KR20230048891A - Phytase Variant - Google Patents

Abstract

The present invention application relates to phytase variants and uses thereof. One object of the present application is to provide a variant polypeptide having phytase activity. The variant polypeptide has sequence identity of 70 to 100% with SEQ ID NO: 1 or an amino acid sequence with 90% or more sequence identity thereto.

Description

Phytase Variant {Phytase Variant}

The present application relates to variant polypeptides having phytase activity and uses thereof.

Phytic acid (myo-inositol hexakisphosphate) is an organic form of phosphorus found in grains and oilseeds. It is not broken down in the digestive tract of monogamous animals, causing mineral deficiency in humans and livestock, and is also excreted as manure. It has caused water pollution by eutrophication of rivers and lakes in areas where livestock breeding is concentrated.

Accordingly, chemical treatment has been attempted as a method for decomposing phytic acid, but it has not been put to practical use because it destroys coexisting nutrients, and then, as a means for decomposing phytic acid without adverse nutritional effects on food or feed, phytic acid hydrolysis Phytase (myo-inositol hexakisphosphate phosphohydrolase), a phosphatase enzyme that catalyzes the breakdown and releases phosphorus in usable inorganic form (Mullaney EJ, et al., Advances in Applied Microbiology, Volume 47, 2000, Pages 157-199., 2000) was proven to be most effective, and research to discover microorganisms that produce phytase has been conducted since the 1960s. In particular, since the phytase gene was isolated from fungi in the 1990s, research has been conducted to improve the activity and heat resistance of existing phytases, including the discovery of new phytases.

One object of the present application is to provide a variant polypeptide having phytase activity.

Another object of the present application is to provide a composition comprising the variant polypeptide.

Another object of the present application is to provide a composition for reaction comprising the variant polypeptide or the variant polypeptide and/or a use of the composition for reaction with phytin.

Another object of the present application is to prepare a hydrolyzate of phytin, including contacting the variant polypeptide, a host cell expressing the variant polypeptide, and/or a composition comprising the variant polypeptide with a substrate. It is to provide a method and/or a method for hydrolyzing phytin.

Another object of the present application is a polynucleotide encoding the variant polypeptide; a nucleic acid construct comprising the polynucleotide; a vector containing the polynucleotide or nucleic acid construct; and/or a host cell containing the polynucleotide, nucleic acid construct or vector.

Another object of the present application is to provide a method for producing the variant polypeptide.

One aspect of the present application is a variant polypeptide having phytase activity.

In one embodiment, the variant polypeptide has i) the variant polypeptide has a sequence identity of 70% or more and less than 100% with SEQ ID NO: 1 or an amino acid sequence having a sequence identity of 90% or more therewith; and/or

ii) the variant polypeptide is a polypeptide encoded by a polynucleotide having at least 70% and less than 100% sequence identity with a sequence encoding a mature polypeptide of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity therewith; and/or

iii) the variant polypeptide is (a) a mature polypeptide coding sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity therewith, (b) a cDNA thereof, or (c) the full length of (a) or (b) above A polypeptide encoded by a polynucleotide that hybridizes to a full-length complement under low, medium, high, medium, high, or very high stringency conditions; and/or

iv) the variant polypeptide is a functional fragment of i), ii) or iii) polypeptide having phytase activity; and

It includes a variant of any one selected from the following.

Deletion of amino acids at positions 109, 134, 137, 164 and combinations thereof, insertion of amino acids, substitution with other amino acids, and combinations thereof;

Here, the position number is a position corresponding to the position of the polypeptide of SEQ ID NO: 1.

As an embodiment of any one of the above embodiments, amino acid number 109 before the modification is alanine (A); Amino acid 134 is glutamine (Q) or lysine (K); amino acid 137 is asparagine (N) or arginine (R); And/or amino acid number 164 may be arginine (R).

As an embodiment of any one of the above embodiments, the variant polypeptide may include modifications of amino acids at positions selected from the following i) to xv):

i) No. 109;

ii) No. 134;

iii) No. 137;

iv) No. 164;

v) No. 109+134;

vi) No. 109+137;

vii) No. 109+164;

viii) times 134+137;

ix) No. 134+164;

x) No. 137+164;

xi) No. 109+134+137;

xii) No. 109+134+164;

xiii) No. 109+137+164;

xiv) No. 134+137+164; and

xv) No. 109+134+137+164;

Here, the position number is a position corresponding to the position of the polypeptide of SEQ ID NO: 1.

As an embodiment of any one of the above embodiments, the variant polypeptide may include any one or more substitutions of the following i) to iv):

i) substitution of amino acid 109 with glutamic acid;

ii) substitution of amino acid 134 with glutamic acid;

iii) substitution of amino acid 137 with histidine; and

iv) substitution of amino acid 164 with serine;

Here, the position number is a position corresponding to the position of the polypeptide of SEQ ID NO: 1.

As an embodiment of any one of the above embodiments, the variant polypeptide may include any one or more substitutions selected from the following:

A109E;

Q134E or K134E;

N137H or R137H;

R164S;

A109E+Q134E or A109E+K134E;

A109E+N137H or A109E+R137H;

A109E+R164S;

Q134E+N137H or K134E+R137H;

Q134E+R164S or K134E+R164S;

N137H+R164S or R137H+R164S;

A109E+Q134E+N137H or A109E+K134E+R137H;

A109E+Q134E+R164S or A109E+K134E+R164S;

A109E+N137H+R164S or A109E+R137H+R164S;

Q134E+N137H+R164S or K134E+R137H+R164S; and

A109E+Q134E+N137H+R164S or A109E+K134E+R137H+R164S.

As an embodiment of any one of the above embodiments, the variant polypeptide may have one or more altered characteristics of the following i) to vii) compared to the polypeptide composed of the amino acid sequence of SEQ ID NO: 1:

i) increased enzyme activity;

ii) increased specific activity; and

iii) increased heat resistance.

Another aspect of the present application is a composition comprising the variant polypeptide.

Another aspect of the present application is the use of the variant polypeptide and/or a composition comprising the variant polypeptide for reaction with phytin.

Another aspect of the present application is to prepare a hydrolyzate of phytin, comprising contacting phytin with the variant polypeptide, a host cell expressing the variant polypeptide, and/or a composition comprising the variant polypeptide way.

Another aspect of the present application is a method for hydrolyzing phytin, comprising treating phytin with the variant polypeptide, a host cell expressing the variant polypeptide, and/or a composition comprising the variant polypeptide.

Another aspect of the present application is a polynucleotide encoding the variant polypeptide.

Another aspect of the present application is a nucleic acid construct comprising the polynucleotide.

Another aspect of the present application is a vector comprising the polynucleotide or the nucleic acid construct.

Another aspect of the present application is a host cell comprising the variant polypeptide, the polynucleotide, the nucleic acid construct, and/or the vector.

Another aspect of the present application is a method for producing a variant polypeptide comprising culturing the host cell.

The variant polypeptide having phytase activity of the present application can be usefully used in various industrial fields.

Figure 1 is Escherichia coli ( E.coli ) MG1655 strain-derived phytase (EcPhy) is a diagram showing the enzyme titer of the mutant fluorescence (RFU).
Figure 2 is a diagram showing the relative enzyme activity of EcPhy mutants.
Figure 3 is a diagram showing the relative enzyme activity of EPM08 phytase variants.

As used in the specification of this application and the appended claims, the singular articles "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Singular terms include the plural and plural terms include the singular, unless the context indicates otherwise. In the specification of this application and in the appended claims, unless stated otherwise, the use of "or" may be used to include "and/or".

In this application, the term "about" may be presented before a specific numeric value. As used in this application, the term "about" includes not only the exact number that follows the term, but also a range that is or is close to that number. It can be determined whether the number is close to or nearly the specific number mentioned, given the context in which it is presented. As an example, the term “about” can refer to a range of -10% to +10% of a numerical value. As another example, the term "about" can refer to a range of -5% to +5% of a given numerical value. However, it is not limited thereto.

In this application, descriptions such as the terms “first, second, third,,” “i), ii), iii)…” or “(a), (b), (c), (d)…” are used to distinguish similar configurations, and these terms are not meant to be performed sequentially or sequentially. For example, when the term is used in reference to steps in a method, use, or assay, there is no time interval between these steps, performed simultaneously, seconds, minutes, hours, days, Or it may be performed several months apart.

In this application, the term "consisting essentially of" means that a non-specified component may be present if the characteristics of the subject matter claimed in this application are not substantially affected by the presence of the non-specified component.

In this application, the term “consisting of” means that the proportions of the specified component(s) total 100%. Ingredients or features that come after the term “consisting of” may be essential or mandatory. In some embodiments, in addition to the ingredients or features that come under "consisting of", any other ingredients or non-essential ingredients may be excluded.

In this application, the term “comprising” means the presence of features, steps or components described below the term, and does not exclude the presence or addition of one or more features, steps or components. Components or features described under "comprising" in this application may be essential or mandatory, but in some embodiments may further include other optional or non-essential components or features.

In this application, the term “comprising” may, in some embodiments, be modified to refer to “consisting essentially of” or “consisting of”.

Regarding the amino acid sequence in this application, a polypeptide "comprising" the amino acid sequence set forth in a specific SEQ ID NO, a polypeptide "consisting of" the amino acid sequence set forth in a specific SEQ ID NO, or a polypeptide "having" an amino acid sequence set forth in a specific SEQ ID NO, or Even if it is described as a protein, if it has the same or equivalent activity as the polypeptide consisting of the amino acid sequence of the corresponding sequence number, a protein having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted, or added is also used in this application. It is self-evident that it can be used. For example, if the amino acid sequence has an addition of a sequence that does not change the function of the protein, a naturally occurring mutation, a silent mutation thereof, or a conservative substitution to the N-terminus and/or C-terminus of the amino acid sequence. It may, but is not limited thereto.

In this application, the term "protein" or "polypeptide" refers to a polymer or oligomer of contiguous amino acid residues. In this application, "polypeptide", "protein", and "peptide" may be used interchangeably with "amino acid sequence".

In some cases, an amino acid sequence that exhibits an activity may be referred to as an "enzyme." In this application, unless otherwise indicated, amino acid sequences are written in N-terminal to C-terminal orientation.

With respect to a cell, nucleic acid, polypeptide, or vector, the term "recombinant" in this application means that a cell, nucleic acid, polypeptide or vector has been modified by introduction of a heterologous nucleic acid or polypeptide or alteration of a natural nucleic acid or polypeptide; or that the cell is derived from a cell so modified. Thus, for example, a recombinant cell may express a gene that is not found in the native (non-recombinant) form of the cell, or may express a native gene that is expressed or not expressed at all, or otherwise abnormally expressed.

In this application, the term "isolated" refers to a substance in a form that does not exist or exists in a non-naturally occurring environment. This includes at least substantially the separation of a substance (sequence, enzyme or nucleic acid) from at least one other component with which it is naturally associated in nature and which has the same substance, eg, a sequence, enzyme or nucleic acid, as found in nature. .

For example, an isolated sequence, enzyme or nucleic acid provided herein may be provided in a form that is substantially free of one or more contaminants.

Examples of an isolated material are i) any material that is not naturally occurring, ii) any material from which one, more, or all naturally occurring constituents associated with it in nature have been removed. (e.g., enzymes, variants, nucleic acids, proteins, peptides or cofactors), iii) any substance that has been artificially modified from a substance found in nature, or iv) other constituents with which it is naturally associated. (e.g., increased copy number of a gene encoding a specific substance; modification of a promoter naturally linked to a gene encoding a specific substance into a highly active promoter, etc.) It may, but is not limited thereto.

In this application, the term "wild type" means a naturally-occurring one without artificial modification. When the term "wild type" is used in reference to a polypeptide, it is meant to be a naturally occurring polypeptide, which does not have artificial variance (substitutions, insertions, deletions, etc.) at one or more amino acid positions. Similarly, when the term "wild type" is used in reference to a polynucleotide, it means not having artificial modifications (substitutions, insertions, deletions) of one or more nucleotides. However, polynucleotides encoding wild-type polypeptides are not limited to wild-type polynucleotides, and include sequences encoding any wild-type polypeptides.

In the present application, a parent sequence or backbone refers to a reference sequence that becomes a mutant polypeptide by introducing modification. That is, the parental sequence may be a target for introducing mutations such as substitution, insertion, and/or deletion as a starting sequence. The parental sequence may be a naturally occurring or wild type, or a variant in which one or more substitutions, insertions or deletions have occurred in the natural or wild type, or may be an artificially synthesized sequence. there is. When the parent sequence is an amino acid sequence showing activity, that is, an amino acid sequence of an enzyme, it may be referred to as a parent enzyme.

In this application, the term “reference sequence” refers to a sequence used to determine the position of amino acids within any amino acid sequence. Any amino acid sequence can be aligned with a reference sequence to determine the position of an amino acid within any amino acid sequence that corresponds to a particular position in the reference sequence.

The term "fragment" in relation to an amino acid or nucleic acid sequence in this application means a portion of a parent sequence. For example, it may be a polypeptide in which one or more amino acids in the parental sequence are removed from the C or N terminus.

In the present application, a "fragment" of an enzyme may refer to a "functional fragment". "Functional fragment" may also be referred to as an active fragment, and refers to a polypeptide that is part of a parent enzyme and has the enzymatic activity of the parent enzyme. For example, a functional fragment of an enzyme may include a catalytic site of an enzyme.

A fragment of an enzyme may include a portion of the full length of the parent enzyme. For example, at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or more, but less than 100% amino acids of the full length of the parent enzyme. It may include, but is not limited thereto.

In this application, "modifying" means changing or altering. This may be a change from naturally occurring. In one example, an enzyme can be altered in such a way that the enzyme is altered from a parental or reference sequence.

In this application, a modified enzyme may be an enzyme that does not itself exist in nature, i.e., is non-naturally occurring.

In this application, the term "modified" means altered from, for example, its naturally occurring form. Modified enzymes of this application include non-naturally occurring enzymes or naturally occurring variants. In one example, the modified enzyme of the present application is a modified enzyme not found in nature. For example, the modified enzyme of the present application may not occur spontaneously (spontaneously), but is not limited thereto.

In this application, when the term "modification" is used in reference to an amino acid/nucleic acid sequence, it is a substitution of an amino acid/nucleic acid residue of a parent sequence for a different amino acid/nucleic acid residue at one or more sites in an amino acid sequence, one Deletion of a parental amino acid/nucleic acid residue (or set of amino acid/nucleic acid residues) at an abnormal site, insertion of a parental amino acid/nucleic acid residue (or set of amino acid/nucleic acid residues) at one or more sites , truncation of N-terminal and/or C-terminal amino acid sequences or 5' and/or 3' nucleic acid sequences, and any combination thereof.

In this application, a “variant” or “modified polypeptide” of an enzyme refers to a protein that differs from the parent enzyme in one or more amino acids by conservative substitution and/or modification. do. “Variant” or “variant polypeptide” may be used interchangeably. The variant or variant polypeptide may be non-naturally occurring, but is not limited thereto.

Such variants differ from the sequence of the parent enzyme by one or more modifications, eg, amino acid substitutions, deletions and/or insertions.

Such variants can generally be identified by modifying one or more amino acids in the parent enzyme and evaluating the properties of the modified protein. That is, the ability of the variant may be increased, unchanged, or reduced compared to the parent enzyme.

In addition, some variants may include variant polypeptides in which one or more portions such as an N-terminal leader sequence or a transmembrane domain are removed.

Other variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein.

The term "mutant" or "mutant polypeptide" may be used interchangeably with terms such as variant, modification, mutated protein, mutation (in English, modification, modified protein, mutant, mutein, divergent, variant, etc.), If the term is used in a modified sense, it is not limited thereto.

Variants may include deletions or additions of amino acids that have minimal effect on the secondary structure and properties of the polypeptide. For example, a polypeptide may be conjugated with a signal (or leader) sequence at the N-terminus of a protein that is involved in protein transfer either co-translationally or post-translationally. The polypeptide may also be conjugated with other sequences or linkers to allow identification, purification, or synthesis of the polypeptide.

In this application, the term "conservative substitution" means the substitution of one amino acid with another amino acid having similar structural and/or chemical properties. Such amino acid substitutions can generally occur based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues.

Throughout the specification of this application, common one-letter and three-letter codes for naturally occurring amino acids are used. Amino acids also referred to by abbreviations in this application are described according to the IUPAC-IUB nomenclature.

alanine Ala, A Arginine Arg, R

Asparagine Asn, N Aspartate Asp, D

Cysteine Cys, C Glutamate Glu, E

Glutamine Gln, Q Glycine Gly, G

Histidine His, H Isoleucine Ile, I

Leucine Leu, L Lysine Lys, K

Methionine Met, M Phenylalanine Phe, F

Proline Pro, P Serine Ser, S

Threonine Thr, T Tryptophan Trp, W

Tyrosine Tyr, Y Valine Val, V

On the other hand, any amino acid can be described as Xaa, X.

In addition, the generally accepted three-letter designation for naturally occurring amino acids as well as other amino acids such as Aib (2-Aminoisobutyric acid), Sar (N-methylglycine), α-methyl-glutamic acid, etc. code can be used.

Amino acids can generally be classified based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Thus, amino acid substitutions can generally occur based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues.

For example, among amino acids with electrically charged side chains, positively charged (basic) amino acids are arginine, lysine, and histidine, and negatively charged (acidic) amino acids are glutamic acid and aspartic acid. contain; Nonpolar amino acids among amino acids with uncharged side chains include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, and are polar or hydrophilic ( hydrophilic) amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine, and aromatic amino acids among the non-polar amino acids include phenylalanine, tryptophan, and tyrosine.

As used herein, the term "gene" refers to a polynucleotide that encodes a polypeptide and a polynucleotide that includes regions preceding and following the coding region. In some embodiments, a gene may have sequences (introns) inserted between each coding region (exon).

In this application, the term "homology" or "identity" refers to the degree of relatedness between two given amino acid sequences or nucleotide sequences and can be expressed as a percentage. The terms homology and identity are often used interchangeably.

Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms, together with default gap penalties established by the program used. Substantially homologous or identical sequences are generally under moderate or high stringency conditions along at least about 50%, 60%, 70%, 80% or 90% of the entire or full-length sequence. It can hybridize under stringent conditions. It is obvious that hybridization also includes polynucleotides containing common codons or codons considering codon degeneracy in polynucleotides.

Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: can be determined using known computer algorithms such as the “FASTA” program using default parameters as in 2444. or, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop , [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073. For example, BLAST of the National Center for Biotechnology Information Database, or ClustalW can be used to determine homology, similarity or identity, but is not limited thereto.

Homology, similarity or identity of polynucleotides or polypeptides can be found in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, eg, Needleman et al. (1970), J Mol Biol. It can be determined by comparing sequence information using a GAP computer program such as 48:443. In summary, the GAP program can define the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for the GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or 10 gap opening penalty, 0.5 gap extension penalty); and (3) no penalty for end gaps.

In addition, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be confirmed by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and appropriate hybridization conditions defined are within the scope of the art , methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but is not limited thereto.

In this application, the term “mature polypeptide” refers to a polypeptide in its form without a signal sequence or propeptide sequence. A mature protein/polypeptide/peptide may be a functional form of the protein/polypeptide/peptide. A mature polypeptide may be in its final form post-translational or subjected to post-translational modifications. Examples of post-translational modifications include, but are not limited to, N- or C-terminal modifications, glycosylation, phosphorylation, leader sequence removal, and the like.

In this application, the term "nucleic acid construct" includes one or more regulatory sequences, is artificially synthesized, engineered to include a specific sequence by a method that does not exist in nature, or derived from nature. Refers to an isolated single or double-stranded nucleic acid molecule.

As used herein, the term "expression" includes, but is not limited to, any step involved in the production of a polypeptide, such as transcription, post-transcriptional modification, translation, post-translational modification, secretion, and the like.

As used herein, the term "expression vector" refers to a linear or circular nucleic acid molecule comprising a coding sequence and operably linked regulatory sequences for its expression.

As used herein, the term "operably linked" refers to a configuration in which regulatory sequences are positioned in appropriate positions such that the regulatory sequences direct expression of the coding sequence. Thus, "operably linked" means that a regulatory region of a functional domain having a known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, functions to express, secrete, or function a target (gene or polypeptide). It includes those attached to or linked to their targets so that they can be modulated according to the desired activity.

As used herein, the term "cDNA" refers to a DNA sequence that can be prepared by reverse transcription from mature, spliced mRNA molecules obtainable from eukaryotic or prokaryotic cells. A cDNA sequence does not include intronic sequences that may be present in the corresponding genomic DNA. Early primary RNA transcripts are precursors of mRNA before they are processed through a series of steps including splicing to appear as mature spliced mRNA.

As used herein, the term "regulatory sequence" refers to a polynucleotide sequence necessary for the expression of a coding sequence. Each regulatory sequence may be native (of the same origin) or foreign (from another gene) to the coding sequence. Examples of the regulatory sequence include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates transcription and translation termination. contains sequence. The minimum unit of the regulatory sequence may include a promoter, transcriptional and translational termination sequences.

2. How to describe mutations

To describe the variants provided in this application, the following nomenclature is used.

In the present application, reference to a specific position in an amino acid sequence may include reference to an amino acid present or substituted at that position. Referencing an amino acid at a specific position can be described in various ways. For example, "position 109" can be described as "position 109", "amino acid at position 109", "amino acid at position 109". Also, for example, when the amino acid at the 109th position is alanine (A), it can be described as "A109" or "Ala109".

Amino acid substitution can be expressed by describing the amino acid before substitution, the position, and the amino acid to be substituted in the order. The amino acids can be expressed using conventional one-letter and three-letter codes. For example, when alanine, an amino acid at position 109 of a specific sequence, is substituted with glutamic acid, it may be described as "A109E" or "Ala109Glu".

Any amino acid at a particular position may be referred to as "X". For example, X134 refers to any amino acid at position 134. In addition, when the amino acid to be substituted is expressed as X, it means that it is substituted with an amino acid different from the amino acid present before substitution. For example, "R137X" indicates that R at position 137 is substituted with any amino acid other than R.

Different alternations can be expressed by simultaneously describing several types of amino acids using "/" or "," symbols. For example, when the amino acid (R) at position 164 is substituted with S or K, it may be used interchangeably as R164S/K or R164S,K. As another example, R/S164K means that amino acid R or S at position 164 before substitution is substituted with K.

Multiple mutations can be written using "+". For example, descriptions such as "A109E+R137H" mean that alanine, an amino acid at position 109, is substituted with glutamic acid, and arginine, an amino acid at position 137, is substituted with histidine.

Deletion of an amino acid can be expressed by listing the amino acid before deletion, position, * in order. For example, when alanine, an amino acid corresponding to position 109 of a specific sequence, is deleted, it can be expressed as A109* or (Ala109*).

Insertion of amino acids may be described as Ala109GlyLys or A109GK, for example, when lysine is inserted between alanine at position 109 and amino acid at position 110 in a specific sequence. When one or more amino acids are inserted, for example, insertion of lysine and valine between alanine at position 109 and amino acid at position 110 in a specific sequence can be described as Ala109GlyLysVal or A109GKV. In this case, the position of the inserted amino acid can be indicated using the amino acid number and alphabet in front of the inserted amino acid. For example, in the case described above, the inserted lysine and valine can be numbered as 109aK and 109bV.

In this application, the term “corresponding to” refers to an amino acid residue at a recited position in a protein or polypeptide, or an amino acid residue that is similar, identical, or homologous to a recited residue in a protein or polypeptide. Identification of the amino acid at the corresponding position may be determining the specific amino acid in the sequence that references the specific sequence. As used herein, “corresponding region” generally refers to a similar or corresponding position in a related or reference protein.

SEQ ID NO: 1 may be used as a reference sequence to determine the position of amino acids in any amino acid sequence in this application.

That is, SEQ ID NO: 1 disclosed in this application can be used to determine the corresponding amino acid residue in any polypeptide having phytase activity, and unless otherwise indicated in this application, the residue of a specific amino acid sequence is SEQ ID NO: 1 are numbered based on

For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1. . For example, sequence alignment algorithms, such as those described herein, can identify the location of amino acids, or locations where modifications such as substitutions, insertions, or deletions occur, compared to a query sequence (also referred to as a “reference sequence”).

These alignments include the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000). , Trends Genet. 16: 276-277) may be used, but is not limited thereto.

In addition, the corresponding amino acid residues in other phytases can be identified through multiple sequence alignment. Examples of multiple sequence alignment programs known in the art include MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or higher; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or higher; Katoh and Kuma, 2002). , Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900) and EMBOSS EMMA using ClustalW (at least 1.83; Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680), etc. There is, and the basic parameters of each of the above programs can be used, but are not limited thereto.

In addition, if the enzymes diverged from the mature polypeptide of SEQ ID NO: 1 do not detect their relationship by conventional sequence-based comparison, other pairwise sequence comparison algorithms can be used (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615). Higher sensitivity can be achieved in sequence-based searches by using search programs that use stochastic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program calculates a profile through an iterative database search process and can detect remote homologs with low relationships (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has more than one representation in the protein structure database. Programs such as GenTHEADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) have been used for neural networks that predict structural folding for query sequences. It uses information from various sources such as PSI-BLAST, secondary structure predictions, structural alignment profiles, and solvation potentials as input to the . Similarly, to align sequences of unknown structure with superfamily models present in the SCOP database, Gough et al., 2000, J. Mol. Biol. 313: The method of 903-919 can be used. These alignments can in turn be used to build homology models for polypeptides, and these models can be evaluated for accuracy using a variety of tools developed for that purpose.

For proteins of known structure, several tools and resources are available to search for and create structural alignments. For example, the SCOP superfamily of proteins has been structurally aligned, and these alignments are accessible and downloadable. The structure of two or more proteins can be structured in a variety of ways, such as a distance alignment matrix (Holm and Sander, 1998, Proteins 33: 88-96) or a combinational extension (CE) Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747). It can be sorted using an algorithm. Implementations of these algorithms can additionally be used to query structural databases with the structure of interest, to discover possible structural homologs (Holm and Park, 2000, Bioinformatics 16: 566-567).

The above methods are examples, but are not limited thereto.

3. Specific explanation

Hereinafter, specific examples of the present application will be described in more detail.

In this application, “phytase” means an enzyme that catalyzes the reaction of myo-inositol hexakisphosphate + H ₂ O ⇔ 1D-myo-inositol 1,2,3,5,6-pentakisphosphate + phosphate. may be classified as EC 3.1.3.26.

Phytase activity in this application can be measured and evaluated using methods known in the art, including the embodiments described in this application.

In the present application, "parent phytase" refers to a phytase to which a modification is applied to produce a variant or variant polypeptide of the present application. Specifically, the parent phytase, parent enzyme or parent sequence may be a naturally occurring polypeptide or wild-type polypeptide, may be a mature polypeptide thereof, may include a variant or functional fragment thereof, but may have a phytase activity and have a variant It is not limited thereto as long as it is a polypeptide that can be the parent of.

The parent phytase provided in the present application may be a polypeptide of SEQ ID NO: 1, but is not limited thereto. The polypeptide of SEQ ID NO: 1 may be an amino acid sequence excluding a signal sequence consisting of 22 amino acids in wild-type E. coli-derived phytase. In addition, about 60%, 70%, 75% with the polypeptide of SEQ ID NO: 1, as long as it has phytase activity. 80%. It may be a polypeptide having a sequence identity of 85%, 90%, 95%, 96%, 97%, 98% or 99% or more, and if it has the same or corresponding activity as the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, all It may be included without limitation in the range of phytase (Parent Phytase).

In the present invention, the parent phytase may include an amino acid sequence having 90% or more sequence identity with SEQ ID NO: 1, and the amino acid sequence having 90% or more sequence identity with SEQ ID NO: 1 It may include an amino acid sequence of 11, but is not limited thereto and may include an amino acid sequence having 90% or more sequence identity with SEQ ID NO: 1 without limitation.

The parent phytase of the variant provided in the present application (Parent Phytase) may be derived from Escherichia coli ( E.coli ).

On the other hand, the above-described microorganism is an example of a microorganism from which the parent phytase provided in the present application can be derived, and includes those derived from microorganisms taxonomically homologous to the microorganism regardless of the name of the microorganism.

The aforementioned microorganisms may be distributed from known microorganism depository institutions such as ATCC, DSMZ, CBS, NRRL, KCTC, and KCCM.

In this application, a sequence "derived from" a specific microorganism is not limited to those naturally produced or producible in that microorganism, but also includes sequences encoded by genes produced and isolated from the microorganism containing the gene. do.

For example, a phytase derived from the genus Escherichia includes an enzyme having a phytase activity naturally produced in Escherichia , as well as one produced from an Escherichia source, and a genetic modification known in the art (eg, encoding the enzyme). Sequence transformation) also includes those produced in other host cells.

In the present application, "variant polypeptide having phytase activity" may be a variant of the parent phytase.

As used herein, the term "parent phytase variant" or "phytase variant" refers to a protein having at least one amino acid sequence different from that of parent phytase and having phytase activity.

The "mutant polypeptide having phytase activity", the "parent phytase variant" and the "phytase variant" can be used interchangeably.

The variant provided in the present application may have phytase activity and include one or more amino acid modifications in the parent phytase sequence. In addition, the variant is i) a polypeptide having at least 70% and less than 100% sequence identity with SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity therewith; and/or ii) the variant is a polypeptide encoded by a polynucleotide having at least 70% and less than 100% sequence identity with a sequence encoding a mature polypeptide of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity therewith; and/or iii) the variant polypeptide is (a) a mature polypeptide coding sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity thereto, (b) a cDNA thereof, or (c) the above (a) or (b) A polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions, medium stringency conditions, medium to high stringency conditions, high stringency conditions, or very high stringency conditions to the full-length complement of ); and/or iv) the variant polypeptide may be a functional fragment of i), ii) or iii) polypeptide having phytase activity.

Specifically, the variant provided in the present application may have phytase activity and one or more altered functions or properties compared to the parent phytase, including modification of one or more amino acids in the parent phytase sequence.

In one embodiment, the variant provided in the present application has phytase activity, has one or more altered functions or properties compared to the parent phytase, including modification of one or more amino acids in the parent phytase sequence, and one or more Can have conservative substitutions.

The variant provided in the present application is a variant of the parent phytase, and may be a polypeptide having phytase activity.

In one embodiment, the variant provided in the present application may include modifications at one or more positions corresponding to positions 109, 134, 137, and 164 of SEQ ID NO: 1.

In this application, the position number is a position corresponding to the position of the polypeptide of SEQ ID NO: 1, and "corresponding" is as described above.

In one embodiment, the variant provided in the present application may include modifications of amino acids corresponding to one or more of A109, Q134, N137 and R164 of SEQ ID NO: 1, A109, K134, R137 and SEQ ID NO: 11 modifications of amino acids corresponding to one or more of R164.

In one embodiment, the amino acid corresponding to position 109 of SEQ ID NO: 1 before modification provided in the present application is alanine (A); The amino acid corresponding to position 134 is glutamine (Q) or lysine (K); The amino acid corresponding to position 137 is asparagine (N) or arginine (R); And/or the amino acid corresponding to position 164 may be arginine (R).

In one embodiment, the variant provided in this application is G, V, L, I, M, F, W, P, S, T, C, Y, N of the amino acid corresponding to position 109 of SEQ ID NO: 1 , Q, D, E, K, R or H.

In one embodiment, the variant provided in this application is G, A, V, L, I, M, F, W, P, S, T, C, Y of the amino acid corresponding to position 134 of SEQ ID NO: 1 , N, D, E, R or H.

In one embodiment, the variant provided in the present application is G, A, V, L, I, M, F, W, P, S, T, C, Y of the amino acid corresponding to position 137 of SEQ ID NO: 1 , Q, D, E, K or H.

In one embodiment, the variant provided in the present application is G, A, V, L, I, M, F, W, P, S, T, C, Y of the amino acid corresponding to position 164 of SEQ ID NO: 1 , N, Q, D, E, K or H.

In one embodiment, the variant provided in the present application may include substitution of an acidic amino acid with an amino acid corresponding to position 109 of SEQ ID NO: 1.

In one embodiment, the variant provided in the present application may include substitution of an acidic amino acid with an amino acid corresponding to position 134 of SEQ ID NO: 1.

In one embodiment, the variant provided in the present application may include substitution of a basic amino acid with an amino acid corresponding to position 137 of SEQ ID NO: 1.

In one embodiment, the variant provided in the present application may include substitution of an amino acid corresponding to position 164 of SEQ ID NO: 1 with a polar amino acid.

In one embodiment, the variant provided in the present application may include substitution of one or more of A109E, Q134E, N137H and R164S of SEQ ID NO: 1, and substitution of one or more of A109E, K134E, R137H and R164S of SEQ ID NO: 11 can include Specifically, a variant comprising an A3V substitution of SEQ ID NO: 1 may be represented by SEQ ID NO: 2, a variant comprising a V6F substitution of SEQ ID NO: 1 may be represented by SEQ ID NO: 3, and a L9K substitution of SEQ ID NO: 1 A variant comprising the sequence may be represented by SEQ ID NO: 4, and a variant comprising the M12E substitution of SEQ ID NO: 1 may be represented by SEQ ID NO: 5.

A variant comprising the A109E substitution of SEQ ID NO: 1 may be represented by SEQ ID NO: 3, a variant comprising the Q134E substitution of SEQ ID NO: 1 may be represented by SEQ ID NO: 5, and a variant comprising the N137H substitution of SEQ ID NO: 1 may be represented by SEQ ID NO: 7, a variant comprising the R164S substitution of SEQ ID NO: 1 may be represented by SEQ ID NO: 9, and a variant comprising the A109E substitution of SEQ ID NO: 11 may be represented by SEQ ID NO: 13, A variant comprising the R137H substitution of SEQ ID NO: 11 may be represented by SEQ ID NO: 15, a variant comprising the K134E+R164S substitution of SEQ ID NO: 11 may be represented by SEQ ID NO: 17, and A109E+K134E+ of SEQ ID NO: 11 A variant comprising the R137H+R164S substitution can be represented by SEQ ID NO: 19.

In one embodiment, the variants provided herein include all possible combinations of the foregoing variants.

For example, the variant may include a modification of an amino acid at a position selected from i) to xv) as a combination of the above modifications: i) position 109; ii) No. 134; iii) No. 137; iv) No. 164; v) No. 109+134; vi) No. 109+137; vii) No. 109+164; viii) times 134+137; ix) No. 134+164; x) No. 137+164; xi) No. 109+134+137; xii) No. 109+134+164; xiii) No. 109+137+164; xiv) No. 134+137+164; and xv) 109+134+137+164.

As another example, the variant may include, but is not limited to, substitution of any one or more of the following i) to iv): i) substitution of amino acid number 109 with glutamic acid; ii) substitution of amino acid 134 with glutamic acid; iii) substitution of amino acid 137 with histidine; and iv) substitution of amino acid 164 with serine.

As another example, the variant may include one or more modifications selected from the following, but is not limited thereto:

A109E;

Q134E or K134E;

N137H or R137H;

R164S;

A109E+Q134E or A109E+K134E;

A109E+N137H or A109E+R137H;

A109E+R164S;

Q134E+N137H or K134E+R137H;

Q134E+R164S or K134E+R164S;

N137H+R164S or R137H+R164S;

A109E+Q134E+N137H or A109E+K134E+R137H;

A109E+Q134E+R164S or A109E+K134E+R164S;

A109E+N137H+R164S or A109E+R137H+R164S;

Q134E+N137H+R164S or K134E+R137H+R164S; and

A109E+Q134E+N137H+R164S or A109E+K134E+R137H+R164S.

In one embodiment, the variant provided in the present application is a parent phytase; At least about 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, 93 with a mature polypeptide or functional fragment thereof. % or greater, 94% or greater, 95% or greater, 96% or greater, 97% or greater, 98% or greater or 99% or greater and less than 100% sequence identity.

In one embodiment, the variant provided in the present application is about 60% or more, for example, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more and It may have less than 100% sequence identity.

In one embodiment, the variant provided in the present application is about 60% or more, for example, 65% or more, 70% or more, with a sequence encoding a mature polypeptide of SEQ ID NO: 1 or an amino acid sequence having a sequence identity of 90% or more therewith. % or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more , or a polypeptide encoded by a polynucleotide having at least 99% and less than 100% sequence identity.

In one embodiment, the variant provided in the present application is about 60% or more, for example, 65% or more, 70% or more, 75% or more, with SEQ ID NO: 1 or a functional fragment of an amino acid sequence having 90% or more sequence identity therewith. % or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99 % or greater and less than 100% sequence identity.

Variants provided in this application may be one or more changes in any characteristic or attribute of a selected or detectable polypeptide compared to other phytases, such as wild-type phytase, parent phytase, other phytase variants, etc. .

The above properties or attributes include oxidative stability, substrate specificity, catalytic activity, thermal stability, alkali stability, pH activity profile, resistance to proteolysis, Km, k _cat , k _cat /Km ratio, protein folding, induction of an immune response, Ability to bind to ligands, to bind to receptors, to be secreted, to be displayed on the surface of cells, to form oligomers, to signal, to promote cell proliferation, to inhibit cell proliferation, to inhibit cell proliferation ability to induce apoptosis, ability to be modified by phosphorylation or glycosylation, and/or ability to treat disease.

Specifically, the variants provided in this application may have altered activity compared to the parental sequence in any one or more of the following:

i) increase or decrease enzyme activity;

ii) increase or decrease specific activity; and

iii) increase or decrease heat resistance;

However, it is not limited thereto.

In this application, "enzymatic activity" refers to at least one catalytic activity. Specifically, it may be the conversion efficiency of an enzyme mainly expressed as k _cat /Km, but is not limited thereto.

k _cat means a rate constant (catalytic constant) of conversion to a product in unit time by one enzyme when the enzyme is completely saturated with a substrate, and is also referred to as a turnover number. Km is the substrate concentration when the reaction rate is half of the maximum value (Vmax).

Examples of methods of expressing enzyme activity include specific activity (umol of converted substrate x mg ^-1 x min ^-1 ) or volumetric activity (umol of converted substrate x mL ^-1 x min ^-1 ). .

However, the definition of enzyme activity is not limited to the above, and Irwin H. Segel, Enzyme kinetics, John Wiley & Sons, 1979; A. G. Marangoni, Enzyme kinetics, Wiley-Interscience, 2003; A. Fersht, Enzyme structure and mechanisms, John Wiley & Sons, 1981; Structure and Mechanism in Protein Science: A guide to enzyme catalysis and protein folding, Alan Fersht, W.H. Freeman, 1999; Fundamentals of Enzyme Kinetics, Athel Cornish-Bowden, Wiley-Blackwell 2012 and Voet ef a/., "Biochemie" [Biochemistry], 1992, VCH-Verlag, Chapter 13, pages 331-332 with respect to enzymatic activity can be defined and evaluated on the basis of

In one embodiment, the variant provided in the present application is about 101%, about 110%, about 115%, about 115.6%, about 115.9%, about 118%, about 120%, about 120.9%, about 125% compared to the parent enzyme %, about 130%, about 135%, about 139%, about 139.9%, about 140%, about 145%, about 150%, about 155%, about 160%, about 165%, or about 168% or more increased enzyme can have activity.

In another embodiment, the variant provided in the present application is about 99%, about 95%, about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, or It may have a reduced enzymatic activity of about 20% or less.

In this application, the term “specific activity” is the activity of an enzyme per unit weight of protein, and can be expressed as unit/mg. Quantification of the protein can be performed using, for example, SDS-PAGE or Bradford assay.

Enzyme stability means that enzyme activity is preserved during storage or reaction time. In order to measure this change in stability, the initial enzyme activity was measured and compared at time zero (100%) and after a certain amount of time (x%) under predetermined conditions to determine the level at which enzyme activity is lost or enzyme stability. can express

Factors that affect enzyme activity include, for example, pH, heat, the presence of other substances (eg, oxidizing agents, chelating agents), and the like.

As used herein, the term "pH stability" means the ability of a protein to function in a specific pH range. In one embodiment, the variant provided in the present application may have activity at about pH 3.0 to about pH 12.0, but is not limited thereto.

When a protein maintains its function in a specific pH range, it can be defined as having "pH stability", and according to the pH range, it can be defined as having "acid resistance", "alkali resistance", and the like.

As used herein, the term "thermal stability" means the ability of a protein to function in a specific temperature range. In one embodiment, the variant provided in the present application may have activity in the range of about 20 ° C to about 70 ° C, but is not limited thereto.

As used herein, the term "thermal tolerance" refers to the ability of a protein to function after exposure to a specific temperature, eg, high heat or cryogenic temperature. For example, proteins that are thermotolerant may not function at the temperature they are exposed to, but may become functional again when returned to an optimal temperature environment.

The increase in stability may be compared to other enzymes, eg, wild-type enzyme, parent enzyme and/or other variants, maintaining high enzyme activity; This includes increasing the range of pH, temperature and/or time, etc., over which the protein remains functional.

Reduction in stability is associated with maintenance of lower enzyme activity compared to other enzymes, e.g., wild-type enzyme, parent enzyme, and/or other variants; This includes reducing the range of pH, temperature and/or time, etc., over which the protein remains functional.

As used herein, the term “substrate specificity” refers to the ability of an enzyme to discriminate between a substrate and molecules that compete with the substrate. Substrate specificity can be determined by measuring the activity of an enzyme on different substrates. In one embodiment, the change in substrate specificity may be a change in the direction of increasing specificity for a substrate capable of producing a desired product. In another embodiment, the change in substrate specificity may be a change in a direction in which specificity for a substrate capable of producing a desired product is reduced.

The altered properties of the variants provided in this application may be suitable activity, improved activity for application in various compositions including food, feed, pharmaceutical and cleaning.

A polynucleotide encoding a variant of the present application may include the coding sequence of the above-described variant. In the polynucleotide, various modifications may be made to the coding region within a range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or in consideration of codons preferred in organisms in which the polypeptide is to be expressed. .

In addition, the polynucleotide of the present application is a probe that can be prepared from a known gene sequence, for example, a sequence that hybridizes with a complementary sequence to all or part of the nucleotide sequence under stringent conditions to encode the variant of the present application. can be included without limitation.

The "stringent condition" means a condition that allows specific hybridization between polynucleotides. These conditions are described in the literature (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology , John Wiley & Sons, Inc., New York).

For example, polynucleotides with high homology or identity, 40% or more, specifically 90% or more, more specifically 95% or more, 96% or more, 97% or more, 98% or more, more specifically 99% or more 60°C, 1ХSSC, 0.1% SDS, which is a condition in which polynucleotides of the same identity or identity do not hybridize and polynucleotides having less homology or identity do not hybridize, or washing conditions of conventional southern hybridization. , Specifically, at 60 ° C., 0.1ХSSC, 0.1% SDS, more specifically at a salt concentration and temperature corresponding to 68 ° C., 0.1ХSSC, 0.1% SDS, conditions for washing once, specifically 2 to 3 times are listed. can

Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the entire sequence.

Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60 ° C, 63 ° C or 65 ° C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.

Appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotide and the degree of complementarity, parameters well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

For example, “high stringency” occurs about 5 to 10° C. below the Tm of the probe; “Medium stringency” occurs between about 10 and 20° C. below the Tm of the probe; “Low stringency” may occur, but is not limited to, about 20 to 25° C. below the Tm.

In one example, "low stringency condition" is 5X SSPE, 0.3% SDS, sheared and denatured salmon, for probes of at least 100 nucleotides in length, for 12-24 hours according to Southern blotting standard procedures. Prehybridization and hybridization at 42° C. at 200 micrograms/ml of sperm DNA and 25% formamide. The carrier material can be finally washed 2 to 3 times each for 15 minutes using 2 X SSC, 0.1 to 0.2% SDS at 50 °C.

As an example, "medium stringency condition" is 5X SSPE, 0.3% SDS, sheared and denatured salmon, for probes of at least 100 nucleotides in length, for 12-24 hours according to standard Southern blotting procedures. Prehybridization and hybridization at 42°C at 200 micrograms/ml of sperm DNA and 35% formamide. The carrier material can be finally washed 2-3 times with 2 X SSC, 0.1-0.2% SDS at 55°C for 15 minutes each. For example, "medium-high stringency condition" "In 5X SSPE, 0.3% SDS, 200 micrograms/ml of sheared and denatured salmon sperm DNA and 35% formamide, for probes of at least 100 nucleotides in length, for 12-24 hours according to standard Southern blotting procedures, It may be prehybridization and hybridization at 42°C. The carrier material can be finally washed 2 to 3 times at 60° C. with 1 to 2 X SSC, 0.1 to 0.2% SDS for 15 minutes each.

In one example, "high stringency conditions" are 5 X SSPE, 0.3% SDS, sheared and denatured, for probes of at least 100 nucleotides in length, for 12-24 hours according to Southern blotting standard procedures. Prehybridization and hybridization at 42° C. in 200 micrograms/ml of salmon sperm DNA and 35% formamide. The carrier material can be finally washed 2 to 3 times each for 15 minutes using 2 X SSC, 0.1 to 0.2% SDS at 65 °C.

A nucleic acid construct provided herein comprises a polynucleotide encoding a variant provided herein, operably linked to one or more regulatory sequences that direct expression of the coding sequence in an appropriate host cell under conditions suitable for the regulatory sequence. do.

Polynucleotides can be engineered in a variety of ways to allow expression of variants. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide prior to insertion into the vector. Such manipulations may use methods known in the art.

The "vector" provided in the present application contains a nucleotide sequence of a polynucleotide encoding the variant operably linked to a suitable expression control region (or expression control sequence) so as to express the variant of the present application in a suitable host. means a DNA preparation. The expression control region may include a promoter capable of initiating transcription, an arbitrary operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating termination of transcription and translation. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can integrate into the genome itself.

Vectors that can be used in the present application are not particularly limited, and any vectors known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR-based, pUC-based, and pBluescriptII-based plasmid vectors , pGEM-based, pTZ-based, pCL-based, pET-based, etc. can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.

For example, a polynucleotide encoding a variant provided in the present application may be inserted into a chromosome through a vector for chromosomal insertion into a cell. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for determining whether the chromosome is inserted may be further included. Selectable markers are used to select cells transformed with a vector, that is, to determine whether a target nucleic acid molecule has been inserted, and to give selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. markers may be used. In an environment treated with a selective agent, only cells expressing the selectable marker survive or exhibit other expression traits, and thus transformed cells can be selected.

Host cells of the present application may be included without limitation as long as they can express the variants of the present application.

The host cell of the present application may include the above-described variant, a polynucleotide encoding the variant, a nucleic acid construct containing the same, and/or a vector.

The nucleic acid construct or vector may be maintained as a chromosomally integrated or self-replicating extrachromosomal vector as described above.

A host cell of the present application includes any progeny of the parent cell that are not identical to the parent cell due to mutations occurring during replication.

A host cell may be any cell useful for recombinant production of variants, such as a prokaryotic or eukaryotic cell.

A prokaryotic host cell can be any gram-positive or gram-negative bacterium.

Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces.

Gram-negative bacteria include Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Iliobacter, Neisseria, Pseudomonas, Salmonella, Vibrio (e.g. Vibrio natriegens) ) and Ureaplasma.

In one embodiment, the bacterial host cell may be a host cell of the genus Bacillus, specifically, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumillus, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis cells. don't

In one embodiment, the bacterial host cell may be a host cell of the genus Streptococcus, specifically Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis and Streptococcus equi subspecies Zooepidemicus cells.

In one embodiment, the bacterial host cell may be a host cell of the genus Streptomyces, specifically Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces Coelicola, Streptomyces griseus and Streptomyces lividans cells.

In one embodiment, the bacterial host cell may be a host cell of the genus Corynebacterium, Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare ( Corynebacterium singulare), Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium pollutisoli , Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens, but is not limited thereto.

The host cell may be a eukaryote such as a mammalian, insect, plant or fungal cell.

The host cell may be a fungal cell. In this application, "fungi" includes ascomycetes, basidiomycota, phylum phylum and zygomycota, as well as phylum oomycetes and all imperfect fungi.

Fungal host cells may be yeast cells. "Yeast" in this application refers to ascosporogenous yeast (Endomycetales), basidiosporogenous yeast and yeast belonging to Fungi imperfecti (Blastomycetes). includes However, these classifications are subject to change, and classifications may be defined as described in Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980). .

Yeast host cells are Candida, Hansenula, Kluyveromyces, Pichia, Komagataella, Saccharomyces, Schizosaccharomyces ( Schizosaccharomyces or Yarrowia cells, for example Pichia pastoris, Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norvensis (Saccharomyces norbensis), Saccharomyces oviformis, Komagataella phaffii or Yarrowia lipolytica cells.

Fungal host cells may be filamentous fungal cells. "Filamentous fungi" includes all filamentous forms of the subphylum Mycobacterium and Oomycota (as defined above by Hawksworth et al., 1995). Filamentous fungi are generally characterized by hyphal walls composed of chitin, cellulose, glucan, chitosan, mannan and other complex polysaccharides. Vegetative growth is by mycelial elongation, and carbon catabolism is strictly aerobic. In contrast, vegetative growth by yeasts, such as Saccharomyces cerevisiae, is by germination of unicellular thalluses, and carbon catabolism can be fermentative.

Filamentous fungal host cells include Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus ( Coprinus), Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Mycellioptora, Neocalimastics (Neocallimastix), Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus ), Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes or Trichoderma cells can be

For example, filamentous fungal host cells are Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus ), Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis curry Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrupa subrufa), Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense , Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium tropicum Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusa Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium gramineum, Fusarium heterosporum, Fusarium Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarloc Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusa Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor Miehei, Mysellioptora thermophila, Neurospora crassa, Penny Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thiellabia terrestris ( Thielavia terrestris), Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibraki It may be a Trichoderma longibrachiatum, Trichoderma reesei or Trichoderma viride cell. However, it is not limited thereto.

The composition of the present application can be used to convert phytin to hydrolysates of phytin.

The composition of the present application may further include other components in addition to the variants provided in the present application. A person skilled in the art can appropriately select components added to the composition of the present application.

In one embodiment, the composition of the present application may further include any component suitable for conversion of phytin to a hydrolyzate of phytin.

In one embodiment, the composition of the present application may further include any component suitable for application to various compositions including food, feed, pharmaceutical and cleaning.

Examples of materials that may be added are stabilizers, surfactants, builders, chelating agents, dispersants, enzymes, enzyme stabilizers, catalysts, activators, carriers, formulations, lubricants, disintegrants, excipients, solubilizers, suspending agents, colorant, flavoring agent, buffering agent, preservative, soothing agent, solubilizer, tonicity agent, stabilizer, diluent, lubricant, preservative and the like, but are not limited thereto.

In one embodiment, the composition provided in the present application may further include a naturally occurring material or a non-naturally occurring material, in addition to the variant provided in the present application.

In one embodiment, the composition provided in the present application may further include additional enzymes used in various compositions including food, feed, pharmaceuticals, and cleaning, in addition to the variants provided in the present application.

For example, the additional enzymes include beta-amylases, cellulases (beta-glucosidases, cellobiohydrolases and endoglucanases), glucoamylases, hemicellulases (e.g., xylanases), isoamylases. , Isomerase, lipase, phytase, protease, pullulanase and / or alpha-amylase, together with any one or more enzymes selected from the group consisting of other enzymes useful in commercial processes.

The method for producing a variant of the present application may include a step of recovering the step of culturing the host cell.

In this application, the term "culture" means growing the host cells under appropriately controlled environmental conditions. The culture process of the present application may be performed according to suitable media and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art according to the selected strain. Specifically, the culture may be batch, continuous and fed-batch, but is not limited thereto.

As used herein, the term "medium" refers to a material in which nutrients necessary for culturing the host cells are mixed as main components, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the host cells of the present application can be any medium without particular limitation as long as it is a medium used for culturing conventional host cells. It can be cultured while controlling temperature, pH, etc. under aerobic conditions in a conventional medium containing phosphorus, inorganic compounds, amino acids, and/or vitamins.

Examples of the carbon source in the present application include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, and maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sorghum pomace and corn steep liquor can be used, specifically glucose and sterilized pretreated molasses (i.e. converted to reducing sugar). Carbohydrates such as molasses) may be used, and other carbon sources in an appropriate amount may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

Examples of the nitrogen source include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, etc., organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

The number of persons may include monopotassium phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto. As the inorganic compound, sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and amino acids, vitamins, and/or appropriate precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, it is not limited thereto.

In addition, the pH of the medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. to the medium in an appropriate manner during the culture of the host cells. In addition, during cultivation, the formation of bubbles can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without gas injection or nitrogen, hydrogen or carbon dioxide gas may be injected to maintain the anaerobic and non-aerobic state. It is not.

The temperature of the medium may be 20 °C to 45 °C, specifically 25 °C to 40 °C, but is not limited thereto. The culturing period may be continued until a desired production amount of a useful substance is obtained, specifically, it may be 10 hours to 160 hours, but is not limited thereto.

In one embodiment, the method for producing the variant polypeptide having phytase activity of the present application may further include recovering the variant polypeptide having phytase activity of the present application expressed in the culturing step.

In another embodiment, the mutant expressed in the culturing step can be recovered using a method known in the art to which the present invention belongs. For example, variants can be recovered from nutrient media by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation or precipitation.

The recovery method may be to collect variants using a suitable method known in the art according to the host cell culture method of the present application, for example, batch, continuous, or fed-batch culture. For example, centrifugation, filtration, treatment with a precipitating agent for crystallized proteins (salting out method), extraction, sonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity Various chromatography, HPLC, and these methods may be used in combination, and the mutant may be recovered from the medium or host cell using a suitable method known in the art.

In another embodiment, variants expressed by the host cell in the culture step may not be recovered. In the above embodiment, the host cell itself expressing the variant may be used as a source of the variant.

A substrate (e.g., phytin (myo-inositol hexakisphosphate)) is converted into a final product (e.g., 1D-myo-inositol 1, 2,3,5,6-pentakisphosphate). In addition to the variants of the present application, cofactors, coenzymes, etc. may be added together in the hydrolysis step of the substrate. The step of hydrolyzing the substrate can be performed under optimal pH, temperature conditions, etc., and appropriate conditions can be selected by those skilled in the art.

The variants of the present application can be used to treat feeds including grains and oil seeds containing or consisting of phytic acid. Such a feed may further include organic acids such as citric acid, fumaric acid, adipic acid, and lactic acid for administration; phosphates such as potassium phosphate, sodium phosphate, and polymerized phosphate; At least one of natural antioxidants such as polyphenol, catechin, tocopherol, vitamin C, green tea extract, chitosan, and tannic acid may be mixed and used, and other conventional additives such as anti-influenza, buffer, and bacteriostatic agent may be added as necessary. can do. In addition, diluents, dispersants, surfactants, binders, or lubricants may be additionally added to prepare formulations for injections such as aqueous solutions, suspensions, emulsions, and the like, capsules, granules, or tablets. In addition, the feed includes various auxiliary ingredients such as amino acids, inorganic salts, vitamins, antioxidants, antifungal agents, and antibacterial agents as auxiliary ingredients, vegetable protein feed such as pulverized or crushed wheat, barley, and corn, and animal sources such as blood meal, meat meal, and fish meal. In addition to main ingredients such as protein feed, animal fat and vegetable fat, it can be used with nutritional supplements, growth promoters, digestion and absorption promoters, and disease prevention agents. The treatment can provide minerals for the human body and livestock according to decomposition in the digestive tract of unit animals, eutrophication of rivers and lakes in breeding densely populated areas, and prevention of water pollution.

Example

Hereinafter, the present application will be described in more detail through Examples and Experimental Examples. However, these examples and experimental examples are for illustrative purposes of the present application, and the scope of the present application is not limited to these examples and experimental examples.

Example 1: Preparation of phytase variants

Example 1-1. Manufacture of template

Escherichia coli ( Escherichia coli , E.coli ) A polynucleotide (SEQ ID NO: 2) encoding a phytase (hereinafter referred to as EcPhy) (SEQ ID NO: 1) in the genomic DNA of the MG1655 strain is amplified to pET Cloning into a vector (Novagen) was used as a template.

Example 1-2. Construction of EcPhy variant expression vectors

Surface residue sites for increasing EcPhy activity at room temperature were selected, primers were designed, and four variant expression vectors were constructed. Table 1 shows the mutation position and amino acids before and after the mutation based on the amino acid sequence of SEQ ID NO: 1 of each variant.

variant
designation mutation content sequence number Primer sequence (5'→3') EPM1 A109E Forward 21 GGCTGGCACCTGACTGT GAA ATAACCGTACATACCCAGGCAGATACGTCC Reverse 22 TTC ACAGTCAGGTGCCAGCCCGGCGGCGAAGGCTTCG EPM2 Q134E Forward 23 AAAAACTGGCGTTTGC GAA CTGGATAACGCGAACGTGACTGACG Reverse 24 TTC GCAAACGCCAGTTTTTAGAGGATTAAATAACGGATCGGGACTGGACG EPM3 N137H Forward 25 CGTTTGCCAACTGGAT CAC GCGAACGTGACTGACGCGATCC Reverse 26 GTG ATCCAGTTGGCAAACGCCAGTTTTTAGAGGATTAAATAACGGATCGG EPM4 R164S Forward 27 GGCAAACGGCGTTT AGC GAACTGGAACGGGTGCTTAATTTTCCG Reverse 28 GCT AAACGCCGTTTGCCGATGCCCGGTAAAGTCAGCAATTGACC

Specifically, the phytase mutant expression vector was prepared through QuikChange Site-Directed Mutagenesis using a template (SEQ ID NO: 2), primers, and PCR premix (iNtRON, cat no. 25185). Eppendorf Mastercycler Nexus GX2 was used for PCR, and the reaction conditions were initial denaturation at 94 ° C, 2 min, denaturation at 94 ° C, 20 sec, annealing at 55 ° C, 10 sec, and extension 72 ℃, 8min (15 cycles from denaturation to elongation) and final extension (Final Extension) were carried out at 72 ℃, 5min conditions.

The primers used in preparing each variant are shown in Table 1 above.

After transforming the 4 mutant expression vectors prepared by the above method into E.coli DH5α strain, sequence mutation was confirmed through colony PCR and sequencing.

Example 1-3. Construction of EPM08 phytase mutant expression vector

A primer was designed to introduce the same mutation introduced into ECphy in Example 1-2 into the corresponding position of EPM08 phytase (SEQ ID NO: 11) having 90% sequence identity with ECphy, and the mutations in Table 2 below ( A109E or R137H) or mutation combinations (K134E+R164S or A109E+K134E+R137H+R164S) were introduced into four variant expression vectors. The position of mutation based on the amino acid sequence of SEQ ID NO: 11 of each variant and the amino acids before and after the mutation are shown in Table 2 below.

mutation content sequence number Primer sequence (5'→3') A109E Forward 29 GGCTGC GAA ATTACGGTCCACACGCAGCCCGACG Reverse 30 GACCGTAAT TTC GCAGCCGGGAGCCAAGCCGGCAG K134E Forward 31 AGACGGGCGTGTGT GAA TTAGATCGTGCCAACGTTACTGCTGC Reverse 32 TTC ACACACGCCCGTCTTTAATGGATTAAAAAGGGGATCGGGC R164S Forward 33 GGCAACCCGCCTTT AGC GAATTAGAAAGGGTGTTGAACTTTCCTCAG Reverse 34 GCT AAAGGCGGGTTGCCTATGTTGCGTCCATCTGGCAATAGAGC R137H Forward 35 TGTGTAAATTAGAT CAT GCCAACGTTACTGCTGCAATTTTAGCACGTGC Reverse 36 GGC ATG ATCTAATTTACACACGCCCGTCTTTAATGGATTAAAAAGGGG

Specifically, the EPM08 phytase variant (A109E or R137H) expression vector was constructed through QuikChange Site-Directed Mutagenesis using a template, primers, and PCR premix (iNtRON, cat no. 25185). As a template, a polynucleotide (SEQ ID NO: 12) encoding EPM08 phytase (SEQ ID NO: 11) was cloned into a pET vector (pET-EPM08). Eppendorf Mastercycler Nexus GX2 was used for PCR, and the reaction conditions were initial denaturation at 94°C, 2min, denaturation at 94°C, 20sec, annealing at 55°C, 10sec, elongation at 72°C, 8min (15cycles from denaturation to elongation) and final Elongation was performed under conditions of 72°C and 5 min.

The EPM08 phytase variant EPM08M2 (K134E+R164S) expression vector (pET-EPM08M2) was constructed by introducing the K134E mutant coding sequence and then the R164S mutant coding sequence into the polynucleotide sequence encoding EPM08 phytase of the pET-EPM08 vector as a template. .

The EPM08 phytase variant EPM08M4 (A109E+K134E+R137H+R164S) expression vector (pET-EPM08M4) was prepared by introducing the A109E mutant coding sequence and then the R137H mutant coding sequence into the EPM08M2 phytase coding sequence of the previously constructed pET-EPM08M2 vector. did

The primers used in preparing each variant are shown in Table 2 above.

After transforming the 4 mutant expression vectors prepared by the above method into E.coli DH5α strain, sequence mutation was confirmed through colony PCR and sequencing.

Example 2: Confirmation of the effect of improving the activity of phytase variants

Example 2-1. EcPhy variant enzyme titer

E. coli BL21(DE3) strains each transformed with the EcPhy variant and EcPhy expression vector prepared in Example 1 were inoculated into a sterile LB medium, pre-cultured at 37°C and 250 rpm for 20 hours, and 1:100 After incubation for 2 hours after dilution, intracellular protein was expressed for 4 hours through IPTG induction. The cultured medium was centrifuged to recover cells, and lysis buffer (50 mM Tris-HCl, pH 7.4, 2 mg/mL lysozyme) was added to the recovered cells, resuspended, and then 30°C at 1000 rpm at 37°C. After dissolving for 10 minutes, the enzyme solution was secured through centrifugation to evaluate the potency.

The enzyme titer was determined by the fluorescence (RFU; excitation 360 nm, emission 465 nm) of the substance (4-methylumbelliferone) produced by mixing 10 μL of enzyme solution and 50 μL of substrate solution (50 mM sodium acetate pH 5.5, 1 mM 4-methylumbelliferyl phosphate). ) was evaluated by measuring. The reaction was carried out for 10 minutes for each variant, and the RFU was measured every 30 seconds to calculate the RFU increase per second (RFU / s) to obtain the relative titer of the variants. The RFU increase per second (RFU / s) of each variant is shown in Figure 1, and based on this, the relative titer of each variant was calculated based on EcPhy, and the results are shown in Table 3 below.

variant name RFU/s potency ratio Potency increase (%) EcPhy 63.25 1.00 0.00 EPM1 76.40 1.21 20.78 EPM2 88.46 1.40 39.86 EPM3 73.31 1.16 15.89 EPM4 73.14 1.16 15.63

As a result, when the enzyme titer was measured as a ratio, it was confirmed that the enzyme titer was improved by 15% to 40% or more in the four EcPhy variants (EPM1, EPM2, EPM3 and EPM4) compared to EcPhy.

Example 2-2. EPM08 phytase variant enzyme titer

Four EPM08 phytase mutants (A109E, R137H , EPM08M2 As a result of analyzing the enzyme activity of (K134E + R164S) and EPM08M4 (A109E + K134E + R137H + R164S)), it was confirmed that the activity was improved by 18% to 68% compared to EPM08 phytase in four EPM08 phytase variants (FIG. 3 ).

Example 3: Phytase variant expression Pichia pastoris ( Pichia pastoris ) strain production

In order to prepare a Pichia pastoris strain expressing Ecphy phytase, EPM08 phytase or each variant thereof prepared in Example 1, each polynucleotide capable of expressing these proteins was codon-optimized and then synthesized, It was amplified by PCR using the primer pairs shown in Table 4 below. Each amplified polynucleotide was fusion-ligated to the multi cloning site between the signal peptide of the pPICZaA vector and the AOX1 terminator, transformed into E.coli DH5a, and plated on a Zeocin plate. Colonies were selected by culturing at 37° C. for 24 hours in (low salt LB). PCR was performed on the selected colonies using the primer pairs shown in Table 4 below, and colonies containing vectors containing polynucleotides encoding Ecphy phytase, EPM08 phytase or variants thereof were finally selected.

Colonies selected for each polynucleotide were inoculated in low-salt LB supplemented with Zeocin, cultured at 37° C. for 24 hours, centrifuged to obtain cells, and then cloned vectors were obtained through DNA prep. Each obtained vector was treated with Sac1 restriction enzyme and incubated at 37°C for 4 hours to obtain a linearized plasmid.

Each corresponding plasmid was transformed into wild-type Pichia pastoris BG10 strain by electroporation, and then cultured at 30° C. for 2 days or more to select colonies. After inoculating the selected colonies into YPD medium to obtain cells, PCR was performed to select each Pichia pastoris strain containing a vector inserted with a polynucleotide encoding Ecphy phytase, EPM08 phytase or a variant thereof. .

sequence number sequence name Sequence (5'→3') 37 primer_F AGA GAG GCT GAA GCT CAA TCT GAA TTG CAA 38 primer_R AAG GCT ACA AAC TCA CAA AGA ACA AGC TGG AAT TCT AG

Example 4: Activity evaluation of Pichia pastoris strains expressing phytase variants

Flask comparison evaluation was performed to confirm the flask culture and enzyme expression of each strain prepared in Example 3. Seed culture was inoculated with the above strain in 1ml BMGY (1% glycerol) (Table 5) and cultured at 30 ° C and 200 rpm for 16 hours. C, incubated at 200 rpm. To induce the Aox1 promoter, 3% methanol was added every 24 hours. For titer evaluation, a phytase activity assay was performed using the supernatant of this culture, and then the relative phytase activity was analyzed.

Composition of BMGY 1% medium Stock conc. Working conc. per 1L Yeast extract One% 10g Peptone 2% 20g Autoclave 121℃, 15min
BMGY (1%): total volume 700ml 1M K-pi, pH6.0 100 mM 100ml 13.4% YNB 1.34% 100ml 1X10-2% Biotin 4X10-5% 2ml 10% Glycerol One% 100ml

Potency medium composition medium component density KH ₂ PO ₄ 11.7g/L K ₂ HPO ₄ 2.4g/L Calcium sulfate 0.93g/L Pottasium sulfate 9.1g/L MgSO ₄ 7H2O 14.9g/L Glycerol 1.0g/L YE (yeast extract) 20.0g/L Corn steep liquor (CSL) (50%) 50.0g/L PTM4 (Pichia trace minerals 4) 2.0ml/L

PTM4 stock composition ingredient density CuSO ₄ 5H ₂ O 2g/L sodium iodide (NaI) 0.08g/L MnSO ₄ H ₂ O 3g/L Sodium _molybdate 2H ₂ O 200mg/L Boric acid 20mg/L CaSO ₄ 2H ₂ O 0.5g/L Cobalt chloride 0.5g/L Zinc chloride 7g/L FeSO ₄ 7H ₂ O 22g/L Biotin 200mg/L Sulfuric acid 1ml/L

As a result, the strain into which the EPM08 phytase expression vector was introduced showed a phytase activity of about 84 U/ml, and the EPM08 phytase mutant EPM08M4 (A109E+K134E+R137H+R164S) expression vector in which four mutations were simultaneously introduced The introduced strain showed a phytase activity of 10 3 U/ml.

Next, as a result of confirming the relative phytase activity of each of the four EcPhy variants based on the activity calculated above, it was confirmed that the activity of all four EcPhy variants increased compared to EcPhy, as shown in FIG.

In addition, as a result of confirming the relative phytase activity of each of the four EPM08 phytase variants based on EPM08 phytase, it was confirmed that the activity of all four EPM08 phytase variants increased compared to EPM08 phytase as shown in FIG. 3 .

From the above description, those skilled in the art to which this application pertains will be able to understand that this application can be implemented in other specific forms without changing its technical spirit or essential features. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present application should be construed as including all changes or modifications derived from the meaning and scope of the following patent claims and their equivalent concepts rather than the detailed description above.

<110> CJ CheilJedang Corporation <120> Phytase Variant <130> KPA210391-KR <160> 38 <170> KoPatentIn 3.0 <210> 1 <211> 410 <212> PRT <213> Unknown <220> <223> EcPhy AA <400> 1 Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Asp Gly Leu Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val 100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile 130 135 140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser 225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 <210> 2 <211> 1230 <212> DNA <213> Unknown <220> <223> EcPhy NT <400> 2 cagagtgagc cggagctgaa gctggaaagt gtggtgattg tcagtcgtca tggtgtgcgt 60 gctccaacca aggccacgca actgatgcag gatgtcaccc cagacgcatg gccaacctgg 120 ccggtaaaac tgggttggct gacaccgcgc ggtggtgagc taatcgccta tctcggacat 180 taccaacgcc agcgtctggt agccgacgga ttgctggcga aaaagggctg cccgcagtct 240 ggtcaggtcg cgattattgc tgatgtcgac gagcgtaccc gtaaaacagg cgaagccttc 300 gccgccgggc tggcacctga ctgtgcaata accgtacata cccaggcaga tacgtccagt 360 cccgatccgt tatttaatcc tctaaaaact ggcgtttgcc aactggataa cgcgaacgtg 420 actgacgcga tcctcagcag ggcaggaggg tcaattgctg actttaccgg gcatcggcaa 480 acggcgtttc gcgaactgga acgggtgctt aattttccgc aatcaaactt gtgccttaaa 540 cgtgagaaac aggacgaaag ctgttcatta acgcaggcat taccatcgga actcaaggtg 600 agcgccgaca atgtctcatt aaccggtgcg gtaagcctcg catcaatgct gacggagata 660 tttctcctgc aacaagcaca gggaatgccg gagccggggt ggggaaggat caccgattca 720 caccagtgga acaccttgct aagtttgcat aacgcgcaat tttatttgct acaacgcacg 780 ccagaggttg cccgcagccg cgccaccccg ttattagatt tgatcaagac agcgttgacg 840 ccccatccac cgcaaaaaca ggcgtatggt gtgacattac ccacttcagt gctgtttatc 900 gccggacacg atactaatct ggcaaatctc ggcggcgcac tggagctcaa ctggacgctt 960 cccggtcagc cggataacac gccgccaggt ggtgaactgg tgtttgaacg ctggcgtcgg 1020 ctaagcgata acagccagtg gattcaggtt tcgctggtct tccagacttt acagcagatg 1080 cgtgataaaa cgccgctgtc attaaatacg ccgcccggag aggtgaaact gaccctggca 1140 ggatgtgaag agcgaaatgc gcagggcatg tgttcgttgg caggttttac gcaaatcgtg 1200 aatgaagcac gcataccggc gtgcagtttg 1230 <210> 3 <211> 410 <212> PRT <213> Artificial Sequence <220> <223> EPM1(A109E) AA <400> 3 Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Glu Ile Thr Val 100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile 130 135 140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser 225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 <210> 4 <211 > 1230 <212> DNA <213> Artificial Sequence <220> <223> EPM1(A109E) NT <400> 4 cagagtgagc cggagctgaa gctggaaagt gtggtgattg tcagtcgtca tggtgtgcgt 60 gctccaacca aggccacgca actgatgcag gatgtcaccc cagacgcatg gccaacctgg 120 ccggtaaaac tgggttggct gacaccgcgc ggtggtgagc taatcgccta tctcggacat 180 taccaacgcc agcgtctggt agccgacgga ttgctggcga aaaagggctg cccgcagtct 240 ggtcaggtcg cgattattgc tgatgtcgac gagcgtaccc gtaaaacagg cgaagccttc 300 gccgccgggc tggcacctga ctgtgaaata accgtacata cccaggcaga tacgtccagt 360 cccgatccgt tatttaatcc tctaaaaact ggcgtttgcc aactggataa cgcgaacgtg 420 actgacgcga tcctcagcag ggcaggaggg tcaattgctg actttaccgg gcatcggcaa 480 acggcgtttc gcgaactgga acgggtgctt aattttccgc aatcaaactt gtgccttaaa 540 cgtgagaaac aggacgaaag ctgttcatta acgcaggcat taccatcgga actcaaggtg 600 agcgccgaca atgtctcatt aaccggtgcg gtaagcctcg catcaatgct gacggagata 660 tttctcctgc aacaagcaca gggaatgccg gagccggggt ggggaaggat caccgattca 720 caccagtgga acaccttgct aagtttgcat aacgcgcaat tttatttgct acaacgcacg 780 ccagaggttg cccgcagccg cgccaccccg ttattagatt tgatcaagac agcgttgacg 840 ccccatccac cgcaaaaaca ggcgtatggt gtgacattac ccacttcagt gctgtttatc 900 gccggacacg atactaatct ggcaaatctc ggcggcgcac tggagctcaa ctggacgctt 960 cccggtcagc cggataacac gccgccaggt ggtgaactgg tgtttgaacg ctggcgtcgg 1020 ctaagcgata acagccagtg gattcaggtt tcgctggtct tccagacttt acagcagatg 1080 cgtgataaaa cgccgctgtc attaaatacg ccgcccggag aggtgaaact gaccctggca 1140 ggatgtgaag agcgaaatgc gcagggcatg tgttcgttgg caggttttac gcaaatcgtg 1200 aatgaagcac gcataccggc gtgcagtttg 1230 <210> 5 <211> 410 <212> PRT <213> Artificial Sequence <220> <223> EPM2(Q134E) AA <400 > 5 Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val 100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Glu Leu Asp Asn Ala Asn Val Thr Asp Ala Ile 130 135 140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser 225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 <210> 6 < 211> 1230 <212> DNA <213> Artificial Sequence <220> <223> EPM2(Q134E) NT <400> 6 cagagtgagc cggagctgaa gctggaaagt gtggtgattg tcagtcgtca tggtgtgcgt 60 gctccaacca aggccacgca actgatgcag gatgtcaccc cagacgcatg gccaacctgg 120 ccggtaaaac tgggttggct gacaccgcgc ggtggtgagc taatcgccta tctcggacat 180 taccaacgcc agcgtctggt agccgacgga ttgctggcga aaaagggctg cccgcagtct 240 ggtcaggtcg cgattattgc tgatgtcgac gagcgtaccc gtaaaacagg cgaagccttc 300 gccgccgggc tggcacctga ctgtgcaata accgtacata cccaggcaga tacgtccagt 360 cccgatccgt tatttaatcc tctaaaaact ggcgtttgcg aactggataa cgcgaacgtg 420 actgacgcga tcctcagcag ggcaggaggg tcaattgctg actttaccgg gcatcggcaa 480 acggcgtttc gcgaactgga acgggtgctt aattttccgc aatcaaactt gtgccttaaa 540 cgtgagaaac aggacgaaag ctgttcatta acgcaggcat taccatcgga actcaaggtg 600 agcgccgaca atgtctcatt aaccggtgcg gtaagcctcg catcaatgct gacggagata 660 tttctcctgc aacaagcaca gggaatgccg gagccggggt ggggaaggat caccgattca 720 caccagtgga acaccttgct aagtttgcat aacgcgcaat tttatttgct acaacgcacg 780 ccagaggttg cccgcagccg cgccaccccg ttattagatt tgatcaagac agcgttgacg 840 ccccatccac cgcaaaaaca ggcgtatggt gtgacattac ccacttcagt gctgtttatc 900 gccggacacg atactaatct ggcaaatctc ggcggcgcac tggagctcaa ctggacgctt 960 cccggtcagc cggataacac gccgccaggt ggtgaactgg tgtttgaacg ctggcgtcgg 1020 ctaagcgata acagccagtg gattcaggtt tcgctggtct tccagacttt acagcagatg 1080 cgtgataaaa cgccgctgtc attaaatacg ccgcccggag aggtgaaact gaccctggca 1140 ggatgtgaag agcgaaatgc gcagggcatg tgttcgttgg caggttttac gcaaatcgtg 1200 aatgaagcac gcataccggc gtgcagtttg 1230 <210> 7 <211> 410 <212> PRT <213> Artificial Sequence <220> <223> EPM3(N137H) AA < 400>7 Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Asp Gly Leu Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val 100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Gln Leu Asp His Ala Asn Val Thr Asp Ala Ile 130 135 140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser 225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 <210> 8 <211> 1230 <212> DNA <213> Artificial Sequence <220> <223> EPM3(N137H) NT <400> 8 cagagtgagc cggagctgaa gctggaaagt gtggtgattg tcagtcgtca tggtgtgcgt 60 gctccaacca aggccacgca actgatgcag gatgtcaccc cagacgcatg gccaacctgg 120 ccggtaaaac tgggttggct gacaccgcgc ggtggtgagc taatcgccta tctcggacat 180 taccaacgcc agcgtctggt agccgacgga ttgctggcga aaaagggctg cccgcagtct 240 ggtcaggtcg cgattattgc tgatgtcgac gagcgtaccc gtaaaacagg cgaagccttc 300 gccgccgggc tggcacctga ctgtgcaata accgtacata cccaggcaga tacgtccagt 360 cccgatccgt tatttaatcc tctaaaaact ggcgtttgcc aactggatca tgcgaacgtg 420 actgacgcga tcctcagcag ggcaggaggg tcaattgctg actttaccgg gcatcggcaa 480 acggcgtttc gcgaactgga acgggtgctt aattttccgc aatcaaactt gtgccttaaa 540 cgtgagaaac aggacgaaag ctgttcatta acgcaggcat taccatcgga actcaaggtg 600 agcgccgaca atgtctcatt aaccggtgcg gtaagcctcg catcaatgct gacggagata 660 tttctcctgc aacaagcaca gggaatgccg gagccggggt ggggaaggat caccgattca 720 caccagtgga acaccttgct aagtttgcat aacgcgcaat tttatttgct acaacgcacg 780 ccagaggttg cccgcagccg cgccaccccg ttattagatt tgatcaagac agcgttgacg 840 ccccatccac cgcaaaaaca ggcgtatggt gtgacattac ccacttcagt gctgtttatc 900 gccggacacg atactaatct ggcaaatctc ggcggcgcac tggagctcaa ctggacgctt 960 cccggtcagc cggataacac gccgccaggt ggtgaactgg tgtttgaacg ctggcgtcgg 1020 ctaagcgata acagccagtg gattcaggtt tcgctggtct tccagacttt acagcagatg 1080 cgtgataaaa cgccgctgtc attaaatacg ccgcccggag aggtgaaact gaccctggca 1140 ggatgtgaag agcgaaatgc gcagggcatg tgttcgttgg caggttttac gcaaatcgtg 1200 aatgaagcac gcataccggc gtgcagtttg 1230 <210> 9 <211> 410 <212> PRT <213> Artificial Sequence <220> <223> EPM4(R164S) AA <400> 9 Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val 100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile 130 135 140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala Phe Ser Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser 225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 <210> 10 <211> 1230 <212> DNA <213> Artificial Sequence <220> <223> EPM4(R164S) NT <400> 10 cagagtgagc cggagctgaa gctggaaagt gtggtgattg tcagtcgtca tggtgtgcgt 60 gctccaacca aggccacgca actgatgcag gatgtcaccc cagacgcatg gccaacctgg 120 ccggtaaaac tgggttggct gacaccgcgc ggtggtgagc taatcgccta tctcggacat 180 taccaacgcc agcgtctggt agccgacgga ttgctggcga aaaagggctg cccgcagtct 240 ggtcaggtcg cgattattgc tgatgtcgac gagcgtaccc gtaaaacagg cgaagccttc 300 gccgccgggc tggcacctga ctgtgcaata accgtacata cccaggcaga tacgtccagt 360 cccgatccgt tatttaatcc tctaaaaact ggcgtttgcc aactggataa cgcgaacgtg 420 actgacgcga tcctcagcag ggcaggaggg tcaattgctg actttaccgg gcatcggcaa 480 acggcgttta gcgaactgga acgggtgctt aattttccgc aatcaaactt gtgccttaaa 540 cgtgagaaac aggacgaaag ctgttcatta acgcaggcat taccatcgga actcaaggtg 600 agcgccgaca atgtctcatt aaccggtgcg gtaagcctcg catcaatgct gacggagata 660 tttctcctgc aacaagcaca gggaatgccg gagccggggt ggggaaggat caccgattca 720 caccagtgga acaccttgct aagtttgcat aacgcgcaat tttatttgct acaacgcacg 780 ccagaggttg cccgcagccg cgccaccccg ttattagatt tgatcaagac agcgttgacg 840 ccccatccac cgcaaaaaca ggcgtatggt gtgacattac ccacttcagt gctgtttatc 900 gccggacacg atactaatct ggcaaatctc ggcggcgcac tggagctcaa ctggacgctt 960 cccggtcagc cggataacac gccgccaggt ggtgaactgg tgtttgaacg ctggcgtcgg 1020 ctaagcgata acagccagtg gattcaggtt tcgctggtct tccagacttt acagcagatg 1080 cgtgataaaa cgccgctgtc attaaatacg ccgcccggag aggtgaaact gaccctggca 1140 ggatgtgaag agcgaaatgc gcagggcatg tgttcgttgg caggttttac gcaaatcgtg 1200 aatgaagcac gcataccggc gtgcagtttg 1230 <210> 11 <211> 410 <212> PRT <213> Artificial Sequence <220> <223> EPM08 Phy AA <400> 11 Gln Ser Glu Pro Glu Leu Gln Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Ala Glu Leu Ile Lys Tyr Met Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Gln Gly Leu Leu Ala Lys Lys Gly Cys Pro Ala Ser 65 70 75 80 Gly Gln Val Phe Ile Ile Ala Asp Val Asp Gln Arg Thr Arg Ala Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Gly Cys Ala Ile Thr Val 100 105 110 His Thr Gln Pro Asp Gly Ser Met Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Lys Leu Asp Arg Ala Asn Val Thr Ala Ala Ile 130 135 140 Leu Ala Arg Ala Gly Gly Ser Ile Ala Arg Trp Thr Gln His Arg Gln 145 150 155 160 Pro Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Gln Lys Arg Glu Lys Gln Asn Glu Ser Cys Ser Leu Thr Gln 180 185 190 Met Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Leu Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Trp Ala Glu Gly Met Pro Gln Pro Gly Trp Gly Arg Ile Thr Asp Glu 225 230 235 240 His Gln Trp Arg Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Arg Arg Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Leu Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Gly Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Asp Arg Lys Asp Asn Ser Gln Trp Ile Arg Val Ser Phe 340 345 350 Val Phe Gln Thr Leu Asp Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn His Pro Pro Gly Glu Val Thr Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Gln Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 <210> 12 <211> 1233 <212> DNA <213> Artificial Sequence <220> <223> EPM08 Phy NT <400> 12 caaagtgagc cagagctaca gcttgagagt gtggtcatcg tttctcgtca tagca gggtccg 60 aggctaccca gttgatgcag gacgtgaccc cagatccttg gccaacatgg 120 cctgtaaagc tgggttggct gacacctaga ggcgccgagc tgataaaata catgggtcat 180 tatcagcgtc agagactagt agctcaggga ttgctagcga aaaaaggctg ccccgcttct 240 ggccaagtgt tcattatcgc tgacgttgat caaagaacga gagccacggg tgaagccttt 300 gctgccggct tggctcccgg ctgcgcaatt acggtccaca cgcagcccga cggcagtatg 360 cccgatcccc tttttaatcc attaaagacg ggcgtgtgta aattagatcg tgccaacgtt 420 actgctgcaa ttttagcacg tgctggaggc tctattgcca gatggacgca acataggcaa 480 cccgccttta gagaattaga aagggtgttg aactttcctc agagtaattt gtgccaaaag 540 cgtgagaaac agaacgagag ctgttcctta acgcaaatgt taccaagtga gctaaaagta 600 tcagccgaca acgtctcact gactggtgca ctatcattag ccagtatgct aacagaaata 660 tttctacttc aatgggctga gggtatgcca cagccaggtt ggggcagaat caccgatgaa 720 caccaatggc gtacccttct gtcccttcat aatgctcagt tctatctgtt gcaaagaact 780 ccagaggtag ctagacgtcg tgctacaccc cttctggatt tgattttaac ggcactgaca 840 cctcatcctc cccaaaagca ggcttacggt gtaactttgc caacgtctgt cttgtttata 900 gcaggacacg acacgaactt ggccaatctt ggcggtgccc ttggactaaa ttggacgctg 960 ccaggtcagc ctgacaacac acccccaggc ggcgagttag tattcgagag atggagagac 1020 cgtaaagata actcccagtg gatcagggtt tcctttgttt tccagacgct agaccaaatg 1080 cgtgataaga cgcctctaag tcttaatcac cctccaggcg aagtcactct aacactagca 1140 ggatgtgaag aacgtaatgc acaaggtatg tgtagtctag caggttttca gcaaatcgtc 1200 aatgaagcaa gaatcccagc ctgctcactt taa 1233 <210> 13 <211> 410 <212> PRT < 213> Artificial Sequence <220> <223> EPM08 Phy A109E AA <400> 13 Gln Ser Glu Pro Glu Leu Gln Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Ala Glu Leu Ile Lys Tyr Met Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Gln Gly Leu Leu Ala Lys Lys Gly Cys Pro Ala Ser 65 70 75 80 Gly Gln Val Phe Ile Ile Ala Asp Val Asp Gln Arg Thr Arg Ala Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Gly Cys Glu Ile Thr Val 100 105 110 His Thr Gln Pro Asp Gly Ser Met Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Lys Leu Asp Arg Ala Asn Val Thr Ala Ala Ile 130 135 140 Leu Ala Arg Ala Gly Gly Ser Ile Ala Arg Trp Thr Gln His Arg Gln 145 150 155 160 Pro Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Gln Lys Arg Glu Lys Gln Asn Glu Ser Cys Ser Leu Thr Gln 180 185 190 Met Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Leu Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Trp Ala Glu Gly Met Pro Gln Pro Gly Trp Gly Arg Ile Thr Asp Glu 225 230 235 240 His Gln Trp Arg Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Arg Arg Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Leu Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Gly Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Asp Arg Lys Asp Asn Ser Gln Trp Ile Arg Val Ser Phe 340 345 350 Val Phe Gln Thr Leu Asp Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn His Pro Pro Gly Glu Val Thr Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Gln Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 <210> 14 <211> 1233 <212> DNA <213> Artificial Sequence <220> <223> EPM08 Phy A109E NT <400> 14 caaagtgagc cagagctaca gcttgagagt gtggtcatcg tttctcgtca tggtgtca60 gccgcca aggctaccca gttgatgcag gacgtgaccc cagatccttg gccaacatgg 120 cctgtaaagc tgggttggct gacacctaga ggcgccgagc tgataaaata catgggtcat 180 tatcagcgtc agagactagt agctcaggga ttgctagcga aaaaaggctg ccccgcttct 240 ggccaagtgt tcattatcgc tgacgttgat caaagaacga gagccacggg tgaagccttt 300 gctgccggct tggctcccgg ctgcgaaatt acggtccaca cgcagcccga cggcagtatg 360 cccgatcccc tttttaatcc attaaagacg ggcgtgtgta aattagatcg tgccaacgtt 420 actgctgcaa ttttagcacg tgctggaggc tctattgcca gatggacgca acataggcaa 480 cccgccttta gagaattaga aagggtgttg aactttcctc agagtaattt gtgccaaaag 540 cgtgagaaac agaacgagag ctgttcctta acgcaaatgt taccaagtga gctaaaagta 600 tcagccgaca acgtctcact gactggtgca ctatcattag ccagtatgct aacagaaata 660 tttctacttc aatgggctga gggtatgcca cagccaggtt ggggcagaat caccgatgaa 720 caccaatggc gtacccttct gtcccttcat aatgctcagt tctatctgtt gcaaagaact 780 ccagaggtag ctagacgtcg tgctacaccc cttctggatt tgattttaac ggcactgaca 840 cctcatcctc cccaaaagca ggcttacggt gtaactttgc caacgtctgt cttgtttata 900 gcaggacacg acacgaactt ggccaatctt ggcggtgccc ttggactaaa ttggacgctg 960 ccaggtcagc ctgacaacac acccccaggc ggcgagttag tattcgagag atggagagac 1020 cgtaaagata actcccagtg gatcagggtt tcctttgttt tccagacgct agaccaaatg 1080 cgtgataaga cgcctctaag tcttaatcac cctccaggcg aagtcactct aacactagca 1140 ggatgtgaag aacgtaatgc acaaggtatg tgtagtctag caggttttca gcaaatcgtc 1200 aatgaagcaa gaatcccagc ctgctcactt taa 1233 <210> 15 <211> 410 <212> PRT < 213> Artificial Sequence <220> <223> EPM08 Phy R137H AA <400> 15 Gln Ser Glu Pro Glu Leu Gln Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Ala Glu Leu Ile Lys Tyr Met Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Gln Gly Leu Leu Ala Lys Lys Gly Cys Pro Ala Ser 65 70 75 80 Gly Gln Val Phe Ile Ile Ala Asp Val Asp Gln Arg Thr Arg Ala Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Gly Cys Ala Ile Thr Val 100 105 110 His Thr Gln Pro Asp Gly Ser Met Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Lys Leu Asp His Ala Asn Val Thr Ala Ala Ile 130 135 140 Leu Ala Arg Ala Gly Gly Ser Ile Ala Arg Trp Thr Gln His Arg Gln 145 150 155 160 Pro Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Gln Lys Arg Glu Lys Gln Asn Glu Ser Cys Ser Leu Thr Gln 180 185 190 Met Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Leu Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Trp Ala Glu Gly Met Pro Gln Pro Gly Trp Gly Arg Ile Thr Asp Glu 225 230 235 240 His Gln Trp Arg Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Arg Arg Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Leu Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Gly Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Asp Arg Lys Asp Asn Ser Gln Trp Ile Arg Val Ser Phe 340 345 350 Val Phe Gln Thr Leu Asp Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn His Pro Pro Gly Glu Val Thr Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Gln Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 <210> 16 <211> 1233 <212> DNA <213> Artificial Sequence < 220> <223> EPM08 Phy R137H NT <400> 16 caaagtgagc cagagctaca gcttgagagt gtggtcatcg tttctcgtca tggtgtccgt 60 gcaccaacaa aggctaccca gttgatgcag gacgtgaccc cagatccttg gccaacatgg 120 cctgtaaagc tgggttggct gacacctaga ggcgccgagc tgataaaata catgggtcat 180 tatcagcgtc agagactagt agctcaggga ttgctagcga aaaaaggctg ccccgcttct 240 ggccaagtgt tcattatcgc tgacgttgat caaagaacga gagccacggg tgaagccttt 300 gctgccggct tggctcccgg ctgcgcaatt acggtccaca cgcagcccga cggcagtatg 360 cccgatcccc tttttaatcc attaaagacg ggcgtgtgta aattagatca tgccaacgtt 420 actgctgcaa ttttagcacg tgctggaggc tctattgcca gatggacgca acataggcaa 480 cccgccttta gagaattaga aagggtgttg aactttcctc agagtaattt gtgccaaaag 540 cgtgagaaac agaacgagag ctgttcctta acgcaaatgt taccaagtga gctaaaagta 600 tcagccgaca acgtctcact gactggtgca ctatcattag ccagtatgct aacagaaata 660 tttctacttc aatgggctga gggtatgcca cagccaggtt ggggcagaat caccgatgaa 720 caccaatggc gtacccttct gtcccttcat aatgctcagt tctatctgtt gcaaagaact 780 ccagaggtag ctagacgtcg tgctacaccc cttctggatt tgattttaac ggcactgaca 840 cctcatcctc cccaaaagca ggcttacggt gtaactttgc caacgtctgt cttgtttata 900 gcaggacacg acacgaactt ggccaatctt ggcggtgccc ttggactaaa ttggacgctg 960 ccaggtcagc ctgacaacac acccccaggc ggcgagttag tattcgagag atggagagac 1020 cgtaaagata actcccagtg gatcagggtt tcctttgttt tccagacgct agaccaaatg 1080 cgtgataaga cgcctctaag tcttaatcac cctccaggcg aagtcactct aacactagca 1140 ggatgtgaag aacgtaatgc acaaggtatg tgtagtctag caggttttca gcaaatcgtc 1200 aatgaagcaa gaatcccagc ctgctcactt taa 1233 <210> 17 <211> 410 <212> PRT <213> Artificial Sequence <220> <223> EPM08 Phy EPM08M2(K134E+R164S) AA Glun Pro Glun Ser Glun Ser Glun <400> 17 Guln Gln Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Ala Glu Leu Ile Lys Tyr Met Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Gln Gly Leu Leu Ala Lys Lys Gly Cys Pro Ala Ser 65 70 75 80 Gly Gln Val Phe Ile Ile Ala Asp Val Asp Gln Arg Thr Arg Ala Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Gly Cys Ala Ile Thr Val 100 105 110 His Thr Gln Pro Asp Gly Ser Met Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Glu Leu Asp Arg Ala Asn Val Thr Ala Ala Ile 130 135 140 Leu Ala Arg Ala Gly Gly Ser Ile Ala Arg Trp Thr Gln His Arg Gln 145 150 155 160 Pro Ala Phe Ser Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Gln Lys Arg Glu Lys Gln Asn Glu Ser Cys Ser Leu Thr Gln 180 185 190 Met Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Leu Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Trp Ala Glu Gly Met Pro Gln Pro Gly Trp Gly Arg Ile Thr Asp Glu 225 230 235 240 His Gln Trp Arg Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Arg Arg Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Leu Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Gly Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Asp Arg Lys Asp Asn Ser Gln Trp Ile Arg Val Ser Phe 340 345 350 Val Phe Gln Thr Leu Asp Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn His Pro Pro Gly Glu Val Thr Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Gln Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 <210> 18 <211> 1233 <212> DNA < 213> Artificial Sequence <220> <223> EPM08 Phy EPM08M2(K134E+R164S) NT <400> 18 caaagtgagc cagagctaca gcttgagagt gtggtcatcg tttctcgtca tggtgtccgt 60 gcaccaacaa aggctaccca gttgatgcag gacgtgaccc cagatccttg gccaacatgg 120 cctgtaaagc tgggttggct gacacctaga ggcgccgagc tgataaaata catgggtcat 180 tatcagcgtc agagactagt agctcaggga ttgctagcga aaaaaggctg ccccgcttct 240 ggccaagtgt tcattatcgc tgacgttgat caaagaacga gagccacggg tgaagccttt 300 gctgccggct tggctcccgg ctgcgcaatt acggtccaca cgcagcccga cggcagtatg 360 cccgatcccc tttttaatcc attaaagacg ggcgtgtgtg aattagatcg tgccaacgtt 420 actgctgcaa ttttagcacg tgctggaggc tctattgcca gatggacgca acataggcaa 480 cccgccttta gcgaattaga aagggtgttg aactttcctc agagtaattt gtgccaaaag 540 cgtgagaaac agaacgagag ctgttcctta acgcaaatgt taccaagtga gctaaaagta 600 tcagccgaca acgtctcact gactggtgca ctatcattag ccagtatgct aacagaaata 660 tttctacttc aatgggctga gggtatgcca cagccaggtt ggggcagaat caccgatgaa 720 caccaatggc gtacccttct gtcccttcat aatgctcagt tctatctgtt gcaaagaact 780 ccagaggtag ctagacgtcg tgctacaccc cttctggatt tgattttaac ggcactgaca 840 cctcatcctc cccaaaagca ggcttacggt gtaactttgc caacgtctgt cttgtttata 900 gcaggacacg acacgaactt ggccaatctt ggcggtgccc ttggactaaa ttggacgctg 960 ccaggtcagc ctgacaacac acccccaggc ggcgagttag tattcgagag atggagagac 1020 cgtaaagata actcccagtg gatcagggtt tcctttgttt tccagacgct agaccaaatg 1080 cgtgataaga cgcctctaag tcttaatcac cctccaggcg aagtcactct aacactagca 1140 ggatgtgaag aacgtaatgc acaaggtatg tgtagtctag caggttttca gcaaatcgtc 1200 aatgaagcaa gaatcccagc ctgctcactt taa 1233 <210> 19 <211> 410 <212> PRT <213> Artificial Sequence <220> <223> EPM08 Phy EPM08M4(A109E+K134E+R137H +R164S) AA <400> 19 Gln Ser Glu Pro Glu Leu Gln Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Ala Glu Leu Ile Lys Tyr Met Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Gln Gly Leu Leu Leu Ala Lys Lys Gly Cys Pro Ala Ser 65 70 75 80 Gly Gln Val Phe Ile Ile Ala Asp Val Asp Gln Arg Thr Arg Ala Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Gly Cys Glu Ile Thr Val 100 105 110 His Thr Gln Pro Asp Gly Ser Met Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Glu Leu Asp His Ala Asn Val Thr Ala Ala Ile 130 135 140 Leu Ala Arg Ala Gly Gly Ser Ile Ala Arg Trp Thr Gln His Arg Gln 145 150 155 160 Pro Ala Phe Ser Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Gln Lys Arg Glu Lys Gln Asn Glu Ser Cys Ser Leu Thr Gln 180 185 190 Met Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Leu Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Trp Ala Glu Gly Met Pro Gln Pro Gly Trp Gly Arg Ile Thr Asp Glu 225 230 235 240 His Gln Trp Arg Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Arg Arg Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Leu Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Gly Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Asp Arg Lys Asp Asn Ser Gln Trp Ile Arg Val Ser Phe 340 345 350 Val Phe Gln Thr Leu Asp Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn His Pro Pro Gly Glu Val Thr Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Gln Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 <210> 20 <211> 1233 <212> DNA <213> Artificial Sequence <220> <223> EPM08 Phy EPM08M4(A109E+K134E+R137H+R164S) NT <400> 20 caaagtgagc cagagctaca gcttgagagt gtggtcatcg tttctcgtca tggtgtccgt 60 gcaccaacaa aggctaccca gttgatgcag gacgtgaccc cagatccttg gccaacatgg 120 cctgtaaagc tgggttggct gacacctaga ggcgccgagc tgataaaata catgggtcat 180 tatcagcgtc agagactagt agctcaggga ttgctagcga aaaaaggctg ccccgcttct 240 ggccaagtgt tcattatcgc tgacgttgat caaagaacga gagccacggg tgaagccttt 300 gctgccggct tggctcccgg ctgcgaaatt acggtccaca cgcagcccga cggcagtatg 360 cccgatcccc tttttaatcc attaaagacg ggcgtgtgtg aattagatca tgccaacgtt 420 actgctgcaa ttttagcacg tgctggaggc tctattgcca gatggacgca acataggcaa 480 cccgccttta gcgaattaga aagggtgttg aactttcctc agagtaattt gtgccaaaag 540 cgtgagaaac agaacgagag ctgttcctta acgcaaatgt taccaagtga gctaaaagta 600 tcagccgaca acgtctcact gactggtgca ctatcattag ccagtatgct aacagaaata 660 tttctacttc aatgggctga gggtatgcca cagccaggtt ggggcagaat caccgatgaa 720 caccaatggc gtacccttct gtcccttcat aatgctcagt tctatctgtt gcaaagaact 780 ccagaggtag ctagacgtcg tgctacaccc cttctggatt tgattttaac ggcactgaca 840 cctcatcctc cccaaaagca ggcttacggt gtaactttgc caacgtctgt cttgtttata 900 gcaggacacg acacgaactt ggccaatctt ggcggtgccc ttggactaaa ttggacgctg 960 ccaggtcagc ctgacaacac acccccaggc ggcgagttag tattcgagag atggagagac 1020 cgtaaagata actcccagtg gatcagggtt tcctttgttt tccagacgct agaccaaatg 1080 cgtgataaga cgcctctaag tcttaatcac cctccaggcg aagtcactct aacactagca 1140 ggatgtgaag aacgtaatgc acaaggtatg tgtagtctag caggttttca gcaaatcgtc 1200 aatgaagcaa gaatcccagc ctgctcactt taa 1233 <210> 21 <211> 50 <212> DNA <213 > Artificial Sequence <220> <223> A109E Forward <400> 21 ggctggcacc tgactgtgaa ataaccgtac atacccaggc agatacgtcc 50 <210> 22 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> A109E Reverse <400> 22 ttcacagtca ggtgccagcc cggcggcgaa ggcttcg 37 <210> 23 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Q134E Forward <400> 23 aaaaactggc gtttgcgaac tggataacgc gaacgtgact <2021> 112 44 <2021> > DNA <213> Artificial Sequence <220> <223> Q134E Reverse <400> 24 ttcgcaaacg ccagttttta gaggattaaa taacggatcg ggactggacg 50 <210> 25 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> N137H Forward <400> 25 cgtttgccaa ctggatcacg cgaacgtgac tgacgcgatc c 41 <210> 26 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> N137H Reverse <400> 26 gtgatccagt tggcaaacgc cagttttt 50 aggattagggaat a0 <aggattaggaat> 211> 44 <212> DNA <213> Artificial Sequence <220> <223> R164S Forward <400> 27 ggcaaacggc gtttagcgaa ctggaacggg tgcttaattt tccg 44 <210> 28 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> R164S Reverse <400> 28 gctaaacgcc gtttgccgat gcccggtaaa gtcagcaatt gacc 44 <210> 29 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> A109E Forward <400> 29 ggctgcgaaa ttacg ggt3cca c 210> 30 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> A109E Reverse <400> 30 gaccgtaatt tcgcagccgg gagccaagcc ggcag 35 <210> 31 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> K134E Forward <400> 31 agacgggcgt gtgtgaatta gatcgtgcca acgttactgc tgc 43 <210> 32 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> K134E Reverse <400> 32 ttcacac atg cattccgtacta DNA <213> Artificial Sequence <220> <223> R164S Reverse <400> 34 gctaaaggcg ggttgcctat gttgcgtcca tctggcaata gagc 44 <210> 35 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> R137H Forward <400> 35 tgtgtaaatt agatcatgcc aacgttactg ctgcaatttt agcac2g2019 <4gt18> <223> 212> DNA <213> Artificial Sequence <220> <223> R137H Reverse <400> 36 ggcatgatct aatttacaca cgcccgtctt taatggatta aaaagggg 48 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer_F <400> 37 agagaggctg aagctcaatc tgaattgcaa 30 <210> 38 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer_R<400> 38 aaggctacaa actcacaaag aacaagctgg aattctag 38

Claims (16)

As a variant polypeptide having phytase activity,
i) the variant polypeptide has 70% or more and less than 100% sequence identity with SEQ ID NO: 1 or an amino acid sequence having 90% or more sequence identity therewith; and/or
ii) the variant polypeptide is a polypeptide encoded by a polynucleotide having at least 70% and less than 100% sequence identity with a sequence encoding a mature polypeptide of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity therewith; and/or
iii) the variant polypeptide is (a) a mature polypeptide coding sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity therewith, (b) a cDNA thereof, or (c) the full length of (a) or (b) above A polypeptide encoded by a polynucleotide that hybridizes to a full-length complement under low, medium, high, medium, high, or very high stringency conditions; and/or
iv) the variant polypeptide is a functional fragment of i), ii) or iii) polypeptide having phytase activity; and
A variant polypeptide comprising any one of the modifications selected from the following:
Deletion of amino acids at positions 109, 134, 137, 164 and combinations thereof, insertion of amino acids, substitution with other amino acids, and combinations thereof;
Here, the position number is a position corresponding to the position of the polypeptide of SEQ ID NO: 1.
According to claim 1, amino acid number 109 before modification of the variant polypeptide having phytase activity is alanine (A); Amino acid 134 is glutamine (Q) or lysine (K); amino acid 137 is asparagine (N) or arginine (R); And / or amino acid number 164 is arginine (R), the mutant polypeptide.
The variant polypeptide according to claim 1, wherein the variant polypeptide comprises a modification of an amino acid at a position selected from the following i) to xv);
i) No. 109;
ii) No. 134;
iii) No. 137;
iv) No. 164;
v) No. 109+134;
vi) No. 109+137;
vii) No. 109+164;
viii) times 134+137;
ix) No. 134+164;
x) No. 137+164;
xi) No. 109+134+137;
xii) No. 109+134+164;
xiii) No. 109+137+164;
xiv) No. 134+137+164; and
xv) No. 109+134+137+164;
Here, the position number is a position corresponding to the position of the polypeptide of SEQ ID NO: 1.
The variant polypeptide according to claim 1, wherein the variant polypeptide comprises substitution of one or more of the following i) to iv);
i) substitution of amino acid 109 with glutamic acid;
ii) substitution of amino acid 134 with glutamic acid;
iii) substitution of amino acid 137 with histidine; and
iv) by substitution of amino acid position 164 with serine,
Here, the position number is a position corresponding to the position of the polypeptide of SEQ ID NO: 1.
The variant polypeptide according to claim 1, wherein the variant polypeptide comprises any one or more modifications selected from the following:
A109E;
Q134E or K134E;
N137H or R137H;
R164S;
A109E+Q134E or A109E+K134E;
A109E+N137H or A109E+R137H;
A109E+R164S;
Q134E+N137H or K134E+R137H;
Q134E+R164S or K134E+R164S;
N137H+R164S or R137H+R164S;
A109E+Q134E+N137H or A109E+K134E+R137H;
A109E+Q134E+R164S or A109E+K134E+R164S;
A109E+N137H+R164S or A109E+R137H+R164S;
Q134E+N137H+R164S or K134E+R137H+R164S; and
A109E+Q134E+N137H+R164S or A109E+K134E+R137H+R164S.
The method of claim 1, wherein the variant polypeptide has at least one of the following i) to vii) altered characteristics compared to a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 90% or more sequence identity therewith, Variant Polypeptide:
i) increased enzyme activity;
ii) increased specific activity; and
iii) increased heat resistance.
A composition comprising the variant polypeptide of any one of claims 1 to 6.
A composition for reaction comprising the variant polypeptide or the variant polypeptide according to any one of claims 1 to 6 for reaction with phytin.
A hydrolyzate of phytin, comprising contacting phytin with the variant polypeptide of any one of claims 1 to 6, a host cell expressing the variant polypeptide, and/or a composition comprising the variant polypeptide How to manufacture.
A method for hydrolyzing phytin, comprising treating a substrate with the variant polypeptide of any one of claims 1 to 6, a host cell expressing the variant polypeptide, and/or a composition comprising the variant polypeptide. .
A polynucleotide encoding the variant polypeptide of any one of claims 1 to 6.
A nucleic acid construct comprising the polynucleotide of claim 11.
A vector comprising the polynucleotide of claim 11 or the nucleic acid construct of claim 12.
A host cell comprising the variant polypeptide according to any one of claims 1 to 6, the polynucleotide according to claim 11, the nucleic acid construct according to claim 12, and/or the vector according to claim 13.
A method for producing a variant polypeptide having phytase activity, comprising culturing the host cell of claim 14.
The method of claim 15, further comprising the step of recovering the variant polypeptide having the phytase activity of any one of claims 1 to 6 expressed in the culturing step, producing a variant polypeptide having Tase activity method.

Images