KR20230009623A - Composition for treating of COVID-19-associated cytokine storm comprising Lung-selective 25-hydroxycholesterol nanoparticle - Google Patents

Abstract

The present invention relates to a COVID-19-related cytokine storm inhibitory composition comprising a lung-targeted 25-hydroxy cholesterol nanohybrid, which protects the lungs from SARS-CoV-2 infection, and thus inhibits and prevents aggravation by cytokine storm to play an important role in alleviating morbidity and mortality.

Description

Composition for treating COVID-19-associated cytokine storm comprising Lung-selective 25-hydroxycholesterol nanoparticle}

The present invention relates to a COVID-19 related cytokine storm inhibitory composition comprising a lung-targeting 25-hydroxycholesterol nanohybrid, and more particularly, to a composition comprising 25-hydroxycholesterol and didodecyldimethylammonium bromide (DDAB) nanohybrid (25 -HC@DDAB) to a lung-targeted COVID-19 related cytokine storm inhibitory composition.

Since the outbreak of COVID-19 in late 2019, scientists have been working to develop treatments for the coronavirus (COVID-19), most of which are aimed at eliminating severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) itself. is focusing on However, immunocompromised patients are particularly susceptible to SARS-CoV-2, and severe complications such as cytokine release syndrome (CRS) occur, which triggers an excessive and uncontrolled inflammatory response. It is very important to understand the relationship between viruses and inflammation.

Recently, it has been reported that SARS-CoV-2 infection reduces the activity and production of Type I interferons, which causes aggravation of inflammation, chemotaxis of monocytes, multiple organ failure and death (Hadjadj et al. , 2020). Accordingly, the possibility of using type I interferon levels as a criterion for selecting high-risk patients with severe COVID-19 is being raised. Type I interferon is a group of interferon proteins that help regulate the activity of the immune system, and type I interferon levels are known to be closely related to the regulation of cholesterol 25-hydroxylase (CH25H) expression. CH25H is an enzyme that catalyzes the hydroxylation of cholesterol at carbon position 25 to produce 25-hydroxy cholesterol (25-HC). Cytokines, such as type I interferon, have an inhibitory effect on the inflammatory response induced by viral infection. In other words, during viral infection, the expression of CH25H increases through the induction of type I IFN through the interferon (IFN) receptor and the JAK/STAT1 pathway (McDonald and Russell, 2010), and the 25-HC produced at this time is a sterol regulatory element binding protein 2 (SREBP2)-mediated cytokine production and apoptosis (Xiao et al., 2013; Reboldi et al., 2014). It has also been reported that CH25H-deficient mice are highly susceptible to septic shock with increased neutrophil and inflammasome activity through SREBP2 activation (Reboldi et al., 2014).

On the other hand, it has been well known since the 1950s that viral infections lower cholesterol levels (Jacobs et al., 1997), and 25-HC has broad-spectrum antiviral activity against coronaviruses, including porcine infectious diarrhea virus (PEDV) and transmissible gastroenteritis virus (TGEV). It is also known to have activity (Zhang et al., 2019). However, studies on the effect of 25-HC on the inflammatory response induced during viral infection are insignificant.

Korean Patent Registration No. 2126038, a prior art, describes a composition for preventing or treating X-linked adrenoleukodystrophy containing 25-hydrocholesterol or a derivative thereof as an active ingredient, but there are differences in the purpose, configuration and effect of the present invention. there is. In addition, Korean Patent Publication No. 2008-0066962 describes an agent that binds to a target in lung tissue for treating respiratory diseases, but there are also differences in the configuration and effects of the present invention.

Korean Patent No. 2126038, a composition for preventing or treating X-linked adrenoleukodystrophy containing 25-hydrocholesterol or its derivatives as an active ingredient, registered on June 17, 2020. Korean Patent Publication No. 2008-0066962, an agent that binds to a target in lung tissue for treating respiratory diseases, published on July 17, 2008.

J. Hadjadj, N. Yatim, L. Barnabei, A. Corneau, J. Boussier, N. Smith, H. Pere, B. Charbit, V. Bondet, C. Chenevier-Gobeaux, P. Breillat, N. Carlier, R. Gauzit, C. Morbieu, F. Pene, N. Marin, N. Roche, T.A. Szwebel, S.H. Merkling, J.M. Treluyer, D. Veyer, L. Mouthon, C. Blanc, P.L. Tharaux, F. Rozenberg, A. Fischer, D. Duffy, F. Rieux-Laucat, S. Kerneis, B. Terrier, Impaired type I interferon activity and inflammatory responses in severe COVID-19 patients, Science, 369 (2020) 718 -724. J.G. McDonald, D.W. Russell, J. Leukoc. Biol., Editorial: 25-Hydroxycholesterol: a new life in immunology, 88 (2010) 1071. H. Xiao, M. Lu, T.Y. Lin, Z. Chen, G. Chen, W.C. Wang, T. Marin, T. P. Shentu, L. Wen, B. Gongol, W. Sun, X. Liang, J. Chen, H.D. Huang, J.H. Pedra, D.A. Johnson, J.Y. Shyy, Sterol Regulatory Element Binding Protein 2 Activation of NLRP3 Inflammasome in Endothelium Mediates Hemodynamic-Induced Atherosclerosis Susceptibility, Circulation, 128 (2013) 632-642. A. Reboldi, E.V. Dang, J.G. McDonald, G. Liang, D. W. Russell, J.G. Cyster, 25-Hydroxycholesterol suppresses interleukin-1-driven inflammation downstream of type I interferon, Science, 345 (2014) 679-684. D.R. Jacobs, Jr., B. Hebert, P.J. Schreiner, S. Sidney, C. Iribarren, S. Hulley, Reduced cholesterol is associated with recent minor illness: the CARDIA Study. Coronary Artery Risk Development in Young Adults, Am J Epidemiol, 146 (1997) 558-564. Y. Zhang, Z. Song, M. Wang, M. Lan, K. Zhang, P. Jiang, Y. Li, J. Bai, X. Wang, Cholesterol 25-hydroxylase negatively regulates porcine intestinal coronavirus replication by the production of 25-hydroxycholesterol, Vet. Microbiol., 231 (2019) 129-138. K. -i. Kusumoto, T. Ishikawa, Didodecyldimethylammonium bromide (DDAB) induces caspase-mediated apoptosis in human leukemia HL-60 cells, J. Control. Release, 147 (2010) 246-252. D. Rittirsch, M.S. Huber-Lang, M.A. Flierl, P.A. Ward, Immunodesign of experimental sepsis by cecal ligation and puncture, Nat. Protoc., 4 (2009) 31-36.

An object of the present invention is to provide a COVID-19 related cytokine storm inhibitor composition comprising a lung-targeting 25-hydroxycholesterol nanohybrid.

In order to solve the above problems, the present invention provides nanohybrids (NHs) containing dimethyldioctadecylammonium bromide (DDAB) and 25-hydroxycholesterol (25-HC).

Dimethyldioctadecylammonium bromide (DDAB) is a double-chain quaternary ammonium surfactant that forms unilamellar vesicles (ULV) or multilamellar vesicles in water. Nanohybrids (NHs) containing dimethyldioctadecylammonium bromide (DDAB) and 25-hydroxycholesterol (25-HC) of the present invention are lipids with a hydrophilic head and a hydrophobic tail. 25-HC is formed in the form of a depression inside the layer of the closed endoplasmic reticulum formed by the composed DDAB as a layered lipid bilayer. The nanohybrid may be formed into micelles, microspheres, liposomes, and multilayered liposomes, but is not limited thereto.

The nanohybrids (NHs) are 25-hydroxycholesterol (25-hydroxycholesterol, 25-HC) and dimethyldioctadecylammonium bromide (Dimethyldioctadecylammonium bromide, DDAB) in a weight ratio of 1: 2-6 Nanohybrids, characterized in that (Nanohybrids, NHs).

The nanohybrids (NHs),

Step (1) dissolving dimethyldioctadecylammonium bromide (DDAB) and 25-hydroxycholesterol (25-HC) in methanol and ethanol, respectively;

mixing DDAB and 25-HC dissolved in step 1 and evaporating at 70 ° C. for 3 hours (2); and

It may be prepared by a method for preparing nanohybrids (NHs) including the step (3) of adding double deionized water (DDW) to the solids remaining after evaporation and resuspending them by ultrasonic treatment.

The nanohybrids (NHs) may have a weight ratio of 25-hydroxycholesterol (25-HC) and dimethyldioctadecylammonium bromide (DDAB) in a weight ratio of 1:2 to 6. If the weight ratio is lower than 1:2, the amount of 25-HC delivered may be inefficient or the size of the nanohybrid may be too large. If the weight ratio is greater than 1:6, the surface charge of the nanohybrid is too high, which is not desirable for targeting. . Preferably, in nanohybrids (NHs), the weight ratio of 25-hydroxycholesterol (25-HC) and dimethyldioctadecylammonium bromide (DDAB) is 1:4.

The nanohybrids (NHs) are characterized in that they are selectively localized to one or more organs selected from the group consisting of liver, spleen, kidney, heart and lung. In particular, the nanohybrids (NHs) are more selectively localized to the liver, kidneys and lungs, and the nanohybrids (NHs) are selectively localized to the lungs. Accordingly, the present invention provides nanohybrids (NHs) characterized in that they are selectively localized to the lungs. However, it is not limited thereto.

The present invention provides a composition for inhibiting or preventing a cytokine storm comprising the nanohybrids (NHs). 25-HC included in the nanohybrid can act as an important inhibitor of sterol regulatory element binding protein 2 (SREBP2)-mediated cytokine production and apoptosis, thereby suppressing increased neutrophil and inflammasome activity through SREBP2 activation. can In particular, the nanohybrids (NHs) of the present invention can selectively localize to the lungs and inhibit SREBP2 activity in lung tissue.

Inhibition of SREBP2 activity can lead to inhibition of the expression or activity of Nox2, Nrlp3, IL1b, Mcp1, Icam1 and Srebp2 associated with SREBP2.

The composition for inhibiting or preventing a cytokine storm of the present invention is characterized by delivering 25-hydroxycholesterol (25-HC) to a localized organ.

In the present invention, the cytokine storm refers to a large-scale inflammatory reaction caused by an excessive response of the body's immune system against bacteria or viruses infiltrating from the outside by attacking normal cells, and is also referred to as cytokine release syndrome or gocytokine. It is called hypercytoinemia. In other words, it is a reaction in which excessive fever occurs due to the excessive secretion of cytokines, which are immune substances, due to the penetration of external viruses and the like. As a result, normal cells may be attacked by immune cells, and secondary damage such as organ failure may occur in the process of destroying body tissues due to an overreaction of the immune system due to a cytokine storm.

The cytokine storm may be caused by sepsis caused by bacterial or viral infection.

The viruses that induce the cytokine storm are COVID-19 (coronavirus disease 2019, SARS-CoV-2), Spanish flu (H1N1), avian flu (H5N1), Middle East Respiratory Syndrome (MERS-CoV), SARS -Can be corona (SARS-CoV), but is not limited thereto.

Bacteria that induce the cytokine storm are Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae, Neisseria meningitidis, Klebsiella pneumoniae, Escherichia coli coli) and one or more from the group consisting of group B streptococci, but is not limited thereto.

The composition for inhibiting or preventing the cytokine storm is intracellular IL-6, CRP, TNF-alpha, IL-1 beta, IFN-gamma, IL-8, CCL2, BDNF, CCL7, IL-4, IL-3, GM -CSF, M-CSF, IL-10, IL-5, CXCL9, G-CSF, IL-15, IL-16, IL-22, IL-27, IL-17A, MMP-9, CXCL 10, IL- 11, CCL3, PF4, Cystatin C, IL-13, TARC, TGF-alpha, HGF, IL-1 alpha, FGF-19, IL-31, PDGF-AA, GRO-alpha, IL-12, MPO, RBP4, Chitinase 3-like 1, EMMPRIN, CD14, DPPIV, Cripto-1, Angiopoetin-2, Kallikrein 3, MIF, MIP-3 beta, PDGF-AB/BB, Leptin, Endoglin, Lipocalin-2, uPAR, IL-19, It is characterized by reducing one or more selected from the group consisting of TFF3, Resistin, and Complement Factor D.

The present invention provides a COVID-19 related cytokine storm inhibitor composition comprising a lung-targeting 25-hydroxy cholesterol nanohybrid.

The composition for inhibiting or preventing a cytokine storm of the present invention can reduce the permeability of inflammatory blood vessels.

In addition, the composition for inhibiting or preventing a cytokine storm of the present invention is selected from the group consisting of C-reactive protein (CRP), lactate dehydrogenase (LDH), alanine aminotransferase (ALT), aspartic acid aminotransferase (AST) and creatinine One or more markers of tissue damage may be reduced.

The composition for inhibiting or preventing a cytokine storm of the present invention may reduce transcription related to one or more SREBP2 selected from the group consisting of Nox2, Nrlp3, IL1b, Mcp1, Icam1 and Srebp2.

The composition for inhibiting or preventing the cytokine storm may be provided as a pharmaceutical composition. The composition for inhibiting or preventing the cytokine storm may be added in an amount of preferably 0.001 to 50% by weight, more preferably 0.001 to 40% by weight, and most preferably 0.001 to 30% by weight based on the total weight.

The pharmaceutical composition is formulated in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, liquids, aerosols, external preparations, suppositories and sterile injection solutions according to conventional methods, respectively. can Carriers, excipients and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, surfactants, sweeteners, and acidulants. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspensions. As a base for the suppository, witepsol, macrogol, tween-61, cacao butter, laurin paper, glycerogeratin, and the like may be used.

The dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, and weight of the subject to be treated, the specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration, and the prescriber's judgment. Determination of dosage based on these factors is within the level of those skilled in the art, and generally dosages range from 0.01 mg/kg/day to approximately 500 mg/kg/day. A preferred dose is 0.1 mg/kg/day to 200 mg/kg/day, and a more preferred dose is 1 mg/kg/day to 200 mg/kg/day. Administration may be administered once a day, or may be administered in several divided doses. The dosage is not intended to limit the scope of the present invention in any way.

The pharmaceutical composition of the present invention can be administered to mammals such as rats, livestock, and humans through various routes. All modes of administration are contemplated, eg oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine intrathecal or intracerebrovascular injection and dermal application. Nanohybrids (NHs) containing dimethyldioctadecylammonium bromide (DDAB) and 25-hydroxycholesterol (25-HC) of the present invention, or inhibition or prevention of cytokine storms containing the same Since the composition for use has little toxicity and side effects, it is a drug that can be safely used even when taken for a long period of time for preventive purposes.

The present invention relates to a COVID-19-related cytokine storm inhibitory composition comprising a lung-targeting 25-hydroxycholesterol nanohybrid, which protects the lungs from SARS-CoV-2 infection and inhibits aggravation by cytokine storm Prevention can play an important role in improving morbidity and mortality.

Figure 1 shows lung targeting of 25-HC@DDAB NHs. a. Physicochemical properties of Cy5.5-loaded 25-HC@EPC (negatively-charged), 25-HC@DDAB/EPC (less positively-charged), and 25-HC@DDAB (high positively-charged) NHs. b. Size distribution diagram of NHs. c. Ex vivo images of each organ of Cys5.5-loaded NHs 6 h after intravenous injection of each NH. d. Fluorescence efficiency of each organ. e. Whole-body images of Cys5.5-loaded NHs in sepsis model mice. f. In vitro images of Cys5.5-loaded NHs in each organ in a sepsis model mouse.
Figure 2 is a drawing showing the preparation and evaluation of the lung-targeted 25-HC@DDAB nanohybrid. a. Fabrication schematic of 25-Hydroxycholesterol@Didodecyldimethylammonium bromide (25-HC@DDAB) nanohybrid, b. Transmission electron microscopy (TEM) image of the 25-HC@DDAB nanohybrid. (length of scale bar is 100 nm), c. Table showing nanohybrid characteristics of mean hydrodynamic diameter, polydispersity index, and zeta potential values of 25-HC@DDAB. d. Size distribution diagram of the 25-HC@DDAB nanohybrid. e. Time-lapse ex vivo images of liver, spleen, kidney, heart and lung harvested after intravenous administration of Cy5.5-loaded 25-HC@DDAB. (n = 5). f. Relative radiative efficiency of each organ. g. A graph comparing the average radiation efficiency in the lungs of the Cy5.5-added nanohybrid treated group versus the free Cy5.5 treated group as a function of time after intravenous administration of Cy5.5-loaded 25-HC@DDAB.
Figure 3 is a result confirming the cytotoxicity of 25-HC@DDAB in mouse lung endothelial cells. a. Filipin staining of 25-HC@DDAB-treated mouse lung endothelial cells for visualization of intracellular cholesterol. b Results of flow cytometric analysis of 25-HC@DDAB-treated mouse lung endothelial cells at each concentration.
4 is a result of confirming the cytotoxicity of 25-HC@DDAB in HUVECs and MRC5 cell lines.
5 is an in vivo toxicity test result of 25-HC@DDAB of the present invention. a. Changes in organ damage markers 48 hours after administration of 25-HC@DDAB to a mouse model. b. blood count changes.
Figure 6 shows the effects of 25-HC and 25-HC@DDAB on the mouse model in the CLP sepsis mouse model. a. Survival rates of the cecal ligation and puncture (CLP) mouse model over time after treatment with 25-HC and 25-HC@DDAB (n = 10/each group). b. Histological analysis of lung tissue in a CLP mouse model. c. Changes in inflammation-related signatures in the mouse model of 25-HC and 25-HC@DDAB after CLP treatment: serum 25-HC level (n = 10), vascular permeability (n = 5), ICAM-1 in lung tissue (n = 10) 5) levels, leukocyte (n = 5) and neutrophil migration in bronchoalveolar lavage fluid (BAL) (n = 5) and SREBP2 activity in lung tissue (n = 10)). d. Changes in sepsis markers (n = 5). e. Changes in SREBP2-related mRNA expression. f. Changes in cytokine levels.
Figure 7 shows the effect of 25-HC@DDAB of the present invention on cytokine storm in PBMC of patients with severe COVID-19. a. Western blot analysis of CH25H levels in PBMCs from patients with mild and severe COVID-19 (n = 5). b. qRT-PCR analysis of CH25H mRNA levels (n = 10) c. 25-HC levels by 25-HC and 25-HC@DDAB treatment at concentrations of 0.5 μM and 1.0 μM (n = 10). d. Effect of 25-HC and 25-HC@DDAB on the survival rate of PBMCs isolated from patients with severe COVID-19 (n = 10). e. Effects of 25-HC and 25-HC @ DDAB on inhibition of production of IL-1β and TNF-α quantified by ELISA (n = 5). f. Cytokine array analysis by 25-HC and 25-HC @ DDAB treatment (n = 3) **P < 0.01. f. Activity of SREBP2 after treatment with 25-HC or 25-HC @ DDAB 1 μM in PBMs isolated from patients with severe COVID-19.
Figure 8 shows IL-1β, TNF-α, NOX2, NRLP3, MCP1 and SREBP2 cytokine production and mRNA expression related to inflammation after treatment with 1 μM of 25-HC or 25-HC@DDAB in PBMCs isolated from patients with severe COVID-19. It is a graph showing levels.
Figure 9 shows the results of cytokine array analysis after treatment with 1 μM of 25-HC or 25-HC@DDAB in PBMCs isolated from patients with severe COVID-19.

25-HC has been reported as an important inhibitor of sterol regulatory element binding protein 2 (SREBP2)-mediated cytokine production and apoptosis. In particular, mice lacking CH25H, an enzyme that catalyzes the hydroxylation of cholesterol to produce 25-hydroxycholesterol (25-HC), are known to be susceptible to septic shock.

Table 1 below shows cholesterol levels in the plasma of mild and severe COVID-19 patients admitted to Yeungnam University Hospital diagnosed with SARS-CoV-2 infection at the Daegu Public Health Center in the Republic of Korea. As shown in Table 1, 25-HC, LDL, HDL, and total cholesterol levels decreased in the plasma of patients with severe COVID-19, showing a tendency for overall plasma cholesterol to decrease. In particular, in the case of 25-Hydroxycholesterol, the plasma concentration of severely ill patients decreased sharply to 16% of mild patients. Also, in the case of severe patients, sepsis was observed in all patients, which was not seen in mild patients.

Based on the relationship of 25-CH with sepsis and cytokines, the present inventors can increase the therapeutic or preventive effect of COVID-19-related cytokine storm by directly targeting 25-CH to the lung tissue of patients with severe COVID-19. The present invention was completed with the expectation that it would be possible.

Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, the disclosure herein is provided so that it will be thorough and complete, and will fully convey the spirit of the invention to those skilled in the art.

< Example 1 Fabrication of lung-targeted 25-HC@DDAB nanohybrids>

1.1. Manufacturing of 25-HC@DDAB, 25-HC@DDAB/EPC and 25-HC@EPC

224 ng/mL)로 인해 인체 투여 시, 적절한 용해 과정을 거쳐야 한다. 소포 형성 양친 매성 지질과 막 안정화 콜레스테롤로 구성된 기존의 리포좀 구조에서 영감을 받아 소포와 같은 형태를 나타내는 필름 수화 방법을 통해 25-HC @ DDAB를 성공적으로 제조하였다.25-HC has low water solubility (

224 ng/mL), it must undergo an appropriate dissolution process when administered to humans. Inspired by the conventional liposome structure composed of vesicle-forming amphiphilic lipids and membrane-stabilized cholesterol, 25-HC @ DDAB was successfully prepared through a film hydration method that exhibits a vesicle-like morphology.

First, a transporter was selected to target 25-HC to lung tissue. After dissolving dimethyldioctadecylammonium bromide (DDAB) and egg phosphatidylcholine (EPC) in methanol and 25-HC in ethanol, respectively, the weight ratio of DDAB/EPC/25-HC was 0/4/1, 2/2/1 or 4/ Mixed to 0/1. The solvent of the mixed solution was evaporated at 70 ° C. for 3 hours using a heating block (Eyela MG-2200, Tokyo, Japan), and then the remaining solid was added to double deionized water (DDW ) was added and sonicated (VC-750; Sonics & Materials, Inc. Newtown, CT, USA) under conditions of 20% amplitude, pulse period of 2s on and 3s off, and resuspended to obtain 25-HC@DDAB nanohybrid (Nanohybrid, NHs ) was prepared. Then, Cy5.5 was loaded for monitoring.

The particle size, polydispersity index and zeta potential of the resulting nanohybrids (NHs) were measured with a Zetasizer Ultra (Malvern Panalytical, Malvern, UK) according to the manufacturer's protocol and are shown in Figures 1a and 1b. As shown in FIGS. 1a and 1b, the particle size of 25-HC@DDAB/EPC was the smallest, and the polydispersity was similar in the three types of NHs. However, in terms of surface charge, 25-HC@EPC was negatively charged with an average of -32.15 mV, while 25-HC@DDAB was positively charged with an average of 94.37 mV. 25-HC@DDAB/EPC showed a smaller positive charge (66.73 mV) than 25-HC@DDAB.

1.2. Lungs of 25-HC@DDAB, 25-HC@DDAB/EPC and 25-HC@EPC targeting

Lung targeting of 25-HC@DDAB, 25-HC@DDAB/EPC and 25-HC@EPC loaded with Cy5.5 prepared in Example 1.1 was confirmed.

Caecum ligation and puncture ( Cecal ligation and puncture, CLP ) Preparation of sepsis animal model

Male C57BL/6 mice, 6-7 weeks of age and weighing 18-20 g, were obtained from Orient Bio Co. (Seongnam, Korea). Male ICR mice, 4 weeks old, weighing 21–24 g, and female BALB/c nude mice, 5 weeks old, weighing 18–22 g, were purchased from Nara Biotech (Seoul, Korea). Animals were housed 5 per polycarbonate cage under controlled temperature and humidity at 20-25° C. and 40% - 45% under a 12:12 hour light/dark cycle and fed normal rodent pellet diet and water ad libitum. All animals were used in experiments after a 12-day acclimatization period and were treated according to the Guidelines for Care and Use of Laboratory Animals (IRB No.; CNU-01050) issued by Chungnam National University.

To create a mouse sepsis model, cecal ligation and puncture (CLP) was performed on mice. Male mice were mixed with 2% isoflurane (Forane, JW Pharmaceutical, South Korea) in oxygen delivered through a small rodent gas anesthesia machine (RC2, Vetequip, Pleasanton, CA), first in a breathing chamber and then in a face mask. Anesthetized by inhalation. Mice were able to breathe spontaneously during the procedure. A CLP-induced sepsis model was prepared as described by Rittirsch et al. (2009). Briefly, after a 2 cm midline incision was made to expose the cecum and the adjacent intestine, it was ligated tightly with a 3.0 silk suture at a distance of 5.0 mm from the end of the cecum, using a 22 gauge needle to induce high-grade sepsis once. pierced Thereafter, a small amount of feces was pushed out from the puncture site and the perforated intestine was returned to the abdominal cavity, and then the laparotomy site was sutured with 4.0 silk. In sham control animals, the cecum was exposed but returned to the abdominal cavity without being ligated or perforated.

Lungs of 25-HC@DDAB targeting in vitro imaging

Male ICR mice were injected via the tail vein with 25-HC@DDAB, 25-HC@DDAB/EPC and 25-HC@EPC loaded with free Cy5.5 at a Cy5.5 dose of 35 μg/kg. At each time point of 3, 6 and 12 hours after injection, 3 mice were sacrificed and their livers, spleens, kidneys, heart and lungs were removed and used for ex vivo imaging. The fluorescence intensity of the organs obtained above was measured using VISQUE® InVivo Smart (Vieworks, Anyang, Korea) and shown in FIG. 1c, and the fluorescence efficiency of each organ was calculated and shown in FIG. 1d. As shown in Figures 1c and 1d, 25-HC@DDAB, 25-HC@DDAB/EPC and 25-HC@EPC were all localized to the liver, kidney and lung, with 25-HC@DDAB in particular being selective to the lung. confirmed localization.

Lung localization of NHs can be explained by transient aggregation with red blood cells (RBCs) through electrostatic interactions. More specifically, NHs administered through peripheral veins first encounter RBCs, and due to the electrostatic attraction between NHs (positively charged) and RBCs (negatively charged), transient aggregates may be formed in the bloodstream, which are perfused into the pulmonary circulation. Transient aggregates with large particle sizes may be retained in the pulmonary capillaries, increasing the possibility of NHs pulmonary retention. In particular, the negatively charged or less positively charged control NH showed significantly reduced lung distribution compared to 25-HC@DDAB, suggesting that the lung localization of NH may be due to the positively charged zeta potential. Mouse lung tissue lysates also showed higher levels of 25-HC upon delivery of 25-HC@DDAB than 25-HC alone, suggesting that the 25-HC@DDAB nanohybrids (NHs) of the present invention are effective for lung delivery of 25-HC. show more efficient Therefore, the effective pulmonary localization of 25-HC suggests that 25-HC@DDAB of the present invention can be an effective tool for the treatment of respiratory diseases.

Lungs of 25-HC@DDAB targeting in vivo imaging

For in vivo imaging, CLP BALB/c nude mice were administered Cy5.5-loaded 25-HC@DDAB at a Cy5.5 dose of 35 μg/kg, and whole-body scans were performed 30, 90 and 120 min after injection. . The radiative efficiency of the thoracic region was measured using CleVue™ software (Vieworks) and is shown in FIG. 1E. In addition, liver, spleen, kidney, heart and lung were removed and ex vivo imaging was performed, as shown in FIG. 1f. As shown in Figures 1e and 1f, it was confirmed that 25-HC@DDAB was specifically localized to the lung.

1.2. lung targeting Optimization of 25-HC@DDAB

25-HC@DDAB Optimization

An optimized nanohybrid of 25-HC@DDAB, which was confirmed to be most effective for lung targeting in Example 1.1, was prepared.

A schematic diagram of the preparation of the 25-HC@DDAB nanohybrid of the present invention is shown in FIG. 2a. After dissolving DDAB and 25-HC in methanol and ethanol, respectively, they were mixed so that the weight ratio of DDAB/25-HC was 2, 4 or 6. The solvent of the mixed solution was evaporated at 70° C. for 3 hours using a heating block (Eyela MG-2200, Tokyo, Japan), and then the remaining solid was added to double deionized water (DDW) to a final concentration of 25-HC of 1 mg/mL. ) was added and sonicated (VC-750; Sonics & Materials, Inc. Newtown, CT, USA) under conditions of 20% amplitude, pulse period of 2s on and 3s off, and resuspended to obtain 25-HC@DDAB nanohybrid (Nanohybrid, NHs ) was prepared.

In order to confirm the morphology of the 25-HC@DDAB nanohybrid prepared above, it was observed using a transmission electron microscope (Talos L120C; FEI, Hillsboro, OR, USA) at cryogenic temperatures, and this is shown in FIG. 2b. A sample (5 μL) was placed on the surface of a carbon-coated copper grid by the plunge dipping method and vitrified using liquid ethane cooled with liquid nitrogen. The sample was then placed on the surface of a carbon-coated copper grid and negatively stained with uranyl acetate. As shown in FIG. 2b, it was confirmed that the 25-HC@DDAB nanohybrid was prepared in a certain form.

The particle size, polydispersity index and zeta potential of the 25-HC@DDAB nanohybrid of the present invention were measured by Zetasizer Ultra (Malvern Panalytical, Malvern, UK) according to the manufacturer's protocol, and the results are shown in FIGS. 2c and 2d.

To measure the drug encapsulation efficiency (EE), the 25-HC concentration of the NHs suspension prepared above was subjected to high-performance liquid chromatography (HPLC) equipped with a Kinetex C18 column (4.6 mm × 250 mm, 5 μm; Phenomenex, Torrance, CA, USA). The measurement was performed using a system (Agilent 1260 infinity; Agilent Technologies, Palo Alto, CA, USA). Chromatographic separation was performed in isocratic elution mode (flow rate: 1.8 mL/min), where the mobile phase consisted of acetonitrile and DDW (80:20, v/v). The detection wavelength of 25-HC was 205 nm. Analytical samples were prepared by breaking down 25-HC @ DDAB with ethanol (40 x volume). The injection volume and lower limit of quantification (LLOQ) were 20 μL and 1 μg/mL, respectively, and the retention time and total run time of 25-HC were 7.8 and 10.0 minutes, respectively. The encapsulation efficiency of 25-HC was determined to be 101.7 ± 1.3% through the above high-performance liquid chromatography analysis. Cy5.5 was loaded into the nanohybrid as a fluorescent probe, and the average diameter was 204.2 ± 4.1 nm.

As shown in Figures 2c and 2d, as a result of dynamic light scattering analysis, nanohybrids (NHs) with a DDAB/25-HC weight ratio of 4 have an optimal average diameter of 126.5 ± 2.3 nm (polydispersity index [PDI] 0.26 ± 0.01). The positive charge zeta potential was found to be 93.81 ± 3.76 mV. NH with a DDAB/25-HC weight ratio of 2 or 6 showed a larger particle size (179.3 ± 8.6 nm) or a wider size distribution (PDI 0.72 ± 0.10). In addition, the encapsulation efficiency (EE) of 25-HC was determined to be 101.7 ± 1.3% through high-performance liquid chromatography analysis. Cy5.5 was loaded into the nanohybrid as a fluorescent probe, and the average diameter was 204.2 ± 4.1 nm (Figs. 2c and 2d).

25-HC@DDAB lung targeting

Male ICR mice were injected via the tail vein with free Cy5.5 or Cy5.5-loaded 25-HC@DDAB at a dose of 35 μg/kg. Except for free Cy5.5 injection, the same method as the ex vivo imaging method was applied.

A free Cy5.5 injection solution was prepared by mixing and diluting 7 µL of a stock solution of Cy5.5 dissolved in DMSO at a concentration of 1 mg/mL with 993 µL of saline. At each time point of 3, 6, 9, 12, 24 and 48 hours after injection, the mice were sacrificed and their livers, kidneys, spleens, heart and lungs were dissected and used for ex vivo imaging. The biodistribution of free Cy5.5 or Cy5.5-loaded 25-HC@DDAB was monitored by measuring the fluorescence intensity of the organs obtained above using VISQUE® InVivo Smart (Vieworks, Anyang, Korea), as shown in Figure 2e. (n=5). In addition, the relative radiation efficiency over time was measured and shown in FIG. 2f. At this time, the sum of radiation efficiency values for 3 hours of liver, spleen, kidney, heart and lung was set to 100%. As shown in Figures 2e and 2f, it was confirmed that 25-HC@DDAB selectively targets the lungs. The average radiation efficiency in the lungs of the NH-treated group loaded with Cy5.5 was compared with that of the free Cy5.5-treated group according to the elapsed time after administration, and is shown in FIG. 2g. As shown in FIG. 2g, when Cy5.5 was loaded into 25-HC@DDAB, it was confirmed that the radiation efficiency was higher than that of free Cy5.5.

< Example 2 lungs targeting Confirmation of cytotoxicity of 25-HC@DDAB>

2.1 Confirmation of cytotoxicity in mouse lung endothelial cells

from the mouse endothelial detach

Endothelial cells were isolated using anti-CD31 antibody and Dynabeads coupled to a Dynal Magnetic holder according to the manufacturer's (Dynal Biotec, Lake Success, NY) instructions. First, 4 to 6 mice (6 to 10 weeks old) were anesthetized for endothelial cell isolation, and then their lungs were removed. The extracted lungs were placed in RPMI medium to remove other tissues, and then washed once in PBS. Thereafter, the culture was incubated with 1.0 mg/mL of collagenase A at 37° C. for 1 hour with shaking. During this incubation, the tube was gently shaken for a few seconds every 5 min. The suspension was then passed through a 70 μm tissue sieve (BD Falcon) and transferred to a new 50 mL tube. The filtered cell suspension was centrifuged at 1000 rpm for 10 minutes to remove the supernatant, and then the cell pellet was washed once with cold PBS in a new 15 mL tube.

To prepare Dynabead-conjugated anti-mouse CD31 antibody, Dynabeads (60 μL) were washed with MACS buffer (PBS, 0.5% BSA, 2 mM EDTA) in a magnetic holder (Invitrogen). Dynabeads were resuspended in MACS buffer (600 μL), anti-mouse CD31 (5 μg per 10 μL of beads) was added and the mixture was incubated at 4 °C for 12 h. Cells were incubated with Dynabead-conjugated anti-mouse CD31 antibody for 10 min at room temperature and then placed in a magnetic holder. The cell suspension was added slowly to a 15 mL tube and incubated for 5 minutes, then the PBS was carefully removed. Dynabead-conjugated anti-mouse CD31 antibody was washed 3 times in cold PBS, the pellet was resuspended in EBM-2 growth medium, then harvested and dissolved in RIPA buffer containing protease inhibitor cocktail (Roche) on ice.

Lungs in endothelial cells in mice targeting Confirmation of cytotoxicity of 25-HC@DDAB

Filipin is a natural fluorescent polyene antibiotic that binds to cholesterol but not to esterified sterols. The isolated mouse lung endothelial cells were inoculated on a Nunc Lab-Tek II 8-Chamber Slide and treated with PBS (control), 25-HC, and 25-HC@DDAB at concentrations of 0, 0.1, 1, and 10 μM for 24 hours. did Cells were fixed with 4% paraformaldehyde for 1 hour at room temperature and then permeabilized with 0.5% Triton X-100 for 10 minutes. Thereafter, the cells were blocked for 12 hours with PBS blocking buffer containing 3% bovine serum albumin (BSA) and 0.1% Tween-20. Filipin statining dye was added to the blocking buffer and the cells were incubated overnight at 4°C. Thereafter, the cells were washed with PBS, mounted with Immu-mount, and visualized with a fluorescence microscope at 200x magnification (Leica microsystem, Germany), as shown in FIG. 3a.

In addition, the isolated mouse lung endothelial cells were treated with 25-HC@DDAB at concentrations of 0, 0.1, 1, and 10 μM for 24 hours, and LIVE/DEAD™ Fixable Far Red Dead Cell Stain Kit (L34973, Invitrogen™) was used. dyed Cells were then washed twice with PBS. Stained cells were resuspended in 1 mL of PBS and fluorescence was quantified using a FACScan flow cytometer (BD), as shown in FIG. 3B.

As shown in FIGS. 3A and 3B , 25-HC@DDAB treatment increased 25-HC in mouse lung endothelial cells and showed no cytotoxicity.

2.2 HUVECs and MRC5 Confirmation of cytotoxicity in cell lines

The cytotoxic effect of 25-HC@DDAB was evaluated in in vitro cultured human lung endothelial cells (HUVEC) and human fetal lung fibroblast cell line (MRC5). HUVEC and MRC5 cells were exposed to 25-HC and 25-HC@DDAB at concentrations of 0, 0.1 and 1.0 μM, 10 μL of WST-1 reagent was added per well and incubated at 37° C. with 5% CO ₂ . Cell activity was measured and shown in FIG. 4 . As shown in FIG. 4 , cytotoxicity of 25-HC@DDAB was not observed in HUVEC and MRC5 cells as well.

2.3 Confirmation of cytotoxicity in vivo

An in vivo toxicity test of 25-HC@DDAB was performed. 25-HC@DDAB was administered to a mouse model, and organ damage markers and blood counts were observed 48 hours after administration. Lactate dehydrogenase (LDH), alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen ( BUN) and creatinine were measured, and the number of blood cells including leukocytes (WBC), neutrophils (ANC), lymphocytes (ALC) and monocytes of the mouse model was counted and shown in FIGS. 5a and 5b. As shown in Figures 5a and 5b, 25-HC@DDAB did not cause any organ or tissue damage in the mouse model.

< Example 3 CLP lungs in animal models targeting Check the effect of 25-HC@DDAB>

3.1 CLP lungs in animal models targeting survival rates of 25-HC@DDAB and to lung tissue Check the effect

CLP Survival rates in animal models

The sepsis model induced by CLP was prepared by exposing the cecum and adjacent intestine, followed by ligation and puncture, in the same manner as in Example 1. In sham control animals, the cecum was exposed, but returned to the abdominal cavity without ligature or perforation. 25-HC and 25-HC@DDAB (1 μM) were administered intravenously 6 hours after CLP.

A sham control group, a CLP treatment group, and a normal rodent pellet feed were fed, and water was supplied ad libitum and observed. The survival results are shown in FIG. 6a. As shown in Figure 6a, the CLP-treated group, 100% died at 96 hours (n=10). However, 25-HC treatment increased the survival rate of CLP mice by 30%, and 25-HC@DDAB increased the survival rate by 50%.

Hematoxylin and eosin staining

Male C57BL/6 mice were intravenously administered with 25-HC and 25-HC@DDAB (1 μM) 6 h after CLP (n = 5). The mice were euthanized 96 hours after CLP administration, and lung samples were removed from each mouse. The extracted lungs were washed three times in PBS (pH 7.4) to remove remaining blood, and then fixed with 4% formaldehyde solution (Junsei, Tokyo, Japan) at 4°C for 20 hours. After fixation, samples were dehydrated through an ethanol series, embedded in paraffin, cut into 4-μm sections, and placed on slides. Slides were deparaffinized in an oven at 60°C, rehydrated and stained with hematoxylin (Sigma). To remove excessive staining, the slides were quickly dipped in 0.3% acid alcohol 3 times and then counterstained with eosin (Sigma). Thereafter, after washing with ethanol series and xylene, the covers were lifted and light microscopic analysis of the lung specimens was performed through blinded observation to evaluate lung structure, tissue edema, and inflammatory cell infiltration, as shown in FIG. 6B . As shown in FIG. 6B, edema and infiltration of lung tissue were caused by CLP, and damage to blood vessels and lung tissue was reduced in the case of 25-HC@DDAB treatment of the present invention.

3.2 Lungs targeting 25-HC@DDAB CLP Confirmation of effects on plasma components in animal models

Effect on inflammatory response

When 25-HC or 25-HC@DDAB was treated after the CLP surgery of Example 3.1, the inflammatory response of CLP mouse plasma was confirmed. 25-HC concentration in blood was quantified using the 25-HC ELISA kit (MyBioSource, MBS7254215) according to the manufacturer's protocol. In vivo permeability was expressed as the dye leaked into the peritoneal cavity (μg/mouse) according to the standard curve of Evans Blue dye. 25-HC or 25-HC@DDAB was intravenously injected into CRP mice, and 6 hours later, a physiological saline solution containing 1% Evans blue dye was intravenously injected into each mouse. After 30 minutes, the mice were euthanized, and the peritoneal exudate was collected, centrifuged, and the absorbance of the supernatant was measured at 650 nm.

Expression of intercellular adhesion molecule-1 (ICAM-1) in lung tissue was determined by ELISA. Lysed lung tissue was coated onto a Nunc-Immuno™ MicroWell™ 96 well plate and incubated overnight at 4°C. After washing, anti-mouse monoclonal ICAM-1 antibody (Millipore Corporation, Billerica, MA, 1:50 each) was added, and after 1 hour (37 °C, 5% CO ₂ ), the cells were washed 3 times and then 1 :2000 peroxidase conjugated anti-mouse IgG antibody (100 μL; Sigma, Saint Louis, MO) was added and reacted for 1 hour. Cells were washed again three times and developed using o -phenylenediamine substrate (Sigma, Saint Louis, MO), followed by colorimetric analysis by measuring absorbance at 490 nm. All measurements were performed in triplicate wells.

For leukocyte/neutrophil migration analysis, CLP-operated mice were treated with 25-H C @DDAB 1 μM 6 hours after CLP surgery. Then, the mice were euthanized and the bronchoalveolar lavage (BAL) was washed with 0.8 mL of normal saline. BAL fluid (200 μL) was counted by an automated hematology analyzer (Mindray, BC 5000 Vet). Results were expressed as leukocytes/neutrophils×10 ⁵ per BAL fluid.

The transcriptional activity of SREBP-2 in lung tissue was determined by ELISA method using a kit from Abcam (ab133111, Abcam) according to the manufacturer's protocol. Male C57BL/6 mice were intravenously administered with 25-HC and 25-HC@DDAB (1 μM) 6 h after CLP (n = 5). The mice were euthanized 96 hours after CLP, and lung samples were removed from each mouse. After extracting the nuclear extract from the extracted lung, it was added to 96 wells coated with a double-stranded DNA sequence having a consensus SREBP binding sequence (the consensus SRE, sterol regulatory element, SRE) corresponding to a protein content of 30 μg. The nuclear extracts were left overnight at 4° C. to hybridize with the consensus SREBP binding sequence. Then, the activated SREBP transcription factor complex was detected with a sensitive colorimetric reading at 450 nm by adding a specific primary antibody to SREBP-2 and a secondary antibody conjugated to HRP.

The detected inflammatory response index is shown in FIG. 6C. Plasma analysis of mice showed lower 25-HC levels in the blood for 25-HC@DDAB, indicating higher uptake of 25-HC in tissue cells (Fig. 6c). Indices related to inflammation were mostly low in the 25-HC@DDAB-treated group, such as in vivo permeability, intercellular adhesion molecule - 1 (ICAM-1) expression in lung tissue, and bronchoalveolar lavage fluid (BAL). Leukocyte and neutrophil migration and SREBP2 activity in lung tissue all decreased, showing values similar to those of the sham control group.

Effect on septic markers

After the CLP operation, 25-HC or 25-HC@DDAB-treated mouse plasma was prepared using a biochemistry kit (MyBioSource Inc., San Diego, Inc.) to treat C-reactive protein (CRP), lactate dehydrogenase (LDH), and alanine. Aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and creatinine were measured and shown in FIG. 6D. As shown in Figure 6D, sepsis including C-reactive protein (CRP), lactate dehydrogenase (LDH), alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and creatinine The marker for was also significantly reduced by 25-HC@DDAB treatment.

SREBP2 -related mRNA Effect on Expression

Changes in mRNA expression of Nox2 , Nrlp3 , IL1b , Mcp1 , Icam1, and Srebp2 associated with SREBP2 in 25-HC or 25-HC@DDAB-treated mice after the CLP surgery were confirmed and are shown in FIG. 6E. To generate cDNA from lung tissue samples of CLP mice administered with SN50/Fatostatin A, 1 μg of total RNA was reverse transcribed into random hexamers using extended reverse transcriptase polymerase (Roche). Real-time PCR was performed using the LightCycler FastStart DNA Master SYBR Green I from Roche Diagnostics GmbH according to the manufacturer's protocol. Real-time PCR conditions were as follows: initial denaturation at 95°C for 10 minutes, 45 cycle denaturation at 95°C for 10 minutes, binding at 60°C for 5 minutes and extension at 72°C for 15 minutes. The gene primers used at this time are shown in Table 2 below. The amount of a specific mRNA in a sample was determined according to a corresponding gene-specific standard curve.

Gene symbol Forward primer Reverse primer Srebf2 TGTGGCTGGTAAATGGTGTGA AGCACGGATAAGCAGGTTTGT Nox2 ACTCCTTGGAGCACTGG GTTCCTGTCCAGTTGTCTTCG Nlrp3 TCGCCCAAGGAGGAAGAAGAA TGAGAAGAGACCACGGCAGAA Il-1β GGTGTGTGACGTTCCCATTAG TCGTTGCTTGGTTCTCCTTGT Icam-1 GCTACCATCACCGTGTATTCG TAGCCAGCACCGTGAATGTG Mcp-1 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT

As shown in Figure 6e, the expression of SREBP2-related mRNAs, including Nox2 , Nlrp3 , Il - 1b, Mcp1 , Icam1 and Srebp2 , was reduced by treatment with 25-HC@DDAB in the mouse model.

Effects on plasma cytokine levels

To determine the concentrations of IL-1β, IL-6, IL-10, monocyte chemoattractant protein-1 (MCP-1) and TNF-α in 25-HC or 25-HC@DDAB-treated mice after the CLP surgery, the manufacturer A commercially available ELISA kit was used according to the protocol of (R&D Systems). The values were measured using an ELISA plate reader (Tecan, Austria GmbH, Austria) and are shown in FIG. 6f.

As shown in Figure 6f, plasma cytokine levels such as IL-1β, IL-6, IL-8, and TNF-α were significantly reduced in the 25-HC@DDAB-treated group, indicating that 25-HC@DDAB was a cytokine storm inhibitor. confirmed that it can work.

< Example 4 COVID Confirmation of the effect of 25-HC@DDAB in the blood of -19 patients>

4.1 COVID -19 from patient blood CH25H Expression level confirmation

plasma sample

Whole blood was collected from a patient admitted to Yeungnam University Hospital after being diagnosed with SARS-CoV-2 infection at the Daegu Public Health Center in South Korea. Patients with COVID-19 sepsis were defined using criteria provided by the Sepsis Consensus Conference Committee, and patients with pneumonia and septic shock were collected from patients admitted to Yeungnam University Medical Center. Blood from healthy volunteers was used as a control. Clinical data were collected for all patients in the samples used. Plasma samples were prepared by centrifugation at 2000 g for 5 minutes within 12 hours of drawing whole blood to include anticoagulants. The human study protocol was approved by the Institutional Review Board of Daegu Yeungnam University Hospital (YUH 2020-03-057, 2020-05-031-001), and whole blood was collected from patients after it was approved for use in the study. The analysis of blood samples received from the hospital was performed in a blinded manner, and after analysis, the analysis was compared with patient information.

The virus was observed in the blood of patients with COVID-19 and progressed to severe respiratory illness or sepsis based on a patient cohort study. Patients with COVID-19 sepsis were defined using criteria provided by the Sepsis Consensus Conference Committee. i) fever with an tympanic membrane temperature of 38°C or higher, ii) suspected systemic infection, iii) two or more systemic inflammatory response syndromes according to SIRS (systemic inflammatory response syndrome), iv) hypotension with a systolic blood pressure of 90 mmHg or less, and/or v) in shock , were treated as eligible patients if they met the criteria of being 18 years of age or older with one or more acute-onset medical conditions. Healthy volunteers were used as controls and clinical data were collected for all patients included in the trial.

COVID-19 patients were classified according to disease severity. "Mild" is defined as a patient receiving isolation treatment in a general ward or asymptomatic patient, and "severe" is defined as having acute respiratory distress syndrome (ARDS) or sepsis or in an intensive care unit (ICU). Defined as a patient receiving intensive care. This includes patients treated with oxygen therapy or dependent on mechanical ventilation such as ventilators.

COVID -19 from patient blood CH25H Confirm

Blood samples from healthy volunteers and patients with mild and severe COVID-19 were collected at Yeungnam University Medical Center. This study was approved by relevant local institutional review boards and ethics committees. Heparinized blood samples were used within 4 hours, and peripheral blood mononuclear cells (PBMCs) were isolated from the blood using Ficoll-Hypaquek or NycoPrepk according to the manufacturer's recommendations. Then, more purified PBMC were obtained through the MACSprep™ PBMC Isolation Kit and cultured in a medium supplemented with 1 mM Sodium pyruvate, 2 mM L-glutamine, 4.5 mg/L glucose, 10 mM HEPES, and 2 mg/L sodium bicarbonate in RPMI-1640. did.

Cholesterol 25-hydroxylase (CH25H) was detected in PBMCs isolated from the isolated mild or severe COVID-19 patients by immunoblotting. After sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE), immunoblotting analysis was performed with a monoclonal mouse anti-CH25H antibody (CH25H monoclonal antibody (M01), clone 1G8, H00009023-M01, Abnova) This is shown in Figure 7a.

As shown in Figure 7a, CH25H enzyme levels were lower in PBMCs isolated from severe COVID-19 patients than mild COVID-19 patients.

In addition, mRNA levels of CH25H were analyzed by qRT-PCR analysis in PBMCs isolated from patients with mild or severe COVID-19, and are shown in FIG. 7B. As shown in Figure 7b, the mRNA level of CH25H was also significantly lower in severe COVID-19 patients than in mild COVID-19 patients.

4.2 25-HC@DDAB COVID -19 patients to PBMCs effect

COVID of -19 patients PBMCs my CH25H Effect on Concentration

We investigated whether treatment with 25-HC@DDAB could increase the level of 25-HC in PBMC of patients with severe COVID-19. 0.5 or 1.0 μM of 25-HC or 25-HC@DDAB was treated on the PBMC culture dish isolated from the severe COVID-19 patient, and the concentration of 25-HC in the PBMC was measured, as shown in FIG. 7c.

As shown in Fig. 7c, 25-HC levels were significantly increased in a dose-dependent manner in PBMCs of patients with severe COVID-19.

COVID of -19 patients PBMCs Effect on survival rate

In PBMCs of severe COVID-19 patients, the effect of 25-HC@DDAB treatment on the survival rate of PBMCs of severe COVID-19 patients was confirmed. The PBMCs isolated from the severe COVID-19 patients were cultured in a medium supplemented with 1 mM Sodium pyruvate, 2 mM L-glutamine, 4.5 mg/L glucose, 10 mM HEPES, and 2 mg/L sodium bicarbonate in RPMI-1640, and placed on a petri dish for 25 days. -HC or 25-HC@DDAB was treated with 1.0 μM each, and the survival rate was observed and shown in FIG. 7d.

As shown in Figure 7d, after 24 and 48 hours of culture, 25-HC or 25-HC@DDAB treatment increased the survival rate of PBMCs isolated from COVID-19 patients, and after 48 hours of culture, 25-HC@DDAB Treatment increased the survival rate of PBMCs isolated from COVID-19 patients by close to 100%.

COVID -19 Effects on cytokine increase in patients

The effect of treatment with 25-HC@DDAB on plasma cytokine levels in patients with severe COVID-19 was investigated. PBMCs from healthy volunteers (Normal) and severe COVID-19 patients isolated above were cultured in PBS, 1 μM 25-HC and 25-HC@DDAB in RPMI without FBS for 12 hours at a concentration of 2 x 10 ⁶ /well. After treatment, the levels of IL-1β and TNF-α were measured using a human ELISA kit (Quantikine ELISA, R & D Systems, Minneapolis, Minn., USA) according to the manufacturer's instructions and are shown in FIG. 7E.

As shown in Figure 7e, compared to normal people (Normal), the levels of inflammatory cytokines IL-1β and TNF-α were significantly increased in PBMC (PBS) of patients with severe COVID-19, and 1 μM 25-HC or 25- Inhibited by HC@DDAB. In particular, it was confirmed that 25-HC@DDAB restored to a normal level.

COVID of -19 patients SREBP2 Effect on activity

The effect of 25-HC@DDAB on SREBP2 activity in COVID-19 patients was confirmed. The experimental method was carried out in the same manner as in Example 3.2, except that COVID-19 patient PBMC was used, and the results are shown in FIG. 7f.

As shown in FIG. 7f, the increased SREBP2 activity in patients with severe COVID-19 was inhibited by 25-HC or 25-HC@DDAB, and was particularly significantly inhibited by 25-HC@DDAB.

COVID Related to cytokine production or inflammation in patients with -19 mRNA Effect on Expression

The effect of 25-HC@DDAB on cytokine production or inflammation-related mRNA expression in COVID-19 patients was confirmed. After treating the PBMC of the severe COVID-19 patient isolated above with 1 μM each of 25-HC or 25-HC@DDAB, the mRNA of IL-1β, TNF-α, NOX-2, NRLPS, MCP1, and SREBP2 was measured as above. Measurement was performed in the same manner as in Example 3.2, and the results are shown in FIG. 8. However, the primers used at this time are shown in Table 3 below.

Gene symbol Forward primer Reverse primer SREBF2 CCTTCCTGTGCCTCTCCTTA AGGCATCATCCAGTCAAACCA IL1B TACCTGTCCTGCGTGTTGAAA CTGCTTGAGAGGTGCTGATGT TNF TGGCGTGGAGCTGAGAGATAA TTGATGGCAGAGAGGAGGTTGA NLRP3 TGCCGGGGCCTCTTTTCAGT CCACAGCGCCCCAACCACAA NOX AACGAATTGTACGTGGGCAGA GAGGGTTTCCAGCAAACTGAG MCP-1 CGCTCAGCCAGATGCAATCAATGC GGTTTGCTTGTCCAGGTGGTCCA β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT

As shown in Figure 8, the mRNAs of IL-1β, TNF-α, NOX-2, NRLPS, MCP1 and SREBP2 were greatly increased in patients with severe COVID-19, and were suppressed by 25-HC or 25-HC@DDAB. , significantly inhibited by 25-HC@DDAB.

4.3 by 25-HC@DDAB COVID Changes in cytokine profiling in patients with -19

The effect of 25-HC@DDAB on the cytokine storm in patients with COVID-19 was confirmed. 2 x 10 ⁶ /well of cells per group were treated with 1 μM 25-HC and 25-HC@DDAB in RPMI medium without FBS for 12 hours, then as indicated in the Human XL Cytokine Array Kit (R&D Systems) The processed and developed film was scanned and the obtained image was analyzed using ImageJ version 1.43 and is shown in FIG. 9 .

As shown in Figure 9, patients with severe COVID-19 have IL-6, CRP, TNF-alpha, IL-1 beta, IFN-gamma, IL-8, CCL2, BDNF, CCL7, IL-4, IL-3, GM-CSF, M-CSF, IL-10, IL-5, CXCL9, and G-CSF were found at very high levels, and IL-15, IL-16, IL-22, IL-27, IL-17A, MMP-9, CXCL 10, IL-11, CCL3, PF4, Cystatin C, IL-13, TARC, TGF-alpha, HGF, IL-1 alpha, FGF-19, IL-31, PDGF-AA, GRO-alpha , IL-12, MPO and other cytokines were found at high levels. However, the increased cytokines were significantly suppressed by 25-HC or 25-HC@DDAB treatment, especially by 25-HC@DDAB treatment. In addition, RBP4, Chitinase 3-like 1, EMMPRIN, CD14, DPPIV, Cripto-1, Angiopoetin-2, Kallikrein 3, MIF, MIP-3 beta, PDGF-AB/BB, Leptin, Endoglin, Lipocalin-2, uPAR, Concentrations of IL-19, TFF3, Resistin, and Complement Factor D were also significantly suppressed.

Intracellular invasion of the SARS-CoV-2 virus causes COVID-19 infection, resulting in severe lung tissue damage and inflammation. It was confirmed that the 25-HC@DDAB treatment of the present invention inhibits various types of excessive cytokines as described above, and through highly enhanced lung localization, the 25-HC@DDAB of the present invention cytokine storm in patients with severe COVID-19. can be treated or prevented.

Claims (10)

Nanohybrids (NHs) containing dimethyldioctadecylammonium bromide (DDAB) and 25-hydroxycholesterol (25-HC). According to claim 1,
The nanohybrids (NHs) are
Step (1) dissolving dimethyldioctadecylammonium bromide (DDAB) and 25-hydroxycholesterol (25-HC) in methanol and ethanol, respectively;
mixing DDAB and 25-HC dissolved in step 1 and evaporating at 70 ° C. for 3 hours (2); and
Nanohybrids (NHs), characterized in that produced by a method for producing nanohybrids (NHs) comprising the step (3) of adding double deionized water (DDW) to the solids remaining after evaporation and resuspending them by sonication ). According to claim 1,
Nanohybrids (NHs), characterized in that the weight ratio of 25-hydroxycholesterol (25-HC) and dimethyldioctadecylammonium bromide (DDAB) is 1: 2-6. According to claim 1,
The nanohybrids (NHs) are characterized by selectively localizing to one or more organs selected from the group consisting of liver, spleen, kidney, heart and lungs (Nanohybrids, NHs). According to claim 4,
The nanohybrids (NHs) are nanohybrids (NHs), characterized in that selectively localized in the lungs. A composition for inhibiting or preventing a cytokine storm induced by bacteria or viruses, including the nanohybrids (NHs) of any one of claims 1 to 5. According to claim 6,
The composition for inhibiting or preventing a cytokine storm is a composition for inhibiting or preventing a cytokine storm, characterized in that delivering 25-hydroxycholesterol (25-hydroxycholesterol, 25-HC) to a localized organ. According to claim 6,
The viruses are COVID-19 (coronavirus disease 2019, SARS-CoV-2), Spanish flu (H1N1), avian flu (H5N1), Middle East Respiratory Syndrome (MERS-CoV), SARS-CoV ) A composition for inhibiting or preventing a cytokine storm, characterized in that at least one selected from the group consisting of. According to claim 6,
The bacteria include Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae, Neisseria meningitidis, Klebsiella pneumoniae, Escherichia coli and group B streptococci. A composition for inhibiting or preventing a cytokine storm, characterized in that at least one selected from the group consisting of cocci (group B streptococci). According to claim 6,
The composition for inhibiting or preventing the cytokine storm is intracellular IL-6, CRP, TNF-alpha, IL-1 beta, IFN-gamma, IL-8, CCL2, BDNF, CCL7, IL-4, IL-3, GM -CSF, M-CSF, IL-10, IL-5, CXCL9, G-CSF, IL-15, IL-16, IL-22, IL-27, IL-17A, MMP-9, CXCL 10, IL- 11, CCL3, PF4, Cystatin C, IL-13, TARC, TGF-alpha, HGF, IL-1 alpha, FGF-19, IL-31, PDGF-AA, GRO-alpha, IL-12, MPO, RBP4, Chitinase 3-like 1, EMMPRIN, CD14, DPPIV, Cripto-1, Angiopoetin-2, Kallikrein 3, MIF, MIP-3 beta, PDGF-AB/BB, Leptin, Endoglin, Lipocalin-2, uPAR, IL-19, A composition for inhibiting or preventing a cytokine storm, characterized by reducing one or more selected from the group consisting of TFF3, Resistin, and Complement Factor D.

Images