KR20230040069A - Kit for evaluation of bisulfite conversion and method for evaluation using the same - Google Patents

Abstract

In the specification, provided is a method for evaluating bisulfite conversion, comprising: a step of extracting gDNA from a biological sample isolated from an individual; a step of obtaining BS DNA by treating the extracted gDNA with bisulfite (BS); a step of amplifying the extracted gDNA and BS DNA using a kit containing a first primer designed to generate a first amplicon, a second primer designed to generate a second amplicon having a different size than the first amplicon, a first probe which detects cytosine in the DNA sequence of the first amplicon, a second probe which detects thymine at the same position as cytosine, and a third probe which does not contain cytosine; a step of quantifying the amplified gDNA and BS-DNA based on the Ct value for amplification, and a step of calculating conversion efficiency based on quantified gDNA and BS DNA. Accordingly, the present invention can confirm conversion efficiency, degradation level, and yield all through a single PCR amplification process.

Description

Bisulfite conversion evaluation kit and evaluation method using the same {KIT FOR EVALUATION OF BISULFITE CONVERSION AND METHOD FOR EVALUATION USING THE SAME}

The present invention relates to a kit for evaluating bisulfite conversion and an evaluation method using the same.

Epigenetics means that gene expression is controlled by acquired modifications such as methylation of DNA and acetylation of histone proteins without alteration of DNA base sequence, and the phenomenon is It means a phenomenon that is maintained to the next generation.

Among these, DNA methylation is involved in suppression of gene expression. More specifically, there are a large amount of double nucleotide sequences called CpG in the human genome, and about 70% of them have a methyl group (-CH3) bound to the cytosine base of CpG. is called DNA methylation.

This DNA methylation phenomenon is commonly observed in various anti-Buck sequences of the genome, and plays an important role in maintaining the stability of the genome. On the other hand, there is a unique region in which CpG is concentrated at the upper 5' regulatory region of various genes, which is called a CpG island, and most of the cytosines in various CpG regions including the CpG island are not bound to methyl groups. However, due to various acquired influences, methyl groups are bound (methylated) to cytosine, leading to changes in the structure of chromatin through interaction with nucleosome histone molecules, eventually affecting gene expression. will give

As described above, DNA methylation affects gene expression regulation without changing the basic DNA sequence, and has different patterns depending on tissue or cell, and the pattern varies depending on age and lifestyle . That is, as DNA methylation is a characteristic that is differentiated for each individual, it is possible to estimate the age and lifestyle of each individual through this.

Accordingly, the measurement of DNA methylation is widely used in the forensic field to estimate the origin of various evidence found at crime scenes and the physical characteristics of criminals, and most DNA methylation measurement methods require conversion using bisulfite. am.

However, as the bisulfite conversion method causes chemical deamination during the conversion process, it causes structural damage, that is, degradation and loss of DNA, which may hinder further downstream analysis of the same sample. There are limits to what can be done.

In addition, the bisulfite conversion method may cause exaggeration of DNA methylation levels, resulting in unreliable results. Accordingly, in order to measure DNA methylation with high reliability, a new method capable of calibrating the bisulfite conversion method or measuring conversion efficiency, repair level, and degradation level is required.

The background description of the invention has been prepared to facilitate understanding of the present invention. It should not be construed as an admission that matters described in the background art of the invention exist as prior art.

Conventionally, two or more methods have been used to quantify the degree of bisulfite change, degree of decomposition, and yield, and some methods have been difficult to quantitatively evaluate.

Meanwhile, the inventors of the present invention recognized that a specific bisulfite conversion region can be quantified when two regions (target regions) of different amplification sizes are simultaneously quantified. For example, when the bisulfite conversion method is performed based on an amplicon having a size of 110 bp or less and an amplicon having a size of 170 bp or more, respectively, bisulfite-converted DNA at once without two or more cumbersome processes It was found that not only the quantification of and the degree of bisulfite conversion could be confirmed, but also the efficiency, degree of decomposition, and yield of the bisulfite conversion process could all be confirmed.

As a result, the inventors of the present invention have developed a kit including two or more primers and probes capable of quantitatively measuring bisulfite conversion efficiency, yield, and degree of degradation for DNA methylation measurement, and a kit capable of evaluating bisulfite conversion based thereon. I wanted to provide a way.

The tasks of the present invention are not limited to the tasks mentioned above, and other tasks not mentioned will be clearly understood by those skilled in the art from the following description.

In order to solve the above problems, according to an embodiment of the present invention, the present invention comprises the steps of extracting genomic DNA (gDNA) from a biological sample isolated from an individual; Obtaining BS DNA by treating the extracted gDNA with bisulfite (BS); A first primer designed to generate a first amplicon, a second primer designed to generate a second amplicon having a different size from the first amplicon, and cytosine in the DNA sequence of the first amplicon ( cytosine), a second probe that detects thymine at the same position as cytosine, and a third probe that detects a sequence that does not contain cytosine among the DNA sequences of the second amplicon. Amplifying the extracted gDNA and BS DNA using a kit that does; Based on the Ct value for amplification, quantifying gDNA and BS-DNA, and calculating conversion efficiency, degradation level and recovery based on the quantified gDNA and BS DNA It provides a method for evaluating bisulfite conversion, comprising the steps.

According to a feature of the present invention, the first primer may include a sequence having 50% or more homology with the continuous nucleotide sequence of SEQ ID NO: 1 or 2, but is not limited thereto, SEQ ID NO: 17, 18, 19 , 20, 21, 22, 23, 24, 25, 26, 29, 30, 33, 34, and 44 may further include a sequence having 50% or more homology with at least one continuous nucleotide sequence.

According to another feature of the present invention, the second primer may include a sequence having 50% or more homology with the continuous nucleotide sequence of SEQ ID NO: 3 or 4, but is not limited thereto, SEQ ID NO: 11, 12, 13, 14, 15, 16, 27, 28, 31, 32, 35, 36, 39, 40, 41, 42, and 43 may further include a sequence having 50% or more homology with at least one contiguous nucleotide sequence. can

Meanwhile, the first primer and the second primer may be freely designed by those skilled in the art based on various genes other than the above-described sequence numbers. For example, according to another feature of the present invention, the first primer and the second primer are CCDC29, FLJ39739, WASH2P, CROCCL1, MSTP2, AMY1A, PDE4DIP, NBPF14, NCF1, LOC645166, GOLGA6L10, GIYD1, LRRC37A4, C2orf78, MGC13005, RPL23AP53, LOC728323, POM121L4P, ZNF595, DRD5, LOC100272216, GUSBL1, LOC100170939, C6orf41, STAG3L1, GTF2IP1, SPDYE5, AQP7, KGFLP1, FAM95B1 and LOC642929 may target, but are not limited to, at least one of the foregoing. It can be freely designed based on at least one of the genes.

According to another feature of the present invention, the first probe may include a sequence having 50% or more homology to the continuous nucleotide sequence of SEQ ID NO: 7, but is not limited thereto, and the DNA targeted by the first primer Among the sequences, all sequences containing cytosine may be included.

According to another feature of the present invention, the second probe may include a sequence having 50% or more homology to the continuous nucleotide sequence of SEQ ID NO: 8, but is not limited thereto, and the DNA targeted by the second primer Among the sequences, all sequences containing cytosine may be included.

According to another feature of the present invention, the kit may further include an internal positive control (IPC), wherein the IPC includes a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 5 or 6 and a fourth probe including a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 10.

In this case, the sequences of the third primer and the fourth probe of the IPC may preferably be sequences that do not exist in human genes.

According to another feature of the present invention, the first probe, the second probe, the third probe, and the fourth probe may each include a label capable of being detected at different wavelengths.

According to another feature of the present invention, conversion efficiency can be calculated by Equation 1 below.

At this time, in Equation 1, short T is the content of the first amplicon quantified by the second probe in BS DNA, and short C means the content of the first amplicon quantified by the first probe in BS DNA .

According to another feature of the present invention, The calculating step may further include calculating a degradation level and a recovery rate.

According to another feature of the present invention, the decomposition level can be calculated by Equation 2 below.

Here, in Equation 2, short means the content of the first amplicon quantified by the first probe and/or the second probe, and long means the content of the second amplicon quantified by the third probe.

According to another feature of the present invention, the recovery rate is, It can be calculated by Equation 3 below.

At this time, in Equation 3, BS DNA is the content of the first amplicon relative to the BS DNA quantified by the first probe and / or the second probe, and gDNA is the content of the quantified by the first probe and / or the second probe It may refer to the content of the first amplicon relative to gDNA.

According to another feature of the present invention, the biological sample may include at least one of body fluid, hair root, blood, plasma, serum, saliva, tissue, cell, urine, lymph, and organ lavage fluid, but is not limited thereto, It may include all of a variety of samples that may be derived from organisms.

According to another feature of the present invention, the amplification is performed by PCR, which is reverse transcription polymerase chain reaction (RT-PCR), multiplex PCR, real-time PCR , assembly PCR, fusion PCR, ligase chain reaction (LCR), and at least one of ddPCR (Droplet-digital PCR), but is not limited thereto, and DNA amplification A variety of ways to do it can all be included.

In order to solve the above problems, according to one embodiment of the present invention, a first primer designed to generate a first amplicon (amplicon); a second primer designed to generate a second amplicon having a different size than the first amplicon; a first probe for detecting cytosine in the DNA sequence of the first amplicon; Provided is a kit for evaluating bisulfite conversion, comprising a second probe for detecting thymine at the same position as cytosine, and a third probe for detecting a sequence not containing cytosine among the DNA sequences of the second amplicon do.

According to the features of the present invention, the first primer and the second primer are CCDC29, FLJ39739, WASH2P, CROCCL1, MSTP2, AMY1A, PDE4DIP, NBPF14, NCF1, LOC645166, GOLGA6L10, GIYD1, LRRC37A4, C2orf78, MGC13005, RPL23AP53, LOC72832 At least one of POM121L4P, ZNF595, DRD5, LOC100272216, GUSBL1, LOC100170939, C6orf41, STAG3L1, GTF2IP1, SPDYE5, AQP7, KGFLP1, FAM95B1 and LOC642929 may be targeted, but is not limited thereto.

According to another feature of the present invention, the first primer may include a sequence having 50% or more homology with the continuous nucleotide sequence of SEQ ID NO: 1 or 2, but is not limited thereto, SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 29, 30, 33, 34, and 44 may further include a sequence having 50% or more homology with at least one contiguous nucleotide sequence.

According to another feature of the present invention, the second primer may include a sequence having 50% or more homology with the continuous nucleotide sequence of SEQ ID NO: 3 or 4, but is not limited thereto, and SEQ ID NOs: 11 and 12 , 13, 14, 15, 16, 27, 28, 31, 32, 35, 36, 39, 40, 41, 42 and 43 further comprising a sequence having at least 50% homology with at least one contiguous nucleotide sequence can do.

According to another feature of the present invention, the first probe may include a sequence having 50% or more homology to the continuous nucleotide sequence of SEQ ID NO: 7.

According to another feature of the present invention, the second probe may include a sequence having 50% or more homology to the continuous nucleotide sequence of SEQ ID NO: 8.

According to another feature of the present invention, the kit may further include an internal positive control (IPC), wherein the IPC includes a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 5 or 6 and a fourth probe including a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 10.

According to another feature of the present invention, the first probe, the second probe, the third probe, and the fourth probe may each include a label capable of being detected at different wavelengths.

Hereinafter, the present invention will be described in more detail through examples. However, since these examples are merely intended to illustrate the present invention by way of example, the scope of the present invention should not be construed as being limited by these examples.

The bisulfite conversion evaluation method according to an embodiment of the present invention can check the conversion efficiency, degradation level, and yield of a bisulfite conversion kit commercially used in the field of the present invention in one PCR amplification process. and the amount of each gDNA and BS DNA can be quantified.

Furthermore, the bisulfite conversion evaluation method according to an embodiment of the present invention can overcome the limitation on the amount of analysis sample in various fields including forensic medicine, as it is possible to analyze even a very small amount of sample of 5 ng / μl. can

Effects according to the present invention are not limited by the contents exemplified above, and more various effects are included in the present specification.

1 is a flowchart of a method for evaluating bisulfite conversion according to an embodiment of the present invention.
2 is a schematic diagram of target genes used in the bisulfite conversion evaluation method according to an embodiment of the present invention.
Figure 3a is a schematic diagram of the configuration of a kit based on CCDC29 and FLJ39739 used in the method for evaluating bisulfite conversion according to an embodiment of the present invention.
3B is a schematic diagram of a CT indicator used in a method for evaluating bisulfite conversion according to an embodiment of the present invention.
4 is a schematic diagram of equations used in a method for evaluating bisulfite conversion according to an embodiment of the present invention.
5A to 5C are schematic diagrams of a verification process for a method for evaluating bisulfite conversion according to an embodiment of the present invention.
Figure 6a is a schematic diagram of the results of a standard curve and its Ct value of standard DNA in the verification process for the bisulfite conversion evaluation method according to an embodiment of the present invention.
6B shows PCR analysis results for CT indicators in the verification process for the bisulfite conversion evaluation method according to an embodiment of the present invention.
7 shows the PCR analysis results for the internal positive control (IPC) in the verification process for the bisulfite conversion evaluation method according to an embodiment of the present invention.
8 illustrates verification results of a bisulfite conversion evaluation method according to an embodiment of the present invention according to a bisulfite conversion kit.

Advantages and features of the present invention, and methods of achieving them, will become clear with reference to the embodiments described below in detail in conjunction with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below, but will be implemented in a variety of different forms, only these embodiments make the disclosure of the present invention complete, and common knowledge in the art to which the present invention pertains. It is provided to completely inform the person who has the scope of the invention, and the present invention is only defined by the scope of the claims.

As used herein, the term “nucleic acid” can refer to at least one nucleotide consisting of a sugar linked to an organic base (either substituted pyrimidines such as cytosine, thymidine, and uracil, or substituted purines such as adenes and guanines). there is. More specifically, nucleic acids may include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), methylphosphonate nucleic acid, S-oligo, cDNA, miRNA, and aptamer, etc., and may be naturally occurring or artificial. It may include all of those synthesized with . However, it may preferably be RNA and DNA, but is not limited thereto.

As used herein, the term "target gene sequence" is a nucleotide sequence present in a target gene or nucleic acid, specifically, a partial nucleotide sequence of a target region in a target gene or nucleic acid, wherein the "target region" is in the target gene or nucleic acid. It is a site that can be modified by the guide nucleic acid-editor protein.

As used herein, the term "amplification" refers to a reaction that amplifies a target nucleic acid sequence, and includes reverse transcription polymerase chain reaction (RT-PCR), multiplex PCR, and real-time PCR. , assembly PCR, fusion PCR, ligase chain reaction (LCR), and droplet-digital PCR (ddPCR), but are not limited thereto.

As used herein, the term “primer” is one of single-stranded oligonucleotides, and may include ribonucleotides, and preferably deoxyribonucleotides. The primer is hybridized or annealed to one site of the template to form a double-stranded structure. In the present invention, primers may be hybridized or annealed to NGS sequencing adapter sequences. Annealing refers to the apposition of an oligonucleotide or nucleic acid to a template nucleic acid, which causes a polymerase to polymerize the nucleotides to form a nucleic acid molecule complementary to the template nucleic acid or a portion thereof. Hybridization means that two single-stranded nucleic acids form a duplex structure by pairing complementary nucleotide sequences. A primer may serve as an initiation point for synthesis under conditions in which synthesis of a primer extension product complementary to the template is induced.

As used herein, the term "diagnosis" means to identify or characterize a pathological condition. For the purpose of the present invention, it may mean identifying the type of cancer (tumor), onset, and cause of onset, and furthermore, by checking the expression of a target gene, that is, the presence and level of expression of a biomarker, the treatment strategy and development of a tumor And it may include, but is not limited to, determining the susceptibility of an individual to a specific disease or disorder, and determining the prognosis of an individual suffering from a specific disease or disorder. determining, or therametrics (eg, monitoring a subject's condition to provide information about treatment efficacy).

Bisulfite conversion evaluation method

Hereinafter, referring to FIGS. 1 to 7, a kit for evaluating bisulfite conversion and an evaluation method using the kit according to an embodiment of the present invention will be described in detail.

First, referring to FIG. 1, a flowchart of a method for evaluating bisulfite conversion according to an embodiment of the present invention is shown. At this time, for convenience of description, it will be described with reference to FIGS. 2 to 4B.

A method for evaluating bisulfite conversion (evaluating bisulfite conversion) according to an embodiment of the present invention includes extracting gDNA from a biological sample isolated from a subject (S110), adding bisulfite (BS) to the extracted gDNA ) to obtain BS DNA (S120), a first primer designed to generate a first amplicon, and a second designed to generate a second amplicon having a size different from that of the first amplicon. 2 primers, a first probe for detecting cytosine in the DNA sequence of the first amplicon, a second probe for detecting thymine at the same position as cytosine, and a DNA sequence for the second amplicon Amplifying the extracted gDNA and BS DNA using a kit including a third probe for detecting sequences not containing cytosine (S130), based on the Ct value for amplification, quantifying gDNA and BS-DNA (S140), and calculating conversion efficiency based on the quantified gDNA and BS DNA (S150).

First, in the step of extracting gDNA (S110), the biological sample may include at least one of body fluid, hair root, blood, plasma, serum, saliva, tissue, cell, urine, lymph, and organ lavage, but is not limited thereto. , can include all of the various samples that can be derived from organisms.

Next, the bisulfite treatment in the step of obtaining BS DNA (S120) can be performed by a person skilled in the art by freely selecting a commercially available bisulfite conversion kit. For example, commercial bisulfite conversion kits in the bisulfite conversion evaluation method according to an embodiment of the present invention include EZ DNA Methlyation-Lightning Kit (Zymo Research), Premium Bisulfite kit (Diagenode), and MethylEdge Bisulfite Conversion System. (Promega), EpiJET Bisulfite Conversion Kit (Thermo Fisher Scientific), EpiTect Fast Bisulfite kit (Qiagen), and NEBNext Enzymatic Methyl-seq Conversion Module (New England Biolabs), according to the step of obtaining BS DNA (S120). As a method of treating the fight, at least one of the kits described above may be selected and used.

Then, primers of the kit used in the step of amplifying gDNA and BS DNA (S130) may be designed based on a specific gene.

More specifically, referring to FIG. 2, a schematic diagram of a target gene used in the bisulfite conversion evaluation method according to an embodiment of the present invention is shown, and bisulfite conversion evaluation according to an embodiment of the present invention The first and second primers used in the method are CCDC29, FLJ39739, WASH2P, CROCCL1, MSTP2, AMY1A, PDE4DIP, NBPF14, NCF1, LOC645166, GOLGA6L10, GIYD1, LRRC37A4, C2orf78, MGC13005, RPL23AP53, PDE4DIP, Z25L9P5, LOC72831NF1, POM At least one of DRD5, LOC100272216, GUSBL1, LOC100170939, C6orf41, STAG3L1, GTF2IP1, SPDYE5, AQP7, KGFLP1, FAM95B1 and LOC642929 may be targeted.

The above-mentioned gene is a gene that is duplicated in primate lineages including humans, and in particular, continuously expands along the human lineage and has an increased copy number. Thus, the target gene used in the method for evaluating bisulfite conversion according to an embodiment of the present invention is not limited to the above-described genes, but may include all genes having increased copy numbers in human lineages.

However, the most preferred target genes that can be used in the bisulfite conversion evaluation method according to an embodiment of the present invention may be FLJ39739 and/or CCDC29, and sequence information for FLJ39739 and CCDC29 is as follows.

FLJ39739의 DNA 서열 (239bp): 5'- AGGGAAAATGAGGAAGTGATGAATAGAAYTATTTYTTYYATTYAYYYAGYTAYAAATTGTGYTGATTTAYAATGTTGTATGTTATTTGTGGYAYTTGTATTGGTTTTAATTTYATAGTYYTYTYAAGATAGGAAYTTGYYATYAGATGAGYYAGGTGAAYTAGYYAAAYAGGGTTTTYTTGTTGATYTTTTYAAAAAAYYAGYYYTGGATTYATTGATTTTTTGAAGGGTTTTTTGTGT-3' (서열번호 11)

DNA sequence of CCDC29 (104 bp): 5'- GAAATGGTTAAGAGAAAGGGAAAAAYTGAAAYYTGTGGGTGAATAYTTAGAATGAYAGTATTTAGYTYAGYYTGAAGAYAGATGAGGATGAAAAATGTAATGGG-3' (SEQ ID NO: 12)

Furthermore, referring to FIG. 3A, a schematic diagram of the configuration of a kit based on CCDC29 and FLJ39739 used in the method for evaluating bisulfite conversion according to an embodiment of the present invention is shown.

The first primer and the second primer of the kit used in the bisulfite conversion evaluation method according to an embodiment of the present invention may be designed based on the CCDC29 and FLJ39739 genes, and at this time, the first primer and the second primer are respectively It can be designed to generate amplicons of different sizes.

For example, a first primer can be designed to generate a first amplicon of 110 bp or less, and a second primer can be designed to generate a second amplicon of a different size than the first amplicon, i.e., 170 bp or greater. there is. At this time, the maximum size of the second amplicon may be preferably 300 bp or less, but is not limited thereto.

More specifically, the first primer used in the bisulfite conversion evaluation method according to an embodiment of the present invention is designed based on CCDC29, its sequence may be SEQ ID NO: 1 or 2, and generated through the first primer The size of the first amplicon may be 104 bp.

In addition, the second primer is designed based on FLJ39793, its sequence may be SEQ ID NO: 3 or 4, and the size of the second amplicon generated through the second primer may be 238 bp.

On the other hand, the kit used in the bisulfite conversion evaluation method according to an embodiment of the present invention is a first to second amplicon generated through the first primer and the second primer, in order to identify 3 probes may be included.

More specifically, the first probe and the second probe for the first primer are probes for detecting cytosine (C) and thymine (T) in the first amplicon generated through the first primer, respectively. , can be designed based on the sequence of the first amplicon.

In this case, the first probe is a probe for detecting cytosine in the first amplicon, that is, cytosine that is methylated and not converted to urasil (U) in bisulfite, and the specific methylated cytosine in the first amplicon ( methylated cytosine). Accordingly, the first probe in the bisulfite conversion evaluation method according to an embodiment of the present invention may be SEQ ID NO: 7, but is not limited thereto, and the first probe may be a variety of proteins including cytosine in the first amplicon. Can be designed based on sequence.

Furthermore, the second probe is a probe for detecting thymine at the same position as the specific cytosine to be detected by the first probe, and thymine is converted to uracil by bisulfite and converted to thymine by PCR amplification. As it refers to the converted sequence, that is, unmethylated cytosine, the second probe detects thymine (cytosine that is not methylated and converted to uracil) converted by bisulfite in the first amplicon can be designed to Accordingly, the second probe in the bisulfite conversion evaluation method according to an embodiment of the present invention may be SEQ ID NO: 8, but is not limited thereto, and may be designed in various ways according to the above-described first probe.

Meanwhile, the third probe for the second primer may detect the second amplicon generated through the second primer. That is, the third probe is designed to be cytosine free and can detect and quantify both converted DNA and gDNA (genomic DNA). Accordingly, the third probe in the bisulfite conversion evaluation method according to an embodiment of the present invention may be SEQ ID NO: 9, but is not limited thereto, based on various sequences that do not contain cytosine in the second amplicon can be designed.

Furthermore, the kit used in the bisulfite conversion evaluation method according to an embodiment of the present invention includes an internal positive control (internal positive control) in addition to the above-described first primer, second primer, first probe, second probe, and third probe. control, IPC) may be further included.

Unlike the first primer, second primer, first probe, second probe, and third probe described above, the IPC is not designed based on CCDC29 and FLJ39739. More specifically, IPC can be designed as an artificial sequence that is not found in mammals, including humans, as a control for confirming the PCR inhibitory effect by bisulfite conversion.

Accordingly, the sequence of the third primer for IPC used in the method for evaluating bisulfite conversion according to an embodiment of the present invention may be SEQ ID NO: 5 or 6, and the fourth probe for IPC may be SEQ ID NO: 10. , It is not limited thereto, and can be freely designed by those skilled in the art based on sequences that do not exist in mammals, including humans.

For example, the IPC used in the bisulfite conversion evaluation method according to an embodiment of the present invention avoids interaction with the aforementioned first primer, second primer, first probe, second probe, and third probe. For this purpose, it may be dsDNA (double-stranded DNA) of SEQ ID NO: 45, which is a DNA sequence that does not exist in mammals, including humans, but is not limited thereto.

IPC의 dsDNA 서열 (450bp): 5'- CTCTAACTAGTATGGATAACCGTGTTTTCACTGTGCTGCGGTTACCCATCGCCTGAAATCCAGTTGGTGTCAAGCCATTCCCTGTCTAGGACGCCGCATGTAGTAAAACATATACATTGCTCGGGTTCACTCCGGTCCGTTCTGAGTCGACCAAGGACACAATCGAGCTCCGATCTGTATTGTCGAGAAACTTGTATCCAACCCCCGCAGCTTGCCAGCTCTTCGGGTATCATGGAGCCTATGGTTGAACAAGGCCCATACGCGAGATAAACTGCTAGAAAACCGCGTCTTTACGACTGGTGCTTAATTTAATTTCGCTGACGTGATGACATTCCAGGCAGTGCGTCTGCTGTCGGGTCCCTCTCGTGATTGGGTAGTTGGACATGCCCTTGAAAAACATAGCAAGAGCCTGCCTCTCTATTGATGTCACGGCGAATGTCGGGGAGACAG-3' (서열번호 45)

Furthermore, referring to FIG. 3B, the kit used in the method for evaluating bisulfite conversion according to an embodiment of the present invention may further include a C-T indicator of SEQ ID NO: 46 as well as primers, probes, and IPC. . For example, the method for evaluating bisulfite conversion according to an embodiment of the present invention may indirectly calculate the amount of converted DNA by including the C-T indicator. As shown, the C-T index contains degenerate base Y containing equal amounts of cytosine and thymine (C = 50%, T = 50%), and is serially diluted 10-fold during PCR amplification. Relational expressions for cytosine and thymine can be calculated. Thus, the relational expression derived from the C-T index can estimate and convert the amount of the second amplicon containing cytosine in the BS DNA from the amount of the first amplicon containing thymine in the BS DNA.

More specifically, the standard curve of the second probe cannot be obtained because human gDNA is used as a standard in real-time PCR. Therefore, the C-T index is an essential composition that is indirectly substituted into the standard curve of the first probe and used instead of the standard curve of the second probe, that is, the standard material required to confirm the amount of the second probe. .

Therefore, since the C-T indicator includes a sequence including a degenerate base Y of C: T = 50: 50, both the first probe and the second probe can be detected, and furthermore, the first probe (short-C ) and the second probe (short-T).

C)는 관계식을 통해, short-T(제 2프로브)의 Ct값으로 변환된 값으로, C를 제 1 프로브(short-C)의 표준 곡선에 적용해 제 1 앰플리콘의 양을 획득할 수 있다.First, after PCR amplification is performed by serially diluting the CT indicator by 10 times, a relational expression (a kind of parameter expression) between the first probe and the second probe can be calculated through the resulting value between them. For example, as shown in FIG. 3B, C (T of short-T

C) is a value converted to the Ct value of short-T (second probe) through the relational expression, and C is applied to the standard curve of the first probe (short-C) to obtain the amount of the first amplicon there is.

Therefore, according to the present invention, the amount of the first amplicon can be derived by indirectly calculating the standard curve of the second probe by including the aforementioned C-T index.

Referring back to FIG. 3A, the first to fourth probes used in the method for evaluating bisulfite conversion according to an embodiment of the present invention are labeling substances detectable at different wavelengths to detect different targets, respectively. can include

Accordingly, the first probe (SEQ ID NO: 7), the second probe (SEQ ID NO: 8), the third probe (SEQ ID NO: 9), and the fourth probe (SEQ ID NO: 10) are labels, FAM and VIC at the 5' end, respectively. , NED and CY5, but are not limited thereto, and various markers that can be commercially used for probes in the field to which the present invention belongs can all be used. For example, the labels used in the probe of the bisulfite conversion evaluation method according to an embodiment of the present invention are FAM, VIC, NED, CY5, Fluorescein-Dt, TET, HEX, TAMRA, CY3, CY3.5 , CY5.5, JOE, ROX, TEXAS RED, Rhodamine 6G, DABCYL, BHQ-1, EBQ, and at least one of BHQ-2 may be selected and used.

On the other hand, in the composition of the kit used in the bisulfite conversion evaluation method according to an embodiment of the present invention, the first primer and the second primer are limited to the above-described SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5 It is not, and can be designed in various ways as shown in Table 1 below by those skilled in the art based on the genes described above in FIG.

gene Primer seauence (5'>3') amplicon size (bp) no CCDC29 F gaa atg gtt aag aga aag gga aa 104 SEQ ID NO: 1 R ccc att aca ttt ttc atc ctc a SEQ ID NO: 2 F tag aag ggg aga gat tgg g 226 SEQ ID NO: 13 R tca cac cct tca aac tat caa a SEQ ID NO: 14 FLJ39739 F ggg aaa atg agg aag tga tga 238 SEQ ID NO: 3 R aca caa aaa acc att caa aaa a SEQ ID NO: 4 F agg gaa aat gag gaa atg atg 239 SEQ ID NO: 15 R aca caa aaa acc ctt caa aaa a SEQ ID NO: 16 F gga aaa tgt ggg aaa gtt tga 182 SEQ ID NO: 17 R cct ctc ctc aac cac cat ct SEQ ID NO: 18 F gag ttt ggg gat ggg tag g 89 SEQ ID NO: 19 R ccc atc att aca tta tta cca a SEQ ID NO: 20 F tga ggt agg aag tat gtg aga aaa 99 SEQ ID NO: 21 R tca ttc cca tta ccc aat ca SEQ ID NO: 22 F tga gtg gat gtg ggt gta gag 88 SEQ ID NO: 23 R tcc ctt tta caa cca aac tct c SEQ ID NO: 24 F aaa gaa aag aaa aga taa tta ggg a 81 SEQ ID NO: 25 R cat att ttt tcc cca aaa ctc a SEQ ID NO: 26 RPL23AP53 F gga atg tta ttt ttg gat tgt aag g 81 SEQ ID NO: 27 R att ttt cct ccc cta tta caa SEQ ID NO: 28 F ttg taa tag ggg agg aaa aat 227 SEQ ID NO: 29 R cac ctc aaa tct tct ttc ttt SEQ ID NO: 30 ANKRD20A1 F aaa ttt gaa gtg tat ggg a 82 SEQ ID NO: 31 R cca aac ata tta aat tcc aaa ac SEQ ID NO: 32 F tga gat tga ttt aaa gaa att gat t 223 SEQ ID NO: 33 R tct tcc cac ctc aac ttc ct SEQ ID NO: 34 STAG3L1 F ttt ttg taa ggt ggt aag ga 98 SEQ ID NO: 35 R ttc acc cca taa tct tat ctt tct SEQ ID NO: 36 F ggg agg aag aaa tga aag g 192 SEQ ID NO: 37 R cca aca ccc aat ttc ctc aa SEQ ID NO: 38 LSP1P5 F gaa aag gga agg aag aaa aga aa 211 SEQ ID NO: 39 F gag gga ggg aga gag gga g 176 SEQ ID NO: 40 R ttt acc ttc cta aat ttt cac tca SEQ ID NO: 41 F aga aag aag aag aga ggg agg g 193 SEQ ID NO: 42 R ttt acc ttc cta aat ttt cac tca SEQ ID NO: 43 NCF1 F tga gaa agg tat gag gtt tg 96 SEQ ID NO: 44

Accordingly, the first primers used in the bisulfite conversion evaluation method according to an embodiment of the present invention are SEQ ID NOs: 1 and 2 as well as SEQ ID NOs: 17, 18, 19, 20, 21, 22, 23, 24, 25 , 26, 29, 30, 33, 34 and 44 may further include a sequence having 50% or more homology with at least one continuous nucleotide sequence, but is not limited thereto.

In addition, the second primer is SEQ ID NOs: 3 and 4, as well as SEQ ID NOs: 11, 12, 13, 14, 15, 16, 27, 28, 31, 32, 35, 36, 39, 40, 41, 42 and 43 It may further include a sequence having 50% or more homology with at least one contiguous nucleotide sequence, but is not limited thereto.

Referring back to Figure 1, in the step of amplifying gDNA and BS DNA (S130), amplification is performed by PCR, and PCR is reverse transcription polymerase chain reaction (RT-PCR), multiplex PCR , It may be at least one of real-time PCR, assembly PCR, fusion PCR, ligase chain reaction (LCR), and droplet-digital PCR (ddPCR), but is limited thereto It is not, and various methods may all be used.

Then, the Ct value for the amplification in the step of quantifying gDNA and BS-DNA (S140) can be calculated from each probe and C-T index. More specifically, the contents of the first amplicon and the second amplicon may be calculated as the Ct value of the first probe and the Ct value of the third probe, respectively.

Furthermore, the Ct value by the second probe may be calculated by applying a relational expression calculated from the C-T index. At this time, the C-T indicator has a ratio of cytosine and thymine of 50:50 and includes degenerate base Y, so both the first probe and the second probe can be detected, and furthermore, the first probe (short-C) It can be used to derive a relational expression between T and the second probe (short-T). Then, in the step of calculating (S150), not only the conversion efficiency, but also the degradation level and recovery are calculated. A calculating step may be further included.

More specifically, referring to FIG. 4 , conversion efficiency may be calculated by the following [Equation 1].

[Equation 1]

In Equation 1, short T is the content of the first amplicon quantified by the second probe in the BS DNA (the relational formula calculated from the C-T index is applied, the same hereinafter), and short C is the first probe in the BS DNA The content of the first amplicon quantified by

In addition, the decomposition level can be calculated by [Equation 2] below.

[Equation 2]

In Equation 2, short is the content of the first amplicon quantified by the first probe and/or the second probe, and long is the content of the second amplicon quantified by the third probe.

In addition, the recovery rate can be calculated by [Equation 3] below.

[Equation 3]

In Equation 3, BS DNA is the content of the first amplicon relative to the BS DNA quantified by the first probe and / or the second probe, and gDNA is the gDNA quantified by the first probe and / or the second probe is the content of the first amplicon for

According to the above process, the bisulfite conversion evaluation method according to an embodiment of the present invention can confirm the quantification of converted DNA and the degree of conversion through a single amplification process.

Verification of the bisulfite conversion evaluation method according to an embodiment of the present invention

Hereinafter, with reference to FIGS. 5A to 8 , the verification and process of the bisulfite conversion evaluation method according to an embodiment of the present invention will be described.

First, FIGS. 5A to 5C are schematic diagrams of a verification process for a method for evaluating bisulfite conversion according to an embodiment of the present invention.

Referring to FIG. 5A, in the verification process for the bisulfite conversion evaluation method according to an embodiment of the present invention, BS DNA obtained from gDNA through a bisulfite conversion process according to gDNA and various types of bisulfite kits After amplification using the bisulfite conversion evaluation kit according to an embodiment of the present invention (BisQuE), the conversion efficiency, degradation level and recovery rate for each bisulfite kit are evaluated based on the product. .

On the other hand, the verification of the bisulfite conversion evaluation method according to an embodiment of the present invention is a method of confirming the arrangement and efficiency (including degradation and recovery) of cytosine converted through bisulfite (BS) treatment, Treatment with bisulfite can be performed to obtain BS DNA from gDNA.

Accordingly, referring to FIG. 5B, a schematic diagram of a bisulfite conversion kit used in a verification process for a bisulfite conversion evaluation method according to an embodiment of the present invention is shown, and a bisulfite conversion kit according to an embodiment of the present invention is shown. Verification of the sulfite conversion evaluation method is EZ DNA Methlyation-Lightning Kit (Zymo Research), Premium Bisulfite kit (Diagenode), MethylEdge Bisulfite Conversion System (Promega), EpiJET Bisulfite Conversion Kit (Thermo Fisher Scientific), EpiTect Fast Bisulfite kit ( Qiagen) and NEBNext Enzymatic Methyl-seq Conversion Module (New England Biolabs), based on a total of six bisulfite conversion kits.

More specifically, a total of 20 peripheral blood samples were obtained from the biobank of the Asian Sample Network with approval from the Institutional Ethics Committee of Yonsei University Severance Hospital (4-2019-0707). Then, gDNA was extracted from 200 μl of whole blood sample using the QIAamp®DNA Mini Kit (Qiagen, Hilden, Germany), and the extracted gDNA was extracted using the Quantifiler™ Duo Kit (Thermo Fisher Scientific, Waltham, MA, United States). After quantification, it was stored at 20 °C.

Then, 50 ng of gDNA was treated with bisulfite (using each kit) to obtain BS-DNA.

Then, the obtained gDNA and BS DNA were each diluted to 5 ng/μl based on the results of the Quantifiler™ Duo Kit (Thermo Fisher Scientific, Waltham, MA, United States) and used in the amplification process (BisQuE).

For example, referring to FIG. 5B , in the amplification process (BisQuE), the arrangement of each sample in the plate and its content were performed as shown, and BS DNA was also diluted to 5 ng/μl like gDNA and added. At this time, Z-EZ is EZ DNA Methlyation-Lightning Kit (Zymo Research), D-PB is Premium Bisulfite kit (Diagenode), P-ME is MethylEdge Bisulfite Conversion System (Promega), and T-EJ is EpiJET Bisulfite Conversion Kit (Thermo Fisher Scientific), Q-EF is the EpiTect Fast Bisulfite kit (Qiagen), and N-NE is the NEBNext Enzymatic Methyl-seq Conversion Module (New England Biolabs)

Figure 6a is a schematic diagram of the results of a standard curve and its Ct value of standard DNA in a verification process for a bisulfite conversion evaluation method according to an embodiment of the present invention.

Referring to FIG. 6A, the results for standard DNA appear to have consistent assay sensitivity and reproducibility. More specifically, the average Ct values for standard DNA of 10 ng to 0.016 ng (16 pg) are 21.247, 23.510, 25.742, 27.932, and 29.899 in Short-C, respectively, and appear to have uniform results, and in Long-Cfree, respectively 22.595, 24.850, 27.059, 29.182 and 31.077 appear to have uniform results.

Furthermore, as the value of each R-squared for the analysis is 0.99 or more, and the values for the PCR efficiency slope and the y-intercept are all shown to be constant, the result value for PCR amplification is reliable. It can mean having high reproducibility and consistency.

Furthermore, through these results, a standard curve for Short-C and Long-Cfree can be calculated, and the first amplicon (gDNA or unconverted DNA) by the first probe can be calculated using the calculated standard curve. ) and the amount of the second amplicon can be quantified.

Figure 6b shows the PCR analysis results for the C-T index in the verification process for the bisulfite conversion evaluation method according to an embodiment of the present invention.

Referring to FIG. 6B, the average Ct values for the C-T index appear to have uniform results of 23.093, 26.292, 299.414, and 31.974 in Short-C, respectively, and 24.600, 27.786, 30.796, and 33.637 in Short-T, respectively. It appears to have uniform results.

Furthermore, as the value of each R-squared for the analysis is 0.99 or more, and the values for the slope and the y-intercept are both constant, the result for PCR amplification has high reliability and consistency. It may mean that it has, and appears to be similar to the result in FIG. 6a described above.

Furthermore, the relative ratio of Ct values between Short-C and Short-T can be calculated through the results of the CT index with four dilution amounts (10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ ), and the calculation Through the ratio, the Ct value for Short-T can be converted to the Ct value for Short-C.

That is, since the resulting value for Short-T cannot be used for the standard curve, the Ct value for Short-T can be indirectly quantified with the standard curve for Short-C using the relational expression by the C-T index described above. can

7 shows the PCR analysis results for the internal positive control (IPC) in the verification process for the bisulfite conversion evaluation method according to an embodiment of the present invention.

Referring to FIG. 7 , the average Ct value for IPC is about 27, which appears to be very constant among samples, which may mean that the PCR inhibitor is not present in the sample or has no effect.

That is, the IPC used in the bisulfite conversion evaluation method according to an embodiment of the present invention can detect whether or not the sample is contaminated without interfering with other primers and probes.

8 shows verification results of a bisulfite conversion evaluation method according to an embodiment of the present invention according to a bisulfite conversion kit. At this time, (a) to (c) of FIG. 7 were measured based on the qPCR system of the present invention.

More specifically, first, referring to (a) of FIG. 8, the conversion efficiency results for the bisulfite conversion evaluation method according to an embodiment of the present invention according to the bisulfite conversion kit are shown, and most of the bisulfite BS-DNA by Pitt Conversion Kit is shown to have a conversion efficiency of over 95%.

More specifically, the BS conversion efficiency is shown to be high in the order of Z-EZ, Q-EF, P-ME, D-PB, T-EJ and N-NE kits, and 7 of the samples for the N-NE kit are 90 %, and the conversion efficiency for the N-NE kit appears to have a significant difference from other kits (P<0.001).

That is, through the bisulfite conversion evaluation method according to an embodiment of the present invention, it can be confirmed that the bisulfite conversion efficiency through the N-NE kit is the lowest.

Next, referring to (b) of FIG. 8 , the result of the decomposition level of the bisulfite conversion evaluation method according to an embodiment of the present invention according to the bisulfite conversion kit is shown. At this time, the level of degradation is calculated as the ratio of BS DNA to gDNA as shown in Equation 2 below. When the ratio of gDNA and BS DNA is the same, the level of degradation is 1. Furthermore, when the content of long, that is, the second amplicon is small in BS DNA, the degradation level is 1 or more (> 1), so when the degradation level is 1 or more, in the BS conversion step This may mean that BS DNA has been degraded.

[Equation 2]

In Equation 2, short is the content of the first amplicon quantified by the first probe and/or the second probe, and long is the content of the second amplicon quantified by the third probe.

As for the degradation level, the N-NE kit is shown to have the lowest degradation level of 1.0 or less, and the rest of the kits except N-NE appear to have a degradation level of 1.0 or more with a degradation level of 1.279 to 1.577.

That is, through the bisulfite conversion evaluation method according to an embodiment of the present invention, it can be confirmed that the level of bisulfite decomposition through the N-NE kit is the lowest.

Then, referring to (c) of FIG. 8, the recovery rate results for the bisulfite conversion evaluation method according to an embodiment of the present invention according to the bisulfite conversion kit are shown, and the Z-EZ kit shows an average of 50.58% appears to have the highest recovery of , and the N-NE kit appears to have the lowest recovery with an average of 18.24%. Furthermore, the remaining kits appear to have similar levels of recovery, averaging between 43.79 and 48.39%.

Furthermore, the recovery rates of the Z-EZ and Q-EF kits are significantly different (P<0.05), and the recovery rates of the N-NE kit are significantly different from other kits (P<0.05). .

That is, through the bisulfite conversion evaluation method according to an embodiment of the present invention, it can be confirmed that the Z-EZ kit has the highest recovery rate and the N-NE kit has the lowest recovery rate.

Then, referring to (d) of FIG. 8, the results of the recovery rate according to the measured bisulfite conversion kit based on the Qubit ssDNA assay are shown, and as in (c) of FIG. 8, the N-NE kit has the lowest recovery rate. appears to have

That is, the recovery rate verification according to the bisulfite conversion evaluation method according to an embodiment of the present invention may mean that it has a tendency similar to that of the conventional verification method.

According to the above results, the bisulfite conversion evaluation method according to an embodiment of the present invention is a one-time PCR amplification process for the bisulfite conversion kit commercially used in the field of the present invention, the conversion efficiency, degradation level and All yields can be confirmed, and the amount of each gDNA and BS DNA can be quantified.

Furthermore, the bisulfite conversion evaluation method according to an embodiment of the present invention can overcome the limitation on the amount of analysis sample in various fields including forensic medicine, as it is possible to analyze even a very small amount of sample of 5 ng / μl. can

Although the embodiments of the present invention have been described in more detail with reference to the accompanying drawings, the present invention is not necessarily limited to these embodiments, and may be variously modified and implemented without departing from the technical spirit of the present invention. Therefore, the embodiments disclosed in the present invention are not intended to limit the technical idea of the present invention, but to explain, and the scope of the technical idea of the present invention is not limited by these embodiments. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting. The protection scope of the present invention should be construed according to the claims below, and all technical ideas within the equivalent range should be construed as being included in the scope of the present invention.

<110> Industry-Academic Cooperation foundation Yonsei University <120> KIT FOR EVALUATION OF BISULFITE CONVERSION AND METHOD FOR EVALUATION USING THE SAME <130> DP-2021-1092 <160> 46 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 1 gaaatggtta agagaaaggg aaa 23 <210> 2 <211> 22 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 2 cccattacat ttttcatcct ca 22 <210> 3 <211> 21 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 3 gggaaaatga ggaagtgatg a 21 <210> 4 <211> 22 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 4 acacaaaaaa ccattcaaaa aa 22 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 5 aactgctaga aaaccgcgtc 20 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 6 gaggcaggctcttgctatgt 20 <210> 7 <211> 19 <212> DNA <213> artificial sequence <220> <223> C probe <400> 7 tgggtgaata cttagaatg 19 <210> 8 <211> 19 <212> DNA <213> artificial sequence <220> <223> T probe <400> 8 tgggtgaata tttagaatg 19 <210> 9 <211> 21 <212> DNA <213> artificial sequence <220> <223> Cytosine free probe <400> 9 aatgttgtg g 21 <210> 10 <211> 21 <212> DNA <213> artificial sequence <220> <223> probe <400> 10 tccaggcagt gcgtctgctg t 21 <210> 11 <211> 239 <212> DNA <213> Homo sapiens <400> 11 agggaaaatg agggaagtgat gaatagaayt atttyttyya ttyayyyagy tayaaattgt 60 gytgatttay aatgttgtat gttatttgtg gyayttgtat tggttttaat ttyatagtyy 120 tytyaagata ggaayttgyy atyagatgag yyaggtgaay tagyyaaaya gggttttytt 180 gttgatyttt tyaaaaaayy agyyytggat tyattgattt tttgaagggt tttttgtgt 239 <210> 12 <211> 104 <212> DNA 213 <213> <400> 12 gaaatggtta agagaaaggg aaaaaytgaa ayytgtgggt gaatayttag aatgayagta 60 tttagytyag yytgaagaya gatgaggatg aaaaatgtaa tggg 104 <210> 13 <211> 19 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 13 tagaagggga gagatggg 19 <210> 14 <211> 22 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 14 tcacaccctt caaactatca aa 22 <210> 15 <211> 21 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 15 agggaaaatg agggaaatgat g 21 <210> 16 <211> 22 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 16 acacaaaaaa cccttcaaaa aa 22 <210> 17 <211> 21 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 17 ggaaaatgtg ggaaagtttg a 21 <210> 18 <211> 20 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 18 cctctcctca accaccatct 20 <210> 19 <211> 19 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 19 gagtttgggg atgggtagg 19 <210> 20 <211> 22 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 20 cccatcatta cattattacc aa 22 <210> 21 <211> 24 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 21 tgaggtagga agtatgtgag aaaa 24 <210> 22 <211> 20 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 22 tcattcccat tacccaatca 20 <210> 23 <211> 21 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 23 tgagtggatg tgggtgtaga g 21 <210> 24 <211> 22 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 24 tcccttttac aaccaaactc tc 22 <210> 25 <211> 25 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 25 aaagaaaaga aaagataatt aggga 25 <210> 26 <211> 22 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 26 catatttttt ccccaaaact ca 22 <210> 27 <211> 25 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 27 ggaatgttat ttttggattg taagg 25 <210> 28 <211> 21 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 28 atttttcctc ccctattaca a 21 <210> 29 <211> 21 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 29 ttgtaatagg ggaggaaaaa t 21 <210> 30 <211> 21 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 30 cacctcaaat cttctttctt t 21 <210> 31 <211> 19 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 31 aaatttgaag tgtatggga 19 <210> 32 <211> 23 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 32 ccaaacatat taaattccaa aac 23 <210> 33 <211> 25 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 33 tgagattgat ttaaagaaat tgatt 25 <210> 34 <211> 20 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 34 tcttcccacc tcaacttcct 20 <210> 35 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 35 tttttgtaag gtggtaagga 20 <210> 36 <211> 24 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 36 ttcaccccat aatcttatct ttct 24 <210> 37 <211> 19 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 37 gggaggaaga aatgaaagg 19 <210> 38 <211> 20 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 38 ccaacaccca atttcctcaa 20 <210> 39 <211> 23 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 39 gaaaaggggaa ggaagaaaag aaa 23 <210> 40 <211> 19 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 40 gagggaggga gagagggg 19 <210> 41 <211> 24 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 41 tttaccttcc taaattttca ctca 24 <210> 42 <211> 22 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 42 agaaagaaga agagaggggg gg 22 <210> 43 <211> 24 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 43 tttaccttcc taaattttca ctca 24 <210> 44 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 44 tgagaaaggt atgaggtttg 20 <210> 45 <211> 450 <212> DNA <213> artificial sequence <220> <223> internal positive control <400> 45 ctctaactag tatggataac cgtgttttca ctgtgctgcg gttacccatc gcctgaaatc 60 cagtggtgt caagccattc cctgtctagg acgccgcatg tagtaaaaca tatacattgc 120 tcgggttcac tccggtccgt tctgagtcga ccaaggacac aatcgagctc cgatctgtat 180 tgtcgagaaa cttgtatcca acccccgcag cttgccagct cttcgggtat catggagcct 240 atggttgaac aaggcccata cgcgagataa actgctagaa aaccgcgtct ttacgactgg 300 tgcttaattt aatttcgctg acgtgatgac attccaggca gtgcgtctgc tgtcgggtcc 360 ctctcgtgat tgggtagttg gacatgccct tgaaaaacat agcaagagcc tgcctctcta 420 ttgatgtcac ggcgaatgtc ggggagacag 450 <210> 46 <211> 104 <212> DNA <213> artificial sequence <220> <223> internal positive control (contained a degenerate base Y-46 bp) <400> 46 gaaatggtta agagaaaggg aaaaactgaa acctgtgggt gaatayttag aatgacagta 60 tttagctcag cctgaagaca gatgaggatg aaaaatgtaa tggg 104

Claims (28)

extracting gDNA from a biological sample isolated from the subject;
obtaining BS DNA by treating the gDNA with bisulfite (BS);
A first primer designed to generate a first amplicon, a second primer designed to generate a second amplicon having a size different from that of the first amplicon, and a cyto of the DNA sequence of the first amplicon Using a kit including a first probe that detects cytosine, a second probe that detects thymine at the same position as cytosine, and a third probe that does not contain cytosine, the extracted amplifying gDNA and the BS DNA;
Quantifying the amplified gDNA and BS-DNA based on the Ct value for the amplification, and
A method for evaluating bisulfite conversion comprising calculating conversion efficiency based on the quantified gDNA and BS DNA. According to claim 1,
The first primer,
A method for evaluating bisulfite conversion comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 1 or 2. According to claim 2,
The first primer,
SEQ ID NOs: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 29, 30, 33, 34 and 44 and at least one contiguous nucleotide sequence and a sequence having more than 50% homology further A method for evaluating bisulfite conversion, comprising: According to claim 1,
The second primer,
A method for evaluating bisulfite conversion comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 3 or 4. According to claim 4,
The second primer,
SEQ ID NO: 11, 12, 13, 14, 15, 16, 27, 28, 31, 32, 35, 36, 39, 40, 41, 42 and 43 at least one contiguous nucleotide sequence of at least 50% homology A method for evaluating bisulfite conversion, further comprising a sequence having According to claim 1,
The first probe,
A method for evaluating bisulfite conversion comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 7. According to claim 1,
The second probe,
A method for evaluating bisulfite conversion comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 8. According to claim 1,
The first primer and the second primer,
CCDC29, FLJ39739, WASH2P, CROCCL1, MSTP2, AMY1A, PDE4DIP, NBPF14, NCF1, LOC645166, GOLGA6L10, GIYD1, LRRC37A4, C2orf78, MGC13005, RPL23AP53, LOC728323, POM121L4P, ZNF595, DRD5, LOC100272216, GUSBL1, LOC100170939, C6orf41, STAG3L1, A method for evaluating bisulfite conversion, targeting at least one of GTF2IP1, SPDYE5, AQP7, KGFLP1, FAM95B1 and LOC642929. According to claim 1,
The kit,
A method for evaluating bisulfite conversion, further comprising an internal positive control (IPC). According to claim 9,
The IPC,
A third primer comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 5 or 6, and
A method for evaluating bisulfite conversion comprising a fourth probe comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 10. According to claim 10,
The first probe, the second probe, the third probe, and the fourth probe,
A method for evaluating bisulfite conversion, each containing a label detectable at different wavelengths. According to claim 1,
The conversion efficiency is,
A method for evaluating bisulfite conversion, calculated by Equation 1 below.
[Equation 1]

In Equation 1, short T is the content of the first amplicon quantified by the second probe in BS DNA, and short C is the content of the first amplicon quantified by the first probe in BS DNA. According to claim 1,
The calculating step is
A method for evaluating bisulfite conversion, further comprising calculating a degradation level and a recovery rate. According to claim 13,
The level of decomposition is
Bisulfite conversion evaluation method, calculated by Equation 2 below.
[Equation 2]

In Equation 2, short is the content of the first amplicon quantified by the first probe and/or the second probe, and long is the content of the second amplicon quantified by the third probe. According to claim 13,
The recovery rate is
Bisulfite conversion evaluation method, calculated by Equation 3 below.
[Equation 3]

In Equation 3, BS DNA is the content of the first amplicon relative to the BS DNA quantified by the first probe and / or the second probe, and gDNA is the gDNA quantified by the first probe and / or the second probe is the content of the first amplicon for According to claim 1,
The biological sample,
A method for evaluating bisulfite conversion, comprising at least one of body fluids, hair roots, blood, plasma, serum, saliva, tissue, cells, urine, lymph, and organ lavage fluid. According to claim 1,
The amplification is
It is performed by PCR,
The PCR,
Reverse transcription polymerase chain reaction (RT-PCR), multiplex PCR, real-time PCR, assembly PCR, fusion PCR, ligase chain reaction A method for evaluating bisulfite conversion, which is at least one of LCR) and droplet-digital PCR (ddPCR). a first primer designed to generate a first amplicon;
a second primer designed to generate a second amplicon having a different size than the first amplicon;
a first probe for detecting cytosine in the DNA sequence of the first amplicon;
A second probe for detecting thymine at the same position as the cytosine, and
A kit for evaluating bisulfite conversion, comprising a third probe for detecting a sequence not containing cytosine among the DNA sequences of the second amplicon. According to claim 18,
The first primer and the second primer,
CCDC29, FLJ39739, WASH2P, CROCCL1, MSTP2, AMY1A, PDE4DIP, NBPF14, NCF1, LOC645166, GOLGA6L10, GIYD1, LRRC37A4, C2orf78, MGC13005, RPL23AP53, LOC728323, POM121L4P, ZNF595, DRD5, LOC100272216, GUSBL1, LOC100170939, C6orf41, STAG3L1, A kit for evaluating bisulfite conversion, targeting at least one of GTF2IP1, SPDYE5, AQP7, KGFLP1, FAM95B1 and LOC642929. According to claim 18,
The first primer,
A kit for evaluating bisulfite conversion, comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 1 or 2. 21. The method of claim 20,
The first primer,
SEQ ID NOs: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 29, 30, 33, 34 and 44 and at least one contiguous nucleotide sequence and a sequence having more than 50% homology further A kit for evaluating bisulfite conversion, comprising: According to claim 18,
The second primer,
A kit for evaluating bisulfite conversion, comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 3 or 4. 23. The method of claim 22,
The second primer,
SEQ ID NO: 11, 12, 13, 14, 15, 16, 27, 28, 31, 32, 35, 36, 39, 40, 41, 42 and 43 at least one contiguous nucleotide sequence of at least 50% homology A kit for evaluating bisulfite conversion, further comprising a sequence having. According to claim 18,
The first probe,
A kit for evaluating bisulfite conversion, comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 7. According to claim 18,
The second probe,
A kit for evaluating bisulfite conversion, comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 8. According to claim 18,
The kit,
A kit for evaluating bisulfite conversion, further comprising an internal positive control (IPC). 27. The method of claim 26,
The IPC,
A third primer comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 5 or 6, and
A kit for evaluating bisulfite conversion, comprising a fourth probe comprising a sequence having 50% or more homology with the contiguous nucleotide sequence of SEQ ID NO: 10. 28. The method of claim 27,
The first probe, the second probe, the third probe, and the fourth probe,
A kit for evaluating bisulfite conversion, each containing a label that can be detected at different wavelengths.

Images