KR20230001519A - Identification of novel drug-binding protein using proximity labeling - Google Patents

Abstract

The present invention relates to a method for identifying a novel drug-binding protein in living cells using a proximal protein modification reaction. According to the present invention, a target protein which interacts with a drug transiently in vivo can be specifically identified, and thus the target protein of the drug that interacts in the in vivo environment can be more accurately identified. In addition, the possibility of false positives can be significantly reduced compared to existing methods for identifying target proteins using cell lysates.

Description

Identification of novel drug-binding protein using proximity labeling using proximal protein modification reaction {Identification of novel drug-binding protein using proximity labeling}

The present invention relates to a technology for the identification of novel drug-binding proteins using a proximal protein modification reaction, and more particularly, HT-TurbID protein in which biotin ligase enzyme protein (TurbID) is conjugated to halotac (HT) protein. technology to identify a novel target protein of a drug by expressing in living cells, treating a drug conjugated with a halotac ligand, biotinylating a target protein of a drug close to the drug, and isolating the biotinylated target protein for mass spectrometry. It is about.

A variety of natural and synthetic small molecule drugs are used to treat human diseases, and many of these drugs have direct and specific physical interactions with target biomolecules such as proteins or nucleic acids. Information about the binding molecules involved is helpful in understanding the mechanisms underlying the therapeutic effect. In addition, target-ID of drugs is an essential prerequisite not only for regulatory approval, but also for understanding pharmacological efficacy, assessing potential side effects, and repurposing previously approved drugs.

Therefore, several methods have been developed to identify physical binding proteins or “target” proteins of various natural or synthetic small-molecule drugs (Ha et al., 2021), among which affinity-based methods are most widely used in target identification approaches. has come (Jost et al., 2018). However, these methods, including DARTS (Lomenick et al., 2009) and CETSA (Molina et al., 2013), require experiments to be performed under conditions in which the cells are lysed, which is due to artificial lysis buffer conditions that result in false targeting rates. The downside is that it may increase or miss true positive results (Diether et al., 2017).

Proximal protein modification reactions are a technique developed to comprehensively understand local protein networks. Proximal protein modification reactions include APEX; APEX2; BioID; Engineered enzymes such as TurbID (Branon et al., 2018), biotin-AMP (Lee et al., 2016), a kinetically improved version of BioID capable of generating short-lived reactive species such as biotin-phenoxyl radicals can be used. Using this proximal protein modification reaction technique provides sufficient temporal resolution to identify protein components in the size range of less than 50 nm. Using this proximity-based labeling scheme, we provide a novel target identification approach using Neddylator (Hill et al., 2016; Zhuang et al., 2013), which uses a thioester conjugate of NEDD8-UBC12 as a reactive handle. However, since this method was also performed under the aforementioned non-physiological lysate conditions, it is not target identification in living cells, and since only unmodified peptides of the pull-down protein are detected, it is not possible to directly identify the modified protein. There is a downside to not being able to. Indirect mass identification workflows using existing proximal protein modification reaction technologies (e.g. APEX, BioID/TurbID) suffer from the same issues including generating false positives after affinity capturing.

To overcome this problem, the present inventors developed a method called Spot-BioID (hereafter referred to as Spot-ID), which detects biotin-modified residues through MS (mass spectrometry) analysis and directly converts the modified protein to the proximal protein modification reaction. It is a technique of sympathy. Using this method in living cells, we were able to identify FRB-BioID as a bait protein and FKBP25 as a novel rapamycin-binding protein, and using FRB (rapamycin-binding domain of mTOR) as an adapter protein for rapamycin, FKBP25 was identified as FRB BioID. could be recruited with a biotin-labeled radius of . However, this method using FRB-BioID has a problem in that it cannot be used to identify general drug-binding proteins because it can only be used to identify rapamycin-binding proteins that bind specifically to FRB.

The present inventors have made diligent efforts to develop this proximal protein modification reaction approach as a general target identification method. As a result, PROCID ( PRO ximity-based PRO Ximity-based Compound binding protein ID entification) was developed, and using this method, SMARCA2 , a DNA helicase protein, was newly identified as a new target protein with strong affinity to dasatinib in living cells. Thus, the present invention was completed by verifying that the present invention is an effective method for identifying the target of a drug molecule in a living cell system.

Ha, J. et al., (2021), Cell Chemical Biology 28, 394-423; Jost, M. et al., (2018), Acs Chemical Biology 13, 366-37; Lomenick, B. et al, (2009), Proceedings of the National Academy of Sciences of the United States of America 106, 21984-21989; Molina, D.M. et al, (2013), Science 341, 84-87; Diether, M et al., (2017), Curr Opin Microbiol 39, 16-23; Branon, T.C. et al., (2018), Nature Biotechnology 36, 880-887; Lee, S.-Y. et al., (2016), Acs Central Sci 2, 506-516; Hill, Z.B. et al., (2016), J Am Chem Soc 138, 13123-13126; Zhuang, M. et al., (2013), Mol Cell 49, 273-282.

An object of the present invention is to provide a novel method for identifying a target protein that binds to a drug in living cells.

In order to achieve the above object, the present invention provides a fusion protein in which TurbID, a biotin ligase enzyme protein, is linked to a tag protein.

In the present invention, the tag protein may be halotak, snaptack, cliptack or avidin.

The present invention also provides a nucleic acid encoding the fusion protein.

The present invention also provides a cell into which the nucleic acid or a vector containing the nucleic acid has been introduced.

The present invention also provides a method for identifying a drug target protein comprising the following steps:

(a) treating the cell with a drug bound to a ligand that specifically binds to the tag protein:

(b) lysing the cells; and

(c) identifying biotinylated proteins in the lysed cells as drug target proteins.

In the present invention, the cells of step (a) are characterized in that they are living cells.

In the present invention, the method is characterized in that in step (a), the drug target protein is in cellulo biotinylated.

In the present invention, the method is characterized by further comprising, after step (b), (b') separating biotinylated proteins from the lysed cells.

In the present invention, the method is characterized in that, after step (b'), (b'') further comprising the step of digesting the separated protein with a hydrolytic enzyme.

In the present invention, the biotinylated protein in step (c) is characterized in that it is identified by mass spectrometry.

In the present invention, in the method, in the step (c), the biotinylated protein is transferred from the drug target protein in the state where the cell expressing the fusion protein is not treated with the drug to which the ligand specifically binding to the tag protein is bound. characterized by exclusion.

The present invention also provides a kit for identifying a drug target protein comprising a vector containing the nucleic acid and a ligand specifically binding to the tag protein.

In the present invention, the kit is characterized in that it further comprises at least one selected from the group consisting of biotin, streptavidin beads, and instructions for use of the kit.

The present invention is to provide a method for identifying a target protein that binds to a drug in a living cell, and in particular, to provide a method for identifying a target protein that interacts with a drug transiently in vivo. Bar, it is possible to more accurately identify the target protein of the drug in vivo, and it has the advantage of significantly lowering the possibility of false positives compared to the existing method of identifying the target protein using cell lysates.

1 is a schematic diagram illustrating the operating principle of the present invention.
Figure 2a is a schematic diagram showing the overall procedure of the present invention, the steps of drug-mediated biotinylation of a target protein and its identification by mass spectrometry.
Figure 2b is a comparison table between the existing target identification method and the present invention.
3A shows Dasatinib (DA; purple) conjugated to chloroalkane tags with two different lengths (blue), the structure with the shorter chloroalkane tag named DA3 and the other DA5.
Figure 3b is an analysis of the K562 cell growth inhibitory effect of DA, DA3 and DA5. After culturing the cells in a culture medium containing various concentrations of DA and its derivatives for 72 hours, cell viability was measured by CCK-8 assay did
Figure 3c shows the GI50 values of DA, DA3 and DA5 in K562 cells.
Figure 3d shows a schematic diagram of potential analysis. As target proteins of DA (e.g., ^KD ABL1) are displayed on the surface, it is predicted that HT-TurbID will translocate to mitochondria upon incubation of DA.
Figure 3e shows the results of confocal imaging of in-cellulo protein translocation using HT-TurbID-MoA and HA- ^KD ABL1 in U2OS cells. After 16 hours, cells were treated with DMSO or 500 nM of DA5-HTL for 3 hours, then cells were stained with anti-V5 antibody (CY5) and counterstained with anti-HA antibody (green). Right panel: 2D intensity histogram output of coloc2 analysis performed with Fiji/ImageJ. Numbers represent classical Pearson coefficients of pixel intensity correlation between anti-V5 and anti-HA. Scale bar: 18.1 μm.
Fig. 3f is a Western blot analysis result of biotinylation of HA- ^KD ABL1 (molecular weight = 50 kDa, open arrow) by HT-V5-TurbID (molecular weight = 70 kDa, black arrow). Plasmids were co-transfected into HEK293T cells for 16 hours and then treated with DA5-HTL (500 nM) or vehicle (DMSO) for 3 hours. After incubation with biotin (100 μM) for 30 minutes, cells were lysed and TOM20-HA- ^KD ABL1 was immunoprecipitated with anti-HA antibody. Streptavidin-HRP (SA-HRP), anti-HA and anti-V5 antibodies were used for immunoblotting analysis of inflow, passage and elution fractions in the pull-down process
Figure 4a is a schematic diagram showing a process for mass identification of Dasatinib binding proteins according to the present invention.
Figure 4b is a Volcano plot showing a statistically significant enrichment of proteins biotinylated with HT-TurbID (i.e., DA5-HT-TurbID) together with DA5 over non-specific biotinylated proteins with HT-TurbID (i.e., DMSO treatment) ( group I). 30 minutes after treatment with biotin (50 μM).
Figure 4c shows representative proteins biotinylated by DA5-HT-TurbID (group-I). Bubble size represents the mass signal intensity of peptides biotinylated by DA5-HT-TurbID. Protein names of biotinylated peptides are indicated in the Volcano plot in (b).
Figure 4d shows 34 proteins biotinylated by DA5-HT-TurbID in K562 cells (group-I). Color intensity represents the mass intensity of each biotin-labeled peptide per biological triplicate sample.
Figure 5a shows the mass intensity of biotinylated sites on protein tyrosine kinases of group I in DA5-treated samples (D4-6) and control samples (C1-3). (Left: ABL1 and 2, right: CSK and BTK).
Figure 5b shows the structures of BTK (top) and CSK (bottom). The structures of BTK are X-ray co-crystal structures (X-tal structure) and predicted structures (full, 1 - 659 aa ) was created by the AlphaFold database (Uniprot ID: Q06187, gray). The X-tal structure and predicted structure of CSK were obtained from protein databank (PDB ID: 1BYG, green) and AlphaFold Database (Uniprot ID: P41240), respectively. The localized position of DA (magenta) was obtained in the docking simulation program (AutoDock Vina). The predicted structures of BTK and CSK are presented on the left, and each color (i.e., blue, cyan, yellow, and orange) represents the residue-specific reliability score of the predicted local distance difference test (pLDDT). Blue: pLDDT > 90, cyan: 70 < pLDDT < 90, yellow: 50 < pLDDT < 70, orange: pLDDT < 50. Biotinylated lysine residues according to the present invention are aligned with BTK (top) and CSK (bottom), respectively. The structure is marked in red.
Figure 5c shows confocal images of in-cellulo protein translocation according to HT-V5-TurbID-MoA and BTK-mCherry-HA (left) or CSK-EGFP-HA (right) expression plasmids in U2OS cells. After 16 hours, cells were treated with DMSO (control) or 500 nM of DA5-HTL for 3 hours, then cells were stained with anti-V5 antibody (purple). Right panel for each image set: 2D intensity histogram and Pearson correlation values.
Figure 5d shows the in cellulo biotinylation assay of BTK-mCherry-HA (top) and CSK-EGFP-HA (bottom). BTK and CSK plasmids were co-transfected with HT-V5-TurbID (molecular weight = 70 kDa, black arrows in blot images). After expression, HEK293T cells were treated with DMSO or DA5-HTL for 3 hours. Biotinylation was performed by incubation of biotin (100 μm, 30 min). After cell lysis, anti-HA antibody was used for pull-down. Streptavidin-HRP (SA-HRP), anti-HA and anti-V5 were used for immunoblotting (WB). BTK-mCherry-HA (molecular weight = 105 kDa) or CSK-EGFP-HA (molecular weight = 79 kDa) were indicated by open arrows in the blot results.
6A is a schematic diagram showing domain regions of SMARCA2.
Figure 6b shows the normalized mass intensity of biotinylated SMARCA2 in DA5 treated samples (D1-D3) and control samples (C1-C3).
Figure 6c shows the X-ray cocrystal structure (X-tal structure) of SMARCA2. The Helicase-ATP binding domain (amino acids 736-901) and the helicase C-terminal domain (amino acids 1054-1216) of the AlphaFold structure are shown in magenta and light blue, respectively. The binding site of dasatinib (blue) was calculated by protein-ligand docking simulation using AutoDock Vina. The SMARCA2 structure (Uniprot ID: P51531, left) from the AlphaFold database is shown in blue, turquoise, yellow and orange, representing scores per confidence level (pLDDT). (Blue: pLDDT > 90, Cyan: 70 < pLDDT < 90, Yellow: 50 < pLDDT < 70, Orange: pLDDT < 50). Biotinylated lysine residue (K904) is shown in red.
Figure 6d shows confocal images of in cellulo protein potential using TOM20-V5-Halotag (anti-V5) and ABD SMARCA2 (736-901aa helicase-ATP binding domain)-HA in HEK293-AD cells. After 16 hours, cells were treated with DMSO (control) or 500 nM of DA5-HTL for 3 hours and stained with anti-V5 antibody (RFP channel) and anti-HA antibody (GFP channel). Right panel for each image set: 2D intensity histogram and Pearson correlation values.
6E shows a schematic of Dasatinib dependent interactor identification according to the present invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and the experimental methods described below are those well known and commonly used in the art.

In the present invention, while studying a method for applying the proximal protein modification reaction approach to a general target identification method, PROCID ( PRO ximity -based Compound binding protein ID entification, Hereinafter, the present invention has developed a new target identification (target-ID) method called 'PROCID' (which is used interchangeably with the term 'PROCID'). Halotag recognizes a halotag ligand with a chloroalkane moiety (HTL) and forms a covalent bond. The binding kinetics of halotag is very fast, and more than 90% of covalent bonds are typically achieved when HTL is applied to living cells. It is done within 5 minutes. In addition, many HTL conjugation moieties (e.g., fluorophores, inhibitors) could be successfully targeted to halotac proteins, so it was expected that compounds conjugated to HTL would be exposed on the surface of halotac proteins. If the HTL-conjugated moiety can be fully exposed on the halotag surface, HTL-conjugated drug molecules that bind to the halotag protein will be able to recruit the binding protein. Taking note of these characteristics, in the present invention, a method for clearly identifying drug-binding interactors was developed.

Specifically, in the present invention, a proof-of-concept experiment was performed to confirm whether a drug-binding protein could be identified in a living system using Dasatinib as a model compound. As a result, we were able to clearly identify 34 biotinylated proteins that were reproducibly captured by PROCID compared to the negative control, including ABL1, a tyrosine kinase known to bind dasatinib according to previous in vitro characterization; ABL2, BTK and CSK were included. In addition, PROCID also newly identified SMARCA2 as a dasatinib binding protein. This is a novel interactor that has never been reported as a Dasatinib-interacting protein in previous target identification studies. This means that SMARCA2 can bind to Dasatinib in a living cell environment and only PROCID designed to work in living cells can detect it. It means you can.

Accordingly, in one aspect, the present invention relates to a fusion protein in which TurbID, a biotin ligase enzyme protein, is linked to a tag protein.

In the present invention, the tag protein is halotak, snaptack (Gautier et al. Chemistry and Biology, 2008, 15, 128-136), cliptack (Gautier et al. Chemistry and Biology, 2008, 15, 128-136 ) or avidin (Guardia et al. Plos Biology, 17(5): e3000279.), but is not limited thereto.

In one aspect, the present invention may be a HT-TurbID fusion protein in which halotag is coupled with TurbID, a biotin ligase enzyme protein, but is not limited thereto.

In the present invention, the HT-TurbID fusion protein may be represented by SEQ ID NO: 1, but is not limited thereto.

<SEQ ID NO: 1> HT-TurbID

MAEIGTGFPFDPHYVEVLGERMHYVDVGPRDGTPVLFLHGNPTSSYVWRNIIPHVAPTHRCIAPDLIGMGKSDKPDLGYFFDDHVRFMDAFIEALGLEEVVLVIHDWGSALGFHWAKRNPERVKGIAFMEFIRPIPTWDEWPEFARETFQAFRTTDVGRKLIIDQNVFIEGTLPMGVVRPLTEVEMDHYREPFLNPVDREPLWRFPNELPIAGEPANIVALVEEYMDWLHQSPVPKLLFWGTPGVLIPPAEAARLAKSLPNCKAVDIGPGLNLLQEDNPDLIGSEIARWLSTLEISGGRPLAGKPIPNPLLGLDSTKDNTVPLKLIALLANGEFHSGEQLGETLGMSRAAINKHIQTLRDWGVDVFTVPGKGYSLPEPIPLLNAKQILGQLDGGSVAVLPVVDSTNQYLLDRIGELKSGDACIAEYQQAGRGSRGRKWFSPFGANLYLSMFWRLKRGPAAIGLGPVIGIVMAEALRKLGADKVRVKWPNDLYLQDRKLAGILVELAGITGDAAQIVIGAGINVAMRRVEESVVNQGWITLQEAGINLDRNTLAATLIRELRAALELFEQEGLAPYLPRWEKLDNFINRPVKLIIGDKEIFGISRGIDKQGALLLEQDGVIKPWMGGEISLRSAEK

In another aspect, the present invention relates to nucleic acids encoding fusion proteins.

In another aspect, the invention relates to a cell into which a nucleic acid or a vector comprising the nucleic acid has been introduced.

In another aspect, the present invention relates to a method for identifying a drug target protein comprising the following steps:

(a) treating the cell with a drug bound to a ligand that specifically binds to the tag protein:

(b) lysing the cells; and

(c) identifying biotinylated proteins in the lysed cells as drug target proteins.

The present invention has demonstrated the effect of identifying drug-binding proteins that transiently bind to living cells. In the present invention, the cells in step (a) can be characterized as living cells, and therefore the present invention In the step (a), living cells may be treated with a drug to which a halotac ligand is bound.

In the same context, in step (a) of the present invention, the drug target protein may be characterized in that it is in cellulo biotinylated.

In the present invention, the method may further include, after step (b), (b') separating the biotinylated protein from the lysed cells, wherein the separation is performed using streptavidin or avidin , It may be an analogue of streptavidin that reversibly binds to biotin or an analogue of avidin that reversibly binds to biotin, but is not limited thereto.

In the present invention, the method may further include, after step (b'), (b'') digesting the separated protein with a hydrolytic enzyme, but is not limited thereto. does not

In the present invention, the hydrolase is trypsin, arginine C (Arg-C), aspartic acid N (Asp-N), glutamic acid C (Glu-C), lysine C (Lys-C), chymotrypsin (Chymotrypsin), proteinase K (Proteinase k) and pronase (Pronase) characterized in that selected from the group consisting of, but is not limited thereto.

In the present invention, the biotinylated protein in step (c) may be identified by mass spectrometry, but is not limited thereto.

In the present invention, the mass spectrometer for mass spectrometry may be selected from the group consisting of LTQ-FT, Orbitrap, Triple-Tof, Q-Tof, Tof-Tof and Q Exactive, but is not limited thereto does not

In the present invention, in the method, in the step (c), the biotinylated protein is transferred from the drug target protein in the state where the cell expressing the fusion protein is not treated with the drug to which the ligand specifically binding to the tag protein is bound. It can be characterized by excluding it, and it is possible to prevent false-positive drug-binding proteins from being identified by this process.

In addition, in the present invention, it was confirmed that when a mitochondrial outer membrane-targeting peptide is additionally fused to HTL-drug or HT-TurbID, it can be used to verify interaction proteins in living cells through in-cellulo mitochondrial translocation.

Accordingly, in another aspect, the present invention relates to an intracellular organ-targeting fusion protein in which an intracellular organ-targeting peptide is further fused to an HT-TurbID fusion protein.

In the present invention, the fusion protein may be characterized in that a tag sequence for immune labeling is additionally bound thereto.

In the present invention, the tag may be selected from the group consisting of HA, V5, Myc, His and Flag, but is not limited thereto.

In another aspect, the present invention relates to nucleic acids encoding intracellular organelle targeting fusion proteins.

In another aspect, the present invention provides a nucleic acid or a vector comprising the nucleic acid; and a nucleic acid encoding a drug interaction protein to be verified or a vector containing the nucleic acid.

In the present invention, the drug interaction protein may be characterized in that a tag sequence for immunolabeling is additionally bound thereto.

In the present invention, the tag may be selected from the group consisting of HA, V5, Myc, His and Flag, but is not limited thereto.

In this case, it is preferable that the tag for immunolabeling of the fusion protein and the tag for immunolabeling of the drug interaction protein are different from each other.

Meanwhile, in the present invention, the nucleic acid encoding the intracellular organ-targeting fusion protein and the nucleic acid encoding the drug interaction protein to be verified may be included in one vector, and also encodes the intracellular organ-targeting fusion protein. The nucleic acid to be tested and the nucleic acid encoding the drug interaction protein to be verified may be included in separate vectors.

In another aspect, the present invention relates to a method for validating a drug interacting protein in living cells comprising the steps of:

(a) treating the cells with a drug to which halotac ligand is bound:

(b) fixing and permeabilizing the cells; and

(c) visualizing the intracellular organ-targeting fusion protein and the drug-interacting protein by immunofluorescence, respectively.

In the present invention, when the immunofluorescence of the intracellular organ-targeting fusion protein and the immunofluorescence of the drug-interacting protein overlap in step (c), the two proteins exist at a proximal distance within 20 nanometers. can be evaluated as

In the present invention, when the immunofluorescence of the intracellular organ-targeting fusion protein and the immunofluorescence of the drug-interacting protein overlap in step (c), the two proteins are present at a distance of 1 to 20 nm. can do.

In another aspect, the present invention relates to a kit for identifying a drug target protein.

In the present invention, the kit may be characterized in that it includes a ligand specifically binding to the vector for expressing the fusion protein and the tag protein, but is not limited thereto.

In the present invention, the kit may be characterized in that it further comprises at least one selected from the group consisting of biotin, streptavidin beads, and instructions for use of the kit, but is not limited thereto.

In the present invention, the instructions for use include a description of the constituent materials, a description of a series of processes for identifying a drug target protein, including a method of binding a ligand substance that specifically binds to a tag protein to a drug, and the like. It may be, but is not limited thereto.

Some amino acids of the fusion protein used in the present invention may be non-conservative substitutions or conserved substitutions.

In one aspect, amino acid substitutions may be non-conserved substitutions. Such non-conservative substitutions include, for example, replacement of an amino acid residue having a particular side chain size or a particular property (eg, hydrophilicity) with an amino acid residue having a different side chain size or different property (eg, hydrophobicity). It may involve altering amino acid residues of the target protein or polypeptide in a non-conservative manner.

The amino acid substitutions may also be conserved substitutions. Such conserved substitutions are, for example, replacement of an amino acid residue having a particular side chain size or a particular characteristic (eg, hydrophilicity) with an amino acid residue having the same or similar side chain size or the same or similar characteristic (eg, still hydrophilic). such as altering amino acid residues of a target protein or polypeptide in a conserved manner. These conserved substitutions usually do not significantly affect the structure or function of the produced protein. In the present application, amino acid sequence variants that are mutations of fusion proteins, fragments thereof, or variants thereof in which one or more amino acids are substituted may contain conserved amino acid substitutions that do not significantly change the structure or function of the protein.

For example, mutual substitutions between amino acids in each of the following groups may be considered conservative substitutions in this application:

A group of amino acids with non-polar side chains: alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan and methionine.

A group of uncharged amino acids with polar side chains: glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine.

A group of negatively charged amino acids with polar side chains: aspartic acid and glutamic acid.

A group of positively charged basic amino acids: lysine, arginine and histidine.

A group of amino acids with phenyl: phenylalanine, tryptophan and tyrosine.

A protein, polypeptide and/or amino acid sequence encompassed by the present invention may also be understood to encompass at least the following: variants or homologues having the same or similar function as the protein or polypeptide.

In the present invention, the variant may be a protein or polypeptide produced by substitution, deletion or addition of one or more amino acids compared to the amino acid sequence of the protein and/or the polypeptide. For example, the functional variant comprises substitutions, deletions and/or insertions of at least one amino acid, eg 1-30, 1-20 or 1-10, alternatively, eg 1, 2, 3, 4 , or proteins or polypeptides with amino acid changes by substitution, deletion and/or insertion of 5 amino acids. The functional variant may substantially retain the biological properties of the protein or polypeptide prior to changes (eg, substitutions, deletions or additions). For example, the functional variant may retain at least 60%, 70%, 80%, 90% or 100% of the biological activity of the protein or polypeptide prior to alteration.

In the present invention, the homologue is at least about 80% (e.g., at least about 85%, about 90%, about 91%, about 92%, about 93%) identical to the amino acid sequence of the protein and/or the polypeptide. %, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more) may be proteins or polypeptides having sequence homology.

In the present invention, the homology generally refers to similarity, analogousness or association between two or more sequences. “Percent of sequence homology” refers to identical nucleic acid bases (e.g. A, T, C, G, I) or identical amino acid residues (e.g. Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) can be calculated by comparing the two aligned sequences in a comparison window to determine the number of positions present. and divide the number of matched positions by the total number of positions to give the number of matched positions in the comparison window (i.e., window size), and multiply the result by 100 to give the percentage of sequence identity. Alignment to determine percent sequence homology can be performed in a variety of ways known in the art, for example using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. One skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms necessary to achieve maximal alignment within the full-length sequences being compared or within the target sequence region. The homology can also be determined by the following methods: FASTA and BLAST. The FASTA algorithm is described, for example, in W. R. Pearson and D. J. Lipman's "Improved Tool for Biological Sequence Comparison", Proc. Natl. Acad. Sci., 85: 2444-2448, 1988; and D, J. Lipman and W. R. Pearson's "Fast and Sensitive Protein Similarity Search", Science, 227:1435-1441, 1989; a description of the BLAST algorithm is provided by S. Altschul, W. Gish, W. Miller, See E. W. Myers and D. Lipman, "A Basic Local Alignment Search Tool", Journal of Molecular Biology, 215: 403-410, 1990.

As used herein, the term "vector" refers to a plasmid vector as a means for expressing a gene of interest in a host cell; cosmid vector; and viral vectors such as bacteriophage vectors, adenoviral vectors, retroviral vectors, and adeno-associated viral vectors. In the vector, the nucleic acid encoding the antibody is operably linked to a promoter.

"Operably linked" means a functional linkage between a nucleic acid expression control sequence (eg, a promoter, signal sequence, or array of transcriptional regulator binding sites) and another nucleic acid sequence, whereby the control sequence is linked to the other nucleic acid. It will regulate the transcription and/or translation of the sequence.

When prokaryotic cells are used as hosts, a strong promoter capable of promoting transcription (e.g., tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pLλ promoter, pRλ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter), a ribosome binding site for initiation of translation, and a transcription/translation termination sequence. Further, for example, when a eukaryotic cell is used as a host, a promoter derived from the genome of a mammalian cell (e.g., metallotionine promoter, β-actin promoter, human hemoglobin promoter, and human muscle creatine promoter) or mammalian Promoters derived from animal viruses, such as adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus (CMV) promoter, tk promoter from HSV, mouse mammary tumor virus (MMTV) promoter, LTR promoter from HIV , the promoter of Moloney virus, the promoter of Epstein Barr virus (EBV) and the promoter of Rouss sarcoma virus (RSV) can be used, and usually has a polyadenylation sequence as a transcription termination sequence.

In some cases, vectors may be fused with other sequences to facilitate purification of proteins expressed therefrom. Sequences to be fused include, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA).

The vector contains an antibiotic resistance gene commonly used in the art as a selectable marker, for example, for ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and tetracycline. There is a resistance gene.

In the present invention, the cell may be a prokaryotic, yeast or higher eukaryotic cell, but is not limited thereto.

Of these, animal cells are of greatest interest, and examples of useful host cell lines include COS-7, BHK, CHO, CHOK1, DXB-11, DG-44, CHO/-DHFR, CV1, COS-7, HEK293, BHK, TM4, VERO, HELA, MDCK, BRL 3A, W138, Hep G2, SK-Hep, MMT, TRI, MRC 5, FS4, 3T3, RIN, A549, PC12, K562, PER.C6, SP2/0, NS-0 , U20S, or HT1080, but is not limited thereto.

As used herein, the term "drug" is a term that includes any substance, including compounds or proteins, for which an interacting protein is to be identified in vivo.

Example

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Experiment method

1-1. Cell culture and transfection

HEK293T cells were obtained from the American Type Culture Collection (Manassas, VA, USA) and were used at <20 passages. HEK293-AD cells were obtained from UNIST. U2OS, COS7 and K562 cells were obtained from Korean Cell Line Bank. Ba/F3 cells were obtained from the RIKEN BioResource Research Center (RCB0805, Japan), and stably expressing BCR-ABL cells were custom-made by the DGMIF laboratory. HEK293T, HEK293-AD, U2OS, and COS7 cell lines were cultured in high glucose-DMEM containing 10% FBS (fetal bovine serum) at 37 °C and 5% CO ₂ (v/v). These cell lines were transiently transfected with polyethyleneimine (PEI) at 60 - 80% confluency. K562 cells were cultured in RPMI 1640 medium containing 10% FBS at 37 °C and 5% CO ₂ (v/v) conditions. All cell lines were frequently checked and tested microscopically for morphology and Mycoplasma contamination.

1-2. compound synthesis

All nuclear magnetic resonance (NMR) experiments were performed using an Avance III 400 MHz NMR spectrometer equipped with a 5 mm broadband observation probe head (Bruker, Billerica, MA, USA). NMR spectra were optimized using Bruker Topspin 3.1 software. Compounds were dissolved in CDCl3 or d-MeOH and spectra were acquired at 25 °C. Mass spectra were measured in positive electrospray ionization (ESI) mode on an LCMS-2020 system (Shimadzu, Tokyo, Japan). Column chromatography was performed using a CombiFlash Rf system with RediSep Rf (Teledyne Isco, Lincoln, NE, USA). Preparative high performance liquid chromatography using acetonitrile/H2O as eluent on a Kinetex 5 μm Biphenyl 100 Å (GX-281 HPLC system, Gilson, Middleton, WI, USA; column tube: 250 mm × 21.2 mm ID) for final compounds. Further purification was carried out by chromatography (HPLC).

The purity of the target compound was confirmed to be >95% by analytical HPLC using a dual phase wavelength UV detector. Starting materials were obtained from Sigma-Aldrich (St. Louis, MO, USA) or Alfa Aesa (Ward Hill, MA, USA). Solvents were purchased from Fisher Scientific (Hampton, NH, USA) or Sigma-Aldrich and were used without further purification unless otherwise specified.

DA-HTL synthesis

2-(4-(6-((5-((2-chloro-6-methylphenyl) carbamoyl)thiazol-2-yl)amino)-2-methylpyrimidin-4-yl)piperazin-1-yl)ethyl (4 -nitrophenyl) carbonate ( compound 2 )

Dasatinib (1, 0.2 g, 0.410 mmol) was mixed with 4-nitrophenyl chloroformate (0.091 g, 0.451 mmol) and DIPEA (0.200 mL, 1.148 mmol) in anhydrous tetrahydrofuran (10 mL). After the reaction mixture was stirred at room temperature for 8 hours, 4-nitrophenyl chloroformate (0.091 g, 0.451 mmol) was added. After 16 hours, when the solution was clear, the solvent was evaporated under reduced pressure. The residue was neutralized with acetic acid and solidified with ethyl acetate, and then the solid compound was filtered to obtain yellowish compound 2 (90 mg, yield 34%). LC/MS (ESI) m/z: 654 [M]+

2-(4-(6-((5-((2-chloro-6-methylphenyl)carbamoyl)thiazol-2-yl)amino)-2-methylpyrimidin-4-yl)piperazin-1-yl)ethyl(2 -(2-(2-((6-chlorohexyl)oxy)ethoxy)ethoxy)ethyl)carbamate trifluoroacetate salt ( 3a compound )

A mixture of 2-(2-(2-((6-chlorohexyl)oxy)ethoxy)ethoxy)ethanamine, hydrogen chloride (0.024 g, 0.079 mmol) and compound 2 (0.020 g, 0.031 mmol) was prepared by DIPEA ( 0.050 mL, 0.286 mmol) in anhydrous tetrahydrofuran (5 mL). The reaction mixture was stirred at room temperature for 16 hours. The solvent was evaporated in vacuo and the mixture was purified by prep-HPLC to give compound 3a (21 mg, 88% yield).

¹ H NMR (400 MHz, DMSO) δ11.65 (brs, 1H), 9.92 (s, 2H), 8.24 (s, 1H), 7.41 (d, J = 1.4 Hz, 1H), 7.40 - 7.24 (m, 3H), 6.15 (s, 1H), 4.31 (brs, 2H), 3.63 - 3.61 (m, 4H), 3.44 - 3.36 (m, 10H), 3.19 - 3.17 (m, 4H), 2.45 (s, 3H) , 2.24 (s, 3H), 1.71 - 1.68 (m, 2H), 1.50 - 1.45 (m, 2H), 1.39 - 1.27 (m, 4H); LC/MS (ESI) m/z: 781 [M]+.

2-(4-(6-((5-((2-chloro-6-methylphenyl)carbamoyl)thiazol-2-yl)amino)-2-methylpyrimidin-4-yl)piperazin-1-yl)ethyl(21 -chloro-3,6,9,12,15-pentaoxahenicosyl)carbamate trifluoroacetate salt ( 3b compound )

A mixture of 21-chloro-3,6,9,12,15-pentaoxahenicosan-1-amine, hydrogen chloride (0.056 g, 0.144 mmol) and compound 2 (0.094 g, 0.144 mmol) was mixed with DIPEA (0.050 mL, 0.288 mmol) in anhydrous tetrahydrofuran (10 mL). The reaction mixture was stirred at room temperature for 16 hours. The solvent was evaporated in vacuo and the mixture was purified by prep-HPLC to give product 3b (76 mg, 61% yield).

¹ H NMR (400 MHz, DMSO) δ11.69 (s, 1H), 9.93 (s, 2H), 8.24 (s, 1H), 7.49 - 7.33 (m, 2H), 7.33 - 7.21 (m, 2H), 6.14 (s, 1H), 4.37 - 4.30 (m, 2H), 4.21 - 3.68 (m, 18H), 3.68 - 3.58 (m, 4H), 3.47 - 3.40 (m, 4H), 3.35 (t, J = 6.5 Hz, 2H), 3.33 - 3.06 (m, 6H), 2.45 (s, 3H), 2.23 (s, 3H), 1.69 (p, J = 6.8 Hz, 2H), 1.47 (p, J = 6.8 Hz, 2H) ), 1.41 - 1.18 (m, 4H); LC/MS (ESI) m/z : 870 [M+H]+.

1-3. Expression plasmid cloning

Genes were cloned into the indicated vectors using standard enzyme restriction digestion and then ligated with T4 DNA ligase. A tag was included in the primers used to PCR amplify the gene to generate a construct with a short tag (eg V5 epitope tag) or signal sequence attached to the protein. PCR products were digested with restriction enzymes and ligated into cutting vectors (eg pcDNA3, pcDNA5 and pLX304). The cytomegalovirus (CMV) promoter has been used for expression in mammalian cells. Information cloned in the present invention is shown in Table 1.

Name
Features Promotor/
Vector Details BTK-mCherry-HA KpnI -BTK-mcherry-HA-Stop- XhoI (SEQ ID NO: 2) CMV/
pCDNA5 pMSCV-BTK-mCherry was purchased from addgene (Addgene plasmid #50043).
Red fluorescent fused to BTK protein CSK-EGFP-HA HindIII -CSK-EGFP-HA-Stop- XhoI (SEQ ID NO: 3) CMV/
pCDNA5 Tet-myc-CSK-GFP was purchased from addgene (Addgene plasmid #83470).
Green fluorescent fused to CSK protein HaloTag-V5-TurboID NotI- HaloTag- BamHI- V5-TurboID - Stop -ApaI (SEQ ID NO: 4) CMV/
pCDNA3 TurboID fused to HaloTag protein HaloTag-V5-TurboID BsiWI- HaloTag- NheI- V5-TurboID - Stop -AgeI (SEQ ID NO: 5) CMV/
pLX304 TurboID fused to HaloTag protein for generation of lentiviral particles HaloTag-V5-TurboID-MoA BsiWI- HaloTag- NheI- V5-TurboID - MoA-Stop -AgeI (SEQ ID NO: 6) CMV/
pLX304 MoA (signal sequence for targeting to outer mitochondria) fused to HaloTag-TurboID HA- ^KD ABL1 HindIII -HA-Abl Kinetic Domain-Stop- XhoI (SEQ ID NO: 7) CMV/pCDNA3 Kinetic domain of ABL1 for translocation assay and immunoprecipitation TOM20-HA- ^KD ABL1 KpnI -TOM20-HA-Kinetic Domain-Stop- XhoI (SEQ ID NO: 8) CMV/pCDNA5 Kinetic domain of ABL1 fused to TOM20 protein (OMM protein) for translocation assay TOM20-Myc- ^ABD SMARCA2-HA BsiWI -TOM20-SMARCA2 Helicase ATP binding domain-HA-Stop- AgeI (SEQ ID NO: 9) CMV/pLX304 ATP binding domain of SMARCA2 fused to TOM20 protein (OMM protein) for translocation assay and immunoprecipitation ^ABD SMARCA2-HA BsiWI -SMARCA2 Helicase ATP binding domain-HA-Stop- AgeI (SEQ ID NO: 10) CMV/pLX304 ATP binding domain of SMARCA2 for translocation assay and immunoprecipitation

1-4. halotac ligand in vitro competition analysis

Purification of halotag proteins was carried out by Kang et al. (2017, Chemical Communications 53, 9226-9229). Purified halotac (10 μM) and compounds (10 μM, pure drug or drug-HTL) were co-incubated in PBS buffer for 30 min. Then, dansyl-HTL (10 μM) was added and incubated for 30 minutes. After adding 5x SDS loading buffer, each reaction mixture was boiled for 5 minutes and subjected to SDS-PAGE. In-gel fluorescence was analyzed by the AF430 channel from GeneSys (Syngene, UK).

1-5. CCK-8 assay

Ba/F3, K562 and stable expression K562 cells were cultured in RPMI medium supplemented with 10% FBS. 8 x 10 ³ cells were seeded in a 96-well microplate, and compounds were treated at 10 point concentrations over 5-fold serial dilutions (0-10 μM) including DMSO control in a 37° C. CO ₂ incubator for 72 hours. After 72 hours, 10 μl of CCK-8 solution (Dojindo) was added to each well and incubated for 2 hours in a CO ₂ incubator. Absorbance at 450 nm was measured with a Synergy-neo2 microplate reader (BioTek), and GI50 was calculated with GraphPad Prism 7 (GraphPad software Inc).

1-6. Potential analysis of U2OS cells using confocal microscopy

To visualize the subcellular localization of the target protein, HT-V5-TurbID and U2OS cells transiently expressing the target protein were plated on coverslips (thickness 1.5, radius 18 mm) after DA5-HTL treatment. . Cells were then treated with DMSO or DA5-HTL (500 nM) in DMEM at 37 °C for 3 hours and washed three times with cold DPBS. Cells were fixed in 4% paraformaldehyde, permeabilized with cold methanol for 5 minutes at -20 °C, washed with DPBS and blocked with 2% FBS in DPBS for 1 hour at room temperature.

Immunolabeling is performed in a blocking solution containing appropriately diluted antibodies (anti-V5 and anti-HA) and Alexa Fluor labeled secondary antibodies (mouse anti-Alexa Fluor 647 and rabbit anti-Alexa Fluor 488) with extensive washes It became. Immunofluorescence images were acquired on an SP8 X Leica microscope (NICEM, Seoul National University, Korea) with an objective lens (HC PL APO 100×/1.40 OIL), a white light laser (470 - 670 nm, 1 nm tunable laser) and LAS X software. Analysis was performed using a controlled HyD detector.

1-7. Construction of K562 cell line stably expressing HT-V5-TurbID

To construct K562 cells stably expressing HT-V5-TurbID, cells at about 60% confluency were treated with 6 μl polyethylenimine (PEI) (6.7 mg/mL in water, pH 7.3) to induce expression of the gene of interest. and 1,000 ng of the lentiviral vector containing the lentiviral packaging plasmid psPAX2 (750ng) and the envelope plasmid pM.D2.G (250ng) were transfected in serum-free medium. After 48 hours, the cell medium containing the lentiviral particles was harvested and filtered using a 0.45 μm filter. Then, K562 cells at about 50% confluency were infected with crude lentiviral particles, and then selected using 800 μg/mL Geneticin (G-418) in growth medium for at least 14 days. . The selected cell lines were tested for bait expression levels and biotinylation signals by conventional biochemical assays (immunofluorescence and immunoblotting), and biotinylated proteins were analyzed by mass spectrometry.

1-8. Biotin labeling and sample preparation for MS analysis

For bulk sampling, K562 cells stably expressing HT-V5-TurbID were grown in 150 Φ cell culture dishes. Two dishes (6 samples in total) were prepared for each triplicate sample for MS analysis. Three dishes were treated with DMSO and the other three dishes were treated with DA5-HTL (500 nM) at 37 °C for 3 hours, and then washed three times with RPMI medium. Cells were then treated with biotin (50 μM) in DMEM at 37° C. for 30 min. After biotin labeling, cells were washed 3-4 times with cold DPBS and lysed with 1.5mL 2% SDS in 1X TBS (25mM Tris, 0.15M NaCl, pH 7.2), 1X Protease Inhibitor Cocktail. The lysate was clarified by sonication (Bioruptor, diagenode) for 15 min in a cold water bath, and the two dishes were combined (approximately 2 ml).

1-9. Combination of Immunoprecipitation and Proximal Protein Modification Reaction (PL-IP)

HT-V5-TurbID expressing cells were biotinylated and lysed in 0.5% NP40 in PBS buffer (pH 7.4) containing 100X diluted protease inhibitor cocktail.

After collecting the input fractions, the lysates were mixed with anti-HA coated Protein G magnetic beads for 16 hours at 4°C. After collecting the flow-through (FT) fraction in each experiment, the beads were washed twice with lysis buffer, elution buffer (5x SDS loading buffer diluted 5-fold in PBS buffer) was added and 10 μm for protein elution from the beads. Boiled for minutes.

1-10. Biotinylated Peptide Concentration and LC MS/MS Analysis

1-10-1. Digestion and Concentration of Biotinylated Peptides

Cold acetone (4 mL) stored at -20 °C was mixed with the lysate and stored at -20 °C for a minimum of 2 hours. This sample was centrifuged at 13,000 xg for 10 minutes at 4 °C and the supernatant was carefully removed. The pellet was resuspended in 500 μl of 8 M urea in 50 mM ammonium bicarbonate. After determining the protein concentration using the bicinchoninic acid (BCA) assay, the protein samples were denatured at 650 rpm for 1 hour at 37 °C using a Thermomixer (Eppendorf). Reduction and alkylation were separately performed by adding 10 mM dithiothreitol and 40 mM iodoacetamide to each sample and incubating at 650 rpm for 1 hour at 37 °C using a Thermomixer. After diluting the sample 8-fold with 50 mM ABC, CaCl ₂ was added to a final concentration of 1 mM. Samples were digested in a Thermomixer at 650 rpm for 6-18 hours at 37 °C using trypsin (50:1 w/w). Insoluble material was removed by centrifugation at 10,000 xg for 3 minutes. SA beads (200 μl) were washed 3-4 times with 2M Urea in 1X TBS and then added to the samples. The mixture was then spun at room temperature for 1 hour, then the beads were washed 2 - 3 times with 2 M Urea in 50 mM ABC; The FT fraction was not discarded. After discarding the supernatant, the beads were washed with pure water and transferred to a new tube. After adding 100 μl of 80% Acetonitrile, 0.2% trifluoroacetic acid (TFA) and 0.1% formic acid, the biotinylated peptide was heated at 60 °C and mixed at 650 rpm. The supernatant without SA beads was transferred to a new tube. After repeating this elution step at least four times, the entire elution fraction was dried for 5 hours using a Speed-vac (Eppendorf). Samples were stored at -20 °C prior to use for MS analysis.

1-10-2. LC-MS/MS

The resulting tryptic digested peptides were analyzed by LC-MS/MS. All mass spectrometry was performed using a Q Exactive Plus Orbitrap Mass Spectrometer (Thermo Fisher Scientific, MA, USA) equipped with a nanoelectrospray ion source. The peptide mixture was separated using a C18 reverse phase HPLC column (500 mm x 75 μm ID) using a gradient of 4 - 32.5% acetonitrile/0.1% formic acid for 120 min at a flow rate of 300 nL/min. Precursor ion scan MS spectra (m/z 400 to 2000) were acquired on an Orbitrap at a resolution of 70,000 at m/z 400 with internal lock mass for MS/MS analysis. The 15 most concentrated ions were separated and fragmented by high-energy collision-induced dissociation (HCD).

1-10-3. LC-MS/MS data processing

All MS/MS samples were analyzed using the Sequest Sorcerer platform (Sagen-N Research, San Jose, CA, USA). Sequest was set up to search the Homo sapiens protein sequence database (20676 entries, UniProt (http://www.uniprot.org/)) containing frequently observed contaminants assuming the digestive enzyme trypsin. Sequest was searched with a fragment ion mass tolerance of 1.00 Da and a parent ion tolerance of 10.0 ppm. Carbamidomethylation of cysteine was designated as a fixed modification in Sequest. Oxidation of methionine and acetyl at the n-terminus, and biotin at lysine were designated variable modifications in Sequest. MS/MS-based peptide and protein identification was validated using Scaffold (version 4.11.0, Proteome Software Inc., Portland, OR, USA). Peptide identification was allowed if it could be established with a probability of 83.0% or more by the Scaffold Local FDR algorithm to achieve a False Discovery Rate (FDR) of less than 1.0%. Peptide identification was allowed if it could be established with a probability of greater than 90.0% to achieve an FDR of less than 1.0% and contained at least two identified peptides. Protein probabilities were assigned by the Protein Prophet algorithm. Proteins containing similar peptides and indistinguishable by MS/MS analysis alone were grouped to satisfy the principle of brevity. Proteins were annotated with Gene Ontology (GO) terms in the National Center of Biotechnology Information database (NCBI, downloaded on November 1, 2019).

1-11. Protein-ligand docking simulation

Docking simulations were performed with AutoDockTools and AutoDock vina software. PDB files of proteins were downloaded from AlphaFold and PDB websites. I edited the file with AutoDockTools and set the volume and location of the grid box where the docking simulation will occur. After downloading the 3D structure of the ligand from the PubChem website, a docking simulation was performed using AutoDock vina (energy range = 4, completeness = 8).

1-12. reagent information

Reagent information used in the present invention is as follows.

REAGENT or SOURCES SOURCE IDENTIFIER Antibodies Anti-V5 Tag Monoclonal Antibody (mouse) Invitrogen Cat# R960-25 V5-tag Antibody, pAb, Rabbit GenScript Cat#A00623 Goat Anti-Mouse IgG (H + L)-HRP conjugate Bio-Rad Laboratories Cat#1706516 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology Cat#7074S Streptavidin-HRP Thermo Fisher Scientific Cat#21126 Streptavidin, Alexa Fluor 647 conjugate Invitrogen Cat#S21374 HA-tag Antibody (F-7) Santacruz Cat#sc-7392 HA Tag Polyclonal Antibody (SG77) Invitrogen Cat#71-5500 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A-11008 Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen Cat#A-21235 Chemicals, Peptides, and Recombinant Proteins Biotin Alfa Aesar Cat#A14207 RIPA lysis buffer ELPISBIO Cat# EBA-1149 Protease inhibitor cocktail Invitrogen Cat#78438 Urea Sigma-Aldrich Cat#U5378 20X TBS Thermo Fisher Scientific Cat#28358 Acetone Sigma-Aldrich Cat#650501 Ammonium bicarbonate Sigma-Aldrich Cat#A6141 TPCK-Trypsin Thermo Fisher Scientific Cat#20233 Dithiothreitol Sigma-Aldrich Cat#43819 Iodoacetoamide Sigma-Aldrich Cat#I1149 CaCl ₂ Alfa Aesar Cat#12312 Trifluoroacetic acid Sigma-Aldrich Cat# T6508-10AMP Formic acid Thermo Fisher Scientific Cat#28905 Acetonitrile Sigma-Aldrich Cat#900667 Polyetherimide (PEI) Polyscience Cat#23966-1 Nonidet ^™ P 40 Substitute (NP40) Sigma-Aldrich Cat#74385 4% paraformaldehyde solution Chembio Cat#CBPF-9004 Protein G magnetic beads Thermo Fisher Scientific Cat#88847 5X SDS loading buffer Biosesang Cat# SF2002-110-00 Recombinant DNA (See detail information in Table 1) BTK-mCherry-HA This study pCDNA5/Ampicillin CSK-EGFP-HA This study pCDNA5/Ampicillin HaloTag-V5-TurboID This study pCDNA3/Ampicillin HaloTag-V5-TurboID This study pLX304/Ampicillin HaloTag-V5-TurboID-MoA This study pLX304/Ampicillin HA- ^KD ABL1 This study pcDNA3.1(+)-zeo vector/ Ampicillin TOM20-HA- ^KD ABL1 This study pCDNA5/Ampicillin TOM20-Myc- ^ABD SMARCA2-HA This study pLX304/Ampicillin ^ABD SMARCA2-HA This study pLX304/Ampicillin Software and Algorithms Image J NIH https://imagej.nih.gov/ij/ Pymol Schrodinger https://pymol.org/2/ Normalizer Lund University, Medicon Village 406, 223 81, Lund, Sweden http://normalyzer.immunoprot.lth.se/ Perseus Max-Planck-Institute of Biochemistry https://maxquant.net/perseus/ AutoDock Vina The Scripps Research Institute, TSRI http://vina.scripps.edu/ GraphPad Prism 7/9.1.2 GraphPad https://www.graphpad.com/

PROCID Design: Combining the Halotax System with Proximal Protein Modification Reaction Technology

If the gene fusion construct of Halotag and TurbID can be expressed, it is predicted that the Halotag protein will be able to recruit the bait protein (i.e., compound binding protein) to the proximal site of TurbID. In this case, when processing compound-HTL molecules, TurbID will be able to preferentially biotinylate drug-binding proteins in a proximity-dependent manner in living cells (Fig. 2a).

After in cellulo biotinylation for 10 - 30 minutes, the cells were lysed, and TurbID biotinylated peptides were concentrated with Streptavidin (SA) beads, followed by MS analysis. In this case, a biotinylated protein that is reproducibly identified only in drug-HTL treated samples through mass spectrometry of replicates versus control samples can be considered as a drug-binding protein.

The present invention (i.e., PROCID) offers several advantages over other existing target identification methods (FIG. 2b). First, PROCID is designed to be performed in cellulo conditions that reduce artifacts caused by non-physiological environments such as cell lysis. Second, PROCID was able to identify specific binders through mass spectrometry of biotin-labeled peptides (Fig. 2a).

In order to verify that the PROCID method can effectively identify target proteins in living cells, a model system was prepared using dasatinib, a tyrosine kinase inhibitor well known for the treatment of chronic myelogenous leukemia (CML). did Dasatinib's target protein has already been identified through various methods including affinity precipitation, ubiquitin-like protein tagging, and photocrosslinking , so it was judged that it would be a useful drug for verifying the present invention. In terms of conducting the experiment, it was expected that a new physical interaction partner of dasatinib previously unknown could be found by the present invention.

Two Dasatinib-HTL (DA 140 HTL) molecules with different chloroalkane lengths were prepared to bind Dasatinib to the Halotac system: DA3-HTL (DA3) and DA5-HTL (DA5) (FIG. 3A ). The synthesis method is as follows.

2-(4-(6-((5-((2-chloro-6-methylphenyl) carbamoyl)thiazol-2-yl)amino)-2-methylpyrimidin-4-yl)piperazin-1-yl)ethyl (4 -nitrophenyl) carbonate ( compound 2 ).

Dasatinib ( compound 1 , 0.2 g, 0.410 mmol) was mixed with 4-nitrophenyl chloroformate (0.091 g, 0.451 mmol) and DIPEA (0.200 mL, 1.148 mmol) in anhydrous tetrahydrofuran (10 mL). After the reaction mixture was stirred at room temperature for 8 hours, 4-nitrophenyl chloroformate (0.091 g, 0.451 mmol) was added. After 16 hours, when the solution was clear, the solvent was evaporated under reduced pressure. The residue was neutralized with acetic acid and solidified with ethyl acetate, and the solid compound was filtered to give yellowish compound 2 (90 mg, yield 34%). LC/MS (ESI) m/z: 654 [M]+

2-(4-(6-((5-((2-chloro-6-methylphenyl) carbamoyl)thiazol-2-yl)amino)-2-methylpyrimidin-4-yl)piperazin-1-yl)ethyl(2 -(2-(2-((6-chlorohexyl)oxy)ethoxy)ethoxy)ethyl)carbamate trifluoroacetate salt ( compound 3a )

A mixture of 2-(2-(2-((6-chlorohexyl)oxy)ethoxy)ethoxy)ethanamine, hydrogen chloride (0.024 g, 0.079 mmol) and compound 2 (0.020 g, 0.031 mmol) was prepared by DIPEA ( 0.050 mL, 0.286 mmol) in anhydrous tetrahydrofuran (5 mL). The reaction mixture was stirred at room temperature for 16 hours. The solvent was evaporated in vacuo and the mixture was purified by prep-HPLC to give compound 3a (21 mg, 88% yield).

¹ H NMR (400 MHz, DMSO) δ11.65 (brs, 1H), 9.92 (s, 2H), 8.24 (s, 1H), 7.41 (d, J = 1.4 Hz, 1H), 7.40 - 7.24 (m, 3H), 6.15 (s, 1H), 4.31 (brs, 2H), 3.63 - 3.61 (m, 4H), 3.44 - 3.36 (m, 10H), 3.19 - 3.17 (m, 4H), 2.45 (s, 3H) , 2.24 (s, 3H), 1.71 - 1.68 (m, 2H), 1.50 - 1.45 (m, 2H), 1.39 - 1.27 (m, 4H); LC/MS (ESI) m/z: 781 [M]+.

2-(4-(6-((5-((2-chloro-6-methylphenyl)carbamoyl)thiazol-2-yl)amino)-2-methylpyrimidin-4-yl)piperazin-1-yl)ethyl(21 -chloro-3,6,9,12,15-pentaoxahenicosyl)carbamate trifluoroacetate salt ( compound 3b ).

A mixture of 21-chloro-3,6,9,12,15-pentaoxahenicosan-1-amine, hydrogen chloride (0.056g, 0.144mmol) and compound 2 (0.094g, 0.144mmol) was mixed with DIPEA (0.050mL, 0.288 mmol) in anhydrous tetrahydrofuran (10 mL). The reaction mixture was stirred at room temperature for 16 hours. The solvent was evaporated in vacuo and the mixture was purified by prep-HPLC to give compound 3b (76 mg, yield 61%).

¹ H NMR (400 MHz, DMSO) δ11.69 (s, 1H), 9.93 (s, 2H), 8.24 (s, 1H), 7.49 - 7.33 (m, 2H), 7.33 - 7.21 (m, 2H), s , 1H), 4.37 - 4.30(m, 2H), 4.21 - 3.68(m, 18H), 3.68 - 3.58(m, 4H), 3.47 - 3.40(m, 4H), 3.35(t, J =, 6 2H) , 3.33 - 3.06(m, 6H), 2.45(s, 3H), 2.23(s, 3H), 1.69(p, J = 6.8Hz, 2H), 1.47(p, J = 6.8Hz, 2H), 1.41 - 1.18 (m, 4H); LC/MS (ESI) m/z: 870 [M+H]+.

The binding affinity of the two synthesized molecules to the halotag was confirmed through a competition assay using dansyl-HTL, which exhibits a high fluorescence signal. In the presence of DA-HTL, the binding of dansyl-HTL to halotag was reduced and thus the fluorescence signal was also reduced, indicating that both DA3 and DA5 bind well to halotag (data not shown).

Next, we tried to confirm whether DA-HTL exhibits a similar antiproliferative effect on cancer cells compared to unconjugated dasatinib. To this end, two cell lines with high expression levels of endogenous BCR-ABL kinase, a target protein of dasatinib, were tested using human CML cell line K562 and mouse IL-3 dependent pro-B cell line Ba/F3. As a result, both DA3 and DA5 were found to have concentrations (GI ₅₀ values) that induce 50% growth inhibition in the submicromolar range, indicating that they effectively inhibit the growth of cancer cells. The GI ₅₀ values of DA-HTL were higher than those of free Dasatinib due to the expected ligand conjugation effect on the drug molecule (Figs. 3b, 3c).

PROCID validation

In order to verify PROCID, we wanted to confirm whether DA-HTL immobilized on the HT-TurbID protein could recruit a compound-binding protein (i.e., ABL kinase) already known as a target in living cells. To this end, after DA-HTL treatment, a translocation assay was performed to image whether the target protein was translocated into the mitochondria where HT-TurbID is located (Fig. 3d).

A V5-tagged HT-TurbID-MoA construct, located in the mitochondrial outer membrane, with halotac, TurbID, MoA (mitochondrial membrane constant domain of amine oxidase, amino acids 490-527, Uniprot ID: P21397) conjugated The HA epitope-tagged kinase domain (KD) of ABL1, known as the T and DA binding domain ( ^KD ABL1, amino acids 239-512, Uniprot ID: P00519), was prepared. These constructs were co-expressed in U2OS cells and treated with 500 nM of DA3 or DA5, respectively, for 3 hours. After compound incubation, cells were fixed and permeabilized, and both proteins were visualized by immunofluorescence.

As a result, when DA5 was treated, efficient translocation of ^KD ABL1 from the cytosol to mitochondria, which was not detected in other control samples (eg, DMSO, DA), was observed (Fig. 3e). In particular, DA5 was able to more efficiently translocate ^KD ABL1 with HT-TurbID-MoA compared to DA3 (R ² = 0.56) (R ² = 0.89). This result is interpreted as being because the longer linker in DA5 provides more space for protein-drug binding on the halotac surface. Similarly, treatment with DA5 confirmed mitochondrial translocation of HT-TurbID to TOM20- ^KD ABL1 (the outer mitochondrial membrane targeting TOM20) (data not shown).

Next, we investigated whether HT-TurbID (V5-tagged) activates the proximity-dependent biotinylation reaction of ^KD ABL1 recruited by DA5. ^KD ABL1 (HA tag) was enriched with an anti-HA antibody in cell lysates of cells co-expressing HA- ^KD ABL1 and HT-TurbID, and immunofluorescence experiments were performed.

As a result, as expected, it was confirmed that ^KD ABL1 was biotinylated by HT-TurbID only when living cells were treated with DA5 (shown in SA-HRP in the western blot of Fig. 3f). In addition, reproducible DA5-dependent biotinylation of TOM20-HA- ^KD ABL1 by HT-TurbID was observed in the cytoplasm (data not shown). These results demonstrated that HT-TurbID can biotinylate a drug-binding protein (ie, ^KD ABL1) in the presence of a drug-ligand (ie, DA-HTL) molecule.

Identification of dasatinib target proteins in CML cell lines

In Example 3, it was confirmed that DA5 can properly recruit and biotinylate Dasatinib-binding proteins through the HT-TurbID system. We wanted to investigate whether a novel target protein could be identified.

To this end, a K562 cell line stably expressing HT-TurbID was prepared through a selection process after infection with lentivirus. Strong biotinylation reactions were confirmed in all cases of DA5, DA, and vehicle (DMSO) treatment in the above cell lines, and the streptavidin-HRP Western blot pattern was slightly different in DA5 treatment compared to the pattern of DA and DMSO treatment samples. . This result means that the protein biotinylated by HT-TurbID can be altered by forming a complex between the halotac protein and DA5.

By comparing the mass spectrometry results of biotinylated proteins of DA5-treated and DA5-untreated samples, we expect to be able to identify dasatinib-binding proteins in K562 cells, DA5-treated samples (D1-D3) and negative controls for mass spectrometry Samples of K562 cells were prepared in triplicate as in samples (C1-C3, no DA5 treatment). Biotinylated peptides were directly identified by mass observation of biotinylated lysine residues (K+226 Da) in TurbID-mediated biotinylated samples (Lee, S.-Y. et al., (2016) for details. see Acs Central Sci 2, 506-516). The triplicate samples were reproducible and had good mass signal intensity, and a significant number of biotinylated peptides could be detected in the samples (total: 3912, false discovery rate < 1%). Mass signal intensities were normalized by the LOESS R protocol for Student's t-test . Thirty-three proteins were observed that were reproducibly biotinylated by HT-TurbID only in DA5 treatment compared to control: P-value < 0.05, Log ₂ (Fold Change, FC) > 1.2). One protein (SMARCA2) was added that had a slightly higher P-value than the standard (P=0.065) but the highest fold change (FC=5.14) due to false detections in one negative control sample (SMARCA2), resulting in total total in viable K562 cells. Thirty-four proteins were selected as "dasatinib-interactors (group I)" (Fig. 4b).

Of the 34 proteins (group I proteins) selected as dasatinib-interactants, 4 protein tyrosine kinases (ABL1, ABL2, BTK and CSK) and 2 ATP binding proteins (RIOK1 and SMARCA2) were found to be significantly higher in DA5-treated samples. Although highly biotinylated by HT-TurbID (Fig. 4c, 4d), a total of 37 kinases and 57 ATP-binding proteins were found to be labeled by HT-TurbID in both samples (data not shown). These results indicate that these selected kinase and ATP-binding proteins have strong affinity for Dasatinib in living cells.

On the other hand, the FDA-approved results that dasatinib's target proteins, ABL1 and ABL2, are selectively biotinylated by HT-TurbID are good "proof-of-concept" results supporting that PROCID works as expected.

BTK and CSK were further identified as Dasatinib target proteins by PROCID. Although these proteins are not FDA-approved Dasatinib target proteins, in vitro characterization confirmed that they have binding affinity for Dasatinib. . Therefore, it means that these proteins have binding affinity for dasatinib specifically in living cells or in cellulo , which could not be confirmed in conventional cell lysates. To verify this, a follow-up experiment was conducted.

Validation of dasatinib-binding target proteins identified by PROCID

As a result of MS analysis, it was confirmed that many lysine residues of BTK and CSK were biotinylated by DA5-treated HT-TurbID (FIGS. 5a and 5b). This result means that they interact strongly with DA5 in living cells. To verify this, in cellulopotential analysis was performed to see if BTK and CSK proteins move to mitochondrial target halotak proteins after DA5 treatment (Fig. 3d). ).

Similar to ^KD ABL1, V5-tagged HT-TurbID-MoA localized to the outer mitochondrial membrane and HA-tagged BTK-mCherry or CSK-EGFP localized to the cytoplasm were transiently expressed. As a result of DA5 treatment, it was confirmed that both target proteins were translocated from the cytosol to the mitochondria (FIG. 5c). In addition, Pearson's correlation coefficient increased rapidly after DA5 treatment for both BTK and CSK. These DA5-dependent translocation results were also reproduced in experiments using the COS-7 cell line (data not shown).

Proximal protein modification reaction (PL-IP) coupled with immunoprecipitation assay was performed to confirm that BTK and CSK proteins were biotinylated by HT-TurbID under DA5 treatment. To this end, V5-tagged cytoplasmic HT-TurbID and HA-tagged BTK-mCherry or CSK-EGFP were transiently expressed intracellularly (Fig. 5d). The HA-tagged bait proteins BTK-mCherry and CSK-EGFP were well enriched with the anti-HA pulldown, but HT-TurbID was co-purified with the bait protein only from DA5 treated samples. In addition, concentrated BTK-mCherry and CSK-EGFP were biotinylated only under DA5 treatment (shown in SA-HRP western blot). These DA5-dependent biotinylation results were also reproduced in the results using HT-TurbID-MoA-transfected cells instead of HT-TurbID (data not shown). These results indicate that BTK and CSK are strongly bound to DA5 by DA5 treatment and that HT-TurbID is biotinylated by HT-TurbID in a close manner. From these results, it can be seen that the PROCID results preceding these proteins are valid. there was.

Identification of SMARCA2 as a Novel Interacting Protein of Dasatinib

Among the HT-TurbID-tagged proteins, the protein with the highest fold change by DA5 treatment was identified as SMARCA2 (FC=5.14). SMARCA2 is a relatively large protein (1590 amino acids, 181 kDa) involved in the process of chromatin remodeling. SMARCA2 has an ATP-binding domain (amino acids 736-901) and the biotinylated site of HT-TurbID (K904) is located near this ATP-binding domain. was found in (Fig. 6a).

Therefore, it was assumed that Dasatinib would bind to this ATP-binding domain specifically labeled by HT-TurbID following DA5 treatment in living cells (Fig. 6b), and to verify this, the 3D structure of SMARCA2 predicted in the AlphaFold database Structural analysis of the dasatinib-binding site of SMARCA2 was performed. As a result of Autodock's molecular simulation, the Dasatinib binding site clearly overlapped with the ATP binding site of the SMARCA2 protein in the X-ray co-crystal structure (PDB ID: 6EG3) (Fig. 6c). From these results, it was found that dasatinib can actually target the ATP binding site of SMARCA2.

In order to experimentally verify these structural data-based results, intracellular potential analysis and PL-IP analysis were performed using the ATP-binding domain of SMARCA2 (ABD SMARCA2). As a result, ^ABD SMARCA2 was observed to migrate to mitochondria-targeted HT-TurbID protein. Collectively, these results suggest that ^ABD SMARCA2 has physical binding affinity for dasatinib, and the PROCID method according to the present invention This indicates that novel interactors such as drugs that cannot be identified by conventional cell lysis methods can be identified in these living cells (FIG. 6e).

Having described specific parts of the present invention in detail above, it is clear to those skilled in the art that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<SEQ ID NO: 1> Halotag-TurboID

<SEQ ID NO: 2> KpnI -BTK-mcherry-HA-Stop- XhoI

<SEQ ID NO: 3> HindIII -CSK-EGFP-HA-Stop- XhoI

<SEQ ID NO: 4> NotI- HaloTag- BamHI- V5-TurboID - Stop -ApaI

<SEQ ID NO: 5> BsiWI- HaloTag- NheI- V5-TurboID - Stop -AgeI

<SEQ ID NO: 6> BsiWI- HaloTag- NheI- V5-TurboID - MoA-Stop -AgeI

<SEQ ID NO: 7> HindIII -HA-Abl Kinetic Domain-Stop- XhoI

<SEQ ID NO: 8> KpnI -TOM20-HA-Kinetic Domain-Stop- XhoI

<SEQ ID NO: 9> BsiWI- TOM20-SMARCA2 Helicase ATP binding domain-HA- Stop -AgeI

<SEQ ID NO: 10> BsiWI -SMARCA2 Helicase ATP binding domain-HA-Stop- AgeI

<110> Seoul National University R and DB Foundation <120> Identification of novel drug-binding protein using proximity labeling <130> 1069437 <150> KR 1020210084273 <151> 2021-06-28 <160> 10 <170> KoPatentIn 3.0 < 210> 1 <211> 635 <212> PRT <213> Artificial Sequence <220> <223> HT-TurbID <400> 1 Met Ala Glu Ile Gly Thr Gly Phe Pro Phe Asp Pro His Tyr Val Glu 1 5 10 15 Val Leu Gly Glu Arg Met His Tyr Val Asp Val Gly Pro Arg Asp Gly 20 25 30 Thr Pro Val Leu Phe Leu His Gly Asn Pro Thr Ser Ser Tyr Val Trp 35 40 45 Arg Asn Ile Ile Pro His Val Ala Pro Thr His Arg Cys Ile Ala Pro 50 55 60 Asp Leu Ile Gly Met Gly Lys Ser Asp Lys Pro Asp Leu Gly Tyr Phe 65 70 75 80 Phe Asp Asp His Val Arg Phe Met Asp Ala Phe Ile Glu Ala Leu Gly 85 90 95 Leu Glu Glu Val Val Val Leu Val Ile His Asp Trp Gly Ser Ala Leu Gly 100 105 110 Phe His Trp Ala Lys Arg Asn Pro Glu Arg Val Lys Gly Ile Ala Phe 115 120 125 Met Glu Phe Ile Arg Pro Ile Pro Thr Trp Asp Glu Trp Pro Glu Phe 130 135 140 Ala Arg Glu Thr Phe Gln Ala Phe Arg Thr Thr Asp Val Gly Arg Lys 145 150 155 160 Leu Ile Ile Asp Gln Asn Val Phe Ile Glu Gly Thr Leu Pro Met Gly 165 170 175 Val Val Arg Pro Leu Thr Glu Val Glu Met Asp His Tyr Arg Glu Pro 180 185 190 Phe Leu Asn Pro Val Asp Arg Glu Pro Leu Trp Arg Phe Pro Asn Glu 195 200 205 Leu Pro Ile Ala Gly Glu Pro Ala Asn Ile Val Ala Leu Val Glu Glu 210 215 220 Tyr Met Asp Trp Leu His Gln Ser Pro Val Pro Lys Leu Leu Phe Trp 225 230 235 240 Gly Thr Pro Gly Val Leu Ile Pro Pro Ala Glu Ala Ala Arg Leu Ala 245 250 255 Lys Ser Leu Pro Asn Cys Lys Ala Val Asp Ile Gly Pro Gly Leu Asn 260 265 270 Leu Leu Gln Glu Asp Asn Pro Asp Leu Ile Gly Ser Glu Ile Ala Arg 275 280 285 Trp Leu Ser Thr Leu Glu Ile Ser Gly Gly Arg Pro Leu Ala Gly Lys 290 295 300 Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Lys Asp Asn Thr 305 310 315 320 Val Pro Leu Lys Leu Ile Ala Leu Leu Ala Asn Gly Glu Phe His Ser 325 330 335 Gly Glu Gln Leu Gly Glu Thr Leu Gly Met Ser Arg Ala Ala Ile Asn 340 345 350 Lys His Ile Gln Thr Leu Arg Asp Trp Gly Val Asp Val Phe Thr Val 355 360 365 Pro Gly Lys Gly Tyr Ser Leu Pro Glu Pro Ile Pro Leu Leu Asn Ala 370 375 380 Lys Gln Ile Leu Gly Gln Leu Asp Gly Gly Ser Val Ala Val Leu Pro 385 390 395 400 Val Val Asp Ser Thr Asn Gln Tyr Leu Leu Asp Arg Ile Gly Glu Leu 405 410 415 Lys Ser Gly Asp Ala Cys Ile Ala Glu Tyr Gln Gln Ala Gly Arg Gly 420 425 430 Ser Arg Gly Arg Lys Trp Phe Ser Pro Phe Gly Ala Asn Leu Tyr Leu 435 440 445 Ser Met Phe Trp Arg Leu Lys Arg Gly Pro Ala Ala Ile Gly Leu Gly 450 455 460 Pro Val Ile Gly Ile Val Met Ala Glu Ala Leu Arg Lys Leu Gly Ala 465 470 475 480 Asp Lys Val Arg Val Lys Trp Pro Asn Asp Leu Tyr Leu Gln Asp Arg 485 490 495 Lys Leu Ala Gly Ile Leu Glu Glu Ser Val Val Val Asn Gln Gly Trp Ile Thr Leu Gln Glu Ala Gly 530 535 540 Ile Asn Leu Asp Arg Asn Thr Leu Ala Ala Thr Leu Ile Arg Glu Leu 545 550 555 560 Arg Ala Ala Leu Glu Leu Phe Glu Gln Glu Gly Leu Ala Pro Tyr Leu 565 570 575 Pro Arg Trp Glu Lys Leu Asp Asn Phe Ile Asn Arg Pro Val Lys Leu 580 585 590 Ile Ile Gly Asp Lys Glu Ile Phe Gly Ile Ser Arg Gly Ile Asp Lys 595 600 605 Gln Gly Ala Leu Leu Leu Glu Gln Asp Gly Val Ile Lys Pro Trp Met 610 615 620 Gly Gly Glu Ile Ser Leu Arg Ser Ala Glu Lys 625 630 635 <210> 2 <211> 2760 < 212> DNA <213> Artificial Sequence <220> <223> KpnI-BTK-mcherry-HA-Stop-XhoI <400> 2 ggtaccatgg ctgcagtgat actggagagc atctttctga agcgctccca gcagaaaaag 60 aaaacatcac ctttaaactt caagaagcgc ctgtttctct tgactgtaca caaactttca 120 tactatgaat atgactttga acgtgggaga agaggcagta agaaaggttc aatagatgtt 180 gagaagatca cctgtgttga aacagtaatt cctgaaaaaa atcccccacc agaaagacag 240 attccgagga gaggtgagga gtctagtgaa atggaacaga tttcaatcat tgaaaggttc 300 ccgtacccat tccaggttgt atatgatgaa ggacctctct atgttttctc cccaactgaa 360 gagctgagaa agcgctggat tcaccagctc aaaaatgtaa tccggtacaa tagtgacctg 420 gtacagaaat accatccttg cttctggatt gatggacagt atctctgctg ctctcagaca 480 gccaagaatg ctatgggctg ccaaattttg gagaacagga atggaagctt aaaacctggg 540 agttctcatc gaaaaacgaa aaagcctctt ccccctaccc cagaggaaga tcagatcttg 600 aaaaaaccgc ttcccccgga gccaacagca gcaccaatct ccacaaccga gctgaaaaag 660 gtcgtggccc tttatgatta catgccaatg aacgcaaatg acttacaatt gcgaaagggc 720 gaggagtatt ttatcctgga ggagagcaac ctaccgtggt ggcgagcacg agataaaaat 780 gggcaggaag gctacatccc aagtaactat atcactgaag ctgaggactc catagagatg 840 tatgagtggt attccaagca catgactcga agtcaagctg agcaactgct aaagcaagag 900 gggaaagaag gaggtttcat tgtcagagac tccagcaaag ctggaaaata caccgtgtct 960 gtgtttgcta aatctactgg ggagcctcaa ggggtgatcc gccattacgt tgtgtgttcc 1020 acgccacaga gccagtatta cctggctgag aaacacctct tcagcaccat ccctgagctc 1080 attaactacc atcaacacaa ctctgcaggc ctcatatcca ggctgaaata tcctgtgtct 1140 aaacaaaaca aaaacgcgcc ttctactgca ggcctg ggct atggatcatg ggaaattgat 1200 ccaaaggacc tcaccttctt gaaggagctt gggactggac aattcggtgt cgtgaaatat 1260 gggaagtgga ggggccaata tgatgtggcc atcaagatga tcagagaagg ttccatgtcg 1320 gaggatgaat tcattgaaga agccaaagtc atgatgaatc tttcccatga gaagctggtg 1380 cagttgtatg gcgtctgcac caaacaacgc cccatcttca tcatcaccga gtacatggct 1440 aatggctgcc tcttgaacta cctgagggag atgcggcacc gcttccagac acagcagctg 1500 cttgagatgt gcaaagatgt ctgtgaagca atggaatact tggagtcgaa gcagttcctt 1560 cacagagacc tggcagctcg aaactgtttg gtaaacgatc aaggagttgt gaaagtatct 1620 gactttggcc tgtctaggta tgtccttgat gatgagtaca ccagctctgt aggctccaag 1680 tttccagtcc ggtggtctcc accagaagtg cttatgtata gcaagttcag cagcaaatct 1740 gacatctggg cttttggggt tttaatgtgg gagatctact ccctggggaa gatgccgtat 1800 gagagattta ctaacagtga gacagcagaa cacattgctc aaggcttacg tctctacagg 1860 cctcatctgg catcagagag ggtatatacc atcatgtaca gctgctggca cgagaaagca 1920 gatgaacgtc ctagtttcaa aattctcttg agtaacattc tagatgtgat ggatgaagaa 1980 tcccctaggg gaggaggagg atcaggagga ggaggatcag t gagcaaggg cgaggaggat 2040 aacatggcca tcatcaagga gttcatgcgc ttcaaggtgc acatggaggg ctccgtgaac 2100 ggccacgagt tcgagatcga gggcgagggc gagggccgcc cctacgaggg cacccagacc 2160 gccaagctga aggtgaccaa gggcggcccc ctgcccttcg cctgggacat cctgtcccct 2220 cagttcatgt acggctccaa ggcctacgtg aagcaccccg ccgacatccc cgactacttg 2280 aagctgtcct tccccgaggg cttcaagtgg gagcgcgtga tgaacttcga ggacggcggc 2340 gtggtgaccg tgacccagga ctcctccctg caggacggcg agttcatcta caaggtgaag 2400 ctgcgcggca ccaacttccc ctccgacggc cccgtaatgc agaagaagac catgggctgg 2460 gaggcctcct ccgagcggat gtaccccgag gacggcgccc tgaagggcga gatcaagcag 2520 aggctgaagc tgaaggacgg cggccactac gacgccgagg tcaagaccac ctacaaggcc 2580 aagaagcccg tgcagctgcc cggcgcctac aacgtcaaca tcaagctgga catcacctcc 2640 cacaacgagg actacaccat cgtggaacag tacgagcgcg ccgagggccg ccactccacc 2700 ggcggcatgg acgagctgta caagtaccct tacgatgtac cggattacgc ataactcgag 2760 2760 <210> 3 <211> 2118 <212> DNA <213> Artificial Sequence <220> <223> HindIII-CSK-EGFP-HA-Stop-XhoI <400> 3 aagcttatgt c agcaataca ggccgcctgg ccatccggta cagaatgtat tgccaagtac 60 aacttccacg gcactgccga gcaggacctg cccttctgca aaggagacgt gctcaccatt 120 gtggccgtca ccaaggaccc caactggtac aaagccaaaa acaaggtggg ccgtgagggc 180 atcatcccag ccaactacgt ccagaagcgg gagggcgtga aggcgggtac caaactcagc 240 ctcatgcctt ggttccacgg caagatcaca cgggagcagg ctgagcggct tctgtacccg 300 ccggagacag gcctgttcct ggtgcgggag agcaccaact accccggaga ctacacgctg 360 tgcgtgagct gcgacggcaa ggtggagcac taccgcatca tgtaccatgc cagcaagctc 420 agcatcgacg aggaggtgta ctttgagaac ctcatgcagc tggtggagca ctacacctca 480 gacgcagatg gactctgtac gcgcctcatt aaaccaaagg tcatggaggg cacagtggcg 540 gcccaggatg agttctaccg cagcggctgg gccctgaaca tgaaggagct gaagctgctg 600 cagaccatcg ggaaggggga gttcggagac gtgatgctgg gcgattaccg agggaacaaa 660 gtcgccgtca agtgcattaa gaacgacgcc actgcccagg ccttcctggc tgaagcctca 720 gtcatgacgc aactgcggca tagcaacctg gtgcagctcc tgggcgtgat cgtggaggag 780 aagggcgggc tctacatcgt cactgagtac atggccaagg ggagccttgt ggactacctg 840 cggtctaggg gtcggtcagt gctgggcggagactgtctcc tcaagttctc gctagatgtc 900 tgcgaggcca tggaatacct ggagggcaac aatttcgtgc atcgagacct ggctgcccgc 960 aatgtgctgg tgtctgagga caacgtggcc aaggtcagcg actttggtct caccaaggag 1020 gcgtccagca cccaggacac gggcaagctg ccagtcaagt ggacagcccc tgaggccctg 1080 agagagaaga aattctccac taagtctgac gtgtggagtt tcggaatcct tctctgggaa 1140 atctactcct ttgggcgagt gccttatcca agaattcccc tgaaggacgt cgtccctcgg 1200 gtggagaagg gctacaagat ggatgccccc gacggctgcc cgcccgcagt ctatgaagtc 1260 atgaagaact gctggcacct ggacgccgcc atgcggccct ccttcctaca gctccgagag 1320 cagcttgagc acatcaaaac ccacgagctg cacctggcgg ccgccatggt gagcaagggc 1380 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 1440 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 1500 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 1560 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 1620 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 1680 aactacaaga cccgcgccga ggtgaagttc gagggcga ca ccctggtgaa ccgcatcgag 1740 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 1800 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 1860 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 1920 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 1980 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 2040 accgccgccg ggatcactct cggcatggac gagctgtaca agtaccctta cgatgtaccg 2100 gattacgcat aactcgag 2118 < 210> 4 <211> 1925 <212> DNA <213> Artificial Sequence <220> <223> NotI-HaloTag-BamHI-V5-TurboID-Stop-ApaI <400> 4 gcggccgcat ggcagaaatc ggtactggct ttccattcga cccccattat gtggaagtcc 60 tgggcgagtcggtc tggcacccct gtgctgttcc 120 tgcacggtaa cccgacctcc tcctacgtgt ggcgcaacat catcccgcat gttgcaccga 180 cccatcgctg cattgctcca gacctgatcg gtatgggcaa atccgacaaa ccagacctgg 240 gttatttctt cgacgaccac gtccgcttca tggatgcctt catcgaagcc ctgggtctgg 300 aagaggtcgt cctggtcatt cacgactggg gctccgctct gggtttccac tgggccaagc 360 gcaatccaga gcgcgtcaaa ggtattgcat ttatggagtt catccgccct atcccgacct 420 gggacgaatg gccagaattt gcccgcgaga ccttccaggc cttccgcacc accgacgtcg 480 gccgcaagct gatcatcgat cagaacgttt ttatcgaggg tacgctgccg atgggtgtcg 540 tccgcccgct gactgaagtc gagatggacc attaccgcga gccgttcctg aatcctgttg 600 accgcgagcc actgtggcgc ttcccaaacg agctgccaat cgccggtgag ccagcgaaca 660 tcgtcgcgct ggtcgaagaa tacatggact ggctgcacca gtcccctgtc ccgaagctgc 720 tgttctgggg caccccaggc gttctgatcc caccggccga agccgctcgc ctggccaaaa 780 gcctgcctaa ctgcaaggct gtggacatcg gcccgggtct gaatctgctg caagaagaca 840 acccggacct gatcggcagc gagatcgcgc gctggctgtc gacgctcgag atttccggca 900 aggatccagg caagcccatc cccaaccccc tgctgggcct ggacagcacc aaagacaata 960 ctgtgcctct gaagctgatc gctctcctgg ctaatggcga gttccatagt ggcgaacagc 1020 tgggagaaac cctgggcatg tccagggccg ctatcaacaa gcacattcag actctgcgcg 1080 actggggcgt ggacgtgttc accgtgcccg gaaagggcta ctctctgccc gagcctatcc 1140 cgctgctgaa cgctaaacag attctgggac agctggacgg cgggagcgtg gcagtcctgc 1200 c tgtggtcga ctccaccaat cagtacctgc tggatcgaat cggcgagctg aagagtgggg 1260 atgcttgcat tgcagaatat cagcaggcag ggagaggaag cagagggagg aaatggttct 1320 ctccttttgg agctaacctg tacctgagta tgttttggcg cctgaagcgg ggaccagcag 1380 caatcggcct gggcccggtc atcggaattg tcatggcaga agcgctgcga aagctgggag 1440 cagacaaggt gcgagtcaaa tggcccaatg acctgtatct gcaggataga aagctggcag 1500 gcatcctggt ggagctggcc ggaataacag gcgatgctgc acagatcgtc attggcgccg 1560 ggattaacgt ggctatgagg cgcgtggagg aaagcgtggt caatcagggc tggatcacac 1620 tgcaggaagc agggattaac ctggacagga atactctggc cgctacgctg atccgagagc 1680 tgcgggcagc cctggaactg ttcgagcagg aaggcctggc tccatatctg ccacggtggg 1740 agaagctgga taacttcatc aatagacccg tgaagctgat cattggggac aaagagattt 1800 tcgggattag ccgggggatt gataaacagg gagccctgct gctggaacag gacggagtta 1860 tcaaaccctg gatgggcgga gaaatcagtc tgcggtctgc cgaaaagtaa tgatctagag 1920 ggccc 1925 <210> 5 <211> 1948 <212> DNA <213 > Artificial Sequence <220> <223> BsiWI- HaloTag-NheI-V5-TurboID-Stop-AgeI <400> 5 cgtacgatgg cagaaatcgg tactggcttt ccattcgacc cccattatgt ggaagtcctg 60 ggcgagcgca tgcactacgt cgatgttggt ccgcgcgatg gcacccctgt gctgttcctg 120 cacggtaacc cgacctcctc ctacgtgtgg cgcaacatca tcccgcatgt tgcaccgacc 180 catcgctgca ttgctccaga cctgatcggt atgggcaaat ccgacaaacc agacctgggt 240 tatttcttcg acgaccacgt ccgcttcatg gatgccttca tcgaagccct gggtctggaa 300 gaggtcgtcc tggtcattca cgactggggc tccgctctgg gtttccactg ggccaagcgc 360 aatccagagc gcgtcaaagg tattgcattt atggagttca tccgccctat cccgacctgg 420 gacgaatggc cagaatttgc ccgcgagacc ttccaggcct tccgcaccac cgacgtcggc 480 cgcaagctga tcatcgatca gaacgttttt atcgagggta cgctgccgat gggtgtcgtc 540 cgcccgctga ctgaagtcga gatggaccat taccgcgagc cgttcctgaa tcctgttgac 600 cgcgagccac tgtggcgctt cccaaacgag ctgccaatcg ccggtgagcc agcgaacatc 660 gtcgcgctgg tcgaagaata catggactgg ctgcaccagt cccctgtccc gaagctgctg 720 ttctggggca ccccaggcgt tctgatccca ccggccgaag ccgctcgcct ggccaaaagc 780 ctgcctaact gcaaggctgt ggacatcggc ccgggtctga atctgctgca agaagacaac 840 ccggacctga tcggcagcga gatcgcgcgc tggctgtcga cgctcgagat ttccggcggc 900 cggccgctag caggcaagcc catccccaac cccctgctgg gcctggacag caccaaagac 960 aatactgtgc ctctgaagct gatcgctctc ctggctaatg gcgagttcca tagtggcgaa 1020 cagctgggag aaaccctggg catgtccagg gccgctatca acaagcacat tcagactctg 1080 cgcgactggg gcgtggacgt gttcaccgtg cccggaaagg gctactctct gcccgagcct 1140 atcccgctgc tgaacgctaa acagattctg ggacagctgg acggcgggag cgtggcagtc 1200 ctgcctgtgg tcgactccac caatcagtac ctgctggatc gaatcggcga gctgaagagt 1260 ggggatgctt gcattgcaga atatcagcag gcagggagag gaagcagagg gaggaaatgg 1320 ttctctcctt ttggagctaa cctgtacctg agtatgtttt ggcgcctgaa gcggggacca 1380 gcagcaatcg gcctgggccc ggtcatcgga attgtcatgg cagaagcgct gcgaaagctg 1440 ggagcagaca aggtgcgagt caaatggccc aatgacctgt atctgcagga tagaaagctg 1500 gcaggcatcc tggtggagct ggccggaata acaggcgatg ctgcacagat cgtcattggc 1560 gccgggatta acgtggctat gaggcgcgtg gaggaaagcg tggtcaatca gggctggatc 1620 acactgcagg aagcagggat taacctggac aggaatactc tggccgctac gctgatccga 1680 gagctgcggg cagccctgga actgttcgag caggaaggcc tggctcc ata tctgccacgg 1740 tgggagaagc tggataactt catcaataga cccgtgaagc tgatcattgg ggacaaagag 1800 attttcggga ttagccgggg gattgataaa cagggagccc tgctgctgga acaggacgga 1860 gttatcaaac cctggatggg cggagaaatc agtctgcggt ctgccgaaaa gtgataaacc 1920 cagctttctt gtacaaagtg gtaccggt 1948 <210> 6 <211> 2098 <212> DNA <213> Artificial Sequence <220> <223 > BsiWI- HaloTag-NheI-V5-TurboID-MoA-Stop-AgeI <400> 6 cgtacgatgg cagaaatcgg tactggcttt ccattcgacc cccattatgt ggaagtcctg 60 ggcgagcgca tgcactacgt cgatgttggt ccgcgcgatg gcacccctgt gctgttcctg 120 cacggtaacc cgacctcctc ctacgtgtgg cgcaacatca tcccgcatgt tgcaccgacc 180 catcgctgca ttgctccaga cctgatcggt atgggcaaat ccgacaaacc agacctgggt 240 tatttcttcg acgaccacgt ccgcttcatg gatgccttca tcgaagccct gggtctggaa 300 gaggtcgtcc tggtcattca cgactggggc tccgctctgg gtttccactg ggccaagcgc 360 aatccagagc gcgtcaaagg tattgcattt atggagttca tccgccctat cccgacctgg 420 gacgaatggc cagaatttgc ccgcgagacc ttccaggcct tccgcaccac cgacgtcggc 480 cgcaagctga tcatcgatca gaacgttttt atcgagggta cgctgccg at gggtgtcgtc 540 cgcccgctga ctgaagtcga gatggaccat taccgcgagc cgttcctgaa tcctgttgac 600 cgcgagccac tgtggcgctt cccaaacgag ctgccaatcg ccggtgagcc agcgaacatc 660 gtcgcgctgg tcgaagaata catggactgg ctgcaccagt cccctgtccc gaagctgctg 720 ttctggggca ccccaggcgt tctgatccca ccggccgaag ccgctcgcct ggccaaaagc 780 ctgcctaact gcaaggctgt ggacatcggc ccgggtctga atctgctgca agaagacaac 840 ccggacctga tcggcagcga gatcgcgcgc tggctgtcga cgctcgagat ttccggcggc 900 cggccgctag caggcaagcc catccccaac cccctgctgg gcctggacag caccaaagac 960 aatactgtgc ctctgaagct gatcgctctc ctggctaatg gcgagttcca tagtggcgaa 1020 cagctgggag aaaccctggg catgtccagg gccgctatca acaagcacat tcagactctg 1080 cgcgactggg gcgtggacgt gttcaccgtg cccggaaagg gctactctct gcccgagcct 1140 atcccgctgc tgaacgctaa acagattctg ggacagctgg acggcgggag cgtggcagtc 1200 ctgcctgtgg tcgactccac caatcagtac ctgctggatc gaatcggcga gctgaagagt 1260 ggggatgctt gcattgcaga atatcagcag gcagggagag gaagcagagg gaggaaatgg 1320 ttctctcctt ttggagctaa cctgtacctg agtatgtttt ggcgcctgaa gcggggacca 1380 gcagcaatcg gcctgggccc ggtcatcgga attgtcatgg cagaagcgct gcgaaagctg 1440 ggagcagaca aggtgcgagt caaatggccc aatgacctgt atctgcagga tagaaagctg 1500 gcaggcatcc tggtggagct ggccggaata acaggcgatg ctgcacagat cgtcattggc 1560 gccgggatta acgtggctat gaggcgcgtg gaggaaagcg tggtcaatca gggctggatc 1620 acactgcag g aagcagggat taacctggac aggaatactc tggccgctac gctgatccga 1680 gagctgcggg cagccctgga actgttcgag caggaaggcc tggctccata tctgccacgg 1740 tgggagaagc tggataactt catcaataga cccgtgaagc tgatcattgg ggacaaagag 1800 attttcggga ttagccgggg gattgataaa cagggagccc tgctgctgga acaggacgga 1860 gttatcaaac cctggatggg cggagaaatc agtctgcggt ctgccgaaaa gagatctcga 1920 gctcaagctt cgaattcgag tgctggtggt ttctgggaaa ggaacctgcc ctctgtttct 1980 ggcctgctga agatcattgg attttccaca tcagtaactg ccctggggtt tgtgctgtac 2040 aaatacaagc tcctgccacg gtcttgaacc cagctttctt gtacaaagtg gtaccggt 2098 <210> 7 <211> 897 <212> DNA <213> Artificial Sequence <220> <223> HindIII-HA-Abl Kinetic Domain-Stop-XhoI <400> 7 aagcttatgt acccttacga tgtaccgaagggat cacagatgaggtac tacgatcagggat 60 atggaacgta ccgatatcac catgaaacac aaattgggtg gtggccagta cggtgaggtg 120 tatgaaggcg tttggaaaaa atatagcctg accgtggcgg ttaaaaccct gaaagaagat 180 acgatggaag ttgaagagtt tctgaaagaa gcggcagtga tgaaggaaat taaacatcct 240 aacctggtcc agctgctggg cgtgtgtacc cgtgaacccc cgtttt atat cattaccgag 300 ttcatgactt atggtaactt gctggattat ctgcgcgagt gcaaccgtca agaagtgaat 360 gccgttgtgc tgctgtatat ggcgacgcag atctcttctg cgatggagta tctggagaaa 420 aagaacttca tccatcgtga tctggcggcg cgcaactgct tggtgggtga gaaccatctg 480 gtgaaggtgg ctgattttgg cctcagtcgg ctgatgacgg gcgatacata taccgctcac 540 gccggtgcga aatttccgat taaatggacc gcaccggagt ccctggcgta taataagttc 600 tcgattaaaa gcgatgtttg ggcgtttggc gttttgctgt gggagattgc gacctatggt 660 atgtccccgt atccgggcat tgacttgagt caagtgtatg aactgctcga aaaagattat 720 cgcatggagc gtccagaggg ctgccccgag aaagtctatg agctgatgcg cgcatgctgg 780 cagtggaacc cgtccgaccg cccgagcttc gcggaaatcc accaagcctt tgaaacgatg 840 tttcaagaga gtagcattag tgacgaagtg gaaaaagaac tcggaaagta actcgag 897 <210> 8 <211> 1335 <212> DNA <213> Artificial Sequence <220> <223> KpnI-TOM20- HA-Kinetic Domain-Stop-XhoI <400> 8 ggtaccatgg tgggtcggaa cagcgccatc gccgccggtg tatgcggggc ccttttcatt 60 gggtactgca tctacttcga ccgcaaaaga cgaagtgacc ccaacttcaa gaacaggctt 120 cgagaacgaa gaaagaaaca gaagcttg cc aaggagagag ctgggctttc caagttacct 180 gaccttaaag atgctgaagc tgttcagaag ttcttccttg aagaaataca gcttggtgaa 240 gagttactag ctcaaggtga atatgagaag ggcgtagacc atctgacaaa tgcaattgct 300 gtgtgtggac agccacagca gttactgcag gtcttacagc aaactcttcc accaccagtg 360 ttccagatgc ttctgactaa gctcccaaca attagtcaga gaattgtaag tgctcagagc 420 ttggctgaag atgatgtgga aggatcctac ccttacgatg taccggatta cgcaagtccg 480 aactatgaca aatgggaaat ggaacgtacc gatatcacca tgaaacacaa attgggtggt 540 ggccagtacg gtgaggtgta tgaaggcgtt tggaaaaaat atagcctgac cgtggcggtt 600 aaaaccctga aagaagatac gatggaagtt gaagagtttc tgaaagaagc ggcagtgatg 660 aaggaaatta aacatcctaa cctggtccag ctgctgggcg tgtgtacccg tgaacccccg 720 ttttatatca ttaccgagtt catgacttat ggtaacttgc tggattatct gcgcgagtgc 780 aaccgtcaag aagtgaatgc cgttgtgctg ctgtatatgg cgacgcagat ctcttctgcg 840 atggagtatc tggagaaaaa gaacttcatc catcgtgatc tggcggcgcg caactgcttg 900 gtgggtgaga accatctggt gaaggtggct gattttggcc tcagtcggct gatgacgggc 960 gatacatata ccgctcacgc cggtgcgaaa tttccgatta aatgga ccgc accggagtcc 1020 ctggcgtata ataagttctc gattaaaagc gatgtttggg cgtttggcgt tttgctgtgg 1080 gagattgcga cctatggtat gtccccgtat ccgggcattg acttgagtca agtgtatgaa 1140 ctgctcgaaa aagattatcg catggagcgt ccagagggct gccccgagaa agtctatgag 1200 ctgatgcgcg catgctggca gtggaacccg tccgaccgcc cgagcttcgc ggaaatccac 1260 caagcctttg aaacgatgtt tcaagagagt agcattagtg acgaagtgga aaaagaactc 1320 ggaaagtaac tcgag 1335 <210> 9 <211> 1036 < 212> DNA <213> Artificial Sequence <220> <223> BsiWI- TOM20-SMARCA2 Helicase ATP binding domain-HA- Stop-AgeI <400> 9 cgtacgatgg tgggtcggaa cagcgccatc gccgccggtg tatgcggggc ccttttcatt 60 gggtactgca tctacttcga ccgcaaaaga cgaagtgacc ccaacttcaa gaacaggctt 120 cgagaacgaa gaaagaaaca gaagcttgcc aaggagagag ctgggctttc caagttacct 180 gaccttaaag atgctgaagc tgttcagaag ttcttccttg aagaaataca gcttggtgaa 240 gagttactag ctcaaggtga atatgagaag ggcgtagacc atctgacaaa tgcaattgct 300 gtgtgtggac agccacagca gttactgcag gtcttacagc aaactcttcc accaccagtg 360 ttccagatgc ttctgactaa gctcccaaca attagtcaga g aattgtaag tgctcagagc 420 ttggctgaag atgatgtgga agaacaaaaa ctcatctcag aagaggatct gatggtttcc 480 ctgtataata acaacttgaa cggaatctta gccgatgaaa tggggcttgg aaagaccata 540 cagaccattg cactcatcac ttatctgatg gagcacaaaa gactcaatgg cccctatctc 600 atcattgttc ccctttcgac tctatctaac tggacatatg aatttgacaa atgggctcct 660 tctgtggtga agatttctta caagggtact cctgccatgc gtcgctccct tgtcccccag 720 ctacggagtg gcaaattcaa tgtcctcttg actacttatg agtatattat aaaagacaag 780 cacattcttg caaagattcg gtggaaatac atgatagtgg acgaaggcca ccgaatgaag 840 aatcaccact gcaagctgac tcaggtcttg aacactcact atgtggcccc cagaaggatc 900 ctcttgactg ggaccccgct gcagaataag ctccctgaac tctgggccct cctcaacttc 960 ctcctcccaa cataccctta cgatgtaccg gattacgcat gataaaccca gctttcttgt 1020 acaaagtggt accggt 1036 <210> 10 <211> 571 <212> DNA <213> Artificial Sequence <220> <223> BsiWI -SMARCA2 Helicase ATP binding domain-HA- Stop-AgeI <400> 10 cgtacgatgg tttccctgta taataacaac ttgaacggaa tcttagccga tgaaatgggg 60 cttggaaaga ccatacagac cattgcactc atcacttatc tgatgg agca caaaagactc 120 aatggcccct atctcatcat tgttcccctt tcgactctat ctaactggac atatgaattt 180 gacaaatggg ctccttctgt ggtgaagatt tcttacaagg gtactcctgc catgcgtcgc 240 tcccttgtcc cccagctacg gagtggcaaa ttcaatgtcc tcttgactac ttatgagtat 300 attataaaag acaagcacat tcttgcaaag attcggtgga aatacatgat agtggacgaa 360 ggccaccgaa tgaagaatca ccactgcaag ctgactcagg tcttgaacac tcactatgtg 420 gcccccagaa ggatcctctt gactgggacc ccgctgcaga ataagctccc tgaactctgg 480 gccctcctca acttcctcct cccaacatac ccttacgatg taccggatta cgcatgataa 540acccagcttt cttgtacaaa gtggtaccgg t 571

Claims (13)

A fusion protein in which TurbID, a biotin ligase enzyme protein, is linked to a tag protein.
The fusion protein according to claim 1, wherein the tag protein is halotak, snaptac, cliptac or avidin.
A nucleic acid encoding the fusion protein of claim 1.
A cell into which the nucleic acid of claim 3 or a vector containing the nucleic acid has been introduced.
A method for identifying a drug target protein comprising the following steps:
(a) treating the cells of claim 4 with a drug to which a ligand specifically binding to the tag protein is bound:
(b) lysing the cells; and
(c) identifying biotinylated proteins in the lysed cells as drug target proteins.
According to claim 5,
Characterized in that the cells of step (a) are living cells.
According to claim 6,
In the step (a), the drug target protein is characterized in that in cellulo biotinylation, the method.
According to claim 5,
After step (b), (b') isolating biotinylated proteins from the lysed cells.
According to claim 8,
After the step (b'), (b'') characterized in that it further comprises the step of digesting the separated protein with a hydrolytic enzyme.
According to claim 5,
The method characterized in that the biotinylated protein in step (c) is identified by mass spectrometry.
According to claim 5,
In the step (c), the cell expressing the fusion protein is excluded from the drug target protein in a state in which the drug to which the ligand specifically binding to the tag protein is not treated is not treated.
A kit for identifying a drug target protein comprising a vector comprising the nucleic acid of claim 3 and a ligand specifically binding to the tag protein.
The kit according to claim 12, wherein the kit further comprises at least one selected from the group consisting of biotin, streptavidin beads, and instructions for use of the kit.

Images