KR20220162646A - UBE4B protein and uses thereof - Google Patents

Abstract

The present invention relates to the removal of ubiquitin conjugation E4 B (UBE4B) protein, an E3/E4 ubiquitin ligase, or Tau protein of a gene encoding the protein, and uses for preventing, alleviating, or treating tauopathy. The UBE4B of the present invention or the combination of the UBE4B and STIP1 homology and U-Box containing protein 1 (STUB1), the E3 ubiquitin ligase, has the effect of removing the Tau protein and thus can be applied to the prevention, alleviation, or treatment of tauopathy.

Description

UBE4B protein and uses thereof {UBE4B protein and uses thereof}

The present invention relates to an E3/E4 ubiquitin ligase, UBE4B (Ubiquitin conjugation E4 B) protein or Tau protein removal from a gene encoding the protein, and a use for preventing, improving or treating Tauopathy.

Tau is an essential soluble intracellular protein that binds and stabilizes axonal microtubules. Tau induces microtubule destabilization and formation of neurofibrillary tangles (NFT) upon hyperphosphorylation, enhancing neurodegeneration and memory impairment. Neurodegenerative disorders involving Tau or hyperphosphorylated Tau are generally referred to as Tauopathies (Lee, V. M., et al., Annu. Rev. Neurosci. 24, 1121-1159, 2001), and Alzheimer's These include Alzheimer's disease (AD), Parkinson's disease, Lewy body dementia, Down syndrome and progressive supranuclear palsy (PSP).

Among them, AD is one of the most common age-related neurodegenerative diseases, which is caused by extracellular amyloid plaques caused by abnormally folded amyloid-β-42 (Aβ-42) in the brain and cells caused by hyperphosphorylation of Tau. It is known to contain the pathological features of my NFT.

On the other hand, UBE4B (Ubiquitin conjugation E4 B), an E3/E4 ubiquitin ligase, contains a miR-9 binding sequence in its 3'-UTR and is known to be widely expressed in the brain (Kaneko, C. et al., Biochemical biophysical Res. Commun. 300, 297-304, 2003). However, little is known about how UBE4B affects Tau levels.

Under this background, the present inventors found that UBE4B has the effect of removing Tau protein, and the effect is further enhanced by the combination of UBE4B and STUB1 (STIP1 homology and U-Box containing protein 1), an E3 ubiquitin ligase, and removing the Tau protein. The present invention was completed by identifying that the effect is mediated by the autophagy pathway rather than the ubiquitin-proteasome pathway.

One object of the present invention is to provide a composition for removing Tau protein, comprising UBE4B (Ubiquitin conjugation E4 B) protein or a gene encoding the protein as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating tauopathy, comprising a UBE4B protein or a gene encoding the protein as an active ingredient.

Another object of the present invention is to provide a method for preventing or treating tauopathy, comprising administering to a subject a composition containing a UBE4B protein or a gene encoding the protein.

Another object of the present invention is to provide a food composition for preventing or improving tauopathy, comprising a UBE4B protein or a gene encoding the protein as an active ingredient.

Another object of the present invention is to provide a feed composition for preventing or improving tauopathy, comprising UBE4B protein or a gene encoding the protein as an active ingredient.

A detailed description of this is as follows. Meanwhile, each description and embodiment disclosed in the present invention may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed herein fall within the scope of the present invention. In addition, it cannot be seen that the scope of the present invention is limited by the specific descriptions described below.

One aspect of the present invention provides a composition for removing Tau protein, comprising UBE4B (Ubiquitin conjugation E4 B) protein or a gene encoding the protein as an active ingredient.

As used herein, the term "Tau" is an essential soluble intracellular protein that binds to and stabilizes axonal microtubules, and upon hyperphosphorylation, causes microtubule destabilization and neurofibrillary tangles (NFT) formation, leading to neurodegeneration and It is known to enhance memory impairment.

In the present invention, the Tau protein may include both Tau protein and/or Tau aggregation protein in an aggregated form of Tau protein, but is not limited thereto.

In the present invention, the term "UBE4B (Ubiquitin conjugation E4 B)" is an E3/E4 ubiquitin ligase, and is known as a protein that contains a miR-9 binding sequence in the 3'-UTR and is widely expressed in the brain. In the present invention, UBE4B protein may be used interchangeably with UBE4B.

For example, the UBE4B protein may be derived from an animal. The animal may be specifically a mammal, and more specifically may be a monkey, dog, cat, rabbit, guinea pig, rat, mouse, cow, sheep, pig, goat, human, etc., but is not limited thereto.

The UBE4B protein may have, include, consist of, or consist essentially of the amino acid sequence set forth in SEQ ID NO: 1. Specifically, the protein may be composed of a polypeptide described in the amino acid sequence of SEQ ID NO: 1.

The amino acid sequence of SEQ ID NO: 1 can be obtained from NIH GenBank, a known database. In the present invention, the amino acid sequence of SEQ ID NO: 1 is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, It may include amino acid sequences that have greater than 99%, 99.5%, 99.7% or 99.9% homology or identity. In addition, if it is an amino acid sequence having such homology or identity and exhibiting an efficacy corresponding to the protein comprising the amino acid sequence of SEQ ID NO: 1, a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added. It is obvious that also included within the scope of the present invention.

For example, sequence additions or deletions, naturally occurring mutations, silent mutations or conservations to the amino acid sequence N-terminus, C-terminus and/or within that do not alter the function of the protein of the invention. This is the case with redundant substitution.

The "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structural and/or chemical properties. Such amino acid substitutions can generally occur based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.

In the present invention, the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences and can be expressed as a percentage. The terms homology and identity are often used interchangeably.

Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms, together with default gap penalties established by the program used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of the sequence under moderate or high stringent conditions. It is obvious that hybridization also includes hybridization with polynucleotides containing common codons or codons in consideration of codon degeneracy in polynucleotides.

Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: can be determined using known computer algorithms such as the “FASTA” program using default parameters as in 2444. or, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop , [ED.,] Academic Press, San Diego, 1994, and [CARILLO ET AL/.] (1988) SIAM J Applied Math 48: 1073. For example, BLAST of the National Center for Biotechnology Information Database; Alternatively, ClustalW can be used to determine homology, similarity or identity.

Homology, similarity or identity of polynucleotides or polypeptides can be found in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, eg, Needleman et al. (1970), J Mol Biol. It can be determined by comparing sequence information using a GAP computer program such as 48:443. In summary, the GAP program can define the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for the GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or 10 gap opening penalty, 0.5 gap extension penalty); and (3) no penalty for end gaps.

In the present invention, the polynucleotide encoding the UBE4B protein may be the UBE4B gene. In the present invention, the UBE4B gene may be used interchangeably with UBE4B .

The polynucleotide encoding the UBE4B protein of the present invention may include a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 1. As an example of the present invention, the polynucleotide encoding the UBE4B protein of the present invention may have or include the sequence of SEQ ID NO: 2. In addition, the polynucleotide encoding the UBE4B protein of the present invention may consist of or essentially consist of the sequence of SEQ ID NO: 2. Specifically, the UBE4B protein may be encoded by a polynucleotide described in the nucleotide sequence of SEQ ID NO: 2.

The polynucleotide encoding the UBE4B protein of the present invention takes into account codon degeneracy or codons preferred in organisms intended to express the UBE4B protein of the present invention, within the range that does not change the amino acid sequence of the UBE4B protein. Various modifications may be made to the coding region. Specifically, the polynucleotide encoding the UBE4B protein of the present invention has 70% or more homology or identity to the sequence of SEQ ID NO: 2, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more. % or more, 97% or more, 98% or more of a nucleotide sequence, or having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more of homology or identity with the sequence of SEQ ID NO: 2; 95% or more, 96% or more, 97% or more, 98% or more of a nucleotide sequence, or may consist essentially of, but is not limited thereto.

In the present invention, the composition of the present invention may further include STUB1 (STIP1 homology and U-Box containing protein1) protein or a gene encoding the protein.

In the present invention, the term "STUB1 (STIP1 homology and U-Box containing protein1)" is an E3 ubiquitin ligase, which functions as a tetratricopeptide repeat and ubiquitin ligase / cochaperone It is known to bind to and ubiquitinate Hspa8 (shock cognate 71 kDa protein) and Polb (DNA polymerase beta).

In the present invention, the STUB1 protein may be used interchangeably with STUB1.

For example, the STUB1 protein may be derived from an animal. The animal may be specifically a mammal, and more specifically may be a monkey, dog, cat, rabbit, guinea pig, rat, mouse, cow, sheep, pig, goat, human, etc., but is not limited thereto.

The STUB1 protein may have, include, consist of, or consist essentially of the amino acid sequence set forth in SEQ ID NO: 3. Specifically, the protein may be composed of a polypeptide described in the amino acid sequence of SEQ ID NO: 3.

The amino acid sequence of SEQ ID NO: 3 can be obtained from NIH GenBank, a known database. In the present invention, the amino acid sequence of SEQ ID NO: 3 is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, It may include amino acid sequences that have greater than 99%, 99.5%, 99.7% or 99.9% homology or identity. In addition, if it is an amino acid sequence having such homology or identity and exhibiting an efficacy corresponding to the protein comprising the amino acid sequence of SEQ ID NO: 3, a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added. It is obvious that also included within the scope of the present invention.

In the present invention, the polynucleotide encoding the STUB1 protein may be the STUB1 gene. In the present invention, the STUB1 gene may be used interchangeably with STUB1 .

The polynucleotide encoding the STUB1 protein of the present invention may include a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 3. As an example of the present invention, the polynucleotide encoding the STUB1 protein of the present invention may have or include the sequence of SEQ ID NO: 4. In addition, the polynucleotide encoding the STUB1 protein of the present invention may consist of or essentially consist of the sequence of SEQ ID NO: 4. Specifically, the STUB1 protein may be encoded by a polynucleotide described in the nucleotide sequence of SEQ ID NO: 4.

The polynucleotide encoding the STUB1 protein of the present invention can be incorporated into the coding region within the range that does not change the amino acid sequence of the STUB1 protein, considering codon degeneracy or preferred codons in organisms intended to express the STUB1 protein of the present invention. Various modifications may be made, and specifically, the polynucleotide encoding the STUB1 protein of the present invention has 70% or more, 75% or more, 76% or more, 85% or more, 90% or more homology or identity to the sequence of SEQ ID NO: 4 have or contain a nucleotide sequence of at least 95%, at least 96%, at least 97%, at least 98%, or at least 70%, at least 75%, at least 76% homology or identity with the sequence of SEQ ID NO: 4, 85 % or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more of a nucleotide sequence, or may consist essentially of, but is not limited thereto.

In the present invention, UBE4B has the effect of removing Tau protein, and the effect is further enhanced by the combination of UBE4B and STUB1, an E3 ubiquitin ligase, and the effect of removing Tau protein is the autophagy pathway other than the ubiquitin-proteasome pathway. It is significant that UBE4B or a combination of UBE4B and STUB1 can be applied to the prevention, improvement, or treatment of tauopathy.

In the present invention, the composition of the present invention may have a Tau protein removal effect.

In the present invention, the composition of the present invention may reduce the level of Tau protein, but is not limited thereto.

In one embodiment of the present invention, it was confirmed that Tau degradation was increased by overexpression of STUB1 (lanes fi in FIG. 8B, FIG. 8C) and UBE4B (lanes 1-4 in FIG. 8B, FIG. 8C) in mammalian neuroblastoma cells, It was confirmed that Tau degradation was further increased by the co-expression of STUB1 and UBE4B (lanes 6-9 in FIG. 8b, FIG. 8c).

In another embodiment of the present invention, Tau oligomers were degraded by overexpression of UBE4B or STUB1 in Tau-BiFC mice, resulting in decreased Tau fluorescence compared to the control group (FIG. 11e), and co-overexpression of UBE4B and STUB1 resulted in Tau fluorescence was further reduced (Fig. 11e-f).

In the present invention, the composition of the present invention may reduce the level of phosphorylated Tau protein, but is not limited thereto.

In one embodiment of the present invention, as a result of detecting the level of phosphorylated Tau according to the overexpression of UBE4B or STUB1 in the dentate gyrus of the mouse model, the level of phosphorylated Tau was reduced by the overexpression of UBE4B or STUB1 , and the joint of UBE4B and STUB1 It was confirmed that it was further reduced by overexpression (Fig. 11e, g).

In the present invention, the composition of the present invention may remove Tau protein through an autophagy pathway or reduce the level of Tau protein or phosphorylated Tau protein, but is not limited thereto.

In one embodiment of the present invention, UBE4B and STUB1 are overexpressed together with Tau in neuroblastoma cells, and the cells are treated with MG132, an ubiquitin-proteasome system (UPS) pathway inhibitor, or chloroquine, an autophagylysosome system (ALS) pathway inhibitor. As a result, MG132 Treatment did not inhibit Tau degradation compared to control cells (FIG. 13A), but in contrast, chloroquine significantly inhibited Tau degradation (FIG. 13B). In addition, the autophagy inhibitor PEPA (pepstatin A) alone, E64D and PEPA (E64D + PEPA) significantly inhibited Tau degradation (FIG. 13c).

From this, it follows that ALS is the major pathway for UBE4B- and STUB1-mediated Tau degradation in neuroblastoma cells, and that conversion of monomeric Tau molecules by UBE4B and STUB1 in SH-SY5Y cells is preferentially mediated by an autophagy-dependent manner rather than the proteasome pathway. It was confirmed that

The effects of the composition of the present invention described above include i) UBE4B (Ubiquitin conjugation E4 B) protein or a gene encoding the protein; or ii) UBE4B (Ubiquitin conjugation E4 B) protein or a gene encoding the protein; And STUB1 protein or a gene encoding the protein; may be achieved by a combination of, but is not limited thereto.

Another aspect of the present invention provides a pharmaceutical composition for preventing or treating tauopathy, comprising a UBE4B protein or a gene encoding the protein as an active ingredient.

Terms used herein are as described above.

In the present invention, the composition may further include a STUB1 protein or a gene encoding the protein, as described above.

In the present invention, the term "Tauopathy" means a neurodegenerative disorder involving Tau or hyperphosphorylated Tau.

In the present invention, the tauopathies include, for example, Alzheimer's disease (AD), Parkinson's disease, Lewy body dementia, Down syndrome, and progressive supranuclear palsy. palsy, PSP), etc., but is not limited thereto, and any disease including pathological features caused by Tau protein, Tau aggregation protein, or Tau hyperphosphorylation may be included.

As used herein, the term "prevention" refers to any activity that suppresses or delays the onset of tauopathy by administration of the composition, and "treatment" means that symptoms caused by tauopathy are improved or advantageously changed by administration of the composition. means all actions that

The pharmaceutical composition of the present invention may further include suitable carriers, excipients or diluents commonly used in the preparation of pharmaceutical compositions. At this time, the content of the active ingredient included in the pharmaceutical composition is not particularly limited thereto, but may include 0.0001% to 10% by weight, specifically 0.001% to 1% by weight based on the total weight of the composition.

The pharmaceutical composition is any one selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried formulations, and suppositories. It may have one dosage form, and may be various oral or parenteral dosage forms. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient, for example, starch, calcium carbonate, sucrose or lactose ( lactose) and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. have. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. As a base for the suppository, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.

As used herein, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is dependent on the type and severity of the subject, age, sex, and disease. It may be determined according to factors including type, activity of drug, sensitivity to drug, administration time, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And it can be single or multiple administrations. It is important to administer the amount that can obtain the maximum effect with the minimum amount without side effects in consideration of all the above factors, and can be easily determined by those skilled in the art. The preferred dosage of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the drug form, the route of administration and the duration, but for a desired effect, the pharmaceutical composition of the present invention is 0.0001 to 500 mg/day. It may be preferable to administer in kg, specifically 0.001 to 100 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The pharmaceutical composition can be administered to various mammals such as rats, livestock, and humans by various routes, and the method of administration includes without limitation as long as it is a conventional method in the art, for example, oral, rectal or intravenous, It may be administered by intramuscular, subcutaneous, intrauterine, or intracerebrovascular injection.

In addition, the pharmaceutical composition of the present invention can be used in the form of animal medicine as well as medicine applied to humans. Here, the animal is a concept including livestock and companion animals.

Another aspect of the present invention provides a method for preventing or treating tauopathy, comprising administering to a subject a composition containing a UBE4B protein or a gene encoding the protein.

Terms used herein are as described above.

The composition of the present invention may be a pharmaceutical composition.

In the present invention, the composition may further include a STUB1 protein or a gene encoding the protein, as described above.

In the present invention, the tauopathy may include, for example, Alzheimer's disease, Parkinson's disease, Lewy body dementia, Down's syndrome, and progressive supranuclear palsy, but is not limited thereto, and is as described above.

As used herein, the term "subject" refers to all animals other than humans that have or may develop tauopathy, and by administering the pharmaceutical composition of the present invention to a subject suspected of having tauopathy, the subject can be efficiently treated. .

As used herein, the term "administration" means introducing the pharmaceutical composition of the present invention to a subject suspected of having tauopathy by any appropriate method, and the route of administration may be oral or parenteral through various routes that can reach the target tissue. can be administered through

The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount, as described above.

The pharmaceutical composition of the present invention is not particularly limited as long as it is an individual for the purpose of preventing or treating tauopathy, and is applicable to any individual. For example, non-human animals such as monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cows, sheep, pigs, goats, birds, and fish may be used, and the pharmaceutical composition may be used parenterally, subcutaneously, It can be administered intraperitoneally, intrapulmonaryly and intranasally, and for local treatment, it can be administered by any suitable method, including intralesional administration if necessary. The preferred dosage of the pharmaceutical composition of the present invention varies depending on the condition and body weight of the subject, the severity of the disease, the drug type, the route and duration of administration, but can be appropriately selected by those skilled in the art. For example, it may be administered by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine intrathecal or intracerebrovascular injection, but is not limited thereto.

Another aspect of the present invention provides a food composition for preventing or improving tauopathy, comprising a UBE4B protein or a gene encoding the protein.

Terms used herein are as described above.

In the present invention, the composition may further include a STUB1 protein or a gene encoding the protein, as described above.

In the present invention, the tauopathy may include, for example, Alzheimer's disease, Parkinson's disease, Lewy body dementia, Down's syndrome, and progressive supranuclear palsy, but is not limited thereto, and is as described above.

In the present invention, the term "improvement" refers to all activities that improve or benefit the symptoms of suspected or affected individuals of tauopathy by using the composition.

The food composition of the present invention includes forms such as pills, powders, granules, precipitates, tablets, capsules or liquids, and the food to which the composition can be added includes, for example, various foods, such as beverages, There are chewing gum, tea, vitamin complexes, and health supplements.

Ingredients that can be included in the food composition of the present invention are not particularly limited to other ingredients other than containing active ingredients as essential ingredients, and, like conventional foods, various herbal extracts, food supplement additives, or natural carbohydrates as additional ingredients. may contain The content of the active ingredient in the food composition may be appropriately determined depending on the purpose of use (prevention, improvement or therapeutic treatment). At this time, the content of the active ingredient included in the composition is not particularly limited thereto, but may include 0.0001% to 10% by weight, specifically 0.001% to 1% by weight based on the total weight of the composition.

In addition, the food auxiliary additives may include food auxiliary additives common in the art, for example, flavoring agents, flavoring agents, coloring agents, fillers, stabilizers, and the like.

Examples of the natural carbohydrates include monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrins, cyclodextrins, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. In addition to the above, natural flavors (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavors (saccharin, aspartame, etc.) can advantageously be used as flavoring agents.

In addition to the above, the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and fillers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its Salts, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like may be contained. In addition, it may contain fruit flesh for the production of natural fruit juice, fruit juice beverages and vegetable beverages. These components may be used independently or in combination.

In the present invention, the health supplement may include health functional food and health food.

The health functional food (functional food) is the same term as food for special health use (FoSHU), and has high medical effect and is processed to efficiently display bioregulatory functions in addition to nutrient supply. means food. Here, "function (sex)" means obtaining useful effects for health purposes such as regulating nutrients for the structure and function of the human body or physiological functions.

Food containing the food composition of the present invention can be prepared by a method commonly used in the art, and can be prepared by adding raw materials and components commonly added in the art during the preparation. In addition, the formulation of the food may also be prepared without limitation as long as the formulation is recognized as a food. The food composition of the present invention can be prepared in various types of formulations, and unlike general drugs, it has the advantage of not having side effects that may occur when taking drugs for a long time by using food as a raw material, and has excellent portability.

Another aspect of the present invention provides a feed composition for preventing or improving tauopathy, comprising a UBE4B protein or a gene encoding the protein as an active ingredient.

Terms used herein are as described above.

In the present invention, the composition may further include a STUB1 protein or a gene encoding the protein, as described above.

In the present invention, the tauopathy may include, for example, Alzheimer's disease, Parkinson's disease, Lewy body dementia, Down's syndrome, and progressive supranuclear palsy, but is not limited thereto, and is as described above.

The composition of the present invention can be used to prevent or improve tauopathy in non-human subjects such as livestock or companion animals, and can be used as a functional feed additive or composition for feed.

The content of the active ingredient included in the composition of the present invention is not particularly limited thereto, but can be appropriately adjusted depending on the type and age of livestock to be applied, application type, desired effect, etc., for example, 1 to 99% by weight, preferably 10 to 90% by weight, more preferably 20 to 80% by weight, but is not limited thereto.

The feed composition of the present invention may include organic acids such as citric acid, fumaric acid, adipic acid, and lactic acid in addition to the composition for administration; phosphates such as potassium phosphate, sodium phosphate, and polymerized phosphate; At least one of natural antioxidants such as polyphenol, catechin, tocopherol, vitamin C, green tea extract, chitosan, and tannic acid may be mixed and used. In addition, diluents, dispersants, surfactants, binders, or lubricants may be additionally added to prepare formulations for injections such as aqueous solutions, suspensions, emulsions, and the like, capsules, granules, or tablets.

In addition, the feed composition of the present invention contains various additives such as amino acids, inorganic salts, vitamins, antioxidants, antifungal agents, antibacterial agents, etc. as auxiliary ingredients, vegetable protein feed such as pulverized or crushed wheat, barley, corn, blood meal, meat meal, fish meal In addition to main ingredients such as animal protein feed, animal fat and vegetable fat, etc., it can be used with nutritional supplements, growth promoters, digestion and absorption promoters, and disease preventive agents.

When the feed composition of the present invention is used as a feed additive, the feed composition may be added as it is or used together with other ingredients, and may be appropriately used according to a conventional method. The dosage form of the feed composition may be prepared as an immediate release or sustained release formulation in combination with a non-toxic pharmaceutically acceptable carrier. Such edible carriers may be corn starch, lactose, sucrose, propylene glycol. Solid carriers may be dosage forms such as tablets, powders, and liquid preparations, and liquid carriers may be dosage forms such as syrups, liquid suspensions, emulsions, and solutions. In addition, the administration agent may contain a preservative, a lubricant, a solution accelerator, a stabilizer, and may contain other inflammatory disease improving agents and substances useful for preventing viruses.

For example, the feed composition of the present invention can be applied to a number of animal diets, that is, feed, including mammals, but is not limited thereto.

For example, the feed composition according to the present invention may be mixed with livestock feed in an amount of about 10 to 500 g, preferably 10 to 100 g per 1 kg on a dry weight basis, mixed thoroughly and then supplied as a mash, It may be desirable to undergo pelletization, expansion, and extrusion processes through an additional processing process, but is not limited thereto.

UBE4B (Ubiquitin conjugation E4 B) or a combination of UBE4B and STUB1 (STIP1 homology and U-Box containing protein 1) of the present invention has an effect of removing Tau protein, and thus can be applied to the prevention, improvement or treatment of tauopathy. can

1 is a diagram showing the results of identifying Drosophila eye-derived miR-9 family miRNAs as hTau modifiers through genome-wide miRNA library screening in Drosophila. (a) Screening of miRNA libraries in GMR > hTau Drosophila eyes showed significant phenotypic enhancement indicated by reduced eye size in flies overexpressing miR-9 family miRNAs compared to GMR> hTau control flies. Eye sizes were arranged in order from small to large. (b) Volcano plot for average eye size versus respective p-value of flies expressing various miRNAs on a GMR > hTau background. Flies overexpressing miR-9 family miRNAs exhibited a severe tau toxicity phenotype indicated by reduced eye size. N = 3. (c, d) Overexpression of miR-9a , miR-9b or miR-9c in GMR > hTau Drosophila eyes significantly reduced eye size compared to GMR > hTau Drosophila eyes. N = 5. Data are expressed as mean±s.e.m. Box plot representations represent the 5th to 95th percentile range. (e) Alignment of adult Drosophila miR-9a , miR-9b and miR-9c sequences with human and murine miR-9 sequences (represented by SEQ ID NOs: 15-23 from above) shows that miR-9a is mammalian miR -9a It was confirmed to have 100% identity with the 9 sequence.
Figure 2 is a diagram showing the eye size of the Drosophila miRNA library screened at GMR > hTau . (a) Drosophila miRNA library and eye size of GMR-GAL4 . (b) Figures 1A and B are quantitatively presented in order of increasing eye size. Bars represent the miR-9 family miRNAs UAS-miR-9a , UAS-miR-9b and UAS-miR-9c compared to controls stained with GMR-GAL4/+ and GMR > hTau , respectively.
3 is a diagram showing the eye size of Drosophila miR-9a target RNAi screened in GMR > hTau . (a) Three different programs for miRNA target prediction (Targetscan, miR-base and Miranda) identified 34 common miR-9a targets. (b) Eye size of miR-9a target RNAi and GMR-GAL4. (c) Fig. 4A and B are quantitatively presented in order of increasing eye size. Bars represent UAS-miR-9a and corresponding target UAS-CG11070-RNAi compared to controls stained for GMR-GAL4/+ and GMR > hTau , respectively.
4 is a diagram confirming that CG11070, a miR-9a target, was confirmed in the secondary screening and that hTau was modified in the Drosophila eye. (a) As a result of screening GMR > hTau Drosophila eyes using RNAi knockdown targeting miR-9a, eye size was significantly reduced in CG11070 knockdown ( CG11070-RNAi ) flies compared to the control group. (b) Volcano plot of average eye size of flies expressing various miR-9a target gene RNAis versus respective p-values in GMR > hTau flies. CG11070-RNAi flies exhibited more severe ocular tau toxicity as confirmed by reduced eye size. N = 3. (c, d) CG11070 knockdown ( CG11070-RNAi ) in GMR > hTau flies reduced eye size compared to GMR > hTau controls. N = 5. Box plot representations represent the 5th to 95th percentile range. Data were expressed as mean±s.e.m. (e) Results of miRNA-mRNA-RISC pull-down assay in Drosophila S2 cells. miR-9a bound to CG11070 mRNA. Transfection of miR-9a- enriched CG11070 mRNA levels targeted senseless and sNPFR1 . N = 4. Data are expressed as mean±s.e.m. (f) Expression of miR-9a using GMR-GAL4 significantly reduced CG11070 expression. N = 3. Data are expressed as mean±s.e.m.
5 is a result of confirming homology between Drosophila CG11070 and human UBE4B and performing Western blotting. (a) Homologous domains between Drosophila CG11070 and human UBE4B proteins. (b) In the 3' UTR sequences of Drosophila CG11070 (SEQ ID NO: 24) and human UBE4B (SEQ ID NO: 25), the 3' UTR of each ortholog contains a miR-9 a/ miR-9 binding sequence (red) Confirmed. (ce) Western blotting results showed that overexpression of Drosophila CG11070 or mammalian UBE4B in GMR > hTau flies, as detected by AT180 (p-T231) and PHF-1 (p-S396/S404) antibodies, in control GMR > hTau flies. compared to phosphorylated Tau.
6 is a diagram showing the effect on hTau phenotype alleviation in Drosophila CG11070 and mammalian UBE4B overexpressing Drosophila. (a, b) Eye-specific overexpression of Drosophila CG11070 or mammalian UBE4B in GMR > hTau flies increased eye size compared to GMR > hTau controls. (cf) In Elav > hTau flies, larval crawling was increased by neural overexpression of Drosophila CG11070 or mammalian UBE4B using Elav-Gal4 . (e, f) Neural overexpression of Drosophila CG11070 or mammalian UBE4B using Elav-Gal4 in Elav > hTau flies significantly increased the number of synaptic boutons compared to control Elav > hTau flies. (gi) Western blotting results. Ocular overexpression of Drosophila CG11070 or mammalian UBE4B in GMR > hTau flies significantly reduced total Tau protein and phosphorylated Tau protein levels compared to control GMR > hTau flies.
7 is a diagram showing the effect of miR-9a knockdown on alleviating the hTau phenotype in Drosophila. (a, b) Eye-specific knockdown of Drosophila miR-9a using miR-9a -SP with no altered eye size compared to control GMR > hTau flies. ( cf ) Neuronal knockdown of Drosophila miR -9a using miR-9a -SP using Elav-Gal4 in Elav > hTau flies greatly increased larval crawling. ( e , f) Neural knockdown of Drosophila miR -9a using miR-9a -SP using Elav-Gal4 in Elav> hTau flies significantly increased the number of synaptic boutons compared to control Elav > hTau flies.
Figure 8 shows the results of Tau ubiquitination and degradation by UBE4B and STUB1 in 817 mammalian neuroblastomas. (a) Tau was co-expressed with His-ubiquitin , UBE4B and STUB1 wild-type (WT) or dominant-negative mutant STUB1 ^H260Q in SH-SY5Y neuroblastoma cells. Ubiquitinated Tau was significantly increased by co-expression of UBE4B and STUB1 (lane 5) but not by expression of either UBE4B (lane 4) or STUB1 (lane 3) alone. Tau ubiquitination by co-expression of UBE4B and STUB1 required STUB1 ligase activity (lanes 5 and 6). (b, c) Tau protein degradation was enhanced with co-expression of UBE4B and STUB1 (lanes 6-9) compared to UBE4B (lanes 1-4) or STUB1 (lanes fi) alone. Quantification of Tau levels was normalized to the amount of β-actin protein in each case. (d) UBE4B was co-expressed with HA-STUB1 and Tau in SH-SY5Y cells and immunoprecipitated from anti-HA-agarose beads. UBE4B did not directly interact with STUB1 in the absence of Tau, but indirectly interacted with STUB1 in the presence of Tau. (e) HA-UBE4B was co-expressed with Tau in SH-SY5Y cells and immunoprecipitated from anti-HA-agarose beads. Co-precipitated Tau was detected by Western blotting, confirming that Tau directly interacted with UBE4B.
9 is a diagram showing the effect of STUB1 knockdown on Tau degradation in neuroblastoma cells. (a) Knockdown of STUB1 using two different siRNAs in SH-SY5Y cells showed reduced STUB1 protein levels. (b) Tau degradation was inhibited by siSTUB1 . (c) Quantification results of Tau degradation in siSTUB1- expressing cells.
10 is a diagram showing the effect of reducing the UBE4B- mediated alleviated hTau phenotype in STUB1 knockdown Drosophila. (a, b) Eye-specific knockdown of Drosophila STUB1 significantly reduced eye size compared to GMR > hTau + hUBE4B flies. (c, d) Drosophila STUB1 neural knockdown using Elav-Gal4 in Elav > hTau + hUBE4B flies significantly reduced larval crawling. (e, f) Neuronal knockdown of Drosophila STUB1 using Elav-Gal4 in Elav > hTau + hUBE4B flies significantly reduced the number of synaptic boutons compared to control Elav > hTau flies.
11 is a diagram showing degradation of Tau oligomers by UBE4B and STUB1 in the Tau-BiFC mouse model. (a) Schematic of AAV-CMV-mCherry and AAV-UBE4B-mCherry virus constructs. (b) Schematic diagram of AAV-CMV-mCherry or AAV-UBE4B-mCherry viral delivery into the dentate gyrus of Tau-BiFC mice. (c) Fluorescence staining images showing foci (red) of AAV-CMV-mCherry or AAV-UBE4B + STUB1-mCherry viral delivery in the dentate gyrus and hippocampus of Tau-BiFC mice. Scale bar (white), 1 mm. (d) Schematic diagram of the workflow for virus injection and pathological examination in Tau-BiFC mice. (e) AAV-UBE4B and AAV-STUB1 reduced oligomeric Tau-BiFC and pTau(S202/T205) levels in the dentate gyrus compared to controls. GCL, granular cell layer; POL, polymorphic layer. Scale bar (white), 80 μm. (f, g) Results of densitometric analysis, AAV-UBE4B and STUB1 in the dentate gyrus, respectively, compared to controls ( AAV-Cont N = 4; AAV-UBE4B N = 4; AAV-STUB1 N = 4; AAV-UBE4B + AAV-STUB1 ) , N = 4; N = 4 biologically independent animals) significantly reduced both Tau-BiFC and pTau(S202/T205) levels.
12 is a diagram showing the decrease in phosphorylation of Tau by UBE4B and STUB1 in the Tau-BiFC mouse model. (a) AAV-UBE4B and AAV-STUB1 reduced pTau levels AT180 (p-T231) and PHF-1 (pS396/S404) in the dentate gyrus compared to AAV-control. Scale bar (white), 40 μm. (b, c) Results of densitometric analysis, AAV-UBE4B and STUB1 are AAV-control ( AAV-Cont N = 4; AAV-UBE4B N = 4; AAV-STUB1 N = 4; AAV-UBE4B + AAV-STUB1 , N = 4; N = 4 biologically independent animals) showed a significant decrease in pTau levels (AT180 and PHF-1) in the dentate gyrus. Co-delivery of AAV-UBE4B and AAV-STUB1 showed further reduction of pTau levels (AT180 and PHF-1) in the dentate gyrus compared to either AAV-UBE4B or AAV-STUB1 alone. (d) Colocalization analysis (orange line) showed that Tau-BiFC (green) and AT8 (S202/T205) (purple) levels were significantly higher in AAV-UBE4B and AAV-STUB1 -dependently in the polymorphic layer of the dentate gyrus (POL). ) showed a correlation and showed a decrease. Scale bar (white), 20 μm. (e) The intensity of Tau-BiFC and AT8(S202/T205) levels decreased with AAV-UBE4B and AAV-STUB1 dependent correlations compared to AAV-control.
13 is a diagram showing Tau that is reduced through autophagy by UBE4B and STUB1. (a) Treatment of SH-SY5Y cells with proteasome inhibitor MG132 did not affect Tau degradation mediated by UBE4B/STUB1. (b) Chloroquine (CQ) treatment, an autophagy inhibitor, affected Tau degradation by UBE4B/STUB1. (c) Pepstatin A (PEPA) and E64D, an autophagy inhibitor, inhibited Tau degradation by UBE4B/STUB1. (d) Schematic of autophagy inhibitor injection into the dentate gyrus of Tau-BiFC mice. (e) Schematic diagram of the workflow for autophagy inhibitor injection and pathological examination in Tau-BiFC mice. (f) CQ and E64D + PEPA increased pTau(S202/T205) levels in the dentate gyrus compared to saline-injected controls. GCL, granular cell layer; POL, polymorphic layer. (g, h) As a result of densitometric analysis, the chloroquine and ED64 + PEPA administration group was compared to the saline injection control group ( AAV-UBE4B + AAV-STUB1 (saline control), N = 4; CQ + AAV-UBE4B + AAV-STUB1 , significantly increased both pTau(S202/T205) and Tau-BiFC levels in the dentate gyrus compared to N = 4; E64D/PEPEA + AAV-UBE4B + AAV-STUB1 , N = 4; N = 4 biologically independent animals) . (i) AAV-UBE4B and AAV-STUB1 reduced LC3 levels in the dentate gyrus compared to controls. (j) AAV-UBE4B and AAV-STUB1 reduced p62 levels in the dentate gyrus compared to controls. (k) As a result of densitometric analysis, autophagy inhibitors were control ( AAV-Control , N = 4; AAV-UBE4B + AAV-STUB1 , N = 4; CQ + AAV-UBE4B + AAV-STUB1 , N = 4; E64D/ significantly increased LC3 levels in the dentate gyrus compared to PEPA+ AAV-UBE4B + AAV-STUB1 , N = 4; N = 4 biologically independent animals). (i) As a result of densitometric analysis, autophagy inhibitors were control group ( AAV-Control , N = 4; AAV-UBE4B + AAV-STUB1 , N = 4; CQ + AAV-UBE4B + AAV-STUB1 , N = 4; E64D/ significantly increased p62 levels in the dentate gyrus compared to PEPA+ AAV-UBE4B + AAV-STUB1 , N = 4; N = 4 biologically independent animals).
14 is a diagram showing an increase in pTau accumulation by an autophagy inhibitor in the Tau-BiFC mouse model. (a) Chloroquine (CQ) and E64D + PEPA treatment increased pTau(PHF-1: S396/S404) levels compared to controls in the dentate gyrus. GCL, granular cell layer; POL, polymorphic layer. Scale bar (white), 40 μm. (b) As a result of densitometric analysis, autophagy inhibitors in the dentate gyrus control group ( AAV-UBE4B + AAV-STUB1 (saline control), N = 4; CQ + AAV-UBE4B + AAV-STUB1 , N = 4; E64D/PEPA + AAV-UBE4B + AAV-STUB1 , N = 4; N = 4 biologically independent animals) significantly increased pTau(PHF-1: S396/S404) levels. (c) CQ and E64D + PEPA treatment increased pTau(AT180: T231) levels compared to controls in the dentate gyrus. Scale bar (white), 40 μm. (d) As a result of densitometric analysis, autophagy inhibitors in the dentate gyrus control ( AAV-UBE4B + AAV-STUB1 (saline control), N = 4; CQ + AAV-UBE4B + AAV-STUB1 , N = 4; E64D/PEPA + AAV-UBE4B + AAV-STUB1 , N = 4; N = 4 biologically independent animals) significantly increased pTau (AT180: T231).
Figure 15 is a diagram showing the accumulation of beclin (BECN1) by an autophagy inhibitor in the TauBiFC mouse model. (a) Chloroquine (CQ) and E64D + PEPA treatment increased BECN1 levels in the dentate gyrus compared to controls. Scale bar (white), 40 μm. (b) As a result of densitometric analysis, autophagy inhibitors in the dentate gyrus control group ( AAV-UBE4B + AAV-STUB1 (saline control), N = 4; CQ + AAV-UBE4B + AAV-STUB1 , N = 4; E64D/PEPA + AAV-UBE4B + AAV-STUB1 , N = 4; N = 4 biologically independent animals) significantly increased BECN1 levels.

Hereinafter, examples and the like will be described in detail to aid understanding of the present invention. However, the embodiments according to the present invention can be modified in many different forms, and the scope of the present invention should not be construed as being limited to the following examples. Embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

Experimental example

<Experimental Example 1> Drosophila culture and stock

Yellow Drosophila ( Drosophila melanogaster ) was cultured at 25 ° C. in a medium containing standard corn meal, yeast, sugar and agar.

UAS-hTau , GMR-GAL4 and ElavGAL4 fly strains were obtained from the Bloomington Stock Center (Bloomington, USA).

RNAi stocks targeting miR-9a were obtained from Bloomington Stock Center (Bloomington, USA) and Vienna Drosophila Research Center (Vienna, Austria).

pUAS-CG11070 and pUAS-UBE4B flies were constructed by p - element-mediated germline transformation method using cDNA containing the coding region of CG11070 or UBE4B (Ubiquitin conjugation E4 B) .

<Experimental Example 2> Cell culture and transfection

SH-SY5y neuroblastoma cells were cultured in Dulbecco's modified DMEM (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS), penicillin (10 U/mL) and streptomycin (100 μg/mL). Eagle's medium) medium. Cells were cultured at 37° C. in 5% CO ₂ .

Plasmids were transfected into cells using Effectene transfection reagent (Qiagen) according to the manufacturer's instructions.

siRNA was transfected into cells using plasmid Lipofectamine 2000 transfection reagent (lipofectamine 2000 transfection reagent).

<Experimental Example 3> Mouse model production and virus injection

Male TauP301L-BiFC (Bimolecular Fluorescence Complementation) mice and their brain specimens were prepared as described in a previous study (Shin, S. et al., Progress in neurobiology, 101782, 2020). AAV-CMV-UBE4B and AAV-CMV-STUB1 (STIP1 homology and U-Box containing protein1) viruses (Fig. 11a) were injected using a stereotaxic micro-injector (Stoelting Co.). AAV-CMV was injected into the control group. Neuropathological examination was performed 2 weeks after injection. Mice were bred with a light/dark cycle of 12:12 and maintained at a temperature of 18-23°C and humidity of 40-60% in a pathogen-free facility.

<Experimental Example 4> Quantification of eye phenotype in Drosophila screen

GMR > hTau flies were mated with UAS-miRNAs23 or miR-9a targeting UAS-RNAi flies and scored for Tau toxicity observed in the offspring eyes. Eye images were taken using a Digiretina 16 camera and eye size was measured using Image J v1.44 software (National Institutes of Health, Bethesda, USA). Measurements were displayed using a volcano plot in Graphpad Prism 9.1.0.

<Experimental Example 5> Larval crawling assay

Third instar larvae were briefly washed with Phosphate-Buffered Saline (PBS) to remove residual food. Larvae were dried for a short time on clean filter paper and placed in Petri dishes coated with 2% agar grape juice. After allowing them to crawl freely for 90 seconds, a line was drawn to track the crawling larvae to quantify the crawling distance, and the total distance was measured using Image J v1.44 software. About 10-20 larvae of each genotype were tested in the same way.

<Experimental Example 6> Quantification of neuromuscular junctions (NMJ)

Third instar larvae were dissected in PBS and fixed in 4% formaldehyde in PBS for 15 minutes, then washed three times with 0.1% Triton X-100 in PBS. Fluorescein (FITC)-conjugated anti-horseradish peroxidase (HRP) (1:100) was incubated at room temperature for 1 hour and 30 minutes. Larvae were placed on Slow Fade Antifade medium. Confocal images were taken using a Zeiss confocal microscope. NMJ was quantified by counting the number of boutons of each genotype using Image J v1.44 software with a cell counter plugin.

<Experimental Example 7> Quantitative PCR

The heads of 20 adult Drosophila per group were collected and total RNA was isolated from them using Trizol reagent. After treating RNA samples with RNase-free DNase I, cDNA was synthesized using the SuperScript III First-Strand Synthesis System (TAKARA, Japan). Quantitative reverse transcription-PCR (qRT-PCR) analysis was performed using the synthesized cDNA as a template using the StepOnePlus Sequence Detection System (BioRAD, USA) together with silver SYBR Green PCR Core reagent (BioRAD). Relative cycle thresholds quantified the fold change of each specific mRNA after normalization to rp49 levels.

<Experimental Example 8> miRNA-mRNA pull-down analysis

Cells were harvested 24 hours after transfection and lysed in lysis buffer (Cell Signaling, USA) containing 20X protease inhibitor (Roche) and 60 U RNaseOUT (Invitrogen). Protein A Dynabeads (Invitrogen, USA) and 2 μg AGO-1-specific antibody were used for immunoprecipitation. Immunoprecipitates were treated with 20 μg/ml of proteinase K for 10 minutes at 37°C. RNA was extracted using the easy-BLUE kit (iNTRON, Korea) and cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen). To confirm that miR-9a binds directly to CG11070 , primers were designed to amplify a fragment of the 3'-untranslated region (UTR) containing the predicted miR-9a seed sequence match (Table 1 below). ) senseless and sNPFR1 were used as positive controls and tubulin was used as negative control.

sequence number sequence name Sequence (5' -> 3') 5 RP49 F AGGGTATCGACAACAGAGTG 6 RP49R CACCAGGAACTTCTTGAATC 7 CG11070 F GTAGCAGCGAACCCGCAG 8 CG11070R AATTCGGTTGACAGGAAAAA 9 senseless F TGGCAGCTAAACGTACCAAA 10 senseless R GATCGTATAAATAAATGTGG 11 sNPFR1F GGGCCATTTCGCATATTTAC 12 sNPFR1R ATTTAATTCCGTGCGACTGG 13 tubulin F ACTGCAGCATCCTGTGAACC 14 tubulin R TGGGAACATTTCCGTTTGAT

<Experimental Example 9> Western blot

After hatching for each genotype, 20 30-day-old fly heads were homogenized in RIPA buffer, and the lysate was loaded onto each lane of a 10% SDS gel and transferred to a nitrocellulose membrane. Membranes were blocked in 5% BSA (Bovine serum albumin) and incubated overnight with primary antibodies at 4°C. After washing the membrane with TBS-T solution (Tris Buffered Saline with Tween 20), it was incubated with the secondary antibody. Membranes were developed using ECL Western blotting detection reagent and images were taken using FluorChem E image processor. Antibodies used were anti-Tau (1:1000, T46, Cat no. 13-6400, Invitrogen), anti-AT180 (1:1000, Cat no. MN1040, Invitrogen), anti-PHF-1 (1:1000, Cat MN1050, Invitrogen), anti-AT8 (1:1000, catalog number MN1020, Invitrogen) and anti-β-actin (1:1000, catalog number JLA20, DHSB), with β-actin used as a loading control. Signal intensity was quantified using ImageJ (NIH) software.

Anti-Tau (Cat no. ab64193, Abcam), anti-β-actin (Cat no. LF-PA0207, AB Frontier), anti-Myc (Cat no. C3956, Sigma) for western blot analysis of SH-SY5y cells , anti-HA (Cat no. H6908, Sigma) and anti-CHIP (Cat no. sc-133066, Santa Cruz Biotechnology) antibodies were used.

<Experimental Example 10> Immunoprecipitation

After transfecting the cells with the plasmid for 24 hours, the cells were harvested and washed in IP buffer (50 mM HEPES (Hydroxyethyl piperazine Ethane Sulfonicacid) pH 7.5, 150 mM NaCl, 1.5 mM MgCl ₂ , 5 mM KCl, 0.1% Tween-20, 2 mM DTT and protease inhibitor cocktail (Roche)). Lysates were centrifuged at 9700 Х g for 30 minutes at 4°C, and the collected supernatants were incubated with anti-HA agarose beads (Sigma) for 4 hours at 4°C. The beads were then washed with a buffer containing 50 mM HEPES pH 7.5, 150 mM NaCl, 1.5 mM MgCl ₂ , 5 mM KCl, 0.1% Tween-20, and 2 mM DTT and bound proteins were eluted with buffer 2X SDS sample buffer. did Samples were heated at 95° C. for 10 minutes and then quantified by Western blot.

<Experimental Example 11> His-ubiquitin (His-ubiquitin) pull-down analysis

Cells were co-transfected with PCS2-His-ubiquitin-labeled plasmids, and 24 hours after transfection, cells were treated with 10 μM MG132 for 6 hours. Cells were lysed in urea lysis buffer (8 M Urea, 0.3 M NaCl, 0.5 M Na ₂ HPO ₄ , 0.05 M Tris, 0.001 M Phenylmethylsulfonyl fluoride (PMSF), 0.01 M imidazole, pH 8.0) and then 4 min. sonicated. Cell lysates were transferred to equilibrated nitrilotriacetic acid (Ni-NTA) agarose and incubated for 4 hours at room temperature. The beads were washed 5 times with urea wash buffer (8 M Urea, 0.3 M NaCl, 0.5 M Na ₂ HPO ₄ , 0.05 M Tris, 0.001 M PMSF, 0.02 M imidazole, pH 6.5), and the conjugated protein was washed with 40 μL Elution was with 2X Laemmli/Imidazole (200 mM imidazole). The eluted protein samples were heated at 95° C. for 10 minutes and then analyzed by Western blotting.

<Experimental Example 12> Protein stability analysis

SH-SY5y cells were transfected with the indicated plasmids or siRNA and treated with 100 μg/mL CHX (cycloheximide) or vehicle 24 hours after transfection. Cells were collected at specific time points after CHX treatment and immunoblotted using antibodies against specific proteins. To assess autophagic degradation, Tau was co-transfected with STUB1 and UBE4B for 24 hours, and cells were treated with 50 μM Chloroquine (CQ) or vehicle for 8 hours. After cells were collected and lysed, the lysates were immunoblotted with antibodies to specific proteins.

<Experimental Example 13> In vivo confocal microscopy and image analysis

In the Tau-BiFC mouse model, anti-Tau 5 (1:200, ab3931, Abcam), anti-phosphorylated Tau (pTau) AT8 (1:200, Cat no. MN1020, Invitrogen), anti-pTau AT180 (1:200 , Cat no. MN1040, Invitrogen), anti-pTau PHF-1 (1:200, Cat no. MN1050, Invitrogen), anti-LC3 (1:200, Cat no. M152-3, MBL), anti-P62 ( Immunofluorescence staining was performed for 1:200, Cat no. PM045, MBL) and anti-Beclin (1:200, Cat no. PD017, MBL). Fluorescence was observed with a confocal microscope (Nikon A1R, JAPAN), and colocalization and quantitative evaluation of images were performed using NIH Image J v1.44 software.

Example

<Example 1> In Drosophila hTau as a modifier of miR-9a discrimination

Overexpression of human tau ( hTau ) using the eye-specific GMR-GAL4 promoter in the Drosophila eye induced eye neurodegeneration characterized by reduced eye size in a rough eye phenotype. This phenotype was used to screen 131 UAS-miRNA lines covering 144 Drosophila miRNAs. After analyzing the eye shape of each line and quantitatively measuring the eye size, the libraries were arranged in the order of increasing eye size (FIGS. 1a and 2a-b).

As a result, eye-specific overexpression of many miRNAs in hTau flies ( GMR > hTau ) affected eye size. Quantification of eye size was plotted in a volcano plot by the ratio of eye size to p- value of miRNA overexpressing lines versus control GMR > hTau lines (Fig. 1b). The most significant reduction in eye size was induced by overexpression of evolutionarily conserved members of the miR-9 family, miR-9a , miR-9b and miR-9c (Fig. 1c-d) (Fig. 1e).

Reduced eye size of miR-9a , miR-9b or miR-9c in the absence of hTau expression (Fig. 1c-d and Fig. 2) suggests that miRNAs regulate other target genes during eye development with these miRNAs and that the morphology and eye size This may be because they are involved by influencing development. However, when these miRNAs were expressed in the presence of hTau , the reduction in eye size was greatly enhanced. This indicated an important regulatory role for the miR-9 family in Drosophila Tau toxicity.

Since Drosophila miR-9a has 100% homology with mammalian miR-9 , the following experiment was performed focusing on miR-9a (Fig. 1e).

<Example 2> miR-9a target CG11070 On by hTau regulation of

As it was confirmed that miR-9a improves Tau toxicity, individual microRNA target prediction programs TargetScan (www.targetscan.org), miRanda (www.microRNA.org) and miRbase (www.mirbase.org) were used to miR-9a. -9a target gene was searched. Detecting 34 miR-9a targets common to all three platforms (Fig. 3a) and using RNAi knockdown stably expressed in a GMR > hTau background, we estimated 34 for the eye phenotype of hTau overexpression ( GMR > hTau ). After screening the gene of interest, RNAi lines were arranged in order of increasing eye size (Fig. 4a, Fig. 3b-c). Volcano plot analysis was performed as the ratio of eye size to p- values of the 34 RNAi lines relative to control GMR > hTau flies.

As a result, CG11070-RNAi flies showed the most significant decrease in eye size (Fig. 4b, Fig. 3c). The eye size of CG11070-RNAi flies on the GMR > hTau background ( GMR > hTau + CG11070-RNAi ) was significantly reduced compared to that of control GMR > hTau flies (Fig. 4c-d).

Since microRNA binds to the 3'-UTR region of target mRNA to inhibit translation or mRNA stability, the binding of miR-9a to CG11070 was analyzed using a miRNA-mRNA pull-down assay.

As a result, it was confirmed that miR -9a / miR-9 binds to and enriches CG11070 mRNA in Drosophila S2 cells compared to the control scrambled miRNA, similar to the senseless and sNPFR1 targets. (Fig. 4e). In addition, eye-specific overexpression of miR-9a using GMR -GAL4 flies reduced CG11070 mRNA levels (Fig. 4f).

From this, it was confirmed that CG11070 is a target of miR-9a .

<Example 3> Drosophila CG11070 and mammalian orthologues thereof UBE4B overexpression of

CG11070 and UBE4B proteins have similar functional domains with 26% amino acid identity (Fig. 5a), and the 3'-UTR region of UBE4B mRNA also contains a miR-9 binding sequence similar to the 3'-UTR region of CG11070 mRNA ( Fig. 5b). Besides miR-9a , UBE4B is regulated by miR-26 , miR-148/miR-152 and miR-15/16/195/424/497 . However, only in Drosophila, CG11070 is regulated by miR-9a . Therefore, CG11070 / UBE4B was selected for further analysis due to its similarity in regulation by miR-9 . Since knockdown of CG11070 in GMR > hTau flies reduced eye size compared to control GMR > hTau flies, we checked whether overexpression of CG11070 and its mammalian ortholog UBE4B could alleviate the hTau phenotype in GMR > hTau flies.

As a result, overexpression of CG11070 ( GMR > hTau + GC11070 ) and UBE4B ( GMR > hTau + UBE4B ) in GMR > hTau flies alleviated the rough eye neurotype by increasing the eye size (Fig . 6a-b). Neuron-specific ectopic hTau expression ( Elav > hTau ) reduced locomotion of Drosophila larvae, which was mitigated by overexpression of CG11070 and UBE4B (Fig. 6c-d). In Drosophila larvae, the number of boutons at neuromuscular junctions (NMJ) is directly related to locomotion, which is known to decrease in the Drosophila AD model. Larvae expressing hTau in neural cells showed a significant decrease in the number of boutons compared to controls, which was mitigated by overexpression of CG11070 and UBE4B (Fig. 6e–f).

Knockdown of miR-9a by miR -9a-sponge ( miR-9a -SP) did not show any change in eye size compared to GMR > hTau flies (Fig. 7a-b). However, knockdown by miR-9a -SP in neurons of Elav > hTau showed a larval motor phenotype similar to the overexpression of CG11070 and hUBE4B (Fig. 7c–d), and knockdown by miR-9a -SP in neurons resulted in the overexpression of CG11070 and hUBE4B . and improved NMJ bouton number when compared to overexpression of hUBE4B (Fig. 7e-f).

From this, it can be seen that miR-9a and CG11070 / UBE4B form a common axis related to the regulation of Tau toxicity in Drosophila.

Since overexpression of CG11070 and UBE4B alleviated the hTau phenotype, we further investigated whether overexpression of these genes affected Tau degradation.

Western blot was performed on proteins from 30-day-old fly heads showing eye-specific hTau expression ( GMR > hTau ), and total hTau proteins were found in CG11070 ( GMR > hTau + GC11070 ) and UBE4B ( GMR > hTau + UBE4B ) (Fig. 6g-h) was confirmed to significantly decrease by overexpression. Phosphorylated Tau detected by AT8 ( p- S202/T205) antibody was also significantly decreased by overexpression of CG11070 and UBE4B (Fig. 6g,i). Other phosphorylated forms of Tau detected by the AT180 ( p- T231) and PHF-1 ( p- S396/S404) antibodies were also reduced in these genotypes (Fig. 5c-e).

From this, it can be seen that overexpression of Drosophila CG11070 or human UBE4B increases Tau degradation, improving larval movement, NMJ defects, and adult eye phenotypes in hTau- overexpressing Drosophila.

<Example 4> Ubiquitination and degradation of Tau by UBE4B and STUB1 in mammalian neuroblastoma cells

To investigate the mechanism by which UBE4B and STUB1 degrade Tau, it was confirmed whether UBE4B and STUB1 affect Tau ubiquitination in SH-SY5Y neuroblastoma cells. STUB1 was selected because it showed ubiquitination to the Tau protein, which was not regulated by miR-9 .

As a result, STUB1 expression alone, UBE4B expression alone, and co-overexpression of UBE4B with a dominant-negative mutant (STUB1 ^H260Q ) did not significantly affect Tau ubiquitination (lanes 3-4 in FIG. 8a, 6), co-overexpression of UBE4B and STUB1 significantly increased ubiquitinated Tau (lane 5 in FIG. 8a).

From this, it was confirmed that UBE4B and STUB1 jointly regulate Tau ubiquitination.

As it was confirmed that the regulatory role of ubiquitin ligase is essential for protein degradation, UBE4B and STUB1-mediated Tau degradation was investigated by inhibiting protein synthesis with CHX (cycloheximide).

As a result, it was confirmed that Tau degradation was increased by STUB1 (lane fi in FIG. 8B, FIG. 8C) and UBE4B overexpression (lanes 1-4 in FIG. 8B, FIG. 8C), and Tau degradation by co-expression of STUB1 and UBE4B It was confirmed that was further increased (lanes 6-9 in FIG. 8b, FIG. 8c).

Since only overexpression of UBE4B degrades Tau (Fig. 8b-c), endogenous STUB1 was knocked down with siRNA (Fig. 9a), and UBE4B-mediated degradation of Tau was investigated.

As a result, upon STUB1 knockdown, overexpression of UBE4B did not show Tau degradation (Fig. 9b, lanes 6-9 compared to lanes 1-4). Also, knockdown of STUB1 showed no change in Tau degradation when compared to siControl (FIG. 9c).

From this, it was confirmed that UBE4B is an important factor in ubiquitination and degradation of Tau by enhancing the ubiquitination activity of STUB1.

Immunoprecipitation assays were performed to evaluate the biochemical interactions of STUB1 and Tau with UBE4B.

As a result, when Tau was co-expressed with UBE4B and STUB1 , UBE4B co-precipitated with STUB1 (Fig. 8d). However, UBE4B did not co-precipitate with STUB1 in the absence of Tau, confirming that UBE4B did not directly interact with STUB1, but directly interacted with the Tau protein (FIG. 8e).

From this, it can be seen that UBE4B does not directly interact with STUB1, but that Tau mediates the interaction between STUB1 and UBE4B.

<Example 5> In Drosophila STUB1 Alleviated by UBE4B-mediated by knockdown hTau Decrease in phenotype

Since knockdown of STUB1 in neuroblastoma cells did not show any change in Tau level in the presence of UBE4B (Fig. 9b-c), the importance of STUB1 in the in vivo Drosophila model system was further investigated.

As a result, when the STUB1 gene was knocked down in the eyes of flies expressing GMR > hTau + hUBE4B , the eye phenotype was significantly reduced compared to that of GMR > hTau + hUBE4B flies (FIG. 10a-b). In addition, knockdown of the STUB1 gene in neurons expressing Elav > hTau + hUBE4B significantly reduced the larval motor phenotype compared to Elav > hTau + hUBE4B (Fig. 10c-d). However, knockdown of the STUB1 gene in larvae expressing Elav > hTau + hUBE4B did not change the NMJ phenotype compared to Elav > hTau + hUBE4B larvae (Fig. 10e-f).

From this, it can be seen that the alleviated hTau phenotype by hUBE4B overexpression depends on STUB1 function.

<Example 6> Tau-BiFC Tau degradation by UBE4B and STUB1 in a mouse model

BiFC technology was applied to visualize Tau oligomerization in a mouse model. In this system, the full-length human Tau protein was fused to the non-fluorescent N- and C-termini of the Venus fluorescent protein. In the transgenic TauP301L-BiFC mouse model, Venus fluorescence was activated only when Tau was aggregated.

To determine whether in vivo overexpression of UBE4B and STUB1 affects Tau degradation , AAV-CMV-UBE4B and AAV-CMV-STUB1 were constructed (FIG. 11a). After AAV was delivered to the dentate gyri of Tau-BiFC mice by stereotactic injection (Fig. 11b-c), pathological examination was performed (Fig. 11d). Tau oligomerization in the Tau-BiFC mouse model system was visualized by BiFC fluorescence.

As a result, overexpression of UBE4B or STUB1 in Tau-BiFC mice degraded Tau oligomers, resulting in reduced Tau fluorescence compared to the control group (FIG. 11e), and co-overexpression of UBE4B and STUB1 further reduced Tau fluorescence (FIG. 11e). 11e-f).

As a result of detecting the level of phosphorylated Tau in the dentate gyrus of Tau-BiFC mice using the AT8 ( p- S202/T205) antibody, overexpression of UBE4B or STUB1 reduced the level of phosphorylated Tau, and co-overexpression of UBE4B and STUB1 It was further reduced by (Fig. 11e, g).

As a result of detecting additional phosphorylated forms of Tau using AT180 ( p- T231) and PHF-1 ( p- S396/S404) antibodies, overexpression of UBE4B or STUB1 resulted in p- T231 and p- S396/S404 Tau levels. was decreased, and further decreased by co-overexpression of UBE4B and STUB1 (FIG. 12a-c).

From this, it was confirmed that UBE4B and STUB1 additionally degrade Tau in vivo.

<Example 7> UBE4B and STUB1 mediated autophagy Tau degradation

To confirm which pathway Tau degradation by UBE4B and STUB1 takes place, UBE4B and STUB1 were overexpressed together with Tau in neuroblastoma cells, and the cells were treated with MG132, an inhibitor of the ubiquitin-proteasome system (UPS) pathway or the autophagylysosome system (ALS) pathway. They were treated with the inhibitor chloroquine.

As a result, MG132 treatment did not inhibit Tau degradation compared to control cells (Fig. 13a), but in contrast, chloroquine significantly inhibited Tau degradation (Fig. 13b). In addition, the autophagy inhibitor PEPA (pepstatin A) alone, E64D and PEPA (E64D + PEPA) significantly inhibited Tau degradation (FIG. 13c).

From this, it follows that ALS is the major pathway for UBE4B- and STUB1-mediated Tau degradation in neuroblastoma cells, and that conversion of monomeric Tau molecules by UBE4B and STUB1 in SH-SY5Y cells is preferentially mediated by an autophagy-dependent manner rather than the proteasome pathway. It was confirmed that

As it was confirmed that autophagy inhibitor treatment inhibited Tau degradation, it was confirmed that the same result was obtained in vivo by injecting the autophagy inhibitor into the dentate gyrus of Tau-BiFC mice in which UBE4B and STUB1 were co-expressed (FIG. 13d-e ). Oligomeric and phosphorylated Tau levels were measured in the dentate gyrus of Tau-BiFC mice using the AT8 antibody (S202/T205).

As a result, ALS inhibition by chloroquine and E64D + PEPA significantly increased oligomeric and phosphorylated Tau (S202/T205) (FIG. 13f-h), and Tau p- S396/S404 (PHF-1) and p- The phosphorylated form of T231 (AT180) was also significantly increased in Tau-BiFC mice treated with chloroquine and E64D + PEPA (Fig. 14a-d).

ALS disruption inversely correlates with the efficiency of autophagy because it alters LC3 and p62/SQSTM1 levels. Accordingly, LC3 and p62 levels were measured in an animal model system.

As a result, LC3 and p62 levels were significantly decreased in the dentate gyrus of Tau-BiFC mice in which UBE4B and STUB1 were co-overexpressed compared to the control group, whereas in Tau-BiFC mice with UBE4B and STUB1 co-overexpression treated with autophagy inhibitors, In the dentate gyrus, the levels of LC3 and p62 were increased compared to the control group (FIGS. 13i-j).

In addition, autophagy inhibitors modulated the level of beclin (BECN1) in the dentate gyrus of Tau-BiFC mice co-overexpressing UBE4B and STUB1 compared to the control group (FIG. 15).

From this, it was confirmed that monomeric and oligomeric Tau degradation by STUB1 and UBE4B is mediated through the autophagy pathway rather than the ubiquitin-proteasome system.

From the results of the above example, it was confirmed that UBE4B, an E3/E4 ubiquitin ligase, has an effect of removing Tau protein, and that this effect is further enhanced by the combination with STUB1, an E3 ubiquitin ligase. In addition, as it has been found that the effect of removing the Tau protein is mediated by the autophagy pathway rather than the ubiquitin-proteasome pathway, UBE4B or a combination of UBE4B and STUB1 prevents tauopathy including Alzheimer's dementia. , can be applied for improvement or treatment.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be embodied in other specific forms without changing its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be construed as including all changes or modified forms derived from the meaning and scope of the claims to be described later and equivalent concepts rather than the detailed description above are included in the scope of the present invention.

<110> Korea Research Institute of Bioscience and Biotechnology KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY Ewha University - Industry Collaboration Foundation <120> UBE4B protein and uses thereof <130> KPA210750-KR-P1 <150> KR 10-2021-0070331 <151> 2021-05-31 <160> 25 <170> KoPatentIn 3.0 <210> 1 <211> 1302 <212> PRT <213> Unknown <220> <223> UBE4B protein <400> 1 Met Glu Glu Leu Ser Ala Asp Glu Ile Arg Arg Arg Arg Leu Ala Arg 1 5 10 15 Leu Ala Gly Gly Gln Thr Ser Gln Pro Thr Thr Pro Leu Thr Ser Pro 20 25 30 Gln Arg Glu Asn Pro Pro Gly Pro Pro Ile Ala Ala Ser Ala Pro Gly 35 40 45 Pro Ser Gln Ser Leu Gly Leu Asn Val His Asn Met Thr Pro Ala Thr 50 55 60 Ser Pro Ile Gly Ala Ser Gly Val Ala His Arg Ser Gln Ser Ser Glu 65 70 75 80 Gly Val Ser Ser Leu Ser Ser Ser Ser Pro Ser Asn Ser Leu Glu Thr Gln 85 90 95 Ser Gln Ser Leu Ser Arg Ser Gln Ser Met Asp Ile Asp Gly Val Ser 100 105 110 Cys Glu Lys Ser Met Ser Gln Val Asp Val Asp Ser Gly Ile Glu Asn 115 120 125 Met Glu Val Asp Glu Asn Asp Arg Arg Glu Lys Arg Ser Leu Ser Asp 130 135 140 Lys Glu Pro Ser Ser Gly Pro Glu Val Ser Glu Glu Gln Ala Leu Gln 145 150 155 160 Leu Val Cys Lys Ile Phe Arg Val Ser Trp Lys Asp Arg Asp Arg Asp 165 170 175 Val Ile Phe Leu Ser Ser Leu Ser Ala Gln Phe Lys Gln Asn Pro Lys 180 185 190 Glu Val Phe Ser Asp Phe Lys Asp Leu Ile Gly Gln Ile Leu Met Glu 195 200 205 Val Leu Met Met Ser Thr Gln Thr Arg Asp Glu Asn Pro Phe Ala Ser 210 215 220 Leu Thr Ala Thr Ser Gln Pro Ile Ala Ala Ala Ala Arg Ser Pro Asp 225 230 235 240 Arg Asn Leu Leu Leu Asn Thr Gly Ser Asn Pro Gly Thr Ser Pro Met 245 250 255 Phe Cys Ser Val Ala Ser Phe Gly Ala Ser Ser Leu Ser Ser Leu Tyr 260 265 270 Glu Ser Ser Pro Ala Pro Thr Pro Ser Phe Trp Ser Ser Val Pro Val 275 280 285 Met Gly Pro Ser Leu Ala Ser Pro Ser Arg Ala Ala Ser Gln Leu Ala 290 295 300 Val Pro Ser Thr Pro Leu Ser Pro His Ser Ala Ala Ser Gly Thr Ala 305 310 315 320 Ala Gly Ser Gln Pro Ser Ser Pro Arg Tyr Arg Pro Tyr Thr Val Thr 325 330 335 His Pro Trp Ala Ser Ser Gly Val Ser Ile Leu Ser Ser Ser Ser Pro Ser 340 345 350 Pro Pro Ala Leu Ala Ser Ser Pro Gln Ala Val Pro Ala Ser Ser Ser 355 360 365 Arg Gln Arg Pro Ser Ser Thr Gly Pro Pro Leu Pro Pro Ala Ser Pro 370 375 380 Ser Ala Thr Ser Arg Arg Pro Ser Ser Leu Arg Ile Ser Pro Ser Leu 385 390 395 400 Gly Ala Ser Gly Gly Ala Ser Asn Trp Asp Ser Tyr Ser Asp His Phe 405 410 415 Thr Ile Glu Thr Cys Lys Glu Thr Asp Met Leu Asn Tyr Leu Ile Glu 420 425 430 Cys Phe Asp Arg Val Gly Ile Glu Glu Lys Lys Ala Pro Lys Met Cys 435 440 445 Ser Gln Pro Ala Val Ser Gln Leu Leu Ser Asn Ile Arg Ser Gln Cys 450 455 460 Ile Ser His Thr Ala Leu Val Leu Gln Gly Ser Leu Thr Gln Pro Arg 465 470 475 480 Ser Leu Gln Gln Pro Ser Phe Leu Val Pro Tyr Met Leu Cys Arg Asn 485 490 495 Leu Pro Tyr Gly Phe Ile Gln Glu Leu Val Arg Thr Thr His Gln Asp 500 505 510 Glu Glu Val Phe Lys Gln Ile Phe Ile Pro Ile Leu Gln Gly Leu Ala 515 520 525 Leu Ala Ala Lys Glu Cys Ser Leu Asp Ser Asp Tyr Phe Lys Tyr Pro 530 535 540 Leu Met Ala Leu Gly Glu Leu Cys Glu Thr Lys Phe Gly Lys Thr His 545 550 555 560 Pro Val Cys Asn Leu Val Ala Ser Leu Arg Leu Trp Leu Pro Lys Ser 565 570 575 Leu Ser Pro Gly Cys Gly Arg Glu Leu Gln Arg Leu Ser Tyr Leu Gly 580 585 590 Ala Phe Phe Ser Phe Ser Val Phe Ala Glu Asp Asp Val Lys Val Val 595 600 605 Glu Lys Tyr Phe Ser Gly Pro Ala Ile Thr Leu Glu Asn Thr Arg Val 610 615 620 Val Ser Gln Ser Leu Gln His Tyr Leu Glu Leu Gly Arg Gln Glu Leu 625 630 635 640 Phe Lys Ile Leu His Ser Ile Leu Leu Asn Gly Glu Thr Arg Glu Ala 645 650 655 Ala Leu Ser Tyr Met Ala Ala Val Val Asn Ala Asn Met Lys Lys Ala 660 665 670 Gln Met Gln Thr Asp Asp Arg Leu Val Ser Thr Asp Gly Phe Met Leu 675 680 685 Asn Phe Leu Trp Val Leu Gln Gln Leu Ser Thr Lys Ile Lys Leu Glu 690 695 700 Thr Val Asp Pro Thr Tyr Ile Phe His Pro Arg Cys Arg Ile Thr Leu 705 710 715 720 Pro Asn Asp Glu Thr Arg Val Asn Ala Thr Met Glu Asp Val Asn Asp 725 730 735 Trp Leu Thr Glu Leu Tyr Gly Asp Gln Pro Pro Phe Ser Glu Pro Lys 740 745 750 Phe Pro Thr Glu Cys Phe Phe Leu Thr Leu His Ala His His Leu Ser 755 760 765 Ile Leu Pro Ser Cys Arg Arg Tyr Ile Arg Arg Leu Arg Ala Ile Arg 770 775 780 Glu Leu Asn Arg Thr Val Glu Asp Leu Lys Asn Asn Glu Ser Gln Trp 785 790 795 800 Lys Asp Ser Pro Leu Ala Thr Arg His Arg Glu Met Leu Lys Arg Cys 805 810 815 Lys Thr Gln Leu Lys Lys Leu Val Arg Cys Lys Ala Cys Ala Asp Ala 820 825 830 Gly Leu Leu Asp Glu Ser Phe Leu Arg Arg Cys Leu Asn Phe Tyr Gly 835 840 845 Leu Leu Ile Gln Leu Leu Leu Arg Ile Leu Asp Pro Ala Tyr Pro Asp 850 855 860 Ile Thr Leu Pro Leu Asn Ser Asp Val Pro Lys Val Phe Ala Ala Leu 865 870 875 880 Pro Glu Phe Tyr Val Glu Asp Val Ala Glu Phe Leu Phe Phe Ile Val 885 890 895 Gln Tyr Ser Pro Gln Ala Leu Tyr Glu Pro Cys Thr Gln Asp Ile Val 900 905 910 Met Phe Leu Val Val Met Leu Cys Asn Gln Asn Tyr Ile Arg Asn Pro 915 920 925 Tyr Leu Val Ala Lys Leu Val Glu Val Met Phe Met Thr Asn Pro Ala 930 935 940 Val Gln Pro Arg Thr Gln Lys Phe Phe Glu Met Ile Glu Asn His Pro 945 950 955 960 Leu Ser Thr Lys Leu Leu Val Pro Ser Leu Met Lys Phe Tyr Thr Asp 965 970 975 Val Glu His Thr Gly Ala Thr Ser Glu Phe Tyr Asp Lys Phe Thr Ile 980 985 990 Arg Tyr His Ile Ser Thr Ile Phe Lys Ser Leu Trp Gln Asn Ile Ala 995 1000 1005 His His Gly Thr Phe Met Glu Phe Asn Ser Gly Lys Gln Phe Val 1010 1015 1020 Arg Tyr Ile Asn Met Leu Ile Asn Asp Thr Thr Phe Leu Leu Asp Glu 1025 1030 1035 1040 Ser Leu Glu Ser Leu Lys Arg Ile His Glu Val Gln Glu Glu Met Lys 1045 1050 1055 Asn Lys Glu Gln Trp Asp Gln Leu Pro Arg Asp Gln Gln Gln Ala Arg 1060 1065 1070 Gln Ser Gln Leu Ala Gln Asp Glu Arg Val Ser Arg Ser Tyr Leu Ala 1075 1080 1085 Leu Ala Thr Glu Thr Val Asp Met Phe His Ile Leu Thr Lys Gln Val 1090 1095 1100 Gln Lys Pro Phe Leu Arg Pro Glu Leu Gly Pro Arg Leu Ala Ala Met 1105 1110 1115 1120 Leu Asn Phe Asn Leu Gln Gln Leu Cys Gly Pro Lys Cys Arg Asp Leu 1125 1130 1135 Lys Val Glu Asn Pro Glu Lys Tyr Gly Phe Glu Pro Lys Lys Leu Leu 1140 1145 1150 Asp Gln Leu Thr Asp Ile Tyr Leu Gln Leu Asp Cys Ala Arg Phe Ala 1155 1160 1165 Lys Ala Ile Ala Asp Asp Gln Arg S er Tyr Ser Lys Glu Leu Phe Glu 1170 1175 1180 Glu Val Ile Ser Lys Met Arg Lys Ala Gly Ile Lys Ser Thr Ile Ala 1185 1190 1195 1200 Ile Glu Lys Phe Lys Leu Leu Leu Ala Glu Lys Val Glu Ile Val Ala 1205 1210 1215 Lys Asn Ala Arg Ala Glu Ile Asp Tyr Ser Asp Ala Pro Asp Glu Phe 1220 1225 1230 Arg Asp Pro Leu Met Asp Thr Leu Met Thr Asp Pro Val Arg Leu Pro 1235 1240 1245 Ser Gly Thr Ile Met Asp Arg Ser Ile Ile Leu Arg His Leu Leu Asn 1250 1255 1260 Ser Pro Thr Asp Pro Phe Asn Arg Gln Thr Leu Thr Glu Ser Met Leu 1265 1270 1275 1280 Glu Pro Val Pro Glu Leu Lys Glu Gln Ile Gln Ala Trp Met Arg Glu 1285 1290 1295 Lys Gln Asn Ser Asp His 1300 <210> 2 <211> 5905 <212> DNA <213> Unknown <220> <223> UBE4B nucleotide <400> 2 ccctttcaaa gatggccgcc ctgttgtttt gatgaataat acttggtggg gcgaggggga 60 aagagtaggg gtggaggggt aggaggattt actcttccag cgagagctac gcgcatccca 120 tcctccccct cccccctacc cgggctccgg cgtggaggcg gggcgtggcc ggcctgcttt 180 gggaggggag gggcttccct tacagtgctg ggctctgcca ggacggctgt ggggtcgcct 240 tac ctcgggg tatccactct gcagtcgacc agttcccgcc aggagcaaag ggtaggaagg 300 agagcaggat ctgctgtagg aacgcagcta ccgcgccact atcacgaaga aacagcaggc 360 tcggggcacg agacgaactg gagaccgcgc tgcctagctg ggtaacctgg gaagcagagg 420 gtaataagtg gcgccttaag acaaccctgt agcagcagca gtggcggcca aaggaggctg 480 ctcagggaac aagcggctgt agtagtctgt ggggcgactg gagtgaccga agccaaggca 540 gtttagtgcc tctcgtgttc ttatttttta acctctgact atgcaattct gaaacctccc 600 ccattcgggg gaccagacag cctgatagac accttccact ctccttcctc ccgccgtggt 660 ctcgagaaca gaaggatctc tccttaacgc ctttcaccat taagaggaaa gcgatggagg 720 agctgagcgc tgatgagatt cgacggaggc gccttgcacg acttgctggt ggacagacct 780 ctcagccaac caccccactc acctctcccc agagggagaa ccctccgggg cctcccatag 840 cggcatcagc cccaggaccc tctcagagtc ttggtctcaa tgtccacaac atgaccccag 900 ctacctcccc aataggtgca tcaggagtag cccatcgaag ccagagcagt gaaggagtca 960 gttctctcag cagctcgccc tctaatagcc ttgaaacgca atctcagtct ctctcacgtt 1020 cccagagcat ggatatcgat ggtgtctcat gtgagaaaag catgtcccag gtggatgtgg 1080 attcaggaat tgaaaacatg gaggttgatg aaaatgatcg aagagaaaag cggagcctca 1140 gtgataagga gccttcctcg ggccctgaag tgtctgaaga gcaggcctta cagctggtct 1200 gtaagatctt ccgtgtctct tggaaggacc gggacagaga tgtcatcttt ctttcttctc 1260 tttctgcaca gtttaagcag aacccaaaag aagtattctc cgattttaag gacttgattg 1320 gccagatttt aatggaagtg ctaatgatgt ccactcagac cagagatgaa aacccatttg 1380 ccagtctgac agccacatca cagccaattg ctgcagcagc acggtcacca gacagaaatc 1440 tcttgctaaa cactggctcc aatccaggaa caagccccat gttctgcagc gtggcttcct 1500 ttggtgccag ctctttgtct agcctctatg aaagtagtcc ggctcccact cccagtttct 1560 ggagctctgt tcccgtgatg ggcccgtctc ttgcctcacc ttcccgtgca gccagccagt 1620 tggctgtgcc ttccactccc ctcagtcctc acagtgcagc ctctggaact gctgcgggaa 1680 gccagccttc atccccgcgg tatcgcccct acactgtcac tcacccatgg gcgtcctcag 1740 gcgtctccat tctgtcgagc tccccaagtc cccctgccct cgccagtagc ccccaagcag 1800 tgcccgccag cagttccaga cagaggccca gcagcacggg tccaccccta ccacccgcct 1860 cacccagtgc cacgagcaga cgcccctcct ccctgaggat ctctcctagt ttgggagcct 1920 ctggtggagc aagtaattgg gattc ctaca gtgaccattt caccattgaa acctgcaaag 1980 agacagatat gctgaactac ctcatcgagt gtttcgaccg agttggaata gaggaaaaaa 2040 aagcaccaaa gatgtgcagc cagccagcag tcagccagct tctgagcaac atccgctcac 2100 agtgcatatc ccatactgct ttagtactac aaggctccct aacacagccc aggtccttgc 2160 agcagccgtc cttcctagtg ccgtatatgc tgtgtaggaa tctcccatat ggcttcattc 2220 aggaactggt gagaaccact caccaggatg aagaagtgtt caagcagata tttatcccca 2280 ttttacaagg cctggctctt gctgccaaag agtgctccct cgacagtgac tactttaaat 2340 accccctcat ggcactaggt gagctctgtg aaaccaagtt tgggaagaca caccctgtgt 2400 gcaatttggt tgcttctttg cggttgtggt tgccgaaatc cttaagtcct ggctgtgggc 2460 gggagctgca gagactctct tacttagggg ctttctttag cttctcagtc tttgcagaag 2520 atgatgttaa agtggttgaa aaatacttct cagggcctgc cattaccctg gaaaacactc 2580 gtgtggttag ccaatcattg cagcattact tagagctcgg aaggcaagag ctttttaaga 2640 ttctgcatag tattttgtta aatggcgaaa cccgtgaggc tgctctcagt tacatggcgg 2700 ctgtcgtcaa tgccaatatg aagaaagcac agatgcagac agatgataga ttggtgtcta 2760 cagatggatt tatgctgaat ttcctttggg tactgcagca gctaagtaca aaaatcaagt 2820 tagaaacagt tgatcccacg tatatttttc acccaagatg tcggattact cttcccaatg 2880 atgagacgcg tgtgaatgca acgatggaag atgtgaatga ctggctgact gaactctatg 2940 gcgatcagcc tccattttct gagccgaaat tccctacgga gtgcttcttt ctcaccctgc 3000 atgctcacca cctctctatt ctgcctagtt gccgtcgcta tatccgcaga ctccgggcta 3060 tccgggagct caatagaact gtagaagatt tgaaaaataa tgaaagccaa tggaaagatt 3120 ccccactggc aactagacac cgcgaaatgc tgaagcgctg taaaactcag cttaagaaac 3180 tggtacggtg caaggcctgt gctgatgctg gcctacttga cgagagcttc ctgagaagat 3240 gtctgaattt ttatggcctt ctcattcagc tgctgctccg catcctggac cccgcatatc 3300 ccgatataac actgccttta aattcagatg tccccaaggt atttgcagcg ttgcctgagt 3360 tttatgtaga agatgttgca gaatttttat tttttattgt acaatactct ccccaggcgc 3420 tttatgagcc ctgtactcag gatattgtga tgttccttgt tgtgatgttg tgcaaccaga 3480 actacatccg aaacccatat ttggtggcca aactggtaga agtcatgttt atgaccaacc 3540 ctgctgttca gccacgaacc cagaagtttt ttgaaatgat tgagaaccat cctctctcca 3600 ccaagttgtt ggtaccttcc ctgatgaagt tttata caga tgttgagcat accggagcca 3660 ccagtgagtt ttatgacaag ttcacaattc gctatcatat tagcaccatt tttaaaagcc 3720 tttggcaaaa catagctcac catggcacct ttatggagga gttcaactcc gggaagcagt 3780 ttgttcgcta tataaacatg ttgataaacg acacgacgtt tttgctcgat gaaagtctgg 3840 agtctctgaa gcgaatccat gaagtgcagg aagagatgaa gaacaaagaa cagtgggacc 3900 agttgccccg ggatcagcag caggctcgtc agtctcagct tgctcaggat gagcgtgtgt 3960 cccgctctta cctcgccctg gccaccgaaa ccgtggacat gttccacatc ctcacgaagc 4020 aggtccagaa gcccttcctc agaccggagc ttggaccccg attggctgca atgctgaact 4080 ttaatcttca gcaactttgt ggccccaagt gccgtgacct gaaagttgaa aaccctgaga 4140 aatacggctt tgaaccaaag aagctgttgg accaactgac ggatatttac ttacagctgg 4200 actgtgctcg gttcgcgaaa gccattgctg acgaccagag atcctacagt aaggaattgt 4260 ttgaagaagt tatttcaaag atgcggaagg cagggatcaa atccacaata gcaatagaaa 4320 aatttaagct gctcgccgag aaagtggagg agatagtggc caagaacgca cgcgcagaaa 4380 tcgactacag cgacgctcct gatgagttca gagaccctct gatggacacc ctcatgacag 4440 accccgtgcg gctgccctct ggcaccatca tggaccgctc c atcatcctg cggcacctgc 4500 tcaactcccc cacggacccc ttcaaccggc agacgctgac agagagcatg ctggaaccag 4560 tgccagaact gaaagagcag attcaggcgt ggatgagaga gaaacagaac agcgatcact 4620 aaaccgttcc gccgcccacc ctctgctaga cacagccaag gccaacgagg caagcagaag 4680 cagcggccgc agcgaagctg ccgttcatgt gttggaggcc aaatgtggca aaccaacccc 4740 aggcccaccc agagcgagca aacgctgaga cctgaaagga catggatgag aagaggagcc 4800 cgcttcctgt acatatattt aagtgacaaa cacggtcaaa agcttaaggg acaggtttta 4860 tggttgcttg tgtaataaag catgtccttc gtatgtcaca gtttggggca acggaagtct 4920 tttagtgatg gctaatgggt ctgggcagca tcccttcatg aatttttttt taatccaata 4980 tccgttgatt tgattgtgat tagagaacct tggacatttt gctgctaaag aatctttttt 5040 cccctctccc ccttcctgac cctacttgca ctgctgtgga tttttttaag agaagcaaaa 5100 acaaaagtaa actcctttcc ctggccctcc aaacatatat tctgtgagat aactgtgcct 5160 gctaccaagt gttaatcctg ggatcgtatt tttatatcat attcacatat ttgttttttt 5220 aattggtgtt agatgacatg attaataaaa aaggcaagat attttcagaa tttgaatttc 5280 agtttttttt ttcttttgaa atgtcccttt aagatttttt tattcta aac aaaataaaga 5340 aaatcctgct gctctggtcc ttgtgataag cctctcttcg gcatctgagg agcagctgca 5400 gcaaaatcta ggggtgtaag tgtatcagga cttatgtgac ttatattttg gggagatgag 5460 ggttgggttt tttttttaat gctacgtgac agtttgaaac cttcacagtt atcctctggg 5520 ggtaaatcaa ttcttcaacc cttgggtgtg tgagtttgag gcagggtcat ttgtgtgatg 5580 tgtttggcct taccaaagca aaagagggtg caagaatgtg ggagtatgtc tgccggtttc 5640 aacacacaca gacaaacaca gccacacgcg cacacaagta taagactttt tgtattactg 5700 ctccctactt aacatacttg aattctcaaa tttcctttgg ggtaaaaaaa aaaaaaggat 5760 ttgaaaccat aaagtgttct gaagaaatta agtctataaa aagcatactt tcttttttct 5820 tttccttttt tccctccaca gacaatgtcc tctgttcaat tcctaacgca aactacaata 5880 aatggtgaca cacgttcaga agaaa 5905 <210> 3 <211> 303 <212> PRT <213> Unknown <220> <223> STUB1 protein <400> 3 Met Lys Gly Lys Glu Glu Lys Glu Gly Gly Ala Arg Leu Gly Ala Gly 1 5 10 15 Gly Gly Ser Pro Glu Lys Ser Pro Ser Ala Gln Glu Leu Lys Glu Gln 20 25 30 Gly Asn Arg Leu Phe Val Gly Arg Lys Tyr Pro Glu Ala Ala Ala Cys 35 40 4 5 Tyr Gly Arg Ala Ile Thr Arg Asn Pro Leu Val Ala Val Tyr Tyr Thr 50 55 60 Asn Arg Ala Leu Cys Tyr Leu Lys Met Gln Gln His Glu Gln Ala Leu 65 70 75 80 Ala Asp Cys Arg Arg Ala Leu Glu Leu Asp Gly Gln Ser Val Lys Ala 85 90 95 His Phe Phe Leu Gly Gln Cys Gln Leu Glu Met Glu Ser Tyr Asp Glu 100 105 110 Ala Ile Ala Asn Leu Gln Arg Ala Tyr Ser Leu Ala Lys Glu Gln Arg 115 120 125 Leu Asn Phe Gly Asp Asp Ile Pro Ser Ala Leu Arg Ile Ala Lys Lys 130 135 140 Lys Arg Trp Asn Ser Ile Glu Glu Arg Arg Ile His Gln Glu Ser Glu 145 150 155 160 Leu His Ser Tyr Leu Ser Arg Leu Ile Ala Ala Glu Arg Glu Arg Glu 165 170 175 Leu Glu Glu Cys Gln Arg Asn His Glu Gly Asp Glu Asp Asp Ser His 180 185 190 Val Arg Ala Gln Gln Ala Cys Ile Glu Ala Lys His Asp Lys Tyr Met 195 200 205 Ala Asp Met Asp Glu Leu Phe Ser Gln Val Asp Glu Lys Arg Lys Lys 210 215 220 Arg Asp Ile Pro Asp Tyr Leu Cys Gly Lys Ile Ser Phe Glu Leu Met 225 230 235 240 Arg Glu Pro Cys Ile Thr Pro Ser Gly Ile Thr Tyr Asp Arg Lys Asp 245 250 255 Ile Glu Glu His Leu Gln Arg Val Gly His Phe Asp Pro Val Thr Arg 260 265 270 Ser Pro Leu Thr Gln Glu Gln Leu Ile Pro Asn Leu Ala Met Lys Glu 275 280 285 Val Ile Asp Ala Phe Ile Ser Glu Asn Gly Trp Val Glu Asp Tyr 290 295 300 <210> 4 <211> 1340 <212> DNA <213> Unknown <220> <223> STUB1 nucleotide <400> 4 ggagctgggc cgggcccgag cggatcgcgg gctcgggctg cggggctccg gctgcgggcg 60 ctgggccgcg aggcgcggag cttgggagcg gagcccaggc cgtgccgcgc ggcgccatga 120 agggcaagga ggagaaggag ggcggcgcac ggctgggcgc tggcggcgga agccccgaga 180 agagcccgag cgcgcaggag ctcaaggagc agggcaatcg tctgttcgtg ggccgaaagt 240 acccggaggc ggcggcctgc tacggccgcg cgatcacccg gaacccgctg gtggccgtgt 300 attacaccaa ccgggccttg tgctacctga agatgcagca gcacgagcag gccctggccg 360 actgccggcg cgccctggag ctggacgggc agtctgtgaa ggcgcacttc ttcctg gggc 420 agtgccagct ggagatggag agctatgatg aggccatcgc caatctgcag cgagcttaca 480 gcctggccaa ggagcagcgg ctgaacttcg gggacgacat ccccagcgct cttcgaatcg 540 cgaagaagaa gcgctggaac agcattgagg agcggcgcat ccaccaggag agcgagctgc 600 actcctacct ctccaggctc attgccgcgg agcgtgagag ggagctggaa gagtgccagc 660 gaaaccacga gggtgatgag gacgacagcc acgtccgggc ccagcaggcc tgcattgagg 720 ccaagcacga caagtacatg gcggacatgg acgagctttt ttctcaggtg gatgagaaga 780 ggaagaagcg agacatcccc gactacctgt gtggcaagat cagctttgag ctgatgcggg 840 agccgtgcat cacgcccagt ggcatcacct acgaccgcaa ggacatcgag gagcacctgc 900 agcgtgtggg tcattttgac cccgtgaccc ggagccccct gacccaggaa cagctcatcc 960 ccaacttggc tatgaaggag gttattgacg cattcatctc tgagaatggc tgggtggagg 1020 actactgagg ttccctgccc tacctggcgt cctggtccag gggagccctg ggcagaagcc 1080 cccggcccct atacatagtt tatgttcctg gccaccccga ccgcttcccc caagttctgc 1140 tgttggactc tggactgttt cccctctcag catcgctttt gctgggccgt gatcgtcccc 1200 ctttgtgggc tggaaaagca ggtgagggtg ggctgggctg aggccattgc cgccactatc 1260 tgtgta ataa aatccgtgag cacgaggtgg gacgtgctgg tgtgtgaccg gcagtcctgc 1320 cagctgtttt ggctagccga 1340 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RP49 F <400> 5 agggtatcga caacagag 20 <211g> 20 <212> DNA <213> Artificial Sequence <220> <223> RP49 R <400> 6 caccaggaac ttcttgaatc 20 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CG11070 F < 400> 7 gtagcagcga acccgcag 18 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CG11070 R <400> 8 aattcggttg acaggaaaaa 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> senseless F <400> 9 tggcagctaa acgtaccaaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> senseless R <400> 10 gatcgtataa ataaatgtgg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sNPFR1 F <400> 11 gggccatttc gcatatttac 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sNPFR1 R <400> 12 atttaattcc gtgcgactgg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tubulin F <400> 13 actgcagcat cctgtgaacc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tubulin R <400> 14 tgggaacatt tccgtttgat 20 <210 > 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> dme-miR-9a-5p <400> 15 ucuuugguua ucuagcugua uga 23 <210> 16 <211> 23 <212> DNA <213 > Artificial Sequence <220> <223> hsa-miR-9-5p <400> 16 ucuuugguua ucuagcugua uga 23 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mmu-miR -9-5p <400> 17 ucuuugguua ucuagcugua uga 23 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> dme-miR-9b-5p <400> 18 ucuuuggua uuuuagcugu aug 23 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> hsa-miR-9-5p <400> 19 ucuuugguua ucuagcugua uga 23 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mmu-miR-9-5p <400> 20 ucuuugguua ucuagcugua uga 23 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> dme -miR_9c-5p <400> 21 ucuuugguau ucuagcugua ga 22 <21 0> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> hsa-miR-9-5p <400> 22 ucuuugguua ucuagcugua uga 23 <210> 23 <211> 23 <212> DNA < 213> Artificial Sequence <220> <223> mmu-miR-9-5p <400> 23 ucuuugguua ucuagcugua uga 23 <210> 24 <211> 334 <212> DNA <213> Unknown <220> <223> Drosophila mir- 9a binding sequence <400> 24 ggtagcagcg aacccgcagc tgctggctca gttgcccaac caaagagtta gctccacggg 60 gattcggttg ttagggcaat aatcaatgtt tttttgttca taagaattcc agtcatacat 120 ggtggtatgt gtatgtgcag ttttataatt agtggttttt aaaatgtatt cttaatccat 180 tttttcctgt caaccgaatt aattaacaaa caatgtgtac gaataacatg caaaggataa 240 attattgtag tcatatttgg ttttgtgttc acaatatgtt tacatatatg tttaaataaa 300 cggcgtttcg ctgaaaaaat gtgtatattc aatt 334 <210> 25 <211> 839 <212 > DNA <213> Unknown <220> <223> Human E4B mir-9 binding sequence <400> 25 gacggggtgg gacggaggcg gggagaggac gcaggcgaga ggaactcggc ggcgcggcgc 60 ccgcggccta ttggctgcca cgtcccggcg ccagaagccc cgcctccctg acgggggtca 120 cgtgatccct ttcaaagatg gccgccctgt tgttttgatg aataatactt ggtggggcga 180 gggggaaaga gtaggggtgg aggggtagga ggatttactc ttccagcgag agctacgcgc 240 atcccatcct ccccctcccc cctacccggg ctccggcgtg gaggcggggc gtggccggcc 300 tgctttggga ggggaggggc ttcccttaca gtgctgggct ctgccaggac ggctgtgggg 360 tcgccttacc tcggggtatc cactctgcag tcgaccagtt cccgccagga gcaaagggta 420 ggaaggagag caggatctgc t gtaggaacg cagctaccgc gccactatca cgaagaaaca 480 gcaggctcgg ggcacgagac gaactggaga ccgcgctgcc tagctgggta acctgggaag 540 cagagggtaa taagtggcgc cttaagacaa ccctgtagca gcagcagtgg cggccaaagg 600 aggctgctca gggaacaagc ggctgtagta gtctgtgggg cgactggagt gaccgaagcc 660 aaggcagttt agtgcctctc gtgttcttat tttttaacct ctgactatgc aattctgaaa 720 cctcccccat tcgggggacc agacagcctg atagacacct tccactctcc ttcctcccgc 780cgtggtctcg agaacagaag gatctctcct taacgccttt caccattaag aggaaagcg 839

Claims (12)

A composition for removing Tau protein, comprising UBE4B (Ubiquitin conjugation E4 B) protein or a gene encoding the protein as an active ingredient.
The composition of claim 1 , wherein the composition reduces the level of tau protein.
The composition according to claim 1, wherein the composition reduces the phosphorylation level of tau protein.
The composition of claim 1, wherein the UBE4B protein consists of the amino acid sequence of SEQ ID NO: 1.
The composition of claim 1, wherein the composition further comprises a STUB1 protein or a gene encoding the protein.
The composition according to claim 5, wherein the STUB1 protein consists of the amino acid sequence of SEQ ID NO: 3.
A pharmaceutical composition for preventing or treating Tauopathy, comprising a UBE4B protein or a gene encoding the protein as an active ingredient.
The composition of claim 7, wherein the composition further comprises a STUB1 protein or a gene encoding the protein.
The composition according to claim 7, wherein the tauopathy is any one or more selected from the group consisting of Alzheimer's disease, Parkinson's disease, Lewy body dementia, Down's syndrome, and progressive supranuclear palsy (PSP).
A method for preventing or treating tauopathy, comprising administering a UBE4B protein or a composition containing a gene encoding the protein to a non-human subject.
The method of claim 10, wherein the composition further comprises a STUB1 protein or a gene encoding the protein.
The method of claim 10, wherein the tauopathy is any one or more selected from the group consisting of Alzheimer's disease, Parkinson's disease, Lewy body dementia, Down's syndrome, and progressive supranuclear palsy (PSP).

Images