genome of bacteriophage Ab1656-2 as a template using primers 1 and 2 and cecropin A (111 bp) using primers 3 and 4 as a template and the nucleotide sequence of SEQ ID NO: 4 as a template amplified (FIG. 1A). Cecropin A-endolysin polynucleotide (699 bp) (SEQ ID NO: 6) in which endolysin and cecropin A were fused was prepared by site directed PCR (FIG. 1b). PCR products were confirmed by electrophoresis in 1% agarose. The prepared polynucleotide was cloned into the pB4 plasmid by the LIC method, and the structure of the recombinant plasmid (pB4_cecropin A-endolysin) prepared therefrom is shown in FIG. 2 (SEQ ID NO: 7). The recombinant plasmid was confirmed by DNA sequencing using primers 5 and 6 at Macrogen.

Then, the recombinant plasmid was transformed into E. coli BL21 star. Transformed E. coli was inoculated into LB liquid medium supplemented with ampicillin (100 μg/ml) antibiotic, cultured in a shaking incubator at 37°C until OD ₆₀₀ = 0.6, and then IPTG (isopropyl β-D-1-thiogalactopyranoside) (0.2 mM/ml) was added and incubated for 18 hours in a shaking incubator at 18°C. To purify IPTG-induced recombinant proteins, cultured strains were harvested by centrifugation and released into lysis buffer (containing 20 mM Tris pH 7.5, 0.5 M NaCl and 0.5 M imidazole). Thereafter, the strain was disrupted with an ultrasonicator, the disrupted strain was centrifuged, and the supernatant was filtered with a 0.45um filter, and an elution buffer (20 mM Tris pH) was applied to the Ni-NTA column through FPLC (Fast-protein liquid chromatography). 7.0, 0.5 M NaCl and 0.5 M imidazole) were injected to harvest recombinant proteins in which histidine-tagged cecropin A and endolysin were fused. Thereafter, TEV protease was added to the harvested recombinant protein to perform artificial dialysis and TEV site cleavage to separate MBP (His-tag) and cecropin A-endolysin recombinant proteins (FIG. 3). Thereafter, pure recombinant protein P from which MBP was removed was obtained through secondary Ni-NTA purification (FIG. 4).

The primers used here are shown in Table 1 below.

primer Primer sequence (5'-3') sequence number One Endolysin_F GGGCGGCGGTGGTGGCGGCATGCCGCCTTCGGGCG 8 2 Endolysin_R GTTCTTCTTCCTTTGCGCCCTATATAACAACTCGATTGGCGATC 9 3 Cecropin_F CGGGGGCGGTGGTGGCGGCATGGCTAGCAAATGGAAACTGTTTAAAAAA 10 4 Cecropin_R AAGGCGGCATACTACCCGAGCCGCTGCC 11 5 pB4_seq_F GTCAGACTGTCGATGAAG 12 6 pB4_seq_R CATCACCATCTAATTCAAC 13

Comparative Example 1. Preparation of endolysin

Endorysin was produced and purified in the same manner as in Example 1, except that the endolysin gene fragment was cloned into the pB4 plasmid instead of the polynucleotide (SEQ ID NO: 6) in which endolysin and cecropin A were fused.

Experimental example 1. A. baumannii Antibacterial activity assay of recombinant protein P against

Recombinant protein P of Example 1 or endolysin 100 of Comparative Example 1 to a final volume of 200 ul per well in a U-type 96-well plate in order to conduct a growth inhibition experiment of A. baumannii clinical isolates with antibiotic resistance. , 50, 25, 12.5, 6.25, 3.12, 1.56 ug/well, and then 12 clinical isolates of A. baumannii were added at 4x10 ⁶ CFU/well, respectively. In addition, the cofactor Zn ²⁺ was added to a final concentration of 1 mM/ml and incubated at 37° C. for 18 hours to evaluate the antibacterial activity of the recombinant protein P.

As a result, as shown in FIG. 5, the recombinant protein P was found to have improved killing ability against 12 clinical isolates of A. baumannii with antibiotic multidrug resistance compared to endolysin alone by including cecropin A together with endolysin. Confirmed.

Experimental Example 2. Analysis of antibacterial activity of recombinant protein P against strain ESKAPE

ESKAPE strains ( Enterococcus faecium KCTC 13225, Staphlylococcus aureus ATCC 33591, Klebsiella pneumoniae ATCC 13883, Acinetobacter baumannii ATCC 17978, Pseudomonas aeruginosa ATCC 27853, and Enterobacter cloacae KCTC 2519) were used instead of A. baumannii clinical isolates. Except, Experimental Example 1 Antibacterial activity of the recombinant protein P was evaluated in the same manner as described above.

As a result, as shown in FIG. 6, it was confirmed that the recombinant protein P had excellent antibacterial activity against Staphlylococcus aureus as well as A. baumannii compared to endolysin alone.

On the other hand, both recombinant protein P and endolysin showed no antibacterial activity against Enterococcus faecium , Klebsiella pneumoniae and Pseudomonas aeruginosa , whereas both recombinant protein A and endolysin had antibacterial activity against Enterobacter cloacae .

Experimental Example 3. By recombinant protein P A. baumannii Analysis of morphological changes in standard strains

FE-SEM (Field emission scanning electron microscopy, field emission scanning electron microscopy) was performed to image the antibacterial activity of the recombinant protein P against the A. baumannii standard strain. First, a circular slide glass was placed in a 6-well plate, coated with Poly-L-Lysine, and sterilized by UV for 1 hour. Then, 2 ml of LB liquid medium was added to each well, A. baumannii ATCC 17978 4X10 ⁵ CFU/well was inoculated, and grown up to OD ₆₀₀ = 0.5 in a shaking incubator at 37°C, and then the slide glass was placed in a new LB liquid medium (containing 2 mM ZnCl ₂ ). After transferring to a new 6-well plate containing 2 ml, 125 ug/ml of recombinant protein P of Example 1 or endolysin of Comparative Example 1 was added and activated in a shaking incubator at 37° C. for 1 hour. Thereafter, the treatment material was removed, treated with ethanol, and a fixation step was performed, and FE-SEM was taken.

As a result, as shown in FIG. 7, A. baumannii treated with endolysin maintained a cell shape similar to that of untreated A. baumannii, while A. baumannii treated with recombinant protein A had a depressed center or a cell center. It was observed that the contents leaked out due to bursting. These results suggest that the recombinant protein P exhibits excellent killing ability by changing the cell morphology of A. baumannii .

So far, the present invention has been looked at with respect to its preferred embodiments. Those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent scope will be construed as being included in the present invention.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Recombinant protein comprising endolysin and cecropin A, and composition comprising the same <130> BPN210152 <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 195 <212 > PRT <213> Artificial Sequence <220> <223> endolysin <400> 1 Met Pro Pro Ser Gly Gly Phe Leu His Leu Lys Glu Thr Glu Met Asn 1 5 10 15 Ile Glu Gln Tyr Leu Asp Glu Leu Ile Lys Arg Glu Gly Gly Tyr Val 20 25 30 Asn Asn Pro Ala Asp Arg Gly Gly Glu Thr Lys Tyr Gly Ile Thr Glu 35 40 45 Ala Val Ala Arg Thr Asn Gly Phe Lys Gly Asn Met Lys Asp Leu Pro 50 55 60 Leu Asp Val Ala Lys Ala Ile Tyr Lys Lys Gln Tyr Trp Thr Asp Pro 65 70 75 80 Arg Phe Asp Gln Val Asn Val Ile Ser Ser Leu Val Ala Glu Glu Leu 85 90 95 Leu Asp Thr Gly Val Asn Cys Gly Thr Gly Phe Ala Lys Pro Leu Leu 100 105 110 Gln Arg Ala Leu Asn Leu Leu Asn Asn Gln Gly Lys Ala Gly Trp Pro 115 120 125 Asp Leu Thr Val Asp Gly Ile Tyr Gly Pro Ala Thr Leu Asn Ala Leu 130 135 140 Lys Thr Tyr Leu Ala Lys Arg Gly Lys Asp Gly Glu Lys Val Leu Val 145 150 155 160 Arg Val Leu Asn Ile Met Gln Gly Gln Arg Tyr Ile Glu Ile Cys Glu 165 170 175 Arg Asn Pro Ser Gln Glu Gln Phe Phe Tyr Gly Trp Ile Ala Asn Arg 180 185 190 Val Val Ile 195 <210> 2 <211> 588 <212> DNA <213> Artificial Sequence <220> <223> endolysin <400> 2 atgccgcctt cgggcggttt tttacatctg aaggaaaccg aaatgaacat tgaacaatat 60 ctggacgagt taattaagcg tgagggcg gg tacgtaaaca acccagcaga tcgaggcggt 120 gaaacaaagt acggtattac tgaagcagta gcacgtacta acggctttaa gggcaacatg 180 aaagatttac cgcttgatgt ggccaaagcc atttataaaa agcagtattg gacagatccg 240 cgatttgatc aagtgaatgt aattagctcg ttagttgctg aagagctttt agatactggg 300 gtaaattgcg gtaccggatt tgcaaaacca ctcttacagc gtgctttaaa tttgctgaat 360 aaccaaggta aagcaggttg gccagattta acagttgacg gaatttatgg tccagcaact 420 cttaatgcac tcaaaactta tctggccaag cgtggaaaag acggcgaaaa agtcctggtg 480 cgtgttctta atatcatgca agggcaacgt ta cattgaaa tctgtgaacg caatcctagc 540 caggaacagt ttttctatgg ttggatcgcc aatcgagttg ttatatag 588 <210> 3 <211> 46 <212> PRT <213> Artificial Sequence <220> <223> cecropin A <400> 3 Met Ala Ser Lys Trp Lys Leu Phe Lys Lys Ile Glu Lys Val Gly Gln 1 5 10 15 Asn Ile Arg Asp Gly Ile Ile Lys Ala Gly Pro Ala Val Ala Val Val 20 25 30 Gly Gln Ala Thr Gln Ile Ala Lys Gly Ser Gly Ser Gly Ser 35 40 45 <210> 4 <211> 138 <212> DNA <213> Artificial Sequence <220> <223> cecropin A <400> 4 atggctagca aatggaaact gtttaaaaaa attgaaaaag tgggccagaa cattcgcgat 60 ggcattatta aagcgggccc ggcggtggcg gtggtgggcc aggcgaccca gattgcgaaa 120 ggcagcggct cg ggtagt 138 <210> 5 <211> 241 <212> PRT <213> Artificial Sequence <220 > <223> cecropin A-endolysin <400> 5 Met Ala Ser Lys Trp Lys Leu Phe Lys Lys Ile Glu Lys Val Gly Gln 1 5 10 15 Asn Ile Arg Asp Gly Ile Ile Lys Ala Gly Pro Ala Val Ala Val Val 20 25 30 Gly Gln Ala Thr Gln Ile Ala Lys Gly Ser Gly Ser Gly Ser Met Pro 35 40 45 Pro Ser Gly Gly Phe Leu His Leu Lys Glu Thr Glu Met Asn Ile Glu 50 55 60 Gln Tyr Leu Asp Glu Leu Ile Lys Arg Glu Gly Gly Tyr Val Asn Asn 65 70 75 80 Pro Ala Asp Arg Gly Gly Glu Thr Lys Tyr Gly Ile Thr Glu Ala Val 85 90 95 Ala Arg Thr Asn Gly Phe Lys Gly Asn Met Lys Asp Leu Pro Leu Asp 100 105 110 Val Ala Lys Ala Ile Tyr Lys Lys Gln Tyr Trp Thr Asp Pro Arg Phe 115 120 125 Asp Gln Val Asn Val Ile Ser Ser Leu Val Ala Glu Glu Leu Leu Asp 130 135 140 Thr Gly Val Asn Cys Gly Thr Gly Phe Ala Lys Pro Leu Leu Gln Arg 145 150 155 160 Ala Leu Asn Leu Leu Asn Asn Gln Gly Lys Ala Gly Trp Pro Asp Leu 165 170 175 Thr Val Asp Gly Ile Tyr Gly Pro Ala Thr Leu Asn Ala Leu Lys Thr 180 185 190 Tyr Leu Ala Lys Arg Gly Lys Asp Gly Glu Lys Val Leu Val Arg Val 195 200 205 Leu Asn Ile Met Gln Gly Gln Arg Tyr Ile Glu Ile Cys Glu Arg Asn 210 215 220 Pro Ser Gln Glu Gln Phe Phe Tyr Gly Trp Ile Ala Asn Arg Val Val 225 230 235 240 Ile <210> 6 <211> 726 <212> DNA <213> Artificial Sequence <220> <223> cecropin A-endolysin <400> 6 atggctagca aatggaaact gtttaaaaaa attgaaaaag tgggccagaa cattcgcgat 60 ggcattatta aagcgggccc ggc ggtggcg gtggtgggcc aggcgaccca gattgcgaaa 120 ggcagcggct cgggtagtat gccgccttcg ggcggttttt tacatctgaa ggaaaccgaa 180 atgaacattg aacaatatct ggacgagtta attaagcgtg agggcgggta cgtaaacaac 240 ccagcagatc gaggcggtga aacaaagtac ggtattactg aagcagtagc acgtactaac 300 ggctttaagg gcaacatgaa agatttacc g cttgatgtgg ccaaagccat ttataaaaag 360 cagtattgga cagatccgcg atttgatcaa gtgaatgtaa ttagctcgtt agttgctgaa 420 gagcttttag atactggggt aaattgcggt accggatttg caaaaccact cttacagcgt 480 gctttaaatt tgctgaataa c caaggtaaa gcaggttggc cagatttaac agttgacgga 540 atttatggtc cagcaactct taatgcactc aaaacttatc tggccaagcg tggaaaagac 600 ggcgaaaaag tcctggtgcg tgttcttaat atcatgcaag ggcaacgtta cattgaaatc 660 tgtgaacgca atcctagcca ggaacagttt ttctatggtt ggatcgccaa tcgagttgtt 720 atatag 726 <210 > 7 <211> 8021 <212> DNA <213> Artificial Sequence <220> <223> pB4_cecropin A-endolysin <400> 7 taatacgact cactataggg gaattgtgag cggataacaa ttcccctcta gaaataattt 60 tgtttaactt taagaaggag atatacatat gggcagcagc aatcatcatc atcatcacgg 120 taccaaaact gaagaaggta aactggtaat ctggattaac ggcgataaag gctataacgg 180 tctcgctgaa gtcggtaaga aattcgagaa agataccgga attaaagtca ccgttgagca 240 tccggataaa ctggaagaga aattcccaca ggttgcggca actggcgatg gccctgacat 300 tatcttctgg gcacacgacc gctttggtgg ctacgctcaa tctggcctgt tggctgaaat 360 cacccc ggac aaagcgttcc aggacaagct gtatccgttt acctgggatg ccgtacgtta 420 caacggcaag ctgattgctt acccgatcgc tgttgaagcg ttatcgctga tttataacaa 480 agatctgctg ccgaacccgc caaaaacctg ggaagagatc ccggcgctgg ataaagaact 540 gaaagcgaaa ggtaagagcg cgctgatgtt caacctgcaa gaaccgtact tcacc tggcc 600 gctgattgct gctgacgggg gttatgcgtt caagtatgaa aacggcaagt acgacattaa 660 agacgtgggc gtggataacg ctggcgcgaa agcgggtctg accttcctgg ttgacctgat 720 taaaaacaaa cacatgaatg cagacaccga ttactccatc gcagaagct g cctttaataa 780 aggcgaaaca gcgatgacca tcaacggccc gtgggcatgg tccaacatcg acaccagcaa 840 agtgaattat ggtgtaacgg tactgccgac cttcaagggt caaccatcca aaccgttcgt 900 tggcgtgctg agcgcaggta ttaacgccgc cagtccgaac aaagagctgg caaaagagtt 960 cctcgaaaac tatctgctga ctgatgaagg tctggaagcg gttaataaag acaaaccgct 1020 gggtgccgta gcgctgaagt cttacgagga agagttggcg aaagatccac gtattgccgc 1080 caccatggaa aacgcccaga aaggtgaaat catgccgaac atcccgcaga tgtccgcttt 1140 ctggtatgcc gtgcgtactg cggtgatcaa cgccgccagc ggtcgtcaga ct gtcgatga 1200 agccctgaaa gacgcgcaga ctggtaccga ttacgatatc ccaacgaccg aaaaccttta 1260 cttccagggc ggcggtggtg gcggcatggc ctga aggaaa ccgaaatgaa cattgaacaa tatctggacg agttaattaa 1500 gcgtgagggc gggtacgtaa acaacccagc agatcgaggc ggtgaaacaa agtacggtat 1560 tactgaagca gtagcacgta ctaacggctt taagggcaac atgaaagatt taccgcttga 1620 tgtgcca aa gccatttata aaaagcagta ttggacagat ccgcgatttg atcaagtgaa 1680 tgtaattagc tcgttagttg ctgaagagct tttagatact ggggtaaatt gcggtaccgg 1740 atttgcaaaa ccactcttac agcgtgcttt aaatttgctg aataaccaag gtaaagcagg 1800 ttggccagat ttaacagttg acggaattta tggtccagca actcttaatg cactcaaaac 1860 ttatctggcc aagcgtggaa aagacggcga aaaagtcctg gtgcgtgttc ttaatatcat 1920 gcaagggcaa cgttacattg aaatctgtga acgcaatcct agccaggaac agtttttcta 1980 tggttggatc gccaatcgag ttgttatata gccgggcgca aaggagaaga actgttcact 2040 ggtgttgtcc caatt cttgt tgaattagat ggtgatgtta atgggcacaa attttctgtc 2100 agtggagagg gtgaaggtga tgcaacatac ggaaaactta cccttaaatt tatttgcact 2160 actggaaaac tacctgttcc atggccaaca cttgtcacta ctttctctta tggtgttcaa 2220 tgcttttccc gttatccgga tcacatgaaa cggcatgact ttttcaagag tgccatgccc 2280 gaaggttatg tacaggaacg cactatatct a caaaagaat ggaatcaaag ctaacttcaa aattcgccac 2520 aacattgaag atggctccgt tcaactagca gacattatc aacaaaatac tccaattggc 2580 gatggccctg tccttttacc agacaaccat tacctgtcga cacaatctgc cctttcgaaa 2640 gatcccaacg aaaagcgtga ccacatggtc cttcttgagt ttgtaactgc tgctgggatt 2700 acacatggca tggatgagct ctacaaataa gcttgcggcc gcact ggcgaat ggg acgcgccctg tagcggcgca 2940 ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg ctacacttgc cagcgcccta 3000 gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg ctttccccgt 3060 caagctctaa atcgggggct ccctttaggg ttccgattta gtgctttacg gcacctcgac 3120 cccaaaaaac ttgattaggg tgatggttca cg tagtgggc catcgccctg atagacggtt 3180 tttcgccctt tgacgttgga gtccacgttc tttaatagtg gactcttgtt ccaaactgga 3240 acaacactca accctatctc ggtctattct tttgatttat aagggatttt gccgatttcg 3300 gcctattggt taaaaaat ga gctgatttaa caaaaattta acgcgaattt taacaaaata 3360 ttaacgctta caatttaggt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt 3420 tatttttcta gtga aagtaa 3600 aagatgctga agatcagttg ggtgcacgag tggttacat cgaactggat ctcaacagcg 3660 gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag 3720 ttctgctatg tggcgcggta ttatcccgta tt gacgccgg gcaagagcaa ctcggtcgcc 3780 gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta 3840 cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg 3900 cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca 3960 acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac 4020 caaacgacga gcgtgacacc acgatgcctg cagcaatggc aacaacgttg cgcaaactat 4080 taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg 4140 ataaagttgc aggacactt ctgcgctcgg cccttccggc tggctggttt attgctgata 4200 aatct ggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta 4260 agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa 4320 atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag 4380 tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg 4440 tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact 4500 gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg 4560 taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc 4 620 aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata 4680 ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 4740 catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc 4800 ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 4860 ggggttcgtg cacacagccc agct tggagc gaacgaccta caccgaactg agatacctac 4920 agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 4980 taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt 5040 atctttatag tcc tgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct 5100 cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg 5160 ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata 5220 accgtattac cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca 5280 gcgagtcagt gagcgaggaa gcggaaga gc gcctgatgcg gtattttctc cttacgcatc 5340 tgtgcggtat ttcacaccgc aatggtgcac tctcagtaca atctgctctg atgccgcata 5400 gttaagccag tatacactcc gctatcgcta cgtgactggg tcatggctgc gccccgacac 5460 ccgccaacac cc gctgacgc gccctgacgg gcttgtctgc tcccggcatc cgcttacaga 5520 caagctgtga ccgtctccgg gagctgcatg tgtcagaggt tttcaccgtc atcaccgaaa 5580 cgcgcgaggc agctgcggta aagctcatca gcgtggtcgt gaagcgattc acagatgtct 5640 gcctgttcat ccgcgtccag ctcgttgagt ttctccagaa gcgttaatgt ctggcttctg 5700 ataaagcggg ccatgttaag ggcggttttt tcctgttt gg tcactgatgc ctccgtgtaa 5760 gggggatttc tgttcatggg ggtaatgata ccgatgaaac gagagaggat gctcacgata 5820 cgggttactg atgatgaaca tgcccggtta ctggaacgtt gtgagggtaa acaactggcg 5880 gtatggatgc ggcgggacca gagaa aaatc actcagggtc aatgccagcg cttcgttaat 5940 acagatgtag gtgttccaca gggtagccag cagcatcctg cgatgcagat ccggaacata 6000 atggtgcagg gcgctgactt ccgcgtttcc agactttacg aaacacggaa accgaagacc 6060 attcatgttg ttgctcaggt cgcagacgtt ttgcagcagc agtcgcttca cgttcgctcg 6120 cgtatcggtg attcattctg ctaaccagta aggcaacccc gccagcc cagg ccgatc atcgtcgcgc tccagcgaaa gcggtcctcg 6360 ccgaaaatga cccagagcgc tgccggcacc tgtcctacga gttgcatgat aaagaagaca 6420 gtcataagtg cggcgacgat agtcatgccc cgcgcccacc ggaaggagct gactgggttg 6480 aaggctctca agggcatcgg tcgagatccc ggtgcctaat gagtgagcta acttacatta 6540 attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcatta a 6600 tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgccaggg tggtttttct 6660 tttcaccagt gagacgggca acagctgatt gcccttcacc gcctggccct gagagagttg 6720 cagcaagcgg tccacgctgg tttgccccag caggc gaaaa tcctgtttga tggtggttaa 6780 cggcgggata taacatgagc tgtcttcggt atcgtcgtat cccactaccg agatatccgc 6840 accaacgcgc agcccggact cggtaatggc gcgcattgcg cccagcgcca tctgatcgtt 6900 ggcaaccagc atcgcagtgg gaacgatgcc ctcattcagc atttgcatgg tttgttgaaa 6960 accggacatg gcactccagt cgccttcccg ttccgctatc ggctgaattt gattgcgagt 7 020 gagatattta tgccagccag ccagacgcag acgcgccgag acagaactta atgggcccgc 7080 taacagcgcg atttgctggt gacccaatgc gaccagatgc tccacgccca gtcgcgtacc 7140 gtcttcatgg gagaaaataa tactgttgat gggtgtctgg tcagaga cat caagaaataa 7200 cgccggaaca ttagtgcagg cagcttccac agcaatggca tcctggtcat ccagcggata 7260 gttaatgatc agcccactga cgcgttgcgc gagaagattg tgcaccgccg ctttacaggc 7320 ttcgacgccg cttcgttcta ccatcgacac caccacgctg gcacccagtt gatcggcgcg 7380 agatttaatc gccgcgacaa tttgcgacgg cgcgtgcagg gccagactgg aggtggcaac 7440 gccaat cat cgtataa 7620 cgttactggt ttcacattca ccaccctgaa ttgactctct tccgggcgct atcatgccat 7680 accgcgaaag gttttgcgcc attcgatggt gtccgggatc tcgacgctct cccttatgcg 7740 actcctgcat taggaagcag cccagtagta ggttgaggcc gttgagcacc gccgccgcaa 7800 ggaatggtgc atgcaaggag atggcgccca acagtccccc ggccacgggg cctgccacca 7860 tacccacgcc gaaacaagcg ctcatgagcc cgaagtggcg agcccgatct tcccccatcgg 7920 tgatgtcggc gatataggcg ccagcaaccg cacctgtggc gccggtgatg ccggccacga 7980 tgcgtccggc gtagaggatc gagatctcga tcccgcgaaa t 8021 <210> 8 <211> 35 < 212> DNA < 213> Artificial Sequence <220> <223> Endolysin_F <400> 8 gggcggcggt ggtggcggca tgccgccttc gggcg 35 <210> 9 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Endolysin_R <400> 9 gttctt ctcc tttgcgccct atataacaac tcgattggcg atc 43 <210> 10 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Cecropin_F <400> 10 cgggggcggt ggtggcggca tggctagcaa atggaaactg tttaaaaaa 49 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Cecropin_R <400> 11 aaggcggcat actacccgag ccgctgcc 28 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> pB4_seq_F <400> 12 gtcagactgt cgatgaag 18 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> pB4_seq_R<400> 13 catcaccatc taattcaac 19

Claims (10)

A recombinant protein comprising endolysin and cecropin A consisting of the amino acid sequence represented by SEQ ID NO: 1. The method of claim 1,
The endolysin is a recombinant protein derived from bacteriophage Ab1656-2. The method of claim 1,
The cecropin A is a recombinant protein consisting of the amino acid sequence represented by SEQ ID NO: 3. The method of claim 1,
The recombinant protein comprising the amino acid sequence represented by SEQ ID NO: 5. A polynucleotide encoding the recombinant protein of any one of claims 1 to 4. The method of claim 5,
The polynucleotide having the nucleotide sequence represented by SEQ ID NO: 6. A pharmaceutical composition for preventing or treating pathogenic bacterial infections comprising the recombinant protein of any one of claims 1 to 4 as an active ingredient. The method of claim 7,
The pathogenic bacteria are Acinetobacter ( Acinetobacter ) Genus bacteria and Staphylococcus ( Staphylococcus ) Genus bacteria and at least one member selected from the group consisting of pathogenic bacterial infection prevention or treatment pharmaceutical composition. An antibiotic comprising the recombinant protein of any one of claims 1 to 4 as an active ingredient. A disinfectant comprising the recombinant protein of any one of claims 1 to 4 as an active ingredient.

Images