KR20230087291A - Probe Set for Isothermal One-pot Reaction for detecting SARS-CoV-2 Mutant and Uses Thereof - Google Patents

Abstract

The present invention relates to a novel isothermal single reaction probe set for detecting mutations in SARS-CoV-2 and its use.
The novel isothermal single-reaction probe set for detecting SARS-CoV-2 mutations according to the present invention accurately and quickly detects and classifies SARS-CoV-2 mutations in the field under isothermal conditions, thereby detecting mutations under monitoring, mutations of interest, and It enables rapid detection of mutations and high-risk mutations. In particular, by having a simple and convenient diagnosis system, it can be performed without skilled personnel, and all reactions are unified at isotherm without expensive equipment, so the sensitivity and speed of diagnosis can be increased.

Description

Probe Set for Isothermal One-pot Reaction for detecting SARS-CoV-2 Mutant and Uses Thereof

The present invention relates to a probe set for an isothermal single reaction for detecting mutations in SARS-CoV-2, uses thereof, and a method for detecting mutations in SARS-CoV-2 using the same.

Since the start of the COVID-19 pandemic, genetic strains of SARS-CoV-2 have emerged and are prevalent worldwide.

The SARS-CoV-2 Related Organ Group (SIG) mutation classification system defines four classes of SARS-CoV-2 mutations, and the classifications and strains belonging to them are as follows.

Variants under monitoring (VBM, variants no longer detected in the United States or circulating at very low levels that pose no serious or imminent risk to public health): alpha (B.1.1.7 and Q strains), beta (B. 1.351 and derivatives), gamma (P.1 and derivatives), epsilon (B.1.427, B.1.429), eta (B.1.525), iota (B.1.526), kappa (B.1.617.1), Mu (B.1.621, B.1.621.1), Zeta (P.2)

Variants of interest (VOIs, specific genetic signatures associated with changes in receptor binding, mutations observed that attenuate the neutralizing response of antibodies produced by previous infection or vaccination, reduce therapeutic efficacy, have potential diagnostic impact, or predicted increases in infectivity or disease severity)

Evidence is available for variants of concern (VOCs, more transmissible, more serious illness (e.g., increased hospitalizations and deaths), significant reduction in neutralizing antibody responses produced by previous infection or vaccination, reduced effectiveness of therapy or vaccine, failure to detect diagnosis, etc.) variants shown): Delta (B.1.617.2 and AY line), Omicron (B.1.1.529)

High-risk variants (VOHC, variants with clear evidence of significantly lower effectiveness of preventive or medical measures (MCM) compared to previously prevalent variants)

As can be seen above, the types of mutations classified according to the SARS-CoV-2 Related Organ Group (SIG) mutation classification system are clearly divided, and in particular, rapid detection and diagnosis of mutations of concern or high risk are required.

As above, diagnostic methods that can be considered for detecting SARS-CoV-2 and its variants include real-time reverse transcription PCR, mixed sample testing, rapid molecular testing, antigen testing, and antibody testing. Sufficient technology has not been developed to easily perform classification of the same variant.

In particular, molecular diagnosis technology using nucleic acids, which are most commonly used, is more sensitive than conventional diagnosis methods, so it is possible to detect specific genes for the purpose of disease prevention or to screen for infectious diseases, early identification, and quick response. However, most of the molecular diagnostic techniques using nucleic acids have a disadvantage in that a thermocycler equipment and professional personnel who can handle the machine are required.

Under this background, the present inventors have developed a method for detecting and/or diagnosing SARS-CoV-2 mutations very effectively and accurately within a short period of time without reducing the time required for detection and securing expensive equipment and skilled personnel. completed the present invention.

Accordingly, an object of the present invention is to provide an isothermal single reaction probe set for detecting mutations in SARS-CoV-2 and its use.

Specifically, an object of the present invention is an isothermal one-pot reaction probe set for detecting a target nucleic acid including a first probe and a second probe; and an isothermal one-pot reaction probe set for detecting target mutations including a third probe and a fourth probe.

In addition, an object of the present invention is to provide a kit for detecting SARS-CoV-2 mutations comprising a composition for detecting mutations in SARS-CoV-2.

In addition, an object of the present invention is to provide a method for detecting SARS-CoV-2 mutation under isothermal single reaction conditions.

Other objects and advantages of the present invention will become more apparent from the following appended claims and drawings.

The terms used herein are used for descriptive purposes only and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, terms such as "include" or "have" are intended to designate that there is a feature, number, step, operation, component, part, or combination thereof described in the specification, but one or more other features It should be understood that the presence or addition of numbers, steps, operations, components, parts, or combinations thereof is not precluded.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiment belongs. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related art, and unless explicitly defined in the present application, they should not be interpreted in an ideal or excessively formal meaning. don't

Hereinafter, the present invention will be described in detail.

The principle of the isothermal single reaction probe set according to the present invention and its schematic diagram are shown in FIGS. 1 to 4, and a detailed description thereof is as follows.

The present invention has an isothermal one-pot reaction probe set for detecting a target nucleic acid sequence, consisting of a first probe and a second probe, which is used to detect SARS-CoV-2 WT and/or variants thereof .

The first probe is a promoter probe (PP) having a structure of the following general formula I;

3'-X-Y-5' (I)

In the above general formula (I),

X is a stem-loop structure region containing a promoter sequence recognizable by RNA polymerase; Y is a UHS (Upstream Hybridization Sequence) site having a hybridization sequence complementary to a target nucleic acid sequence; The target nucleic acid sequence is DNA or RNA; wherein X and Y are deoxyribonucleotides;

The second probe is a reporter probe (RP) having a structure of the following general formula II;

3’-Y’-Z-5’ (II)

In the above general formula (II),

Y' is a DHS (Downstream Hybridization Sequence) site having a hybridization sequence complementary to the target nucleic acid sequence; Z is an aptamer sequence region with an interactive label system comprising one label or multiple labels that generates a detectable signal; The target nucleic acid sequence is DNA or RNA; wherein Y' and Z are deoxyribonucleotides;

The first probe and the second probe are hybridized with the target nucleic acid sequence and then ligated; Transcription of the ligation product is initiated by RNA polymerase to generate a signal.

More specifically, each component is described as follows.

Each of the first probes of the probe set of the present invention has a structure including two unique and different portions in one oligonucleotide molecule:

X, which is a stem-loop structure region containing a promoter sequence recognizable by RNA polymerase; and Y, an Upstream Hybridization Sequence (UHS) site having a hybridization sequence complementary to a target nucleic acid sequence.

In addition, the second probes of the probe set of the present invention each have a structure including two unique different sites in one oligonucleotide molecule:

Y', which is a Downstream Hybridization Sequence (DHS) site having a hybridization sequence complementary to the target nucleic acid sequence; An aptamer sequence region with an interactive label system comprising one label or multiple labels that generates a detectable signal, Z.

This structure allows the probe set of the present invention to be a probe that exhibits a high detection effect in a short time under isothermal single reaction conditions in a unified step.

More specifically, the probe design of the present invention is such that two single-stranded DNA probes are designed such that the target recognition sequence is exposed, allowing hybridization of the probe set with the target RNA/DNA at an isothermal (e.g., temperature at which the enzyme can act) . Hybridization sequences are designed to maximize hybridization to the target RNA/DNA while minimizing any other structure formation. An efficient hybridization process between the probe and the target RNA/DNA allows for high sensitivity during isothermal reactions.

The first probe, the promoter probe, is designed to form a stem-loop structure, and the stem part forms a double-stranded RNA polymerase promoter sequence to initiate the transcription process using RNA polymerase . Since the double-stranded RNA polymerase promoter portions are physically linked by a loop sequence, the probability of forming the double-stranded promoter in a functional form is higher than when the double-stranded promoter is not linked by a loop sequence. Therefore, the self-assembling promoter sequence in which the hairpin structure is formed in the promoter probe can effectively promote the hybridization process and subsequent transcription process.

The reporter probe, which is the second probe, is designed to include an aptamer sequence as a reporter, and the final product can be identified by the aptamer generating a signal in response to a specific substance.

In the present invention, "Aptamer" used as a reporter is a single-stranded nucleic acid (DNA, RNA or modified nucleic acid) having a stable tertiary structure and being able to bind to a target molecule with high affinity and specificity. nucleic acids).

As the aptamer of the present invention and the reaction material interacting with the aptamer, any kind of aptamer and reaction material may be used as long as they can generate a detectable signal as a desired effect.

After hybridization, the first and second probes hybridized to the target nucleic acid sequence are ligated.

That is, after the first probe and the second probe of the present invention are hybridized with the target nucleic acid sequence, a nick formed between the two probes is ligated using a ligation agent.

According to a preferred embodiment of the present invention, when the first probe and the second probe respectively hybridize with the target nucleic acid sequence, the first probe and the second probe are positioned immediately adjacent to each other.

Positioning in close proximity is necessary for the ligation reaction between the two probes. The term “adjacent” used herein while referring to the hybridization positions of the first probe and the second probe refers to the 3′-end of one probe and the other probe so that the ends of the two probes can be connected to each other. It means that the 5'-terminus of is sufficiently adjacent to each other.

Since enzymatic ligation is the preferred method of covalently linking the first probe and the second probe, the term "ligation" is used throughout this specification.

However, it is understood that the term "ligation" is a general term and includes any method of covalently linking two probes.

The ligation reaction of the present invention can be carried out using a wide variety of ligation agents, including enzymatic and non-enzymatic ligation agents (eg, chemical agents and photoligation agents).

Chemical ligation agents include active agents such as carbodiimide, cyanogen bromide (BrCN), N-cyanoimidazole, imidazole, 1-methylimidazole/carbodiimide/cystamine, dithiothreitol (DTT) and ultraviolet light. , condensing agents and reducing agents, but are not limited thereto.

Autoligation, ie, spontaneous ligation in the absence of a ligation agent, is also within the scope of the present teachings.

Photoligation using light of a suitable wavelength as a ligation agent is also within the scope of the present teachings. According to an embodiment of the present invention, photoligation includes a probe containing a nucleotide analog, including s4T (4-thiothymidine), 5-vinyluracil and the like or a combination thereof, but is not limited thereto no.

According to a preferred embodiment of the present invention, the ligation reaction is by an enzymatic ligation agent, and the ligation agent is SplintR ligase, bacteriophage T4 ligase, E.coli ligase, Afu ligase, Taq ligase, Tfl ligase, Mth ligase, Tth ligase, Tth HB8 ligase, Thermus species AK16D ligase, Ape ligase, LigTk ligase, Aae ligase, Rm ligase, Pfu ligase, ribozymes and their It is carried out using one species selected from the group consisting of variants.

Internucleotide linkages created by ligation include phosphodiester linkages and other linkages. For example, ligation with a ligase usually results in a phosphodiester linkage.

Non-enzymatic methods for ligation can form linkages between other nucleotides. Another internucleotide linkage is a thiophosphorylacetylamino group formed between an α-haloacyl group and a phosphorothioate group, a 5'-phosphorothioester formed between a phosphorothioate group and a tosylate group or an iodide group, and formation of covalent bonds between suitable reactive groups such as pyrophosphate linkages.

After the ligation reaction, the resulting ligation product contains the aptamer sequence and becomes single-stranded DNA as a template for amplifying the target RNA/DNA.

Subsequently, when the transcription process is initiated by RNA polymerase, the target RNA/DNA is extended from the single-stranded DNA, which is a template for amplifying the target RNA/DNA containing the aptamer sequence, and binds to a specific chemical molecule to generate fluorescence. A signal is generated quickly and simply by the aptamer introduced to indicate.

In addition, the time required to observe the signal generated when RNA aptamer is used as a reporter is shortened compared to a fluorescent signal using a conventional fluorescent protein.

If the first probe and the second probe are not carried out as described above, the target nucleic acid sequence is not detected because a signal from the label on the transcription product of the first probe and the second probe is not finally generated.

Any type of RNA polymerase of the present invention can be used as long as it can recognize a promoter region so as to initiate transcription as the desired effect.

Preferably, the RNA polymerase is bacteriophage T7 RNA polymerase, bacteriophage T3 polymerase, bacteriophage RNA polymerase, bacteriophage ΦII polymerase, Salmonella bacteriophage sp6 polymerase, Pseudomonas bacteriophage gh-1 polymerase, Escherichia coli ( E. coli ) A group consisting of RNA polymerase holoenzyme, E. coli RNA polymerase core enzyme, human RNA polymerase I, human RNA polymerase II, human RNA polymerase III, human mitochondrial RNA polymerase and variants thereof It may be selected from, but is not limited thereto.

Similarly, as long as transcription can be initiated by RNA polymerase, any promoter sequence known in the art can be used as the promoter region in the first probe of the present invention recognized by RNA polymerase.

For optimization of the isothermal single reaction of the present invention, the ligation agent and the polymerase may be appropriately adjusted, preferably, 1:1 to 1:5 unit, more preferably 1:4 unit in a single reaction solution , most preferably in a 1:1 unit.

According to a preferred embodiment of the present invention, the label may be selected from the group consisting of a chemical label, an enzyme label, a radioactive label, a fluorescent label, a luminescent label, a chemiluminescent label, and a metal label.

The isothermal single reaction of the present invention is performed simultaneously at a single designated temperature in the range of 15 ° C to 50 ° C without a separate amplification reaction.

The temperature in the range of 15 ° C to 50 ° C is a temperature known in the art at which enzymes act, and is not limited thereto as long as the desired effect of the present invention can be obtained.

In one embodiment of the present invention, the designated temperature is preferably 37°C.

In addition, the isothermal single reaction is performed simultaneously by being unified into a single reaction solution containing Tris-HCl, MgCl _{2 ,} NTPs, NaCl, and ET-SSB (Extreme Thermostable Single-Stranded DNA Binding Protein).

In the present invention, the single reaction solution preferably contains 1 to 100 mM Tris-HCl; 1 to 50 mM MgCl ₂ ; 0.1 to 10 mM NTPs and 1 to 50 mM NaCl; and 1 to 800 ng ET-SSB, more preferably 10 to 60 mM Tris-HCl; 1 to 30 mM MgCl ₂ ; 0.5 to 5 mM NTPs; 1 to 30 mM NaCl; and 100 to 600 ng ET-SSB, most preferably 50 mM Tris-HCl; 10 mM MgCl ₂ ; 1 mM NTPs; 10.5 mM NaCl; and 400 ng ET-SSB,

Based on the above reaction conditions, the present invention is an isothermal one-pot reaction probe set for detecting a target nucleic acid including a first probe and a second probe; And providing a composition for detecting a target SNP comprising an isothermal one-pot reaction probe set for detecting a target SNP nucleic acid comprising a third probe and a fourth probe,

The first probe is a promoter probe (PP) having a structure of the following general formula I;

3'-X-Y-5' (I)

In the above general formula (I),

X is a stem-loop structure region containing a promoter sequence recognizable by RNA polymerase; Y is a UHS (Upstream Hybridization Sequence) site having a hybridization sequence complementary to a target nucleic acid sequence; The target nucleic acid sequence is DNA or RNA; wherein X and Y are deoxyribonucleotides;

The second probe is a reporter probe (RP) having a structure of the following general formula II;

3’-Y’-Z-5’ (II)

In the above general formula (II),

Y' is a DHS (Downstream Hybridization Sequence) site having a hybridization sequence complementary to the target nucleic acid sequence; Z is an aptamer sequence region with an interactive label system comprising one label or multiple labels that generates a detectable signal; The target nucleic acid sequence is DNA or RNA; Wherein Y' and Z are deoxyribonucleotides,

The third probe is a promoter probe (PP) having a structure represented by the following general formula I;

3’-X’’-Y’’-5’ (I)

In the above general formula (I),

X'' is a stem-loop structure region containing a promoter sequence recognizable by RNA polymerase; Y'' is an Upstream Hybridization Sequence (UHS) site having a hybridization sequence complementary to the target SNP nucleic acid sequence; The target nucleic acid sequence is DNA or RNA; wherein X and Y are deoxyribonucleotides;

The second probe is a reporter probe (RP) having a structure of the following general formula II;

3'-Y'''-Z'''-5' (II)

In the above general formula (II),

Y''' is a DHS (Downstream Hybridization Sequence) site having a hybridization sequence complementary to the target SNP nucleic acid sequence; Z''' is an aptamer sequence region with an interactive label system comprising one label or multiple labels that generates a detectable signal; The target nucleic acid sequence is DNA or RNA; The Y''' and Z''' are deoxyribonucleotides.

Specifically, the present invention provides a composition for detecting mutations in SARS-CoV-2 comprising a novel isothermal single reaction probe set.

The present invention is an isothermal one-pot reaction probe set for detecting a target nucleic acid including a first probe and a second probe; And providing a composition for detecting mutations in SARS-CoV-2 comprising an isothermal one-pot reaction probe set for detecting target mutant nucleic acids including a third probe and a fourth probe,

The first probe is a promoter probe (PP) having a structure of the following general formula I;

3'-X-Y-5' (I)

In the above general formula (I),

X is a stem-loop structure region containing a promoter sequence recognizable by RNA polymerase; Y is a UHS (Upstream Hybridization Sequence) site having a hybridization sequence complementary to a target nucleic acid sequence; The target nucleic acid sequence is DNA or RNA; wherein X and Y are deoxyribonucleotides;

The second probe is a reporter probe (RP) having a structure of the following general formula II;

3’-Y’-Z-5’ (II)

In the above general formula (II),

Y' is a DHS (Downstream Hybridization Sequence) site having a hybridization sequence complementary to the target nucleic acid sequence; Z is an aptamer sequence region with an interactive label system comprising one label or multiple labels that generates a detectable signal; The target nucleic acid sequence is DNA or RNA; Wherein Y' and Z are deoxyribonucleotides,

The third probe is a promoter probe (PP) having a structure represented by the following general formula I;

3’-X’’-Y’’-5’ (I)

In the above general formula (I),

X'' is a stem-loop structure region containing a promoter sequence recognizable by RNA polymerase; Y'' is an Upstream Hybridization Sequence (UHS) site having a hybridization sequence complementary to the target mutant nucleic acid sequence; The target nucleic acid sequence is DNA or RNA; wherein X and Y are deoxyribonucleotides;

The second probe is a reporter probe (RP) having a structure of the following general formula II;

3’-Y’’’-Z’’’-5’ (II)

In the above general formula (II),

Y''' is a DHS (Downstream Hybridization Sequence) site having a hybridization sequence complementary to the target mutant nucleic acid sequence and differs from the Y' sequence by one, two or three nucleic acid sequences; Z''' is an aptamer sequence region with an interactive label system comprising one label or multiple labels that generates a detectable signal; The target nucleic acid sequence is DNA or RNA; The Y''' and Z''' are deoxyribonucleotides.

More specifically, the present invention provides an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including a first probe and a second probe; And an isothermal one-pot reaction probe set for detecting SARS-CoV-2 alpha mutation including a third probe and a fourth probe; Provides a composition for detecting SARS-CoV-2 alpha mutation,

here,

The first probe is a promoter probe (PP) having a structure of the following general formula I;

3'-X ₁ - Y ₁ -5' (I-1)

In the above general formula (I-1),

X ₁ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₁ is SEQ ID NO: 13;

The second probe is a reporter probe (RP) having a structure of the following general formula II;

3'-Y _1' -Z _1' -5' (II-1)

In the above general formula (II-1),

Y _1' is SEQ ID NO: 14; Z _1' is an aptamer sequence region having an interactive label system comprising one label or multiple labels that generates a signal detectable with deoxyribonucleotide;

The third probe is a promoter probe (PP) having a structure represented by the following general formula I;

3'-X ₂ - Y ₂ -5' (I-2)

In the above general formula (I-2),

X ₂ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₂ is SEQ ID NO: 15;

The second probe is a reporter probe (RP) having a structure of the following general formula II;

3'-Y _2' -Z _2' -5' (II-2)

In the above general formula (II-2),

Y _2' ' is SEQ ID NO: 16; The Z _2' is an aptamer sequence region having an interactive label system including one label or multiple labels that generates a signal detectable with deoxyribonucleotide.

More specifically, an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including a first probe and a second probe; And an isothermal one-pot reaction probe set for detecting SARS-CoV-2 alpha mutation including a third probe and a fourth probe; In the composition for detecting SARS-CoV-2 alpha mutation, 1 probe is SEQ ID NO: 1, the second probe is SEQ ID NO: 2, the third probe is SEQ ID NO: 3, and the fourth probe is SEQ ID NO: 4.

More specifically, SEQ ID NO: 1 consists of a T7 promoter complementary sequence + loop sequence + hybridization sequence complementary to the T7 promoter sequence and the target nucleic acid sequence, and SEQ ID NO: 2 consists of an aptamer sequence and a hybridization sequence complementary to the target nucleic acid sequence. SEQ ID NO: 3 consists of a T7 promoter complementary sequence + loop sequence + hybridization sequence complementary to the T7 promoter sequence and the target nucleic acid sequence, and SEQ ID NO: 4 consists of an aptamer sequence and a hybridization sequence complementary to the target nucleic acid sequence.

More specifically, the present invention provides an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including a first probe and a second probe; And an isothermal one-pot reaction probe set for detecting SARS-CoV-2 delta mutation including a third probe and a fourth probe; providing a composition for detecting SARS-CoV-2 delta mutation,

here,

The first probe is a promoter probe (PP) having a structure of the following general formula I;

3'-X ₃ - Y ₃ -5' (I-3)

In the above general formula (I-3),

X ₃ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₃ is SEQ ID NO: 17;

The second probe is a reporter probe (RP) having a structure of the following general formula II;

3'-Y _3' -Z _3' -5' (II-3)

In the above general formula (II-3),

said Y _3' is SEQ ID NO: 18; Z _3' is an aptamer sequence region having an interactive label system comprising one label or multiple labels that generates a signal detectable with deoxyribonucleotide;

The third probe is a promoter probe (PP) having a structure represented by the following general formula I;

3'-X ₄ - Y ₄ -5' (I-4)

In the above general formula (I-4),

X ₄ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₄ is SEQ ID NO: 19;

The second probe is a reporter probe (RP) having a structure of the following general formula II;

3'-Y _4' -Z _4' -5' (II-4)

In the above general formula (II-4),

Y _4' ' is SEQ ID NO: 20; The Z _4' is an aptamer sequence region having an interactive label system including one label or multiple labels that generates a signal detectable with deoxyribonucleotide.

More specifically, an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including a first probe and a second probe; And an isothermal one-pot reaction probe set for detecting SARS-CoV-2 alpha mutation including a third probe and a fourth probe; In the composition for detecting SARS-CoV-2 alpha mutation, The first probe is SEQ ID NO: 5, the second probe is SEQ ID NO: 6, the third probe is SEQ ID NO: 7, and the fourth probe is SEQ ID NO: 8.

More specifically, SEQ ID NO: 5 consists of a T7 promoter complementary sequence + loop sequence + hybridization sequence complementary to the T7 promoter sequence and target nucleic acid sequence, and SEQ ID NO: 6 consists of an aptamer sequence and a hybridization sequence complementary to the target nucleic acid sequence. SEQ ID NO: 7 consists of a T7 promoter complementary sequence + loop sequence + T7 promoter sequence and a hybridization sequence complementary to the target nucleic acid sequence, and SEQ ID NO: 8 consists of an aptamer sequence and a hybridization sequence complementary to the target nucleic acid sequence.

More specifically, the present invention provides an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including a first probe and a second probe; and an isothermal one-pot reaction probe set for detecting SARS-CoV-2 omicron mutations including a third probe and a fourth probe. and

here,

The first probe is a promoter probe (PP) having a structure of the following general formula I;

3'-X ₅ - Y ₅ -5' (I-5)

In the above general formula (I-5),

X ₅ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₅ is SEQ ID NO: 21;

The second probe is a reporter probe (RP) having a structure of the following general formula II;

3'-Y _5' -Z _5' -5' (II-5)

In the above general formula (II-5),

said Y _5' is SEQ ID NO: 22; Z _6' is an aptamer sequence region having an interactive label system comprising one label or multiple labels that generates a signal detectable with deoxyribonucleotide;

The third probe is a promoter probe (PP) having a structure represented by the following general formula I;

3'-X ₆ - Y ₆ -5' (I-6)

In the above general formula (I-6),

X ₆ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₆ is SEQ ID NO: 23;

The second probe is a reporter probe (RP) having a structure of the following general formula II;

3'-Y _6' -Z _6' -5' (II-6)

In the above general formula (II-6),

wherein Y _6′ ′ is SEQ ID NO: 24; The Z _10' is an aptamer sequence region having an interactive label system including one label or multiple labels that generates a signal detectable with deoxyribonucleotide.

More specifically, an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including a first probe and a second probe; And an isothermal one-pot reaction probe set for detecting SARS-CoV-2 alpha mutation including a third probe and a fourth probe; In the composition for detecting SARS-CoV-2 alpha mutation, The first probe is SEQ ID NO: 9, the second probe is SEQ ID NO: 10, the third probe is SEQ ID NO: 11, and the fourth probe is SEQ ID NO: 12.

More specifically, SEQ ID NO: 9 consists of a T7 promoter complementary sequence + loop sequence + hybridization sequence complementary to the T7 promoter sequence and the target nucleic acid sequence, and SEQ ID NO: 10 consists of an aptamer sequence and a hybridization sequence complementary to the target nucleic acid sequence. SEQ ID NO: 11 consists of a T7 promoter complementary sequence + loop sequence + T7 promoter sequence and a hybridization sequence complementary to the target nucleic acid sequence, and SEQ ID NO: 12 consists of an aptamer sequence and a hybridization sequence complementary to the target nucleic acid sequence.

In particular, the composition for detecting the above-mentioned SARS-CoV-2 mutations according to the present invention (specifically, the composition for detecting alpha, beta, gamma, delta, or omicron mutations) may be used by mixing two or more compositions. Using this, two or more types of target mutations can be quickly and accurately detected in the field.

For example, in order to confirm the presence or absence of highly prevalent delta and omicron mutations, the above-mentioned SARS-CoV-2 delta mutation detection composition and SARS-CoV-2 omicron mutation detection composition are used together to detect the mentioned mutations. can do.

Such mutation detection may also be applied in a multiplex manner. As an appropriate fluorescent probe, the aptamer may be used by combining two or more SARS-CoV-2 mutation detection compositions, for example, through a combination of a broccoli-specific aptamer and a malachite green-specific aptamer.

Specifically, since the spectral range of malachite green is emission: 616 nm, excitation: 665 nm, and the spectral range of broccoli aptamer is emission: 460 nm, excitation: 520 nm, as above, two or more SARS-CoV-2 mutations Even if the composition for detection is used together, it can have the advantage of being able to detect various mutations at once.

The probe set of the present invention acts as a powerful diagnostic platform for target RNA detection, providing short diagnostic time, high sensitivity and specificity, and a simple analysis procedure, as well as requiring no expensive equipment and diagnostic experts. Therefore, it can be a suitable diagnostic method for detecting SARS-CoV2 mutations that require rapid response.

According to another aspect of the present invention, the present invention provides a method for detecting SARS-CoV-2 mutations under isothermal single reaction conditions, comprising the following steps:

The composition for detecting SARS-CoV-2 mutation (specifically, the composition for detecting alpha, beta, gamma, delta or omicron mutation) is also applied to the method below, and a detailed description thereof is omitted.

The method for detecting the above-mentioned SARS-CoV-2 mutation is specifically,

(a) an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including the first probe and the second probe described above in the sample; and treating an isothermal one-pot reaction probe set for detecting mutations in SARS-CoV-2 including a third probe and a fourth probe to hybridize with a target RNA sequence;

(b) treating the hybridization product of step (a) with a ligation agent to ligate the first and second probes, the third probe and the fourth probe or both of the probe set, and polymerizing the ligation product treating the enzyme to initiate transcription; and

(c) treating the transcription product of step (b) with an aptamer-reactive material to detect signal generation of the aptamer in the transcription product.

References to SARS-CoV-2 mutations may apply to alpha, beta, gamma, delta, or omicron mutations, respectively.

an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including a first probe and a second probe in the sample; And the step of hybridizing with the target RNA sequence by processing an isothermal one-pot reaction probe set for detecting SARS-CoV-2 mutations including a third probe and a fourth probe, the SARS-CoV-2 mutation in each separate sample. An isothermal one-pot reaction probe set for CoV-2 detection and an isothermal one-pot reaction probe set for SARS-CoV-2 mutation detection including a third probe and a fourth probe are separately may have been processed.

an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including these first and second probes; And when the same sample is treated with an isothermal one-pot reaction probe set for detecting SARS-CoV-2 mutations including the third probe and the fourth probe, fluorescence capable of detecting signal generation of the aptamer By changing, detection can be performed within one pot.

The isothermal single reaction of the present invention is performed simultaneously at one designated temperature in the range of 15 ° C to 50 ° C without a separate amplification reaction, and preferably the designated temperature is 37 ° C.

The isothermal single reaction is performed simultaneously by being unified into a single reaction solution containing Tris-HCl, MgCl _{2 ,} NTPs, NaCl, and ET-SSB (Extreme Thermostable Single-Stranded DNA Binding Protein).

In addition, the present invention is characterized in that an additional separate amplification process (eg, PCR) is not required, and the amplification process is automatically performed in the process of a single isothermal reaction.

The reason why a single isothermal reaction including such an amplification process is possible is that (i) the second probe, which is designed so that the ligation reaction with the first probe including the double-stranded promoter sequence having a hairpin structure occurs, to form the downstream aptamer. This is due to the design of the probe; (ii) This is because when the ligated product is transcribed through transcription initiation, the amplification process occurs naturally within the reaction without a separate amplification process using a target sequence (ie, splint) that can be used.

That is, when the ligation product of the ligation reaction between the first probe and the second probe initiates transcription from the RNA polymerase promoter sequence of the first probe forming a hairpin structure to produce a transcript, the transcript is a target RNA sequence. Since it contains the same sequence as, it can be used as a target RNA. In addition, since the transcribed ligation product contains the same sequence as the target nucleic acid sequence, it can act as a target RNA among target nucleic acids.

Therefore, the platform using the probe set of the present invention is designed so that ligation, transcription reaction, and fluorescence reaction occur simultaneously, and in addition, the transcript in which the transcription reaction of the ligated product has occurred is used as a splint RNA to create a single platform that includes an amplification process. It is an isothermal reaction.

Thus, steps (a) to (c) of the present invention can be performed simultaneously in one container, for example, a tube.

In the present invention, the sequence of the DNA probe is not limited to the sequence described in the examples of the present invention as long as it achieves the desired effect, and can be applied to all target gene sequences. In addition, the aptamer used to confirm the final signal is not limited to malachite green aptamer, and any kind of RNA-based fluorescent aptamer can be used.

According to another aspect of the present invention, the present invention provides an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including the above-described first and second probes; and an isothermal one-pot reaction probe set for detecting SARS-CoV-2 mutations including a third probe and a fourth probe; A kit for detecting mutations in SARS-Cov-2 comprising a ligation agent, a polymerase and an isothermal single reaction solution is provided.

According to another aspect of the present invention, the present invention is the composition for detecting the above-mentioned SARS-CoV-2 mutation; A kit for detecting mutations in SARS-Cov-2 comprising a ligation agent, a polymerase and an isothermal single reaction solution is provided. The mutation may be alpha, beta, gamma, delta or omicron mutation.

The kit may include two or more target SARS-Cov-2 mutant probe sets. That is, providing a probe set for detecting SARS-CoV-2 and a probe set for detecting SARS-CoV-2 (specific) mutations for detecting alpha, beta, gamma, delta, or omicron mutations for rapid detection as needed. do.

In this case, the probe sets each contain an interactive label system that is different from each other; Each binds to a different target nucleic acid sequence; This enables multiple detection of different target nucleic acid sequences. That is, simultaneous detection and diagnosis of different SARS-CoV2 mutations is possible.

In addition, the two or more types of targets may be different target regions present in the variant, and in this case, a more accurate and precise diagnosis is possible by effectively detecting different target regions.

Since the kit of the present invention is designed to detect a target nucleic acid sequence by the probe set of the present invention described above, the description of redundant information is omitted to avoid complexity in the present specification.

The kit of the present invention described above may additionally include various polynucleotide molecules, enzymes, and various buffers and reagents. In addition, the kit of the present invention may contain reagents necessary for carrying out positive control and negative control reactions. Optimal amounts of reagents to be used in any one particular reaction can be readily determined by one skilled in the art having the knowledge of the disclosure herein.

Typically, the kits of the present invention are manufactured in separate packages or compartments containing the aforementioned components.

Since the kit of the present invention is designed to detect a target nucleic acid sequence by the probe set of the present invention described above, the description of redundant information is omitted to avoid complexity in the present specification.

Since the method of the present invention includes the probe set of the present invention described above, redundant descriptions are omitted to avoid excessive complexity of the present specification.

The novel isothermal single-reaction probe set for detecting SARS-CoV-2 mutations according to the present invention accurately and quickly detects and classifies SARS-CoV-2 mutations in the field under isothermal conditions, thereby detecting mutations under monitoring, mutations of interest, and It enables rapid detection of mutations and high-risk mutations. In particular, by having a simple and convenient diagnosis system, it can be performed without skilled personnel, and all reactions are unified at isotherm without expensive equipment, so the sensitivity and speed of diagnosis can be increased.

Figure 1 shows the structure of the two DNA probes of the present invention, Figure 2 shows the ligation reaction using SplintR ligase, Figure 3 shows the three key reactions of the molecular diagnosis method based on the ligation of the present invention 4 shows an overall schematic diagram of a nucleic acid detection method using the ligation reaction of the present invention.
5 shows the structure of a probe set for detecting SARS-CoV-2 and a probe for detecting alpha/delta mutations and a principle for distinguishing single nucleotide mutations.
6 shows the results of effective detection of SARS-CoV-2 WT and alpha mutation using a probe set for detecting SARS-CoV-2 and a probe set for detecting alpha mutation.
7 shows the results of effectively detecting SARS-CoV-2 WT and delta mutation using a probe set for detecting SARS-CoV-2 and a probe set for detecting delta mutation.
8 shows results of effective detection of SARS-CoV-2 WT and omicron mutations using a probe set for detecting SARS-CoV-2 and a probe set for detecting omicron mutations. The distinction principle is the same as the alpha/delta shift shown in FIG. 5 .

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

experimental material

T7 RNA polymerase for RNA synthesis used in this experiment was purchased from New England Biolabs (NEB, Ipswich, MA, USA), and dithiothreitol (DTT) was purchased from Thermo Fisher Scientific (Waltham, MA, USA). In addition, Tris-HCl (pH 7.4) and MgCl ₂ , which are materials for a reaction buffer required for this reaction, were purchased from Bioneer, Inc (Daejeon, Republic of Korea). In addition, SplintR ligase, ET-SSB (Extreme Thermostable Single-stranded DNA binding protein), DNase I, and ribonucleotide solution mix were purchased from New England Biolabs (NEB, Ipswich, MA, USA). ATP was purchased from Thermo Fisher Scientific (Walthan, MA, USA), and Recombinant RNase Inhibitor (RRI) was purchased from Takara (Kyoto, Japan). Malachite green oxalate, a fluorescent dye, was ordered from Sigma-Aldrich (St. Louis, MO, USA), and DFHBI-1T was ordered from Tocris Bioscience (Bristol, United Kingdom). In addition, all single-stranded DNA used as a probe was ordered through Bioneer. In addition, oligonucleotides for template DNA necessary for RNA synthesis were obtained from Cosmogenetech, Inc. (Seoul, Republic of Korea) for synthesis. In addition, kits for PCR purification and RNA purification were all purchased from GeneAll Biotechonology (Seoul, Republic of Korea).

Example 1. Isothermal single reaction using probe set for detecting mutant virus

Probe sets were designed for several mutant viruses derived from Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) (a novel coronavirus). Alpha, beta, gamma, delta, and omicron mutant SARS-CoV-2 were targeted as SARS-CoV-2 mutant viruses to be detected.

For each, detection probes were designed to contain mutations in existing SARS-CoV-2. Nucleocapsid (N) gene or Spike protein (S) gene was selected as the target gene sequence for each mutation.

The principle of the present invention will be described as follows.

By designing a probe set targeting the original sequence and a probe set targeting the mutant sequence, it is possible to determine whether the original sequence or the mutant sequence exists in the sample according to the results of each reaction.

First, when detection is detected in the probe set targeting the original sequence but not detected in the probe set targeting the mutant sequence, it can be determined that the original sequence is present, and conversely, detection is detected in the probe set targeting the original sequence. If this does not occur and the probe set targeting the mutant sequence is detected, it can be determined that the mutant sequence is present.

First, when detection is detected in the probe set targeting the original sequence but not detected in the probe set targeting the mutant sequence, it can be determined that the original sequence is present, and conversely, detection is detected in the probe set targeting the original sequence. If this does not occur and the probe set targeting the mutant sequence is detected, it can be determined that the mutant sequence is present.

When designing a probe that detects mutation sequences, the mutations to be distinguished were caught as mutations in the single nucleotide mutation region, and the mutations were placed at the 5' end of UHS or at the 3' end of DHS. distinguish

Detection of each mutant virus was confirmed under the above principle.

Probe sequence information used in the experiment

Base sequences used in the experiment are shown in Table 1 below.

mutant virus category Sequence information (5'-3') Alpha PP SEQ ID NO: 1: [phosphate] AACATTTTGCTCTCAAGCTGGTTC ccctatagtgagtcgtatta atttcgcgacaacacgcgaaat taatacgactcactataggg RP SEQ ID NO: 2: ggatccattcgttacctggctctcgccagtcgggatcc CCTTGTTGTTGTTGGCCTTTACCA PP ^* SEQ ID NO: 3: [phosphate]GACATTTTGCTCTCAAGCTGGTTC ccctatagtgagtcgtatta atttcgcgacaacacgcgaaat taatacgactcactataggg RP ^* SEQ ID NO: 4: ggatccattcgttacctggctctcgccagtcgggatcc CCTTGTTGTTGTTGGCCTTTACCA delta PP SEQ ID NO: 5:
[phosphate]ACTCTTAATCAGACTCAGACTATT ccctatagtgagtcgtatta atttcgcgacaacacgcgaaat taatacgactcactataggg RP SEQ ID NO: 6:
ggatccattcgttacctggctctcgccagtcgggatcc GATCGATGTGATGCACGGGCGGCT PP ^* SEQ ID NO: 7: [phosphate] CCTCTTAATCAGACTCAGACTATT ccctatagtgagtcgtatta atttcgcgacaacacgcgaaat taatacgactcactataggg RP ^* SEQ ID NO: 8: ggatccattcgttacctggctctcgccagtcgggatcc GATCGATGTGATGCACGGGCGGCT Omicron PP SEQ ID NO: 9:
[phosphate] GTGCATTTCGCTGATTTTGGGG ccctatagtgagtcgtatta atttcgcgacaacacgcgaaat taatacgactcactataggg RP SEQ ID NO: 10:
ggatccattcgttacctggctctcgccagtcgggatcc ACCAAACGTAATGCGGG PP* SEQ ID NO: 11: [phosphate] GTGCATTTCGCTGATTTTGGGG ccctatagtgagtcgtatta atttcgcgacaacacgcgaaat taatacgactcactataggg RP* SEQ ID NO: 12:
ggatccattcgttacctggctctcgccagtcgggatcc GTCCACCAAACGTAATGCGGA

In Table 1, nucleotides in uppercase letters mean hybridization sequences complementary to the target nucleic acid sequence, and nucleotides in lowercase letters are T7 promoter complementary sequence + loop sequence + T7 promoter forming a stem-loop structure. As for the sequence, the underlined nucleotides indicate the nucleotides constituting the stem in the stem-loop structure. Nucleotides indicated in lowercase italics indicate the aptamer sequence. [phosphate] means phosphorylation at the 5' end. Among the probe sets, PP/RP is a probe set for detecting the original sequence, and PP*/RP* is a probe set for detecting a mutated virus sequence.

The aptamer sequence is an aptamer that specifically binds to malachite green.

On the other hand, the nucleotides indicated in uppercase letters mean a hybridization sequence complementary to the target nucleic acid sequence.

mutant virus category Sequence information (5'-3') Alpha PP SEQ ID NO: 13: AACATTTTGCTCTCAAGCTGGTTC RP SEQ ID NO: 14: CCTTGTTGTTGTTGGCCTTTACCA PP ^* SEQ ID NO: 15: GACATTTTGCTCTCAAGCTGGTTC RP ^* SEQ ID NO: 16: CCTTGTTGTTGTTGGCCTTTACCA delta PP SEQ ID NO: 17: ACTCTTAATCAGACTCAGACTATT RP SEQ ID NO: 18: GATCGAT GTGATGCACGGGCGGCT PP ^* SEQ ID NO: 19: CCTCTTAATCAGACTCAGACTATT RP ^* SEQ ID NO: 20: GATCGATGTGATGCACGGGCGGCT Omicron PP SEQ ID NO: 21: GTGCATTTCGCTGATTTTTGGGG RP SEQ ID NO: 22: ACCAAACGTAATGCGGG PP* SEQ ID NO: 23: GTGCATTTCGCTGATTTTTGGGG RP* SEQ ID NO: 24: GTCCACCAAACGTAATGCGGA

Detection conditions (one-step single isothermal reaction)

(1) Preparation of target RNA

Template DNA containing the target RNA sequence was amplified using a PCR method using primers. Then, only the template DNA was purified from the (103-102) PCR reaction mixture using a PCR purification kit. Next, for in vitro transcription, the mixture was reacted at 37 °C for 16 hours, and after the reaction was completed, 1 μL of DNase I (RNase-free) was added and further reacted at 37 °C for 1 hour. Next, RNA was purified from the DNase-I-treated sample using the RiboclearTM (plus!) RNA kit.

Reagent information used in the above process is shown in Table 3 below.

Reagent Concentration Amount RNase-free water up to 50mL T7 RNA Polymerase Reaction Buffer 10*?* 5 mL NTPs 25 mM each 5 mL Template DNA 1mg Recombinant RNase Inhibitors 40 U/mL 1.5mL DTT 100 mM 2.5 mL T7 RNA Polymerase 50 U/mL 5 mL Total 50 mL

The SARS-CoV-2 WT RNA sequence and mutant sequence numbers for detection prepared through the above method are shown in Table 4 below.

target RNA
(target mutation) Sequence information (5'-3') Alpha SEQ ID NO: 25GGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTTTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAG delta SEQ ID NO: 26GGTATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCGTTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAA Omicron SEQ ID NO: 27ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACTCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCA

(2) Mutation discrimination method through isothermal single reaction and fluorescence detection

Through the above process, purified RNA to be used as a target RNA in an isothermal single reaction was prepared. Then, an isothermal single reactant was prepared, and the above reactant was reacted at 37 °C for 2 hours.

The single reactant reagent information used is shown in Table 5 below:

Reagent Concentration Amount Promoter probe (PP) 10 mM 1mL Reporter probe (RP) 10 mM 2.2 mL Synthetic target RNA 3 mL RNase-free water up to 30mL SENSR reaction buffer 10X 3 mL NTPs 25 mM each 3 mL ATP 1M 0.3 mL SplintR ligase 25 U/mL 3 mL T7 RNA polymerase 50 U/mL 1.5mL Recombinant RNase inhibitors 40 U/mL 1mL ET-SSB 500 ng/mL 1mL Malachite green 320 mM 1.5 mL Total 30 mL

(10X SENSR reaction buffer: 350 mM Tris-HCl (pH 7.4) and 100 mM MgCl ₂ )

After performing the above reaction, the presence or absence of mutation was confirmed by measuring fluorescence. Specifically, after dispensing 20 μL of the reactant into a 384-well clear flat-bottom black microplate, placing the microplate in a Microplate reader (Hidex Sense), measuring fluorescence with the following settings according to the fluorescent dye to determine the presence or absence of fluorescence emission was measured (ex: 616 nm / em: 665 nm for malachite green).

The detection results using the above-prepared probe set and the above-mentioned detection conditions are specifically shown below.

1-1. Alpha mutant virus detection confirmation

An isothermal single reaction was performed using the probes for detecting the alpha mutant virus (original sequence, PP/RP; alpha, PP*/RP*) mentioned in Table 1 above. The target gene used in this reaction was the N gene, and a site where a single nucleotide mutation occurred in the existing SARS-CoV-2 virus was selected.

Each of the probe set capable of detecting the SARS-CoV-2 virus and the probe set capable of detecting alpha mutation was reacted with the sample to confirm whether the original sequence or the mutant sequence existed in the sample.

The results of the isothermal reaction using the above two pairs of probe sets are shown in FIG. 6 .

When there is a SARS-CoV-2 sequence with the original sequence, high fluorescence is detected in the SARS-CoV-2 confirmation probe set (PP/RP), whereas in the alpha mutant virus detection probe set (PP*/RP*) It was confirmed that relatively low fluorescence came out.

Conversely, when the alpha-mutant virus sequence is present in the sample, high fluorescence is detected in the probe set for detecting the alpha-mutant virus, while relatively low fluorescence is detected in the probe set for SARS-CoV-2 confirmation. It was confirmed that the alpha mutant virus was effectively detected.

1-2. Confirmation of detectability of delta mutant virus

An isothermal single reaction was performed using the delta mutant virus detection mentioned in Table 1 (original sequence, PP/RP; delta, PP*/RP*). The target gene used in this reaction was the S gene, and a site where a single nucleotide mutation occurred in the existing SARS-CoV-2 virus was selected. Each of the probe set capable of detecting the existing SARS-CoV-2 virus and the probe set capable of detecting delta mutation was reacted with the sample to confirm whether the original sequence or the mutant sequence existed in the sample.

The results of the isothermal reaction using the above two pairs of probe sets are shown in FIG. 7 .

As can be seen in FIG. 7, when the original sequence is present, that is, when the SARS-CoV-2 sequence is present, high fluorescence is detected in the probe set for confirming SARS-CoV-2, whereas in the probe set for detecting the delta mutant virus, relatively high fluorescence is detected. It was confirmed that low fluorescence came out. Conversely, when the delta-mutant virus sequence was present in the sample, it was confirmed that high fluorescence was detected in the probe set for detecting the delta-mutant virus, whereas relatively low fluorescence was detected in the probe set for SARS-CoV-2 confirmation. Through this, it was confirmed that the delta mutant virus was effectively detected.

1-3. Confirmation of detectability of Omicron mutant virus

An isothermal single reaction was performed using the Omicron mutant virus detection probe (Omicron, PP/RP) mentioned in Table 1 above. The target gene used in this reaction is the N gene, and sites where single nucleotide mutations occurred in the existing SARS-CoV-2 virus and regions where gene deletion occurred in the virus resulted in amino acid changes were selected.

The results of the isothermal reaction using the above two pairs of probe sets are shown in FIG. 8 .

When the original sequence is present, that is, when the SARS-CoV-2 sequence is present, high fluorescence is detected in the probe set for SARS-CoV-2 identification, whereas relatively low fluorescence is detected in the probe set for detection of the Omicron mutant virus. . Conversely, when the Omicron mutant virus sequence is present in the sample, high fluorescence is detected in the probe set for detecting the Omicron mutant virus, while relatively low fluorescence is detected in the probe set for SARS-CoV-2 confirmation, Through this, it was confirmed that the Omicron mutant virus was effectively detected.

In the above, specific parts of the present invention have been described in detail, and for those skilled in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> POSTECH Research and Business Development Foundation <120> Probe Set for Isothermal One-pot Reaction for detecting SARS-CoV-2 Mutant and Uses Thereof <130> P21201-POST <160> 27 <170> KoPatentIn 3.0 <210> 1 <211> 86 <212> DNA <213> artificial sequence <220> <223> alpha probe 1 <400> 1 aacattttgc tctcaagctg gttcccctat agtgagtcgt attaatttcg cgacaacacg 60 cgaaattaat acgactcact ataggg 86 <210> 2 <211> 62 <212> DNA <213> artificial sequence <220> <223> alpha probe 2 <400> 2 ggatccattc gttacctggc tctcgccagt cgggatcccc ttgttgttgt tggcctttac 60 ca 62 <210> 3 <211> 86 <212> DNA <213> artificial sequence <220> <223> alpha mutant probe 1 <400> 3 gacattttgc tctcaagctg gttcccctat agtgagtcgt attaatttcg cgacaacacg 60 cgaaattaat acgactcact ataggg 86 <210> 4 <211> 62 <212> DNA <213> artificial sequence <220> <223> alpha mutant probe 2 <400> 4 ggatccattc gttacctggc tctcgccagt cgggatcccc ttgttgttgt tggcctttac 60 ca 62 <210> 5 <211> 86 <212> DNA <213> artificial sequence <220> <223> delta probe 1 <400> 5 actcttaatc agactcagac tattccctat agtgagtcgt attaatttcg cgacaacacg 60 cgaaattaat acgactcact ataggg 86 <210> 6 <211> 62 <212> DNA <213> artificial sequence <220> <223> delta probe 2 <400> 6 ggatccattc gttacctggc tctcgccagt cgggatccga tcgatgtgat gcacgggcgg 60 ct 62 <210> 7 <211> 86 <212> DNA <213> artificial sequence <220> <223> delta mutant probe 1 <400> 7 cctcttaatc agactcagac tattccctat agtgagtcgt attaatttcg cgacaacacg 60 cgaaattaat acgactcact ataggg 86 <210> 8 <211> 62 <212> DNA <213> artificial sequence <220> <223> delta mutant probe 2 <400> 8 ggatccattc gttacctggc tctcgccagt cgggatccga tcgatgtgat gcacgggcgg 60 ct 62 <210> 9 <211> 84 <212> DNA <213> artificial sequence <220> <223> omikron probe 1 <400> 9 gtgcatttcg ctgattttgg ggccctatag tgagtcgtat taatttcgcg acaacacgcg 60 aaattaatac gactcactat aggg 84 <210> 10 <211> 55 <212> DNA <213> artificial sequence <220> <223> omikron probe 2 <400> 10 ggatccattc gttacctggc tctcgccagt cgggatccac caaacgtaat gcggg 55 <210> 11 <211> 84 <212> DNA <213> artificial sequence <220> <223> omikron mutant probe 1 <400> 11 gtgcatttcg ctgattttgg ggccctatag tgagtcgtat taatttcgcg acaacacgcg 60 aaattaatac gactcactat aggg 84 <210> 12 <211> 59 <212> DNA <213> artificial sequence <220> <223> omikron mutant probe 2 <400> 12 ggatccattc gttacctggc tctcgccagt cgggatccgt ccaccaaacg taatgcgga 59 <210> 13 <211> 24 <212> DNA <213> artificial sequence <220> <223> alpha hybrid sequence 1 <400> 13 aacattttgc tctcaagctg gttc 24 <210> 14 <211> 24 <212> DNA <213> artificial sequence <220> <223> alpha hybrid sequence 2 <400> 14 ccttgttgtt gttggccttt acca 24 <210> 15 <211> 24 <212> DNA <213> artificial sequence <220> <223> alpha mutant hybrid sequence 2 <400> 15 gacattttgc tctcaagctg gttc 24 <210> 16 <211> 24 <212> DNA <213> artificial sequence <220> <223> alpha mutant hybrid sequence 2 <400> 16 ccttgttgtt gttggccttt acca 24 <210> 17 <211> 24 <212> DNA <213> artificial sequence <220> <223> delta hybrid sequence 1 <400> 17 actcttaatc agactcagac tatt 24 <210> 18 <211> 24 <212> DNA <213> artificial sequence <220> <223> delta hybrid sequence 2 <400> 18 gatcgatgtg atgcacgggc ggct 24 <210> 19 <211> 24 <212> DNA <213> artificial sequence <220> <223> delta mutant hybrid sequence 1 <400> 19 cctcttaatc agactcagac tatt 24 <210> 20 <211> 24 <212> DNA <213> artificial sequence <220> <223> delta mutant hybrid sequence 2 <400> 20 gatcgatgtg atgcacgggc ggct 24 <210> 21 <211> 22 <212> DNA <213> artificial sequence <220> <223> omikron hybrid sequence 1 <400> 21 gtgcatttcg ctgattttgg gg 22 <210> 22 <211> 17 <212> DNA <213> artificial sequence <220> <223> omikron hybrid sequence 2 <400> 22 accaaacgta atgcggg 17 <210> 23 <211> 22 <212> DNA <213> artificial sequence <220> <223> omikron mutant hybrid sequence 1 <400> 23 gtgcatttcg ctgattttgg gg 22 <210> 24 <211> 21 <212> DNA <213> artificial sequence <220> <223> omikron mutant hybrid sequence 2 <400> 24 gtccaccaaa cgtaatgcgg a 21 <210> 25 <211> 130 <212> RNA <213> artificial sequence <220> <223> alpha mutant <400> 25 ggctggcaat ggcggtgatg ctgctcttgc tttgctgctg cttgacagat tgaaccagct 60 tgagagcaaa atgtttggta aaggccaaca acaacaaggc caaactgtca ctaagaaatc 120 tgctgctgag 130 <210> 26 <211> 133 <212> DNA <213> artificial sequence <220> <223> delta mutant <400> 26 ggtatgagtg tgacataccc attggtgcag gtatatgcgc tagttatcag actcagacta 60 attctcgttc ggcgggcacg tagtgtagct agtcaatcca tcattgccta cactatgtca 120 cttggtgcag aaa 133 <210> 27 <211> 130 <212> DNA <213> artificial sequence <220> <223> omikron mutant <400> 27 atgtctgata atggacccca aaatcagcga aatgcactcc gcattacgtt tggtggaccc 60 tcagattcaa ctggcagtaa ccagaatggt ggggcgcgat caaaacaacg tcggccccaa 120 ggtttaccca 130

Claims (12)

an isothermal one-pot reaction probe set for detecting a target nucleic acid including a first probe and a second probe; And a target SNP detection composition comprising an isothermal one-pot reaction probe set for target mutation detection including a third probe and a fourth probe,
The first probe is a promoter probe (PP) having a structure of the following general formula I;
3'-X-Y-5' (I)
In the above general formula (I),
X is a stem-loop structure region containing a promoter sequence recognizable by RNA polymerase; Y is a UHS (Upstream Hybridization Sequence) site having a hybridization sequence complementary to a target nucleic acid sequence; The target nucleic acid sequence is DNA or RNA; wherein X and Y are deoxyribonucleotides;
The second probe is a reporter probe (RP) having a structure of the following general formula II;
3'-Y'-Z-5' (II)
In the above general formula (II),
Y' is a DHS (Downstream Hybridization Sequence) site having a hybridization sequence complementary to the target nucleic acid sequence; Z is an aptamer sequence region with an interactive label system comprising one label or multiple labels that generates a detectable signal; The target nucleic acid sequence is DNA or RNA; Wherein Y' and Z are deoxyribonucleotides,
The third probe is a promoter probe (PP) having a structure represented by the following general formula I;
3'-X''-Y''-5' (I)
In the above general formula (I),
X'' is a stem-loop structure region containing a promoter sequence recognizable by RNA polymerase; Y'' is an Upstream Hybridization Sequence (UHS) site having a hybridization sequence complementary to the target SNP nucleic acid sequence; The target nucleic acid sequence is DNA or RNA; wherein X and Y are deoxyribonucleotides;
The second probe is a reporter probe (RP) having a structure of the following general formula II;
3'-Y'''-Z'''-5' (II)
In the above general formula (II),
Y''' is a DHS (Downstream Hybridization Sequence) site having a hybridization sequence complementary to the target SNP nucleic acid sequence; Z''' is an aptamer sequence region with an interactive label system comprising one label or multiple labels that generates a detectable signal; The target nucleic acid sequence is DNA or RNA; Wherein Y''' and Z''' are deoxyribonucleotides, the composition. an isothermal one-pot reaction probe set for detecting a target nucleic acid including a first probe and a second probe; And a SARS-CoV-2 mutation detection composition comprising an isothermal one-pot reaction probe set for target mutation detection including a third probe and a fourth probe,
The first probe is a promoter probe (PP) having a structure of the following general formula I;
3'-X-Y-5' (I)
In the above general formula (I),
X is a stem-loop structure region containing a promoter sequence recognizable by RNA polymerase; Y is a UHS (Upstream Hybridization Sequence) site having a hybridization sequence complementary to a target nucleic acid sequence; The target nucleic acid sequence is DNA or RNA; wherein X and Y are deoxyribonucleotides;
The second probe is a reporter probe (RP) having a structure of the following general formula II;
3'-Y'-Z-5' (II)
In the above general formula (II),
Y' is a DHS (Downstream Hybridization Sequence) site having a hybridization sequence complementary to the target nucleic acid sequence; Z is an aptamer sequence region with an interactive label system comprising one label or multiple labels that generates a detectable signal; The target nucleic acid sequence is DNA or RNA; Wherein Y' and Z are deoxyribonucleotides,
The third probe is a promoter probe (PP) having a structure represented by the following general formula I;
3'-X''-Y''-5' (I)
In the above general formula (I),
X'' is a stem-loop structure region containing a promoter sequence recognizable by RNA polymerase; Y'' is an Upstream Hybridization Sequence (UHS) site having a hybridization sequence complementary to the target mutant nucleic acid sequence; The target nucleic acid sequence is DNA or RNA; wherein X and Y are deoxyribonucleotides;
The second probe is a reporter probe (RP) having a structure of the following general formula II;
3'-Y'''-Z'''-5' (II)
In the above general formula (II),
Y''' is a DHS (Downstream Hybridization Sequence) site having a hybridization sequence complementary to the target mutant nucleic acid sequence and differs from the Y' sequence by one, two or three nucleic acid sequences; Z''' is an aptamer sequence region with an interactive label system comprising one label or multiple labels that generates a detectable signal; The target nucleic acid sequence is DNA or RNA; Wherein Y''' and Z''' are deoxyribonucleotides, the composition. an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including a first probe and a second probe; And an isothermal one-pot reaction probe set for detecting SARS-CoV-2 alpha mutation including a third probe and a fourth probe; As a composition for detecting SARS-CoV-2 alpha mutation,
here,
The first probe is a promoter probe (PP) having a structure of the following general formula I;
3'-X ₁ - Y ₁ -5' (I-1)
In the above general formula (I-1),
X ₁ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₁ is SEQ ID NO: 13;
The second probe is a reporter probe (RP) having a structure of the following general formula II;
3'-Y _1' -Z _1' -5' (II-1)
In the above general formula (II-1),
Y _1' is SEQ ID NO: 14; Z _1' is an aptamer sequence region having an interactive label system comprising one label or multiple labels that generates a signal detectable with deoxyribonucleotide;
The third probe is a promoter probe (PP) having a structure represented by the following general formula I;
3'-X ₂ - Y ₂ -5' (I-2)
In the above general formula (I-2),
X ₂ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₂ is SEQ ID NO: 15;
The second probe is a reporter probe (RP) having a structure of the following general formula II;
3'-Y _2' -Z _2' -5' (II-2)
In the above general formula (II-2),
Y _2' ' is SEQ ID NO: 16; Wherein Z _2' is an aptamer sequence region having an interactive label system including one label or multiple labels that generates a signal detectable with deoxyribonucleotide. According to claim 3,
The first probe is SEQ ID NO: 1, the second probe is SEQ ID NO: 2, the third probe is SEQ ID NO: 3, and the fourth probe is SEQ ID NO: 4. an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including a first probe and a second probe; A composition for detecting SARS-CoV-2 delta mutation, comprising; and an isothermal one-pot reaction probe set for detecting SARS-CoV-2 delta mutation including a third probe and a fourth probe,
here,
The first probe is a promoter probe (PP) having a structure of the following general formula I;
3'-X ₃ - Y ₃ -5' (I-3)
In the above general formula (I-3),
X ₃ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₃ is SEQ ID NO: 17;
The second probe is a reporter probe (RP) having a structure of the following general formula II;
3'-Y _3' -Z _3' -5' (II-3)
In the above general formula (II-3),
said Y _3' is SEQ ID NO: 18; Z _3' is an aptamer sequence region having an interactive label system comprising one label or multiple labels that generates a signal detectable with deoxyribonucleotide;
The third probe is a promoter probe (PP) having a structure represented by the following general formula I;
3'-X ₄ - Y ₄ -5' (I-4)
In the above general formula (I-4),
X ₄ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₄ is SEQ ID NO: 19;
The second probe is a reporter probe (RP) having a structure of the following general formula II;
3'-Y _4' -Z _4' -5' (II-4)
In the above general formula (II-4),
Y _4' ' is SEQ ID NO: 20; The composition of claim 1, wherein Z _4' is an aptamer sequence region having an interactive label system including one label or multiple labels that generates a signal detectable with deoxyribonucleotide. The composition according to claim 5, wherein the first probe is SEQ ID NO: 5, the second probe is SEQ ID NO: 6, the third probe is SEQ ID NO: 7, and the fourth probe is SEQ ID NO: 8. an isothermal one-pot reaction probe set for detecting SARS-CoV-2 including a first probe and a second probe; And an isothermal one-pot reaction probe set for detecting SARS-CoV-2 omicron mutations including a third probe and a fourth probe; As a composition for detecting SARS-CoV-2 omicron mutations,
here,
The first probe is a promoter probe (PP) having a structure of the following general formula I;
3'-X ₅ - Y ₅ -5' (I-5)
In the above general formula (I-5),
X ₅ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₅ is SEQ ID NO: 21;
The second probe is a reporter probe (RP) having a structure of the following general formula II;
3'-Y _5' -Z _5' -5' (II-5)
In the above general formula (II-5),
said Y _5' is SEQ ID NO: 22; Z _6' is an aptamer sequence region having an interactive label system comprising one label or multiple labels that generates a signal detectable with deoxyribonucleotide;
The third probe is a promoter probe (PP) having a structure represented by the following general formula I;
3'-X ₆ - Y ₆ -5' (I-6)
In the above general formula (I-6),
X ₆ is a deoxyribonucleotide and is a stem-loop structure region including a promoter sequence recognized by RNA polymerase; Y ₆ is SEQ ID NO: 23;
The second probe is a reporter probe (RP) having a structure of the following general formula II;
3'-Y _6' -Z _6' -5' (II-6)
In the above general formula (II-6),
wherein Y _6′ ′ is SEQ ID NO: 24; Wherein Z _10' is an aptamer sequence region having an interactive label system including one label or multiple labels that generates a signal detectable with deoxyribonucleotide. According to claim 7,
The first probe is SEQ ID NO: 9, the second probe is SEQ ID NO: 10, the third probe is SEQ ID NO: 11, and the fourth probe is SEQ ID NO: 12. According to any one of claims 1 to 8,
Wherein the label is selected from the group consisting of a chemical label, an enzyme label, a radioactive label, a fluorescent label, a luminescent label, a chemiluminescent label, and a metal label. According to any one of claims 1 to 8,
The isothermal single reaction, without a separate amplification reaction, the composition that is carried out simultaneously in one vessel by unifying at any one designated temperature in the range of 15 ° C to 50 ° C. According to any one of claims 1 to 8,
The isothermal single reaction is performed simultaneously by being unified into a single reaction solution containing Tris-HCl, MgCl _{2 ,} NTPs, NaCl and ET-SSB (Extreme Thermostable Single-Stranded DNA Binding Protein) composition. a composition according to any one of claims 2 to 8; A kit for detecting mutations in SARS-Cov-2, comprising a ligation agent, a polymerase and an isothermal single reaction solution.

Images