KR20230011226A - Pharmaceutical composition for preventing or treating β-catenin overexpressed cancer disease comprising NEURL, NEURL gene expression vector or NEURL protein - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating β-catenin overexpressing cancer disease comprising an expression vector containing a NEURL gene or a NEURL protein as an active ingredient, wherein NEURL is excellent in inhibiting the Wnt/β-catenin signaling pathway through suppression of tumor cells, degradation of β-catenin, and inhibition of mRNA expression of c-Myc, survivin, and cyclin D1, so that it is very effective in the treatment of β-catenin overexpressing cancer diseases such as colorectal cancer, gastric cancer, breast cancer, and prostate cancer.

Description

A pharmaceutical composition for preventing or treating β-catenin overexpressed cancer disease comprising a NEURL gene, an expression vector containing the same, or a NEURL protein as an active ingredient, resulting from overexpression of β-catenin vector or NEURL protein}

The present invention provides a pharmaceutical composition for preventing or treating cancer caused by overexpression of β-catenin, comprising a NEURL gene, an expression vector containing the same, or a NEURL protein as an active ingredient.

The Wnt signaling pathway is widely involved in cell differentiation, embryonic patterning, proliferation and adult homeostasis. Genetic mutations in key components of the Wnt pathway, including adenomatous polyposis coli (APC), axis inhibitor protein 1 (AXIN1), and β-kanenin, are well-known causes of abnormal signaling leading to colon cancer. This genetic defect results in the accumulation of β-catenin in the nucleus, followed by activation of oncogenic target genes such as Cyclin D1 and c-Myc in association with the T-cell factor (TCF)/lymph enhancer-coupled factor transcriptional cofactor family. There is also increasing evidence that aberrant activation of the Wnt/β-catenin signaling pathway is a major driver of tumorigenesis in a variety of human cancers.

In addition to genetic mutations in components of the Wnt/β-catenin pathway, epigenetic events may contribute to aberrant activation of this signaling pathway in cancer cells. For example, transcriptional silencing associated with promoter hypermethylation of Wnt inhibitors such as secreted frizzled-related proteins (SFRPs), Wnt inhibitory factor-1 (WIF-1) and DKK-1 (DICKKOPF-1) has been reported in colorectal cancer. It became. To understand its biological function, restoration of expression of Wnt inhibitors such as SFRP1/2 inhibits Wnt/β-catenin signaling in colon cancer cells even in the presence of APC or β-catenin mutations. These findings suggest that epigenetic regulation of the Wnt/β-catenin pathway is a potential therapeutic target for human cancers, but most studies performed to date have mainly focused on direct disruption of TCF/β-catenin-mediated transcriptional activation in cancer cells. had put this

NEURL was originally identified as a neuronal gene important for the regulation of Notch signaling during cell fate decisions in Drosophila neurogenesis. Drosophila NEURL (dNEURL) contains two evolutionarily conserved neutralized homologous repeats (NHRs) and a Really Interesting New Gene (RING) domain for E3 ubiquitin ligase function. The human homolog of dNEURL is encoded at 10q25.1, a region that shows a frequent lack of heterozygosity in astrocytomas. Inactivation of NEURL is also associated with progression of astrocytoma. A recent study that transcriptional silencing of NEURL by promoter hypermethylation is associated with colon cancer progression supports the above notion. Although NEURL has been well characterized as a key component of the Notch pathway that regulates the internalization and degradation of Notch ligands through its E3 ligase function, the potential tumor suppressor function of NEURL in human cancers is not well defined.

Therefore, it is still necessary to develop a pharmaceutical composition for preventing or treating β-catenin overexpressing cancer diseases by finding out the tumor suppression function of NEURL.

1. Republic of Korea Patent Publication No. 2014-0052821 (published on May 7, 2014)

An object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer caused by overexpression of β-catenin, which contains a NEURL gene, an expression vector containing the same, or a NEURL protein as an active ingredient.

Another object of the present invention is to provide a reagent composition that inhibits the Wnt/β-catenin signaling pathway through β-catenin degradation, which includes a NEURL gene, an expression vector containing the same, or a NEURL protein as an active ingredient.

Another object of the present invention is to provide a composition for predicting the prognosis of cancer diseases due to overexpression of β-catenin, including an agent for measuring the methylation level of the NEURL gene.

Another object of the present invention is to provide a kit for predicting the prognosis of cancer diseases due to overexpression of β-catenin comprising the above composition.

Another object of the present invention is to measure the methylation level of the NEURL gene from a biological sample isolated from the subject; And to provide a method for providing information for predicting the prognosis of cancer diseases due to overexpression of β-catenin, comprising comparing the methylation level with the methylation level of the corresponding gene in a normal control group.

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating cancer caused by overexpression of β-catenin, comprising a NEURL gene, an expression vector containing the same, or a NEURL protein as an active ingredient.

In addition, the present invention provides a reagent composition that inhibits the Wnt/β-catenin signaling pathway through β-catenin degradation, which includes a NEURL gene, an expression vector containing the same, or a NEURL protein as an active ingredient.

In addition, the present invention provides a composition for predicting the prognosis of cancer diseases due to overexpression of β-catenin, including an agent for measuring the methylation level of the NEURL gene.

In addition, the present invention provides a kit for predicting the prognosis of cancer diseases due to overexpression of β-catenin comprising the above composition.

In addition, the present invention comprises the steps of measuring the methylation level of the NEURL gene from a biological sample isolated from the subject; and comparing the methylation level with the methylation level of the corresponding gene in a normal control group.

The present invention relates to a pharmaceutical composition for the prevention or treatment of β-catenin overexpressing cancer disease, comprising a NEURL gene, an expression vector containing the same, or a NEURL protein as an active ingredient, wherein the effect of NEURL on inhibiting the ability of cancer cells to form colonies and the β-catenin overexpression It has an excellent effect of inhibiting the Wnt signaling pathway through catenin degradation, and is very effective in treating β-catenin overexpressing cancer diseases such as colorectal cancer, gastric cancer, breast cancer, and prostate cancer.

1 shows the experimental results confirming that NEURL is epigenetically inactivated in colorectal cancer.
Figure 2 shows the experimental results confirming the tumor suppression effect in colorectal cancer cells according to NEURL activation.
Figure 3 shows the experimental results confirming the change in tumor size of the control group in which NEURL was not overexpressed and the NEURL group in which NEURL was overexpressed in LS174T cells.
Figure 4 shows the experimental results confirming that NEURL interacts with β-catenin.
Figure 5 shows the results of Western blot analysis of different β-catenin according to NEURL expression.
Figure 6 shows the experimental results confirming that NEURL interacts with β-catenin to interfere with Wnt/β-catenin signaling.
Figure 7 shows the experimental results confirming that β-catenin degradation occurs independently through the ubiquitination-proteasome pathway.
8 shows experimental results confirming that NEURL degrades β-catenin regardless of GSK3β or β-TrCP.
9 shows experimental results confirming that β-TrCP does not affect NEURL related to Wnt/TCF/β-catenin.
10 shows experimental results confirming the clinical significance of NEURL expression levels and β-catenin levels in colorectal cancer (hereinafter referred to as CRC) specimens.

Hereinafter, the present invention will be described in more detail.

The present invention provides a pharmaceutical composition for preventing or treating cancer caused by overexpression of β-catenin, comprising a NEURL gene, an expression vector containing the same, or a NEURL protein as an active ingredient.

The NEURL gene may be represented by the nucleotide sequence of SEQ ID NO: 1.

The NEURL protein may be represented by the amino acid sequence of SEQ ID NO: 2.

The cancer disease may be selected from the group consisting of colorectal cancer, gastric cancer, breast cancer and prostate cancer, but is not limited thereto.

The NEURL gene, an expression vector containing the same, or a NEURL protein can inhibit the Wnt/β-catenin signaling pathway through β-catenin degradation, and the β-catenin degradation can cause NEURL to ubiquitinate through the proteasome pathway. It can be done.

In another embodiment of the present invention, the pharmaceutical composition is a suitable carrier, excipient, disintegrant, sweetener, coating agent, swelling agent, lubricant, lubricant, flavoring agent, antioxidant, buffer, bacteriostatic agent, One or more additives selected from the group consisting of diluents, dispersants, surfactants, binders and lubricants may be further included. Specifically, carriers, excipients and diluents are lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil may be used, and solid dosage forms for oral administration include tablets, pills, powders, granules, and capsules. These solid preparations may be prepared by mixing at least one or more excipients, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., with the composition. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, solutions for oral use, emulsions, syrups, and the like, and various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included in addition to commonly used simple diluents such as water and liquid paraffin. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, and the like. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspensions. As a base material of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogeratin and the like may be used. According to one embodiment of the present invention, the pharmaceutical composition is intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, intrasternal, transdermal, intranasal, inhalational, topical, rectal, oral, intraocular or It can be administered to a subject in a conventional manner via the intradermal route. The dosage of the active ingredient according to the present invention may vary depending on the condition and weight of the subject, the type and severity of the disease, the drug type, the route and duration of administration, and may be appropriately selected by a person skilled in the art, and the daily dosage is 0.01 mg. /kg to 200 mg/kg, preferably 0.1 mg/kg to 200 mg/kg, and more preferably 0.1 mg/kg to 100 mg/kg. Administration may be administered once a day or divided into several times, and the scope of the present invention is not limited thereby.

In addition, the present invention provides a reagent composition that inhibits the Wnt/β-catenin signaling pathway through β-catenin degradation, which includes a NEURL gene, an expression vector containing the same, or a NEURL protein as an active ingredient.

In addition, the present invention provides a composition for predicting the prognosis of cancer diseases due to overexpression of β-catenin, including an agent for measuring the methylation level of the NEURL gene.

"Prognosis prediction" of the present invention means the act of predicting the course and outcome of a disease in advance. More specifically, prognosis is interpreted as meaning that the course of a disease after treatment may vary depending on the patient's physiological or environmental state, and that it refers to all activities that predict the course of a disease after treatment by comprehensively considering the patient's condition. It can be.

For the purpose of the present invention, the prediction of prognosis may be interpreted as an act of predicting the disease-free survival rate or survival rate of a cancer patient by predicting in advance the course of a disease and whether or not it is completely cured after drug treatment of a cancer patient. For example, predicting "good prognosis" means that the disease-free survival rate or survival rate of cancer patients after drug treatment is high, and the cancer patient is likely to be cured. Since the disease-free survival rate or survival rate of cancer patients after drug treatment is low, it means that there is a high possibility of cancer recurrence or death due to cancer from cancer patients.

In addition, the present invention provides a kit for predicting the prognosis of cancer diseases due to overexpression of β-catenin comprising the above composition.

In addition, the present invention comprises the steps of measuring the methylation level of the NEURL gene from a biological sample isolated from the subject; and

Provided is a method for providing information for predicting prognosis of cancer disease due to overexpression of β-catenin, comprising comparing the methylation level with the methylation level of the corresponding gene in a normal control group.

When the NEURL gene is hypermethylated, the prognosis of cancer disease due to overexpression of β-catenin may be poor.

The biological sample isolated from the subject is specifically a cell line isolated from the subject, histological slide, biopsy, formalin-fixed paraffin embedded (FFPE) tissue, body fluid, feces, urine , It may be plasma, serum, whole blood, isolated blood cells or blood, and more specifically blood, but is not limited thereto.

Hereinafter, examples and the like will be described in detail to aid understanding of the present invention. However, the following examples are merely illustrative of the content of the present invention, and the scope of the present invention is not limited to the following examples. Examples of the present invention and the like are provided to more completely explain the present invention to those skilled in the art.

<Experimental Example 1> Plasmid, siRNA and reagents

Complementary DNA (cDNA) encoding full-length human neuralization (NEURL) was amplified by reverse transcription-polymerase chain reaction (RT-PCR) from normal colonic RNA (Stratagene). For mammalian expression constructs, wild-type (hereinafter referred to as WT) NEURL and its inactive mutants were cloned into the pIRES-Neo3 vector (Invitrogen). HA containing WT NEURL and its inactive mutants were also cloned into the pEF1α-IRES-puro vector. NEURL siRNA, β-transducin repeat-containing protein (β-TrCP) siRNA and non-targeting siRNA (siControl) were purchased from Dharmacon. Recombinant human Wnt3a was purchased from R&D Systems. Cycloheximide (CHX), MG132, LiCl, cisplatin, leptomycin B and mitomycin C were purchased from Sigma-Aldrich. Glycogen synthase kinase-3 beta (GSK3β) specific inhibitor was purchased from Celecchem.

<Experimental Example 2> Generation of cell lines

Stable transfectants were established by subcloning the NEURL cDNA into the mammalian expression vector pIRES-NEO3 (Invitrogen) and pEF1α-puro containing an HA tag and neomycin or puromycin resistance genes. Individual clones were selected and maintained in the presence of G418 (4 μg/ml) or puromycin (2 μg/ml). Selected clones expressing NEURL or HA were detected by Western blot analysis. Stable control colonies were also generated at the same time. Off-target small hairpin RNA (shRNA) and NEURL-specific shRNA of the lentiviral vector pLKO.1 were purchased from Sigma-Aldrich. Appropriate double-stranded oligonucleotides (#1; 5′-CCG GCT CGG CTG TTA TGC TGT TCT CGA GAA CAG CAT AAC AGC CGA GTT TTT G-3′ and its complement) were cloned into the pLKO.1-puro-shRNA vector. (Sigma Aldrich). Using Lipofectamine 2000, SW480 cells were transfected with a plasmid or empty vector according to the manufacturer's instructions. NEURL shRNA-containing stable clones were selected using 1 μg/ml puromycin (Sigma Aldrich). Stable clones were isolated and endogenous NEURL knockdown was determined by Western blot analysis using an anti-NEURL antibody.

<Experimental Example 3> Cell culture and transfection using a plasmid

Human colorectal cancer cell lines (HCT116, SW480, RKO, Colo320 and DLD1) and human embryonic kidney cell line (293T) were obtained from the American Type Culture Collection (ATCC). Within 6 months of purchasing the cell lines, the relevant experiments were completed and regular microscopic examination was performed to confirm a stable phenotype. HCT116 and SW480 cells were maintained in McCoy's 5A medium (Wellgene). RKO and 293T cells were cultured in DMEM medium (Dulbecco's Modified Eagle Medium; Wellgene). Colo320 and DLD1 cells were maintained in RPMI medium (Wellgene). All culture media were supplemented with 10% fetal bovine serum (FBS; Hyclone, Logan, UT, USA) and 1% antibiotic antimycotic (Gibco). HCT116, SW480, RKO and 293T cells were transfected with Lipofectamine 2000 (Invitrogen). HCT116 and SW480 cells were transfected with siRNA using Lipofectamine RNAi MAX (Invitrogen).

<Experimental Example 4> Western blot

Lysates containing equal amounts of protein were separated using 4-12% Bis-TrisGel (Invitrogen) electrophoresis and then transferred to polyvinylidene difluoride membranes (GE Healthcare Life Sciences). NEURL (Sigma-Aldrich), Histone H3 (Abcam), Servivin (Abcam), Delta-Like 1 (Antibodies-online.com), β-catenin (BD Bioscience), Axin1, β-transducin repeat-containing proteins ( β-TrCP), phospho-β-catenin, cyclin D1 (cell signaling), HA (Covance), α-tubulin, Axin2, β-actin, c-Myc, claudin 1, E-cadherin, frizzled 7, GSK-3α/β, Jagged-1, Slug, Snail, SOX9, and Vimentin (Santa Cruz) were incubated overnight at 4°C.

<Experimental Example 5> Tissue Sample

We reviewed the medical records of colorectal cancer patients and collected data such as gender, age, other comorbid tumors, and recent follow-up results. Pathological characteristics evaluated included tumor location and size, histological subtype, differentiation, depth of invasion, lymphatic and perineural invasion, lymph nodes and distant metastases. All elements of this study were approved by the institutional review boards of Sapporo Medical University (Sapporo, Japan) and Asan Medical Center, University of Ulsan School of Medicine (Seoul, South Korea), and written informed consent was obtained from all patients. A total of 43 primary colorectal cancer specimens and 34 normal colorectal mucosal specimens were collected from 34 patients. All H&E stained slides of 94 surgically resected colorectal cancers were carefully reviewed, and areas of normal colonic epithelium and adenocarcinoma were identified.

<Experimental Example 6> TCGA data analysis

Genome-wide DNA methylation and expression data of the TCGA data set were obtained from the Cancer Genomics Browser (https://genome-cancer.ucsc.edu). The level 3 data set obtained through the Infinium HumanMethylation450 BeadChip was analyzed using R software (http://www.R-project.org/). Survival analysis was performed using the Cutoff Finder website (http://molpath.charite.de/cutoff/).

<Experimental Example 7> Co-immunoprecipitation (Co-IP)

500 μg of whole cell lysate was incubated with 1 μg anti-HA or anti-NURL conjugated to protein A/G-agarose beads (Sigma) for 12 hours at 4° C. with rotation. After washing with lysis buffer, protein was eluted from the beads by boiling in sodium dodecyl sulfate (SDS) sample buffer, separated by 10% SDS-polyacrylamide gel electrophoresis, and immunoblotting was performed with an appropriate antibody.

<Experimental Example 8> Double luciferase assay

CT116 and 293T cells were transfected with the FOP- and TOP-FLASH reporter plasmids together with pRK-TK. Luciferase activity was measured using the Dual Luciferase Report Assay Kit (Promega) according to the manufacturer's instructions. Relative Renilla luciferase activity was used to normalize transfection efficiency and firefly luciferase activity.

<Experimental Example 9> Chromatin Immunoprecipitation (ChIP)

PCR was performed using a C1000 Thermal Cycler (Biorad). The ChIP primers listed in Table 1 below were used. A β-catenin antibody (BD Biosciences) was used to immunoprecipitate β-catenin-related chromatin fragments.

gene Primer (5’-3’) source forward reverse ChIP primers c-myc GTATACGTGGCAATGCGTT TGAGTATAAATCATCGCAG Zhang, N. et al . Cancer Cell 20, 427-442 (2011) cyclinD1 CCGACTGGTCAAGGTAGGAA CCAAGGGGGTAACCCTAAAA Iguchi, H. et al . J Biol Chem 282, 19052-19061 (2007) Axin2 AGTGTGCAGGGAGCTCAGAT AGGTGGGGAGAGAGAAAAGG Kim, HA et al . J Clin Invest 122, 3248-3259 (2012) GAPDH TAGGCCTTTGCCTGAGCAGTCCGGTGT TTGAGGCCTGAGCTACGTGCGCCCGTAA Gan, XQ et al. J Cell Biol 180, 1087-1100 (2008)

<Experimental Example 10> Xenograft analysis

Female BALB/c nude mice (4 weeks old) were obtained from Central Labs. All animal protocols were reviewed and approved by the Institutional Animal Care and Use Committee of the Southeast Institute of Radiation Medicine. For HCT116 cells, 15 nude mice were randomly divided into 3 groups (mock, empty vector control and NEURL overexpressing; divided by n=5 for each group) and 5×10 ⁶ cells were subcutaneously inoculated into the mice. For SW480 cells, 30 nude mice were randomly divided into 6 groups (untreated group (control group and NEURL Knock Down group), and cisplatin 3mg/kg treated group by intraperitoneal (ip) injection 1 week after tumor cell introduction (control group and NEURL Knock Down group)). NEURL Knock Down group) and mitomycin C 3mg/kg treatment group by intraperitoneal (ip) injection 1 week after tumor cell introduction (control group and NEURL knock down group)). Tumors were monitored weekly, and tumor volume was estimated as follows: Tumor volume = (short axis) 2 x (long axis) x 0.5. After the experiment, mice were sacrificed and tumors were excised and weighed.

<Experimental Example 11> Immunofluorescence

HCT116 control and NEURL overexpressing cells, SW480 (control) and NEURL KD cells were fixed with 4% paraformaldehyde for 10 minutes at room temperature. Cells were then washed three times with PBS containing 0.1% Triton X-100 (PBST), permeabilized in 0.5% Triton X-100 in PBS, and washed once in PBST. Cells were then blocked in 20% FBS in PBS for 30 minutes at room temperature and then incubated with anti-NURL and anti-β-catenin antibodies for 1 hour at 37°C. Cells were then washed with PBS and incubated with anti-mouse IgG-FITC or Cy3 antibody (molecular probe) for 1 hour at room temperature. After rinsing with PBS, Hoechst 33342 or DAPI (4',6-diamidino-2-phenylindole; Sigma Aldrich) was added to the slides to counterstain nuclei. Slides were washed with PBS and mounted with Vectashield (Vectashield). Images were captured with an LSM700 confocal microscope (Zeiss) or a Nikon Eclipse Ni-U microscope using a DS-Fi2 digital camera (Nikon) supported by NIS-Elements BR 4.00.03 software (Nikon).

<Experimental Example 12> Configuration of tissue microarray

Tissue microarrays were used on formalin-fixed, paraffin-embedded tissue blocks of 94 colorectal cancer surgically resected using a manual tissue microarray (UniTMA Co Ltd, Seoul, Korea). An area containing 75% cancer cells without necrosis was selected as a line. Tissue array block contains 4 cores from cancer, 4 cores from primary colorectal cancer or 2 from primary, 2 from colorectal cancer that has metastasized to other organs, and 1 core from normal colonic mucosa .

<Experimental Example 13> Immunohistochemistry (IHC)

Serial 4 μm sections were applied to 3-aminopropyltriethoxysialene coated slides (Sigma), deparaffinized and rehydrated in xylene and serially diluted ethanol. Heat-induced antigen retrieval was performed after blocking endogenous peroxidase in 3% aqueous hydrogen peroxide. A benchmark autostainer (Ventana Medical Systems) was used according to the manufacturer's instructions. After incubation of primary antibodies at room temperature for 32 minutes, sections were labeled with an automated immunostaining system using the I-View Detection Kit (Ventana Medical Systems). Immunostained sections were lightly counterstained with hematoxylin, dehydrated in ethanol, and cleared in xylene.

<Experimental Example 14> Statistical Analysis

Statistical analysis was performed with SPSS version 17.0 for Windows (Chicago, IL, USA). To compare associations between immunohistochemical markers and clinicopathological parameters, x ² and Fisher's exact tests were performed. A p-value <0.05 was considered statistically significant.

<Experimental Example 15> Research Approval

All animal experiments were approved and performed in accordance with the Southeast Institute of Radiology (DIRAMS) Animal Care and Use Committee (DIRAMS AEC-2015-007). Patient samples were collected according to protocols approved by the institutional review boards of Sapporo Medical University (IRB no. 24-04, Sapporo, Japan) and Inje University School of Medicine (Busan, Korea). All patients provided written informed consent.

<Example 1> Confirmation of Downregulation by Hypermethylation of Human NEURL Promoter in Colorectal Cancer

To establish the epigenetic regulation of NEURL in colorectal cancer (CRC), we analyzed promoter methylation in primary colorectal cancer (CRC) using bisulfite pyrosequencing. As a result, according to FIG. 1A, an increase in NEURL methylation level was detected in primary colorectal cancer tumors (CRC) (27%, 12 out of 43). In contrast, the NEURL methylation level was low in normal colon tissue, confirming that NEURL has cancer-specific methylation.

In addition, bisulfite sequencing analysis was performed to confirm the methylation status in the selected tissue samples. As a result, according to FIG. 1B, it was confirmed that the promoter region of NEURL was densely methylated in CRC samples compared to normal tissues. In addition, according to Figure 1C, hypermethylation and expression of NEURL were confirmed in adjacent normal colon (n = 3) and primary tumor tissue (n = 3) including hypermethylated NEURL.

Therefore, it was confirmed that the regulation of NEURL is related to promoter hypermethylation by confirming that the expression level of NEURL is significantly different between colon cancer and adjacent normal tissues.

<Example 2> Confirmation of relationship between NEURL promoter hypermethylation and CRC patients

The clinical relevance of NEURL in colon tumors was estimated by analyzing the colon cancer sample data set from The Cancer Genome Atlas (TCGA). To evaluate the correlation between NEURL methylation status and clinical characteristics in colorectal cancer (CRC) patients. As a result, according to Fig. 1D, the results of Kaplan-Meier survival analysis of this probe confirmed that CRC patients with high levels of NEURL methylation were associated with worse survival than those with low levels of NEURL methylation.

<Example 3> Confirmation of tumor suppression effect in colon cancer according to recovery of NEURL expression

To investigate the possible role of NEURL as a tumor suppressor, we determined whether NEURL affects the growth rate of colon cancer cells. As a result, according to FIG. 2A, overexpression of NEURL by transient transfection in colon cancer cell lines exhibiting a deficiency of endogenous NEURL (RKO, DLD and HCT116) due to promoter hypermethylation strongly suppressed the colony formation ability of colon cancer cells. . To investigate the inhibitory effect of NEURL on cancer cell growth, we established HCT116 cells stably expressing NEURL. As a result, according to Figures 2B and 2C, compared to the mock or empty vector control group, NEURL-expressing HCT116 cells showed reduced proliferation efficiency. Also, according to Figures 2D and 2E, metastasis and invasion were reduced due to restoration of NEURL expression.

A mouse xenograft tumor assay was used to confirm the tumor suppressor function of NEURL in vivo. Tumor xenografts were established in 6-week-old female immunodeficient mice via injection of HCT116 cells stably expressing NEURL together with an empty vector control. As a result, according to Fig. 2F, the tumor volume was significantly smaller in mice injected with HCT116 cells stably expressing NEURL than in mice receiving control or mock-treated cells. This result was consistent with another colon cancer cell line, LS174T cells, overexpressing NEURL by transient transfection, as shown in FIG. 3 . In contrast, depletion of endogenous NEURL by shRNA in SW480 cells resulted in similar growth rates as control cells.

When the tumor volume reached 100 mm ³ , cisplatin or mitomycin C (hereinafter referred to as MMC) treatment was started. Mice were administered with 3 mg/kg cisplatin or MMC 1 week after the introduction of the tumor cells. As a result, according to Fig. 2G, chemotherapy treatment significantly inhibited the tumor growth of mice injected with control group SW480, whereas mice injected with NEURL-Knock Dowm (KD) tumor showed significant resistance to both drugs.

Therefore, these functional data suggest that NEURL acts as a tumor suppressor and that depletion of NEURL promotes tumor growth and negates its tumor suppressor effect in colon cancer.

<Example 4> Confirmation of whether NEURL is localized in the cytoplasm and interaction with β-catenin

We tested the localization of the NEURL protein in colon cancer cell lines. As a result, according to FIG. 3A, in colon cancer cell lines (HCT116, RKO, SW480 and Colo320), NEURL was mainly localized in the cytoplasm.

Experiments were conducted to determine whether NEURL could interact with β-catenin through its E3 ligase function and cross the Wnt/β-catenin pathway in colorectal cancer. The Wnt signaling pathway plays prominent and widespread roles in development, tissue homeostasis and cancer. Since a key step in this pathway is the regulation of cytosolic β-catenin levels, we investigated the potential role of NEURL in regulating β-catenin. We investigated whether NEURL and β-catenin interact at the physiological level and performed a co-immunoprecipitation (IP) assay. As a result, according to Figures 4B and 4C, the interaction between NEURL and β-catenin was detected in HCT116 cells overexpressing NEURL, and this interaction was also detected in SW480 cells expressing endogenous NEURL.

To understand the physiological relevance of the interaction between NEURL and β-catenin, we investigated the regulation of β-catenin stability by NEURL. As a result, according to Figures 4D and 4E, it was confirmed that the overexpression of NEURL in HCT116 cells resulted in a significant decrease in the level of β-catenin in both the cytoplasm and nucleus. In addition, according to FIG. 5 , it was confirmed that NEURL transiently transfected into HEK293 cells showed a decrease in β-catenin level. However, no significant change in β-catenin level was detected by siRNA targeting NEURL in endogenous NEURL-expressing SW480 cells.

Human NEURL, similar to its Drosophila homologue, is composed of three conserved domains: two neutralized homology repeat (NHR) domains and a carboxyl-terminal RING domain. The RING domain is required for E3 ubiquitin ligase activity. Whether NEURL promotes the degradation of β-catenin through ubiquitination was investigated. As a result, according to Figure 4F, polyubiquitination analysis showed that wild-type NEURL increased ubiquitination of β-catenin in 293T cells, whereas RING domain in the absence of NEURL showed no effect. In addition, according to Figure 4G, it was confirmed that the re-expression of NEURL in HCT116 cells increased the localization of β-catenin protein compared to the control group.

In addition, a series of cycloheximide (CHX)-based protein tracking was used to measure the protein stability of β-catenin in HCT116 cells stably overexpressing NEURL. As a result, according to Figure 4H, it was confirmed that human NEURL expression enhances the β-catenin degradation rate.

Therefore, through these results, it was confirmed that restoration of NEURL in colon cancer cells can lead to inhibition of the Wnt signaling pathway through interaction with β-catenin.

<Example 5> Confirmation of Wnt/β-Catenin Pathway Disruption by Restoration of NEURL

Aberrant activation of the Wnt signaling pathway is a prerequisite for tumorigenesis in colon cancer. To confirm the importance of NEURL on β-catenin signaling, a T-cell factor/β-catenin transcriptional assay was used to determine the transcriptional activity of β-catenin in the context of different NEURL conditions. As a result, according to FIG. 6A, the transcriptional activity of β-catenin was significantly suppressed by overexpression of NEURL in 293T cells. This requires the E3 ligase activity of NEURL, as inactive mutants of NEURL lacking the RING domain do not inhibit β-catenin activity. In addition, according to Figures 6B and 6C, it was confirmed that expression of NEURL in HCT116 and 293T cells suppressed β-catenin activity both in the absence and presence of Wnt3a, an agonist for Wnt activation. These data suggest that the constitutively active Wnt pathway from mutated β-catenin according to Figures 6D and 6E is HCT116 (one β-catenin allele and one WT allele deletion of Ser45) and LS174T (homozygously activated β). -catenin mutation) was blocked by overexpression of NEURL in all cells.

We also investigated whether functional expression of NEURL resulted in downregulation of β-carnenin target genes including c-Myc, subvivin and cyclin D1 at the mRNA level. As a result, according to Fig. 6F, mRNA levels of 12 target genes including c-Myc, subvivin and cyclin D1 were significantly down-regulated by NEURL expression. In addition, according to Figure 6G, consistent with the mRNA levels of these target genes, it was confirmed that the protein level was significantly reduced in cells stably expressing NEURL when compared to the control group. In addition, according to Fig. 6H, immunofluorescence analysis confirmed significantly reduced cellular levels of c-Myc and cyclin D1 in NEURL expressing cells. Moreover, according to Figure 6I, chromatin immunoprecipitation (ChIP) analysis showed a dramatic decrease in β-catenin binding to target promoters in NEURL expressing cells, confirming that this decrease was increased by NEURL depletion in control cells.

Therefore, these results confirm that NEURL down-regulates the level of β-catenin in colon cancer.

<Example 6> Confirmation of whether the abnormal Wnt/β-catenin pathway induced by NEURL is independent of GSK3β or β-TrC

To determine whether downregulation of β-catenin is mediated by the ubiquitin-proteosome pathway, immunoblot analysis was performed in the presence or absence of the proteasome inhibitor MG132. As a result, according to FIG. 7 , β-catenin expression was hardly detected in NEURL-expressing HCT116 cells. However, it can be confirmed that MG132 blocked NEURL-mediated β-catenin degradation in NEURL-expressing HCT116 cells. Through this, it was confirmed that the degradation of β-catenin by NEURL is mediated through the ubiquitination-proteasome pathway.

Phosphorylation of β-catenin by GSK3β followed by binding to β-TrCP results in β-catenin degradation in the canonical Wnt pathway. To investigate whether GSK-3β or β-TrCP is required for NEURL's involvement in β-catenin degradation, the GSK3β inhibitor BIO (6-bromoindirubin-3'-oxime) was used, which specifically inhibits GSK3β activity and Destruction complexes are inactivated, resulting in accumulation of active β-catenin As a result, according to Figures 8A to 8C, stable overexpression of NEURL in HCT116 cells reduces β-catenin protein level and immunofluorescence and immunoblot analysis show BIO In contrast to HCT116 cells, RKO cells have very low levels of basal β-catenin due to a functional Axin-disrupting complex, but BIO is a stable β-catenin in the cytoplasm and nucleus of RKO cells. Since RKO cells resulted in the accumulation of active β-catenin in the presence of BIO, a transient transfection assay was performed using WT NEURL and a mutant NEURL without RING domain. The results are shown in Figures 7 and 8B. According to the results, overexpression of NEURL reduced β-catenin levels, but transfection with inactive NEURL lacking the RING domain did not, suggesting that NEURL-mediated downregulation of β-catenin protein is independent of GSK3β activity. there was.

To determine whether the degradation of β-catenin mediated by NEURL occurs through a mechanism different from that of β-TrCP, we analyzed β-TrCP by small interfering RNA (siRNA) target depletion of β-TrCP stably overexpressing NEURL HCT116 cells. -blocked TrCP activity. As a result, according to FIGS. 8D, 8E and 9, it was confirmed that β-TrCP did not additionally affect NEURL-mediated β-catenin degradation and target genes. In addition, according to Fig. 8F, it was observed that NEURL itself significantly inhibited β-catenin transcriptional activity in HCT116 cells and stably overexpressed NEURL and depleted β-TrCP. Furthermore, according to Fig. 8G, it was confirmed that β-TrCP did not affect NEURL-mediated degradation of β-catenin in RKO cells treated with BIO.

Therefore, it was confirmed that the NEURL-mediated β-catenin degradation capacity did not require functional GSK3β or β-TrCP.

<Example 7> Confirmation of clinical significance of β-catenin level and NEURL level in CRC

To determine whether β-catenin and NEURL levels are of clinical relevance, we investigated the NEURL and β-catenin expression levels in serial sections of 98 primary CRC specimens by IHC analysis. As a result, according to FIG. 10A, lack of NEURL expression was observed in 18% (17 out of 93) of surgically resected colorectal adenocarcinomas. Intact NEURL expression was observed with cytoplasmic β-catenin staining, but NEURL expression was not associated with more nuclear β-catenin staining. Representative IHC data showed that the level of NEURL was inversely proportional to the level of active β-catenin expression in CRC tumors. In addition, according to FIG. 10B, the results of Kaplan-Meier analysis showed that CRC patients with NEURL expression deficiency (5-year survival rate, 50.5%) had a shorter survival period and shorter survival than NERUL expression patients (79.0%, P=0.069, log=rank test). could be confirmed to be related. In addition, according to Fig. 10C, the recurrence-free survival rate (5-year survival rate, 27.5%) of CRC patients with deficient NEURL expression was significantly lower than that of patients with intact NEURL expression (64.1%, P=0.0027, log=rank test).

Therefore, through this, it was confirmed that NEURL, which is inversely proportional to active β-catenin, can be a potential prognostic marker and a new therapeutic target for CRC patients.

The above description of the present invention is for illustrative purposes, and those skilled in the art can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting.

The scope of the present invention is indicated by the following claims, and all changes or modifications derived from the meaning and scope of the claims and equivalent concepts should be interpreted as being included in the scope of the present invention.

<110> University of Inje Foundation For Industry Cooperation <120> Pharmaceutical composition for preventing or treating beta catenin overexpression cancer disease comprising NEURL, NEURL gene expression vector or NEURL protein <130> ADP-2022-0256 <150> KR 10-2021-0091362 <151> 2021-07-13 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 1725 <212> DNA <213> artificial sequence <220> <223> 1: Nucleic Sequence of NEURL, 2: Amino acid Sequence of NEURL <400> 1 atgggtaaca acttctccag tatcccctcg ctgccccgag gaaacccgag ccgcgcgccg 60 cggggccacc cccagaacct caaagactct atcgggggcc ccttccccgt cacttctcac 120 cgatgccacc acaagcagaa gcactgtccg gcagtgctgc ccagcggggg gctcccagcc 180 acgccgctgc tcttccaccc gcacaccaag ggctcccaga tcctcatgga cctcagccac 240 aaggctgtca agaggcaggc cagcttctgc aacgccatca ccttcagcaa ccgcccggtc 300 ctcatctacg agcaagtcag gctgaagatc accaagaagc agtgctgctg gagcggggcc 360 ctgcggctgg gcttcaccag caaggacccg tcccgcatcc accctgactc gctgcccaag 420 tacgcctgcc ccgacctggt gtcccagagt ggcttctggg ccaaggcgct gcctgaggag 480 tttgccaatg agggcaacat catcgcattc tgggtggaca agaagggccg tgtcttccac 540 cgcatcaacg actcggctgt tatgctgttc ttcagcgggg tccgcacggc cgacccgctc 600 tgggccctgg tggacgtcta cggcctcacg cggggcgtcc agctgcttga tagcgagctg 660 gtgctcccgg actgtctgcg gccgcgctcc ttcaccgccc tgcggcggcc gtcgctgcgg 720 cgcgaggcgg acgacgcgcg cctctcggtg agcctatgcg acctcaacgt gccgggcgcg 780 gacggcgacg aggccgcgcc ggccgccggc tgccccatcc cgcagaactc actcaactcg 840 cagcacagcc gcgcgctgcc ggcgcagctc gacggcgacc tgcgtttcca cgccctgcgc 900 gccggcgcgc acgtccgcat cctcgacgag cagacggtgg cgcgcgtgga gcacgggcgc 960 gacgagcgcg cgctcgtctt caccagccgg cccgtgcgcg tggccgagac catcttcgtc 1020 aaggtcacgc gctcgggtgg cgcgcggccc ggcgcgctgt cgttcggcgt caccacgtgc 1080 gaccccggca cgctgcggcc ggccgacctg cctttcagcc ctgaggccct ggtggaccgc 1140 aaggaattct gggccgtgtg ccgcgtgccc gggcccctgc acagcggcga catcctgggc 1200 ctggtggtca acgccgacgg cgagctgcac ctcagccaca atggcgcggc cgccggcatg 1260 cagctgtgcg tggacgcctc gcagccgctt tggatgctct tcggcctgca cgggaccatc 1320 acgcagatcc gcatcctcgg ctccactatc ctggccgagc ggggtatccc atcactcccc 1380 tgctcccctg cctccacgcc aacctcgccc agtgccctgg gcagccgcct gtctgacccc 1440 ttgctcagca cgtgcagctc tggccctctg ggtagctctg ctggtgggac agcccccaat 1500 tcgccagtga gcctgcccga gtcgccagtg accccaggtc tgggccagtg gagcgatgag 1560 tgcaccattt gctatgaaca cgcggtggac acggtcatct acacatgtgg ccacatgtgc 1620 ctctgctacg cctgtggcct gcgcctcaag aaggctctgc acgcctgctg ccccatctgc 1680 cgccgcccca tcaaggacat catcaagacc taccgcagct cctag 1725 <210> 2 <211> 574 <212> PRT <213> artificial sequence <220> <223> 1: Nucleic Sequence of NEURL, 2: Amino acid Sequence of NEURL <400> 2 Met Gly Asn Asn Phe Ser Ser Ile Pro Ser Leu Pro Arg Gly Asn Pro 1 5 10 15 Ser Arg Ala Pro Arg Gly His Pro Gln Asn Leu Lys Asp Ser Ile Gly 20 25 30 Gly Pro Phe Pro Val Thr Ser His Arg Cys His His Lys Gln Lys His 35 40 45 Cys Pro Ala Val Leu Pro Ser Gly Gly Leu Pro Ala Thr Pro Leu Leu 50 55 60 Phe His Pro His Thr Lys Gly Ser Gln Ile Leu Met Asp Leu Ser His 65 70 75 80 Lys Ala Val Lys Arg Gln Ala Ser Phe Cys Asn Ala Ile Thr Phe Ser 85 90 95 Asn Arg Pro Val Leu Ile Tyr Glu Gln Val Arg Leu Lys Ile Thr Lys 100 105 110 Lys Gln Cys Cys Trp Ser Gly Ala Leu Arg Leu Gly Phe Thr Ser Lys 115 120 125 Asp Pro Ser Arg Ile His Pro Asp Ser Leu Pro Lys Tyr Ala Cys Pro 130 135 140 Asp Leu Val Ser Gln Ser Gly Phe Trp Ala Lys Ala Leu Pro Glu Glu 145 150 155 160 Phe Ala Asn Glu Gly Asn Ile Ile Ala Phe Trp Val Asp Lys Lys Gly 165 170 175 Arg Val Phe His Arg Ile Asn Asp Ser Ala Val Met Leu Phe Phe Ser 180 185 190 Gly Val Arg Thr Ala Asp Pro Leu Trp Ala Leu Val Asp Val Tyr Gly 195 200 205 Leu Thr Arg Gly Val Gln Leu Leu Asp Ser Glu Leu Val Leu Pro Asp 210 215 220 Cys Leu Arg Pro Arg Ser Phe Thr Ala Leu Arg Arg Pro Ser Leu Arg 225 230 235 240 Arg Glu Ala Asp Asp Ala Arg Leu Ser Val Ser Leu Cys Asp Leu Asn 245 250 255 Val Pro Gly Ala Asp Gly Asp Glu Ala Ala Pro Ala Ala Gly Cys Pro 260 265 270 Ile Pro Gln Asn Ser Leu Asn Ser Gln His Ser Arg Ala Leu Pro Ala 275 280 285 Gln Leu Asp Gly Asp Leu Arg Phe His Ala Leu Arg Ala Gly Ala His 290 295 300 Val Arg Ile Leu Asp Glu Gln Thr Val Ala Arg Val Glu His Gly Arg 305 310 315 320 Asp Glu Arg Ala Leu Val Phe Thr Ser Arg Pro Val Arg Val Ala Glu 325 330 335 Thr Ile Phe Val Lys Val Thr Arg Ser Gly Gly Ala Arg Pro Gly Ala 340 345 350 Leu Ser Phe Gly Val Thr Thr Cys Asp Pro Gly Thr Leu Arg Pro Ala 355 360 365 Asp Leu Pro Phe Ser Pro Glu Ala Leu Val Asp Arg Lys Glu Phe Trp 370 375 380 Ala Val Cys Arg Val Pro Gly Pro Leu His Ser Gly Asp Ile Leu Gly 385 390 395 400 Leu Val Val Asn Ala Asp Gly Glu Leu His Leu Ser His Asn Gly Ala 405 410 415 Ala Ala Gly Met Gln Leu Cys Val Asp Ala Ser Gln Pro Leu Trp Met 420 425 430 Leu Phe Gly Leu His Gly Thr Ile Thr Gln Ile Arg Ile Leu Gly Ser 435 440 445 Thr Ile Leu Ala Glu Arg Gly Ile Pro Ser Leu Pro Cys Ser Pro Ala 450 455 460 Ser Thr Pro Thr Ser Pro Ser Ala Leu Gly Ser Arg Leu Ser Asp Pro 465 470 475 480 Leu Leu Ser Thr Cys Ser Ser Gly Pro Leu Gly Ser Ser Ala Gly Gly 485 490 495 Thr Ala Pro Asn Ser Pro Val Ser Leu Pro Glu Ser Pro Val Thr Pro 500 505 510 Gly Leu Gly Gln Trp Ser Asp Glu Cys Thr Ile Cys Tyr Glu His Ala 515 520 525 Val Asp Thr Val Ile Tyr Thr Cys Gly His Met Cys Leu Cys Tyr Ala 530 535 540 Cys Gly Leu Arg Leu Lys Lys Ala Leu His Ala Cys Cys Pro Ile Cys 545 550 555 560 Arg Arg Pro Ile Lys Asp Ile Ile Lys Thr Tyr Arg Ser Ser 565 570

Claims (11)

A pharmaceutical composition for preventing or treating cancer caused by overexpression of β-catenin, comprising a NEURL gene, an expression vector containing the same, or a NEURL protein as an active ingredient. The pharmaceutical composition according to claim 1, wherein the NEURL gene is represented by the nucleotide sequence of SEQ ID NO: 1. The pharmaceutical composition according to claim 1, wherein the NEURL protein is represented by the amino acid sequence of SEQ ID NO: 2. The pharmaceutical composition according to claim 1, wherein the cancer disease is selected from the group consisting of colorectal cancer, gastric cancer, breast cancer and prostate cancer. The pharmaceutical composition according to claim 1, wherein the NEURL gene, the expression vector containing the same, or the NEURL protein inhibits the Wnt/β-catenin signaling pathway through β-catenin degradation. The pharmaceutical composition according to claim 5, wherein the β-catenin is decomposed by NEURL ubiquitination-proteasome pathway. A reagent composition for inhibiting the Wnt/β-catenin signaling pathway through β-catenin degradation, comprising a NEURL gene, an expression vector containing the same, or a NEURL protein as an active ingredient. A composition for predicting the prognosis of cancer diseases due to overexpression of β-catenin, comprising an agent for measuring the methylation level of a NEURL gene. A kit for predicting cancer disease prognosis due to overexpression of β-catenin, comprising the composition of claim 8. Measuring the methylation level of the NEURL gene from a biological sample isolated from the subject; and
A method for providing information for predicting prognosis of cancer disease due to overexpression of β-catenin, comprising comparing the methylation level with the methylation level of the corresponding gene in a normal control group. 11. The method according to claim 10, wherein when the NEURL gene is hypermethylated, the prognosis of cancer due to overexpression of β-catenin is poor.

Images