KR20220170019A - Prebiotics composition for improving intestinal microflora comprising sweet potato peel extract and functional food comprising the same - Google Patents

Abstract

The present invention relates to a prebiotics composition for alleaviating intestinal microflora comprising a sweet potato peel oligosaccharide extract as an active ingredient containing 1-kestose (GF_2) as a key component, and to a functional food that can improve the intestinal microflora by promoting the growth of probiotics including the same.

Description

Prebiotics composition for improving intestinal microflora comprising sweet potato peel extract and functional food comprising the same}

The present invention relates to a prebiotics composition for improving the intestinal microflora containing a sweet potato peel extract and a functional food containing the same, and more particularly, to a sweet potato peel extract containing 1-kestose (GF ₂ ) as a key ingredient as an active ingredient It relates to a prebiotics composition for improving the intestinal flora and a functional food capable of improving the intestinal flora by promoting the growth of probiotics by including the same.

Probiotics are microorganisms that are beneficial to the human body and can contribute to the maintenance of the health of the host when ingested in an appropriate amount. Probiotics provide a kind of barrier to suppress the establishment of pathogenic bacteria in the intestine, and strengthen the intestinal mucosa to produce antibacterial substances, lysozyme, etc., and have the effect of enhancing immune activity.

Prebiotics are indigestible ingredients that help the growth of beneficial bacteria (probiotics) in the intestine, and are substances that help improve the intestinal environment by becoming a nutrient source for probiotics.

Conventional techniques for isolating prebiotics from agricultural products or foods include a prebiotics composition for improving the intestinal flora containing a banana peel extract and a functional food containing the same (Patent Document 0001), and a garlic peel extract for improving the intestinal flora. Prebiotics composition and functional food containing the same (Patent Document 0002), composition for improving intestinal health containing deodeok extract (Patent Document 0003), composition for improving intestinal health containing red yeast rice extract (Patent Document 0004) etc. are disclosed.

Currently, not only the tuber, but also the sweet potato skin and aboveground parts are all listed as edible, but only a small amount of the petiole of the aboveground parts is used for vegetables, and most of the peel and aboveground parts are treated as agricultural by-products during harvest and are discarded. In addition, there are no studies that have confirmed the efficacy of prebiotics for each variety and part of Korean sweet potato.

If prebiotics can be separated from agricultural by-products such as sweet potato skins, it is possible to process the by-products as well as increase economic added value. Research and development for using agricultural by-products such as sweet potato skins as prebiotics materials is urgently required.

Therefore, the present inventors confirmed the applicability of sweet potato peel extract to functional food together with probiotics as a prebiotics composition and completed the present invention.

Korean Patent Publication No. 10-2020-0112147 Korean Patent Publication No. 10-2020-0112148 Korean Patent Publication No. 10-2017-0135520 Korean Patent Publication No. 10-2018-0041104

The present invention has been made to solve the problems of the prior art as described above, and an object of the present invention is to provide a prebiotics composition for utilizing an extract obtained from sweet potato peel, which is a by-product, as a prebiotics material.

Another object of the present invention is to provide a functional food capable of improving intestinal flora by promoting the growth of probiotics using the prebiotics composition.

The present invention provides a prebiotics composition for improving the intestinal microflora containing sweet potato peel extract as an active ingredient.

In addition, the present invention provides a functional food containing the prebiotics composition.

One embodiment of the present invention relates to a prebiotics composition for improving the intestinal flora comprising garlic peel extract as an active ingredient.

In the present invention, "for improving the intestinal flora" means promoting the growth or growth of beneficial bacteria in the intestine and inhibiting the growth or growth of harmful bacteria in the intestine, but maintaining the balance between beneficial bacteria and harmful bacteria in the intestine.

“For antioxidant activity” means preventing aging and chronic diseases.

The present invention finds that an oligosaccharide extract of sweet potato peel and an ethanol extract of sweet potato peel have antioxidant activity, and thus relates to an antioxidant composition containing these components and a food composition containing the antioxidant composition.

The term "intestinal beneficial bacteria" may refer to microorganisms living in the intestines and exerting beneficial effects on the human body. For example, intestinal beneficial bacteria may include probiotics.

The term "intestinal harmful bacteria" may refer to microorganisms that live in the intestines and have harmful effects on the human body, such as enteritis, such as Escherichia coli, Clostridium sp., and Staphylococcus. Examples include Staphylococcus sp. In addition, in the present invention, "probiotics" may mean microorganisms that have a good effect on health in the body, such as Lactobacillus sp., Lactococcus sp., Streptococcus sp.), Enterococcus sp., Pediococcus sp., and Bifidobacterium bifidum sp.

In the present invention, "prebiotics" may mean a component that is used by microorganisms, including beneficial bacteria, to promote the growth or activity of microorganisms, thereby exhibiting beneficial effects on the health of the host.

In the prebiotics composition of the present invention, the sweet potato peel extract may be extracted using a polar solvent or an organic solvent, and the polar solvent may be any one selected from lower alcohols having 1 to 4 carbon atoms, preferably It can be extracted using ethanol as a solvent. In the case of extraction using ethanol as a solvent, 50 to 99% (w/v), preferably 70% (w/v) ethanol may be used.

In the prebiotics composition of the present invention, the sweet potato peel extract may be an oligosaccharide extract.

The sweet potato peel extract included in the prebiotics composition of the present invention may contain 1-kestose (GF2) as an active ingredient.

The prebiotics composition of the present invention may further include 1-kestose (GF2), and when the sweet potato peel extract and the 1-kestose (GF2) are included, the growth of probiotic bacteria can be promoted.

The sweet potato of the present invention may include Pungwonmi sweet potato or Pungwonmi sweet potato, and may be preferably extracted using Pungwonmi sweet potato.

Currently, most prebiotics are chemically synthesized, but according to the present invention, since prebiotics can be extracted and used from sweet potato skins, which are food by-products, a new prebiotics material can be provided. In addition, the cost required for processing by-products can be reduced, and there is an advantage that by-products can be used as functional food materials.

1 is a schematic diagram of the process of extracting oligosaccharides from sweet potatoes.
Figure 2 shows the standard curve of tannic acid.
Figure 3 shows the standard curve of the routine.
Figure 4 shows the standard curve of Cyanidine 3-O-Glucoside chloride.
Figure 5 shows the graphic design of the experimental animals.
Figure 6 shows the results of qPCR analysis using primers L50 as a standard curve.
7 is a result of measuring the total polyphenol content of the ethanol extract for each sweet potato variety and part.
8 is a result of measuring the total flavonoid content of the ethanol extract for each sweet potato variety and part.
9 is a result of measuring the total anthocyanin content of the ethanol extract for each sweet potato variety and part.
Figure 10 shows the growth rate of Poongwonmi sweet potato skin oligosaccharide extract.
Figure 11 shows the growth rate of the sweet potato skin oligosaccharide extract.
12 shows the results of HPLC-RID analysis of SPPOE oligosaccharides using fructooligosaccharide standards and inulin standards.
13 shows the results of HPLC-RID analysis of SPPOE oligosaccharides using xylooligosaccharide standards.
14 shows the results of the cytotoxicity test of kestose.
Figure 15 shows the results of analyzing the content of P. pentosaceus targeting the Pediocine L50 gene by classifying the control group into G1 and G2 and classifying the experimental group into G3 and G4.
Figure 16 shows the results of observing the tissue cells of the kidney, liver, spleen, and intestines of each group of mice using a transmission electron microscope.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following Examples and Experimental Examples.

<Example 1> Preparation of oligosaccharide extracts by sweet potato varieties and parts

For the preparation of oligosaccharide extracts for each sweet potato variety and part, Poongwonmi and Favorable rice were used as varieties, and sweet potato peel, sweet potato tuber, and above-ground parts were used as parts. The above-ground part of the sweet potato was harvested from the test field of the Potato Research Institute of the Gangwon-do Agricultural Research and Extension Services located in Gangneung, Gangwon-do in September 2019, washed, dried at 40 ° C for 72 hours using a cold wind dehumidifying dryer (TJHP-1003, Jungang, Korea), and then a grinder (Daesung Artlon , DA280-S, Korea), and then used for experiments while stored in a -20 ° C freezer. Sweet potatoes were sold at the Bioenergy Crop Research Institute of the National Institute of Food Science in February 2020, washed, peeled, and separated from the tuber root and skin. In addition, after drying in cold air, it was powdered with a grinder (Daesung Artlon, DA280-S, Korea) and used as a sample. Samples were degreased by the Soxhlet method. After mixing, 5 times petroleum ether (Daejung, cas 8032-32-4) was added per g of the dried sample, put into a centrifuge (Hanil, SUPRA 22K, Korea), and centrifuged (15 ° C, 3,000 rpm, 20 minutes). . The above process was repeated twice, and the oil-removed sample was spread widely on a tray, and then the remaining amount of petroleum ether was volatilized and removed in a hood. After adding 100 mL of sodium acetate buffer (0.1 M, pH 4.5) and 1 mg of α -amylase (Sigma A31765, 1000U) to 50 g of the degreased sample, the mixture was stirred in a 95°C shaking constant temperature water bath (37L, BS-21, Korea). After heating for 12 hours, it was cooled at room temperature. Thereafter, 100 mg of glucoamylase (Sigma, 9032-08-0, 6000U) was mixed and heated in a 55° C. shaking water bath for 48 hours, followed by cooling at room temperature. After adding 100mg of xylanase (Sigma, 31278-89-0, 125U) as a third enzyme treatment, the mixture was heated for 7 hours in a 50°C shaking constant temperature water bath. The sample was centrifuged at 3000 rpm for 20 minutes using a centrifuge, and the supernatant from which starch was removed was mixed with 1,000 mL of distilled water (DW) and allowed to stand at room temperature for 2 hours. After collecting the supernatant by centrifuging the settled solution at 3000 rpm for 20 minutes, 99% (w / v) ethanol was added three times and mixed to precipitate for 8 hours. The extracted sample was concentrated under reduced pressure to obtain an extract after evaporating ethanol. The extract was lyophilized using a lyophilizer (PVFD 20RS, Ilshin, Korea) under conditions of 5 m Torr and -40 ° C, and then stored in a -20 ° C freezer and used in the experiment (Fig. 1). In addition, as a standard material used as a control, fructooligosaccharide (Sigma, F8052) derived from chicory was used.

<Example 2> Preparation of ethanol extracts by sweet potato varieties and parts

As in Example 1, the samples were collected and cold air dried powder was used, and the samples for each treatment were 70% (w / v) in 30 g of the sample. After adding 300 mL of ethanol, the mixture was extracted twice for 12 hours by stirring at room temperature in a shaker at 120 rpm. Each extract was filtered under reduced pressure (Whatman 2# filter paper), then completely concentrated with a rotary vacuum evaporator (N-21NS, EYELA, Japan), freeze-dried, and stored in a -20°C freezer for use.

<Experimental Example 1> Total polyphenol content of sweet potato varieties and ethanol extracts by region

The total polyphenol content of the 70% (w/v) ethanol extract by sweet potato variety (rich taste, pleasant taste) and part (tubercle skin, tuber root, aerial part) was determined by reducing the Folin-Ciocalteu reagent by polyphenolic compounds in the sample. It was measured using the principle of developing a molybdenum blue color. 1.8 mL of distilled water was added to 0.2 mL of the sample solution, and 0.2 mL of Folin-ciocalteu's phenol reagent (Sigma Co., St. Louis, MO, USA) was added and reacted for 3 minutes, followed by 0.4 mL of Na ₂ CO ₃ saturated solution and distilled water. After adding 1.4 mL of the mixture and reacting at room temperature for 1 hour, the absorbance of the reaction solution was measured at 760 nm using a spectrophotometer (Evolution 201, Thermo, Waltham, MA, USA). A calibration curve was prepared using tannic acid (Sigma Co., St. Louis, MO, USA) as a standard material, and the total polyphenol content of each extract was quantified.

<Experimental Example 2> Flavonoid content of sweet potato varieties and ethanol extracts by region

The total flavonoid content of the 70% ethanol extract of sweet potato varieties (rich taste, favorable taste) and parts (top part, tuber skin, tuber root) was measured. 4 mL of distilled water was added to 1 mL of the sample solution, 0.3 mL of 5% NaNO ₂ was added, mixed, and left at room temperature for 5 minutes, and then 0.3 mL of 10% AlCl ₃ was added, mixed, and left at room temperature for 5 minutes. After the reaction, 2 mL of 1 M NaOH was added, reacted for 1 minute, and the absorbance of the reaction solution was measured at 510 nm using a spectrophotometer (Evolution 201, Thermo, Waltham, MA, USA). A calibration curve was prepared using rutin (Sigma Co., St. Louis, MO, USA) as a standard material, and the total flavonoid content of each extract was quantified.

<Experimental Example 3> Total anthocyanin content of sweet potato varieties and ethanol extracts by region

The total anthocyanin content of 70% (w/v) ethanol extracts of sweet potato varieties (rich taste, favorable taste) and parts (top part, tuber skin, tuber root) was measured by modifying the method of Ryu et al. 0.1 g of the sample was weighed, 10 mL of 60% ethanol containing 1% citric acid was added, and the mixture was stirred for 12 hours and extracted twice. After passing the extract through a 0.45 ㎛ membrane filter, the absorbance was measured at 535 nm using a spectrophotometer (Evolution 201, Thermo, Waltham, MA, USA). Cyanidine 3-O-Glucoside chloride (Sigma Co. , St. Louis, MO, USA) was used to prepare a calibration curve and measure the total anthocyanin content.

<Experimental Example 4> Measurement of antioxidant activity of ethanol extracts by sweet potato varieties and parts

1. 1,1-diphenyl-2-picryl-hydrazyl (DPPH) radical scavenging activity

The scavenging ability for DPPH radical was measured by modifying the method of Okawa et al. 0.8 mL of 0.2 mM DPPH (1,1-diphenyl-2-picryl-hydrazyl) solution was added to 0.2 mL of each extract sample, mixed, reacted at room temperature for 30 minutes, and then ELISA reader (FLUOstar Omega, BGM LABTECH, Germany) was used. The absorbance was measured at 517 nm. The DPPH radical scavenging ability was expressed as a percentage of the difference in absorbance between the group with and without the addition of the sample solution, and all extracts were measured in triplicate. In addition, the DPPH radical scavenging ability of the extract was shown as inhibition concentration 50% (IC ₅₀₎ value, and as a positive control, the IC ₅₀ value of ascorbic acid (Sigma, St, Louis, MO, USA) was calculated to ethanol extract for each sweet potato variety and region. compared with

2. 2,2'-Azino-bis [3-ethylbenzothiazoline-6-sulfonic acid] (ABTS) radical scavenging activity

ABTS radical scavenging ability was measured using the method of Pellegrin et al. A mixture of 7.4 mM ABTS (2,2'-azino-bis[3-ethylbenzothiazoline-6-sulfonic acid]) solution and 2.6 mM potassium persulfate was reacted for 15 hours in the dark at room temperature to form radicals, and the ABTS solution immediately before the experiment It was diluted with ethanol so that the absorbance of was 0.70 at 734 nm. 300 μL of ABTS solution was added to 20 μL of each extract, mixed, reacted at room temperature for 20 minutes, and then absorbance was measured at 734 nm using an ELISA reader (FLUOstar Omega, BGM LABTECH, Germany). ABTS radical scavenging ability was expressed as a percentage of the difference in absorbance between the group with and without the addition of the sample solution, and all extracts were measured in triplicate. In addition, the DPPH radical scavenging ability of the extract was shown as inhibition concentration 50% (IC ₅₀₎ value, and as a positive control, the IC ₅₀ value of ascorbic acid (Sigma, St, Louis, MO, USA) was calculated to ethanol extract for each sweet potato variety and region. compared with

<Experimental Example 5> Growth promoting efficacy of ethanol and oligosaccharide extracts by sweet potato varieties and parts

1. Strains of probiotics and media used

본 연구에서는 총 7개의 유산균( Lactobacillus rhamnosus KACC11953 , Lactobacillus brevis ATCC8787, Lactobacillus plantarum ATCC8787, Pediococcus acidilactici KACC12307, Pediococcus pentosaceus OHF23, Enterococcus faecium KACC11953, Streptococcus thermophilus SCML300)과 1개의 효모( Saccharomyces boulardii KT000032 ) 를 사용하였으며, 실험 It was used after activation by subculturing three or more times. As the growth medium of the strain, MRS broth (Difco Detroir, MI, USA) medium was used, and the composition of the medium is shown in Table 1.

Ingredient Amount (g/L) Proteose peptone NO. 3 10 Beef extract 10 Yeast extract 5 Dextrose 20 Polysorbate 80 One Ammonium Citrate 2 Sodium Acetate 5 Magnesium Sulfate 0.1 Manganese Sulfate 0.05 Dipotassium Phosphate 2

2. Probiotics Growth Promoting Efficacy

In order to see the growth enhancing effect of probiotics, ethanol and oligosaccharide extracts for each sweet potato variety and site were diluted at concentrations of 10, 30, and 50 mg/mL and then used.

1 mL of strain culture medium, 1 mL of MRS medium, and 1 mL of each extract solution were put into a 12-well plate. In addition, as in the extract treatment experiment, fructooligosaccharide (Sigma, St, Louis, MO, USA) aqueous solution (2.5, 5, 10 mg/mL) was used as a positive control group, and as a negative control group, 2 mL of MRS medium and 1 strain culture medium were used. mL was used, and 3 mL of sterile distilled water (DW) was used as a blank. For absorbance measurement, the initial absorbance value at 600 nm was measured using a spectrophotometer (SpectraMax i3, Molecular Devices, Busan, South Korea), and the bacterial growth was measured every 3 hours while stored in an incubator at 37 ° C for 24 hours. measured.

<Experimental Example 6> HPLC analysis of sweet potato peel oligosaccharide extract (SPPOE)

As a result of analyzing the growth promoting effect in ethanol extract and oligosaccharide extract for each part of sweet potato (top part, tuber root, peel), sweet potato peel oligosaccharide extract (SPPOE, Sweeet Potato Peel Oligosaccharide Extract) was the most effective, and HPLC analysis and Further experiments were conducted.

1. Standards and reagents

Oligosaccharide standards include 5 fructooligosaccharides (1-kestose, 1,1-kestotetraose, 1,1,1-kestopentaose, levanbiose, levantriose), 1 inulin, and 3 xylo-oligosaccharides (xylobiose, xylopentaose, xylohexaose). ) was selected and purchased from Megazyme (Bray, Ireland), distilled water used for the sample was Samchun Pure Chemical Co. (Pyeongtaek, Korea), and acetonitrile (HPLC Grade) was purchased from Fisher Scientific Co. (Fairlawn, seoul, Korea). purchased and used.

2. Preparation of standard solution and test solution

After quantifying 1 mg of each of the 9 oligosaccharide standards and dissolving them in a 50 mL volumetric flask with distilled water, standard solutions were prepared at concentrations of 0.5, 1, and 2.5 mg/mL, respectively. For the test solution, after precisely measuring 0.5 g of SPPOE samples of two types of homogenization (Pungwon-mi, Pleasant-mi), 10 mL of distilled water was added, and after ultrasonic extraction at 85 ° C for 1 hour, 0.45 μm membrane filter (Millex, Merck Millipore Ltd. ., Darmstadt, Germany) was filtered and used.

3. HPLC instrument conditions

HPLC (Agilent 1260, Palo Alto, CA, USA) was used as the analytical instrument, and RI (Refractive Index) detector (Agilent Technology, Germany) was used as the detector. Carbohydrate (SUPELCOSIL LC-NH2, 25cm x 4.6mm) was used as the analytical column, and the mobile phase was prepared with acetonitrile distilled water at a ratio of 80:20 (v:v), the column temperature was 35℃, and the sample injection amount was 10 μL, the flow rate was analyzed at 1 mL/min (Table 2).

Items HPLC condition Column SUPELCOSIL LC-NH2, 25cm x 4.6mm Mobile phages ACN:d-Water = 80:20 Detector RID Flow rate 1mL/min Injection volume 10 μl Column temp. 35℃ Run time 15min

<Experimental Example 7> Cytotoxicity evaluation of Poongwonmi sweet potato skin oligosaccharide extract (PSPPOE)

1. Cell culture and LPS treatment method

An experiment was conducted to confirm the cytotoxicity of sweet potato peel oligosaccharide extract (SPPOE) and chicory-derived fructooligosaccharide (FOS). Raw 264.7 cells, a mouse macrophage cell line used in the experiment, were purchased from the Korea Cell Line Bank and used. Raw 264.7 cells were cultured in DMEM (Hyclone, Loganm, UT, USA) medium supplemented with 10% Fetal Bovine Serum (FBS) and 1% penicilin-streptomycin solution (Sigma Co., St. Louis, MO, USA). and subcultured in a 37℃, 5% CO ₂ incubator. 1 mg of Lipopolysaccharide (LPS) was dissolved in 1 ml of 1X PBS and used after filtering. In each experiment, the cells were cultured for 24 hours and then treated with LPS at a concentration of 1 μg/ml to conduct the experiment.

2. Cytotoxicity evaluation (EZ-Cytox)

For cytotoxicity, EZ-Cytox assay kit (DAEILLAB SERVICE Co., Ltd., Seoul, Korea) was used. After dispensing 100 μL of the cell culture solution to a 96-well plate at a concentration of 1 × 10 ⁵ cell/well and incubating for 24 hours in an incubator at 37 ° C, 5% CO ₂ , samples were prepared by concentration and added to each well by 10 μL. Incubated for 24 hours. After culturing, 10 μL of EZ-cytox reagent was added to each well, reacted for 4 hours, and absorbance was measured at 450 nm using an ELISA reader (FLUOstar Omega, BGM LABTECH, Ortenberg, Germany).

<Experimental Example 8> Evaluation of prebiotics efficacy in in vivo model

1. Experimental animals and experimental design

In this experiment, 5-week-old male ICR mice with an average weight of 30 g ± 2 g were purchased from Orient Bio Co., Ltd. (Sung-nam, Gyeonggi-do, Korea). After a 5-day acclimatization period, the experiment was conducted for 21 days, and the experimental conditions in the animal breeding room were maintained at a temperature of 23 ± 1 ℃) and humidity of 60 ± 10%, and the lighting was automatically turned on at 7 am and turned on at 7 pm. The lights were automatically turned off at the time of day and the lighting was adjusted at 12-hour intervals. For the feed, a compound feed for mice (crude protein 22.1%, crude fat 3.5%, crude fiber 5.0%, ash 8.0%, calcium 0.6%, phosphorus 0.4%) of Samyang Oil Feed Co., Ltd. was used, and feed and water were supplied without restriction. . This experiment was conducted with the approval of the Animal Ethics Committee of Kangwon National University (KW-201113-3), and the experimental animals were divided into 4 groups of 10 animals per group. The control group, G1 = Control (PBS), G2 = PBS + Lactic acid bacteria, the experimental group, G3 = PBS + LAB + SPPOE, and G4 = PBS + LAB + Kestose, were designed as shown in FIG. 5. As for the composition of the diet, the number of lactic acid bacteria ( P. pentosaceus OHF23) was prepared at 1×10 ⁸ CFU/300 μL and orally administered to the G2, G3, and G4 groups for 7 days. After that, the G3 and G4 groups were treated with SPPOE and kestose for 14 days, respectively. (GF ₂ ) was orally administered.

Group Number of mice PBS (μL/mice) Bacterial ( P.pentosaceus OHF 23 strain) Supplementation
(Log CFU/mL) Treatment
(mg/g) G1 10 300 - - G2 10 300 1 × 10 ⁸ - G3 10 300 1 × 10 ⁸ 50 G4 10 300 1 × 10 ⁸ 50

G1: Negative Control, G2: Positive Control ( P.pentosaceus OHF 23), G3: SPPOE, G4: Kestose (GF ₂₎

2. Fecal collection and DNA extraction

In order to confirm changes in the intestinal microbiota of mice, mice reared for 21 days were fasted for 12 hours from the end of the experiment, and then anesthetized with ethyl ether. Thereafter, feces were collected by laparotomy and the cecum was separated, stored at -80 ° C, and then analyzed. Fecal DNA was extracted using the AllPrep® PowerFecal® DNA/RNA Kit (Qiagen, Valencia, CA, USA). After putting 200 mg of fecal sample in a lysis tube provided by the kit, 1 M DDT (dithiothreitol) solution and 650 μL of PM1 solution provided by the kit were added, vortexed, and centrifuged at 18,000 × g for 1 minute. Then, the supernatant was transferred to a new 1.5 ml tube, vortexed by adding 150 μL of IRS solution, stored in a refrigerator at 4° C. for 5 minutes, and then centrifuged at 13,000 × g for 1 minute at room temperature. After that, AllPrep DNA MinElute Spin column was placed in a 2 mL tube, 300 μL of supernatant and 400 μL of C4 solution were added, and centrifugation was performed at room temperature at 13,000 × g for 30 seconds. After transferring the AllPrep DNA MinElute Spin column to a new 2mL tube, add 500 μl of AW1 buffer, centrifuge at 3,000 × g for 1 minute to remove the liquid phase, add 500 μl of AW2 buffer, and spin at 18,000 × g for 2 minutes. was centrifuged. The liquid phase that escaped was removed and centrifuged again for 1 minute to remove all the liquid phase in the column. 300 μl of EB buffer was added directly to the column membrane while the AllPrep DNA MinElute Spin column was inserted into a new 1.5 ml tube. After leaving at room temperature for 1 minute, DNA was extracted by centrifugation at 8,000 × g for 1 minute, and the final concentration was set using a NanoDrop 2000 UV-Vis Spectorophotometer (Thermo Fisher Scientific, Massachusetts, USA). The extracted DNA was used as template DNA for Quantification Real-Time PCR for quantitative analysis.

3. Quantitative analysis of P. pentosaceus using qPCR

Differences in the increase in P. pentosaceus OHF 23 between the control group and the experimental group of mice were compared and analyzed. First of all, the DNA to secure the standard curve is MRS P. pentosaceus OHF 23 It was obtained by extraction after culturing in a selective medium. The standard curve was used by sequentially diluting 10-fold from 10 ng/μL to 1 ng/μL using the 16s rRNA gene of P. pentosaceus OHF 23 (FIG. 6). qPCR analysis was performed with ABI StepOne™ Real-time PCR system (Applied Biosystems). PCR was reacted for 45 cycles under conditions of 95℃ (10 minutes), 95℃ (15 seconds), 50℃ (2 minutes), and 60℃ (1 minute), and the reaction solution was 10 μL MeltDoctor™ HRM master mix, 7 μL of sterilized tertiary distilled water, 0.5 μL of forward primer, 0.5 μL of reverse primer, and 2 ul of template DNA (bacterial genomic DNA or mouse fecal DNA) were mixed to make a total volume of 20 μL. In this way, real-time PCR was performed using genomic DNA extracted from feces, and the amount of P. pentosaceus in each control and experimental group was quantitatively analyzed. The primers used are shown in Table 4.

Target Gene Primer Universal Forward 5' AGATTTGATCMTGGCTCAG 3' (SEQ ID NO: 1) Reverse 5' GGTTACCTTGTTACGACT 3' (SEQ ID NO: 2) Novel Pediocin L50 Forward 5' GGAGCAATCGCAAAATTAG 3' (SEQ ID NO: 3) Reverse 5' ATTGCCCATCCTTCTCCAAT 3' (SEQ ID NO: 4)

4. Electron Microscopy Analysis

The kidney, liver, spleen, and colon tissues of the mice ingested SPPOE and kestose were observed by transmission electron microscopy (TEM) to confirm the presence or absence of inflammation. The tissues of kidney, liver, spleen, and colon excised from mice were fixed with 0.1 M carcodylate buffer containing 2% glutaraldehyde and 2% paraformaldehyde, respectively. After washing three times with 0.1 M carcodylate buffer, the tissue was dehydrated for 20 minutes in increasing concentrations of ethanol 50, 60, 70, 80, and 90%, and then dehydrated twice at 100% concentration. Dehydrated tissues were substituted twice for 10 minutes each in propylene oxide (Acros, USA). Thereafter, eponate 812 was gradually infiltrated into the tissue, followed by polymerization and embedding with new eponate 812 in an oven at 60°C for 2 days. The fabricated block is analyzed using TEM (JEM100F, JEOL, Japan) of Kangwon National University Basic Science Research Center after cutting the sample using an Ultra microtome (Ultracut UCT, Leica), staining it using uranyl acetate and lead citrate did

5. Statistical analysis

For statistical analysis, analysis of variance (ANOVA) was performed using SPSS Statistics (ver. 12.0, SPSS Inc., Chicago, IL, USA), and Scheffe's multiple range test ( p <0.05) was used to verify significant differences. analyzed. All test analyzes were repeated three times or more to calculate the mean and standard deviation.

<Experiment result>

1. Manufacture of extracts by sweet potato varieties and parts

A 70% ethanol extract and an oligosaccharide extract were prepared using the dry powder sample, and the yields of each extract are shown in Table 5. Looking at the yield of ethanol extract by variety and part, Poongwonmi had the highest ethanol extract yield of 28% in the above-ground part, tuber root 27.4%, and rind the lowest with 25.9%. Hogammi ethanol extract did not have a large difference in yield by part, and the yield of tuber root was the highest at 30.6%. As a result of examining the yield of oligosaccharide extracts, the yields of both Pungwonmi and Hogammi tubers were 28.4 - 44.9%, higher than other parts, and particularly, Hogammi tubers showed a high yield of 44.9%. The above-ground part showed 22.3% of rich rice and 14.9% of favorable taste, showing differences among varieties, and the peel showed a similar yield of 22.3-23.5%.

Variety Part Yield (%) 70% EtOH Oligosaccharides Pungwonmi Peel 25.9 23.1 Tuber 27.4 28.4 Aerial part 28.0 22.3 Hogammi Peel 29.9 23.5 Tuber 30.6 44.9 Aerial part 29.2 14.9

2. Functional substance content of sweet potato extract

In this study, ethanol extracts were prepared for each sweet potato variety and part, and the prebiotics efficacy of non-carbohydrate components and the prebiotics efficacy of oligosaccharides, which are representative indigestible saccharides, were divided into studies.

The key reason for using the peel is that there was no prebiotics effect that promotes the growth of probiotics in other parts except the peel. Sweet potato peel oligosaccharide extract has a clear prebiotics function, but it has been reported that some polyphenols exhibit a prebiotics function, so in this study, the ethanol extract and the oligosaccharide extract were simultaneously separated and the prebiotics efficacy was analyzed.

3. Total polyphenol content of ethanol extracts by sweet potato varieties and parts

Polyphenol is a substance that has a major effect on the antioxidant activity of fruits and vegetables, and the results of measuring the total polyphenol content of the ethanol extract for each sweet potato variety and part are shown in FIG. 7. There was no significant difference in total polyphenol content between varieties, but there were significant differences by part. The total polyphenol content of the ethanol extract of aboveground parts was 41.87 - 42.13 mg TAE/g, which was the highest among the three parts, and the average total polyphenol content of sweet potato leaves and stems of 10 varieties including dry flavor was 46.47 It was similar to the results of Li (physicochemical properties of sweet potato leaves and petioles and optimization of useful component extraction conditions, Chungbuk National University master's thesis, August 2013, Li Meishan) reported as mg GAE/g. The total polyphenol contents of the ethanol extracts of tubers and skins were 28.55 - 26.55 mg TAE/g and 11.67 - 12.56 mg TAE/g, respectively, which were lower than those of the above-ground ethanol extracts. Truong et al. measured the content of phenolic compounds in the roots and leaves of three varieties of sweet potato, and as a result, the sweet potato tuber including the peel was 60.4∼90.3 mg chlorogenic acid/100 g, and the peeled sweet potato tuber was 57.1∼78.6 mg chlorogenic acid/100 g. On the other hand, the content of phenolic compounds in sweet potato leaves was 1,223.6∼1,298.1 mg chlorogenic acid/100 g. In addition, Ishida et al. measured the polyphenol content of the tuber, leaf, and stem of two kinds of sweet potatoes cultivated in Japan. reported that it was This research result coincided with the study of Islam et al., who reported that sweet potato leaves are generally known to have a higher polyphenol content than sweet potato roots or other leafy vegetables.

4. Total flavonoid content of ethanol extracts by sweet potato varieties and parts

Flavonoids and polyphenols are generally well known as substances exhibiting antioxidant activity. The results of measuring the total flavonoid content of the ethanol extract for each sweet potato variety and region are shown in FIG. 8. By part, the highest content was found in the order of aerial part (119.24 - 148.47 mg RUE/g), skin (71.14 - 83.33 mg RUE/g), and tuber root (2.03 - 3.05 mg RUE/g). There was no significant difference between varieties in the tuber root extract, but the above-ground parts and peel extracts showed that the flavonoid content was higher in rich taste than in favorable taste. The average total flavonoid content in the leaf and petiole extracts of 10 varieties of sweet potato reported in Li's study was reported to be 33.63 mg CE/g, showing a large difference from the total flavonoid content of this study and the extract, which is due to differences in varieties and cultivation environments. It is thought to be due to the difference in the manufacturing process of the extract and the difference in standard reagents.

5. Total Anthocyanin Content of Ethanol Extracts by Varieties and Parts of Sweet Potatoes

Anthocyanin is a water-soluble natural pigment mainly present in vegetables and fruits as a class of flavonoid compounds. In this experiment, the content of anthocyanin used as an antioxidant was analyzed. There was no difference in the content of anthocyanin by cultivar in the tuber root extract (0.59 - 0.73 mg C3G/g), but there was a difference between the cultivars in the above-ground part and peel extract. Anthocyanin content was high in the order of rich taste peel (16.26 mg C3G/g) > aerial part (12.38 mg C3G/g) > tuber root (0.59 mg C3G/g), and favorable aerial part (21.02 mg C3G/g) > peel (10.40 mg C3G/g) > root (0.73 mg C3G/g) in the order (FIG. 9). Both varieties showed the lowest anthocyanin content in tuber extract. As a result of analyzing the content of anthocyanin by cultivar of Park's purple sweet potato, the anthocyanin content of tubers of five varieties of purple sweet potato including Shinmi was 3.8-4.7 mg/g, which was different from the reported result. Although the difference in anthocyanin content from the tuber root extract of this experiment was about 10 times, it is considered that the content of anthocyanin was not high because the sweet potato variety used in this experiment was a variety with orange flesh color rather than purple.

6. Functional properties of sweet potato extract

1) Measurement of antioxidant activity of ethanol extracts by sweet potato varieties and parts

Table 6 shows the DPPH and ABTS radical scavenging abilities of the ethanol extracts for each sweet potato variety and region. Since there was a big difference in the DPPH and ABTS radical effects of the samples by variety and part of sweet potato, the treatment concentration range of the samples was treated differently to obtain the IC ₅₀ , which is the concentration at which the radical scavenging activity is inhibited by 50%. Ascorbic acid was used as a positive control reagent, and the IC 50 value was shown in comparison with each extract. (Table 6) As for the DPPH radical scavenging ability, the IC ₅₀ values of the extracts from the aerial parts of Pungwonmi and _Hogammi were 0.62 and 0.90 mg/mL, respectively. It was found to have the highest antioxidant activity among the extracts by part, and no difference was seen between the varieties. As a result of measuring antioxidant activity by part of sweet potato, this showed a similar trend to the results of a study by Lee et al. In plants, the leaf produces energy, is an important organ with a very high activity, contains various active ingredients, and is a place where various substances are biosynthesized. For this reason, among the various antioxidant functional substances included in the aerial part, the content of polyphenol substances is high, and it is considered that a lot of substances with high DPPH radical scavenging activity are contained. Next, DPPH radical scavenging activity was shown to be high in the order of peel (1.34 - 1.37 mg/mL) and tuber root (6.19 - 6.26 mg/mL) extract. Among the antioxidant activities of the sweet potato methanol extract according to the cultivation conditions, the peel extract (958.81 mg TE/100g) showed a higher DPPH-radical scavenging activity than the fruit pulp extract (132.01 - 189.93 mg TE/100g), which showed a similar trend. ABTS radical scavenging activity also showed a similar tendency to DPPH radical scavenging activity, and the aerial part extract had the highest activity at the level of 6.63 - 7.15 mg/mL, but there was no difference between varieties. Next, ABTS radical scavenging activity was high in the order of skin (10.91-10.97 mg/mL) and tuberous root (16.08-22.84 mg/mL). It was found that the antioxidant activity was also high in the aerial part, which had a high content of total polyphenols and total flavonoids. In addition, as a result of measuring the two types of radical scavenging activity for the same sample, the DPPH radical scavenging activity was better than the ABTS radical scavenging activity.

Variety Part IC ₅₀ ¹⁾ DPPH radical scavenging (mg/mL) ABTS radical scavenging (mg/mL) Pungwonmi Peel 1.37 10.97 Tuber 6.26 22.84 Aerial part 0.62 6.63 Hogammi Peel 1.34 10.94 Tuber 6.19 16.08 Aerial part 0.90 7.15 Ascorbic acid ²⁾ 0.034 0.35

¹⁾ Concentration of ethanol extract of samples reducing DPPH radical by 50%

²⁾ Positive control

2) Growth enhancement efficacy of ethanol and oligosaccharide extracts by sweet potato varieties and parts

The growth enhancing effects of ethanol and oligosaccharide extracts for each sweet potato variety and part are shown in Tables 7 and 8. As a result of analyzing the growth promoting efficacy of the ethanol extract for each variety and site on eight probiotics strains, the ethanol extract did not show a growth promoting effect in all eight probiotic strains regardless of breed and site (Table 9). In addition, oligosaccharide extracts for each sweet potato variety and site showed different growth activities for probiotic strains depending on the variety and site (Table 10). The tuber root and above-ground oligosaccharide extracts of the two varieties did not show probiotics growth promoting effects, but the skin oligosaccharide extracts showed a growth promoting effect in all 8 strains used in the experiment. .thermophillus SCML300, S. boulardii KT000032) showed growth enhancing effect. Among the 8 strains used in the experiment, S. thermophillus SCML300 from Latic Acid Bacteria (LAB) and S. boulardii KT000032, a yeast, showed growth-enhancing effects in both strains of peel oligosaccharide extracts. S. thermophilus is a strain that has been mainly used to manufacture milk and yogurt. Dr. Mechnikoff proposed bacteria in yogurt, a food of Bulgarian residents, as the cause of longevity, and it emerged as a beneficial bacteria for health. There is a report that showed efficacy in the treatment and prevention of intestinal disease and ulcerative colitis. The growth curves of eight probiotic strains for the sweet potato skin oligosaccharide extract (SPPOE), which has the highest growth promoting effect on probiotics among the three parts of the two varieties, are shown in FIGS. 9 and 10 . The test treatment group treated with SPPOE at 10, 30, and 50 mg/ml concentration, and the kestose (GF ₂ ) prepared at 10 mg/ml concentration were divided into a positive control group and a control group without additives, and the growth enhancing efficacy was compared. Poongwonmi sweet potato peel oligosaccharide extract (PSPPOE) showed high absorbance values compared to the control in all eight strains, indicating a high growth rate (FIG. 10). The growth of L. rhanmnosus KACC11953 was rapidly accelerated for 9 hours in both samples and controls, and PSPPOE showed higher absorbance values in a concentration-dependent manner than kestose (GF ₂ ) and control. L. brevis ATCC 8787 showed the highest absorbance value at 15 hours at the concentration of PSPPOE 50 mg/ml, showing a clear difference from the control group (positive, negative), and at other concentrations (10, 30 mg/ml) showed growth similar to that of the control group. L. plantarum JDFM 44 showed a higher increase than the control group from the beginning of culture, and growth was shown to be enhanced in a concentration-dependent manner. P. acidilactici KACC12307 showed higher absorbance values than control in all concentrations of PSPPOE and kestose (GF ₂ ) treatment groups, and P. pentosaceus OHF23 showed a higher absorbance value than the control at 50 mg/ml of PSPPOE at 12 hours among 8 strains. It showed the highest absorbance value, and showed a certain level higher than the control value at all treatment concentrations . If the concentration exceeds 50 mg/ml, the color of the extract becomes dark and affects the absorbance measurement, so 50 mg/ml was used as the critical point.

E. faecium KACC11953 showed similar growth in the control and SPPOE treatments until 6 hours of incubation, but the growth of the strain increased more at all concentrations after 9 hours of SPPOE treatment. It is judged that the growth was enhanced by using the oligosaccharide component of SPPOE after the nutrient source was consumed mainly using glucose in the medium until 6 hours. In S. thermophillus SCML300 and S. bouladii KT000032, PSPPOE was generally higher than the control value, but there was no difference between treatment concentrations. Hogammi Peel Oligosaccharide Extract (HSPPOE) showed the highest absorbance value of kestose (GF ₂ ) in 3 types of Lactobacillus , 2 types of Pediococcus , and 1 type of Enterococcus among 8 types of probiotics, and the treatment group by HSPPOE concentration was significantly different from the control group. No difference was found, indicating that there was no growth promoting effect (FIG. 11). In S. thermophilus SCML300, the absorbance value was higher than the control at 50 mg/ml treatment concentration, and there was no effect at concentrations of 10 and 30 mg/ml. S. bouladii KT000032 did not show a difference in absorbance between the test treatment group and the control at the beginning of growth, but after 6 hours of cultivation, it showed a growth enhancement effect that was significantly different from the control value at concentrations of 30 and 50 mg/ml. As a result, in this study, the following experiment was carried out by selecting the skin part (SPPOE) with excellent growth promoting effect among the sweet potato peel, tuber root, and aboveground parts, and P. pentosaceus OHF23, which showed the highest absorbance value among 8 strains, was selected. In-vivo experiments were conducted.

Variety Part strains A B C D E F G H Pungwonmi Peel - - - - - - - - Tuber - - - - - - - - Aerial part - - - - - - - - Hogammi Peel - - - - - - - - Tuber - - - - - - - - Aerial part - - - - - - - -

A, Lactobacillus Rhamnosus KACC11953 ; B, Lactobacillus brevis ATCC8787; C, Lactobacillus plantarum JDFM 44 ; D, Pediococcus acidilactici KACC12307; E, Pediococcus pentosaceus OHF23; F, Enterococcus faecium KACC11953; G, Streptococcus thermophillus SCML300; H, Saccharomyces bouladii KT000032

Sample Part strains A B C D E F G H Pungwonmi Peel + + + + + + + + Tuber - - - - - - - - Aerial part - - - - - - - - Hogammi Peel - - - - - - + + Tuber - - - - - - - - Aerial part - - - - - - - -

A, Lactobacillus Rhamnosus KACC11953 ; B, Lactobacillus brevis ATCC 8787; C, Lactobacillus plantarum JDFM 44 ; D, Pediococcus acidilactici KACC12307; E, Pediococcus pentosaceuss OHF23; F, Enterococcus faecium KACC11953; G, Streptococcus thermophillus SCML300; H, Saccharomyces bouladii KT000032

3) Identification and content analysis of oligosaccharides in sweet potato skin oligosaccharide extract (SPPOE)

In order to analyze the oligosaccharide of SPPOE, the oligosaccharide of SPPOE was analyzed by HPLC-RID using 6 kinds of fructooligosaccharide standard, 1 kind of inulin standard, and 3 kinds of xylooligosaccharide standard. As shown in FIGS. 12 and 13, as a result of confirming the components of the oligosaccharide of the peel of the two varieties of sweet potato, both varieties were found to have 1-kestose and levanbiose fructooligosaccharide components and inulin among the fructooligosaccharides, and the xylo-oligosaccharide component was two None of the cultivars were detected. Among the fructooligosaccharide components, the content of 1-kestose was the highest at 133.50 - 421.75 mg/g, indicating that it was the main component of SPPOE, and the Poongwonmi Peel Oligosaccharide Extract (PSPPOE) was superior. The content of levanbiose was 33.77 - 46.37 mg/g, and the content of inulin was 83.09 - 105.12 mg/g (Table 9). For all oligosaccharide components detected, the content of Poongwonmi Sweet Potato Peel Oligosaccharide Extract (PSPPOE) was significantly higher than that of Hogammi Sweet Potato Peel Oligosaccharide Extract (HSPPOE). This was similar to the results in which the growth promoting efficacy of PSPPOE was most excellent in the probiotics growth enhancing efficacy test. Based on these results, in this study, PSPPOE was selected as the final material and further experiments were conducted.

Oligosaccharides ¹⁾ Contents (mg/g) Pungwonmi Hogammi FOS ²⁾ 1-Kestose 421.75 ± ^5.08 133.50 ± ^1.68 1,1-Kestotetraose ND ND 1,1-Kestopentaose ND ND Levanbiose 46.37 ± ^0.85 33.77 ± ^1.07 Levantriose ND ND Sum of FOS 467.42 ± ^4.79 167.26 ± ^2.70 Inulin 105.12 ± ^3.98 83.09 ± ^1.68 XOS ³⁾ Xylobiose ND ND Xylotriose ND ND Xylopentaose ND ND Xylohexaose ND ND

¹⁾ Mean ± standard deviation (n=3)

²⁾ Fructooligosaccharides

³⁾ Xylooligosacchraide

4) Cytotoxicity evaluation of Poongwonmi sweet potato skin oligosaccharide extract (PSPPOE) (EZ-Cytox)

The effects of PSPPOE and kestose (GF ₂ ) on the cytotoxicity of Raw264.7 macrophage were analyzed (FIG. 14). As a result of treatment with kestose (GF ₂ ) and PSPPOE at different concentrations (10, 30, and 50 mg/ml) for 24 hours, cell viability was higher than 90% at all concentrations, showing no toxicity.

5) Evaluation of prebiotics efficacy in in vivo models

(1) Quantitative analysis of Pediococcus pentosaceus using qPCR

The control group, G1 = Control (PBS), G2 = PBS + Lactic acid bacteria, the experimental group, G3 = PBS + LAB + SPPOE, G4 = PBS + LAB + Kestose, were extracted from the fecal DNA of fed mice to identify the Pediocine L50 gene. The content of P. pentosaceus as a target was analyzed (FIG. 15). In the G1 group, P. pentosaceus was not fed, so it was not normally detected, and P. pentosaceus and In the G3 and G4 groups fed SPPOE and kestose respectively, the number of microorganisms increased significantly compared to the G2 group fed only P. pentosaceus . This is based on the research result that Lactobacillus sakei , Leuconostoc citreum , and Weissella cibaria Weissella koreensis were significantly increased when feeding prebiotics in atopic dermatitis mouse model, and the report that Bacteroidetes, a microorganism related to weight loss, increased when synbiotics mixed with lactic acid bacteria and kelp were fed. similar The content of P. pentosaceus between the G3 and G4 groups did not show a significant numerical difference. As a result, PSPPOE is considered to have a prebiotics effect by increasing the number of beneficial bacteria in the intestine when fed together with probiotics.

(2) electron microscopic analysis (TEM)

Kidney, liver, spleen, and intestinal tissue cells of each group of mice were observed using a transmission electron microscope to confirm whether inflammation was induced in the tissue of the kidney, liver, spleen, and intestine. As a result, in the kidney, liver, spleen, and intestine tissues of the G3 and G4 groups fed with PSPPOE and kestose (GF ₂ ), necrosis of all tissues was not observed compared to the control groups G1 and G2, respectively, and the PSPPOE and kestose (GF ₂ ) samples showed no toxicity (FIG. 16). This was consistent with the results of no toxicity in the samples of PSPPOE and kestose in the in vitro cytotoxicity evaluation.

<110> KNU-Industry Cooperation Foundation <120> Prebiotics composition for improving intestinal microflora comprising sweet potato peel extract and functional food including the same <130> 21-11977 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> Universal Forward Primer <400> 1 agagtttgat cmtggctcag 20 <210> 2 <211> 18 <212> DNA <213> artificial sequence <220> <223> Universal Reverse Primer <400> 2 ggttaccttg ttacgact 18 <210> 3 <211> 19 <212> DNA <213> artificial sequence <220> <223> Novel Pediocin L50 Forward Primer <400> 3 ggagcaatcg caaaattag 19 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> Novel Pediocin L50 Reverse Primer <400> 4 attgcccatc cttctccaat 20

Claims (9)

A prebiotics composition for improving intestinal flora comprising sweet potato peel oligosaccharide extract as an active ingredient. According to claim 1,
A prebiotics composition for improving intestinal flora, further comprising Pediococcus pentosaceus . The prebiotics composition for improving intestinal flora according to claim 1, wherein the sweet potato peel oligosaccharide extract further contains 1-kestose (GF ₂ ) or inulin. The prebiotics composition for improving intestinal flora according to claim 1, wherein the prebiotics composition further comprises 1-kestose (GF ₂ ) or inulin. A food composition comprising the prebiotics composition of any one of claims 1 to 4. The food composition according to claim 5, which is for improving intestinal flora. The prebiotics composition according to any one of claims 1 to 4, wherein the sweet potato skin oligosaccharide extract is rich-wonmi sweet potato skin oligosaccharide extract or favorable sweet potato skin oligosaccharide extract. An antioxidant composition comprising sweet potato peel oligosaccharide extract or sweet potato peel ethanol extract as an active ingredient. A food composition comprising the antioxidant composition of claim 8.

Images