KR20220150264A - Composition for detecting pathogen of sepsis and uses thereof - Google Patents

Abstract

The present invention relates to a composition for detecting sepsis causative bacteria including a primer set capable of detecting sepsis causative bacteria, a kit, a detection method, a composition for diagnosis or prognosis of sepsis, a kit or composition for detecting sepsis, and a method for providing information. When the composition for detecting sepsis causative bacteria of the present invention is used, it is possible to detect the main sepsis causative bacteria with rapid and high sensitivity. In particular, when the present invention is used for digital PCR, higher sensitivity and specificity can be provided compared to general TaqMan PCR or blood culture. In addition, the present invention can be used clinically and can be effectively used for sepsis diagnosis or prognosis prediction because it is possible to detect sepsis causative bacteria-related genes directly from the blood of suspected sepsis patients without a culture step.

Description

Composition for detecting pathogen of sepsis and uses thereof

The present invention relates to a composition, kit, and detection method for detecting a sepsis causative bacterium comprising a primer set capable of detecting a sepsis causative bacterium;

Bacterial bloodstream infection (BSI) is a life-threatening condition and remains one of the leading medical problems worldwide. Gram-negative bacteria that cause most BSI are the most common organisms causing high morbidity and mortality, and develop antimicrobial resistance. Sepsis, which may result from BSI, is most commonly seen in hospitalized patients with underlying conditions or symptoms susceptible to BSI, or in burns, trauma or surgery. In Korea, the incidence of sepsis is 347 per 100,000, which is three times that of myocardial infarction and 1.5 times that of stroke, and the mortality rate is 31% (9% of myocardial infarction and stroke mortality). In particular, it accounts for 60% of deaths in infants under the age of 5 worldwide and is the number one cause of death in intensive care units (ICUs) in Korea. My sepsis mortality rate is rather high at 31%.

In order to improve the clinical outcome of sepsis patients, rapid and accurate identification of the causative agent is essential. Currently, blood culture is the gold standard for identifying blood flow pathogens. With the introduction of an automated blood culture system, it has become possible to identify the causative agent more quickly and effectively. However, until recently, it usually takes more than 5 days and at least 24 hours to identify the causative organism and obtain the final sensitivity result, which inevitably leads to an unnecessary delay in administration of broad-spectrum antibiotics or appropriate antibiotics.

Recently, digital PCR (dPCR), called a third-generation PCR platform, has been developed, which has much higher sensitivity than existing PCR-based tools and is used to detect various causative bacteria and antibacterial resistance genes. However, no dPCR system has been found to cover or enable multiplex detection of major sepsis causing gram-negative causative organisms with antimicrobial resistance genes. As the prevalence of drug-resistant Gram-negative bacteria increases, it is important to efficiently identify them for successful management of BSI.

Korean Patent Laid-Open No. 10-2017-0003403 relates to a method for detecting food poisoning bacteria using digital PCR, and provides a primer set that can be used in digital PCR to detect food poisoning bacteria with higher sensitivity than real-time PCR.

However, there is no study or description of a digital PCR capable of detecting, in particular, multiple detection of a major causative organism causing sepsis or an antibacterial agent resistance gene in the causative organism.

Accordingly, the present inventors made diligent efforts to provide a PCR system that can quickly and sensitively detect the major causative bacteria causing sepsis. As a result, in the case of a multiplex digital PCR system using the primer set of the present invention and cell-free DNA of an individual, about 3 hours After confirming that the major sepsis causative bacteria can be directly detected in the blood of a patient without a culture step, the present invention has been completed.

Accordingly, it is an object of the present invention to provide a composition for detecting sepsis causative bacteria and various uses thereof.

In order to achieve the above object of the present invention, the present invention provides a first primer set comprising a pair of primers including the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2;

a second primer set comprising a pair of primers including the nucleotide sequence of SEQ ID NO: 4 and the nucleotide sequence of SEQ ID NO: 5;

a third primer set consisting of a pair of primers including the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 8;

a fourth primer set consisting of a pair of primers including the nucleotide sequence of SEQ ID NO: 10 and the nucleotide sequence of SEQ ID NO: 11; and

a fifth primer set consisting of a pair of primers including the nucleotide sequence of SEQ ID NO: 13 and the nucleotide sequence of SEQ ID NO: 14;

It provides a composition for detecting sepsis causative bacteria comprising any one or more primer sets selected from the group consisting of, or a composition for diagnosing sepsis or predicting prognosis comprising the same.

According to a preferred embodiment of the present invention, the primer set is used for PCR (polymerase chain reaction).

According to a preferred embodiment of the present invention, the PCR is quantitative PCR (qPCR), real-time PCR (real-time PCR), reverse transcription PCR (Reverse Transcription PCR, RT-PCR), solid phase PCR (Solid Phase PCR) , Competitive PCR, Overlap-extension PCR, Multiplex PCR, Nested PCR, Inverse PCR, Ligation-mediated PCR ), ISSR (Intersequence-specific PCR), Methylation-specific PCR (MSP), Colony PCR (colony PCR), Miniprimer PCR (Miniprimer PCR), Nanoparticle-Assisted PCR (nanoPCR), TAIL -PCR (Thermal asymmetric interlaced PCR), Touchdown (Step-down) PCR, Hot start PCR (Hot start PCR), In silico PCR (In silico PCR), Allele-specific PCR (allele-specific PCR) ), assembly PCR (Assembly PCR), asymmetric PCR (asymmetric PCR), dial-out PCR (Dial-out PCR), digital PCR (Digital PCR, dPCR) and from the group consisting of helicase-dependent amplification technology (helicasedependent amplification) It is more than any one selected.

According to a preferred embodiment of the present invention, the sepsis causative agent is Acinetobacter baumannii , Escherichia coli , Klebsiella pneumoniae , Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Shigella sonnei ), Staphylococcus aureus ), Streptococcus pyogenes ), Bacillus cereus ), Clostridium perfringens perfringens ), Enterococcus faecalis ), Salmonella enteritidis ( Salmonella enteritidis ) and Campylobacter jejuni ( Campylobacter jejuni ) It is any one or more selected from the group consisting of.

According to a preferred embodiment of the present invention, the detection limit of the composition is 1 ag/μl to 500 fg/μl.

According to a preferred embodiment of the present invention, the first primer set further comprises a probe comprising the nucleotide sequence of SEQ ID NO: 3;

The second primer set may additionally include a probe comprising the nucleotide sequence of SEQ ID NO: 6;

The third primer set additionally includes a probe comprising the nucleotide sequence of SEQ ID NO: 9;

The fourth primer set additionally includes a probe comprising the nucleotide sequence of SEQ ID NO: 12; and

The fifth primer set additionally includes a probe comprising the nucleotide sequence of SEQ ID NO: 15; will include

The present invention also provides a kit for detecting the causative bacteria of sepsis or a composition for diagnosing or predicting sepsis, comprising the composition for detecting the sepsis causative organism or the composition for diagnosing or predicting sepsis, and a reagent for PCR amplification reaction.

According to a preferred embodiment of the present invention, the PCR is quantitative PCR (qPCR), real-time PCR (real-time PCR), reverse transcription PCR (Reverse Transcription PCR, RT-PCR), solid phase PCR (Solid Phase PCR) , Competitive PCR, Overlap-extension PCR, Multiplex PCR, Nested PCR, Inverse PCR, Ligation-mediated PCR ), ISSR (Intersequence-specific PCR), Methylation-specific PCR (MSP), Colony PCR (colony PCR), Miniprimer PCR (Miniprimer PCR), Nanoparticle-Assisted PCR (nanoPCR), TAIL -PCR (Thermal asymmetric interlaced PCR), Touchdown (Step-down) PCR, Hot start PCR (Hot start PCR), In silico PCR (In silico PCR), Allele-specific PCR (allele-specific PCR) ), assembly PCR (Assembly PCR), asymmetric PCR (asymmetric PCR), dial-out PCR (Dial-out PCR), digital PCR (Digital PCR, dPCR) and from the group consisting of helicase-dependent amplification technology (helicasedependent amplification) It is more than any one selected.

The present invention also comprises the steps of: i) obtaining a biological sample from a subject suspected of sepsis;

ii) isolating cell free DNA from the biological sample obtained in step i); and

iii) detecting a bacterium causing sepsis using the cell-free DNA obtained in step ii) and the composition of claim 1;

It provides a method for detecting sepsis causative bacteria including a method to provide information for diagnosing sepsis or predicting a prognosis.

According to a preferred embodiment of the present invention, the biological sample of step i) is at least one selected from the group consisting of blood, urine, cerebrospinal fluid and saliva.

According to a preferred embodiment of the present invention, the blood is obtained from central vessels or peripheral vessels of an individual.

According to a preferred embodiment of the present invention, the detection of step iii) is to detect using PCR (polymerase chain reaction).

According to a preferred embodiment of the present invention, the PCR is quantitative PCR (qPCR), real-time PCR (real-time PCR), reverse transcription PCR (Reverse Transcription PCR, RT-PCR), solid phase PCR (Solid Phase PCR) , Competitive PCR, Overlap-extension PCR, Multiplex PCR, Nested PCR, Inverse PCR, Ligation-mediated PCR ), ISSR (Intersequence-specific PCR), Methylation-specific PCR (MSP), Colony PCR (colony PCR), Miniprimer PCR (Miniprimer PCR), Nanoparticle-Assisted PCR (nanoPCR), TAIL -PCR (Thermal asymmetric interlaced PCR), Touchdown (Step-down) PCR, Hot start PCR (Hot start PCR), In silico PCR (In silico PCR), Allele-specific PCR (allele-specific PCR) ), assembly PCR (Assembly PCR), asymmetric PCR (asymmetric PCR), dial-out PCR (Dial-out PCR), digital PCR (Digital PCR, dPCR) and from the group consisting of helicase-dependent amplification technology (helicasedependent amplification) It is more than any one selected.

When using the composition for detecting sepsis causative bacteria of the present invention, it is possible to quickly and with high sensitivity to detect the main causative bacteria of sepsis. In particular, when used for digital PCR, high sensitivity and specificity compared to general TaqMan PCR or blood culture diagram can be provided. In addition, it can be used clinically and can be effectively used for sepsis diagnosis or prognosis prediction because it can detect sepsis causative bacteria-related genes directly from the blood of a patient suspected of sepsis without a culture step.

1 shows a scatter plot of singleplex digital PCR (PCR) for each target. (A) A. baumannii standard strain (ATCC 19606) specifically detected by the ompA primer-VIC probe set (x-axis, red); (B) P. aeruginosa standard strain (ATCC 27853) detected by the ecfX primer-FAM probe set (y-axis, blue); (C) K. pneumoniae standard strain (KCTC 12385) detected by phoE primer-VIC probe set (x-axis, red); (D and E) E. coli standard strain (ATCC 25922) detected by the uidA primer-VIC (x-axis, red) and lacY primer-FAM (y-axis, blue) probe sets; (F and G) S. sonnei standard strain (ATCC 19585) was uidA positive but lacY negative. The yellow dots on the scatterplot do not represent target-specific signals.
Figure 2 shows the target-specific identification result of the antimicrobial resistance gene by a single digital PCR (singleplex digital PCR). (A and B) bla _TEM and bla CTX-M specifically detected by bla _TEM primer-VIC (x-axis, red) and bla CTX _{- M} group 1 primer-FAM probe set (y-axis, blue) _-15 gene E. coli isolate, cm241; (C) bla _IMP-type gene detected by the bla _IMP-type primer-FAM probe set (y-axis, blue) from P. aeruginosa isolate cmPA-1; (D) bla NDM-1 detected by the bla NDM _-1 primer-VIC probe set (x-axis, red) from E. coli isolate cmEC- ₁ ; (E and F) In E. coli isolate cm66, the bla _TEM gene was detected, but the bla _CTX-M group 1 gene was not.
3 shows the detection limits of A. baumannii . (A) X-axis represents the red fluorescence amplitude of the A. baumannii specific ompA primer-VIC probe signal by dPCR; (B) Shows TaqMan qPCR amplification curves using 50 pg/μl, 500 fg/μl, 5 fg/μl DNA isolated from A. baumannii (ATCC 19606).
4 shows double identification of target genes by digital PCR. (A) uidA (x-axis, red) and lacY (y-axis, blue) genes specifically identified in duplex conditions from E. coli standard strain (ATCC 25922); (B) ecfX (y-axis, blue) and phoE (x-axis, red) genes identified from a DNA mixture of P. aeruginosa and K. pneumoniae ; (C) ompA (x-axis, red) and ecfX (y-axis, blue) genes identified from a DNA mixture of A. baumannii and P. aeruginosa ; (D) bla _TEM-type (x-axis, red) and bla _CTX-M group 1 (y-axis, blue) genes identified from E. coli isolate cm241; (E) bla _IMP-type (y-axis, blue) and bla _NDM-1 (x-axis, red) genes identified from the DNA mixture of P. aeruginosa cmPA-1 and E. coli cmEC-1 isolates.
5 shows the detection result of a gram-negative causative organism in the blood of a sepsis patient by duplex digital PCR. (A) E. coli specific genes, uidA (x-axis, red) and lacY (y-axis, blue) detected by double dPCR from 18-C samples; (B) ecfX (y-axis, blue) and phoE (x-axis, red) P. aeruginosa specific ecfX genes detected by double dPCR from 6-C samples; (C) EcfX (y-axis, blue) and phoE (x-axis, red) K. pneumonia -specific phoE gene detected by double dPCR from 36-C sample; (D) bla _TEM-type (x-axis, red) and bla _CTX-M group 1 (y-axis, blue) genes detected from 18-C samples; (E) bla _IMP-type genes detected by double dPCR of bla _IMP-type (y-axis, blue) and bla _NDM-1 (x-axis, red) from 6-C sample; (F) No antibacterial resistance gene was detected in the 36-C sample.

Hereinafter, the present invention will be described in more detail.

'Digital polymerase chain reaction (dPCR)' of the present invention is a new approach to detect and quantify nucleic acids, and enables accurate quantitative analysis and high-sensitivity detection of target nucleic acid molecules compared to conventional PCR. Contrary to the fact that the conventional PCR result analysis method is an analog method, in dPCR, the result signal has a value of “0” or “1” and the analysis method is digital. can In addition, dPCR enables absolute quantification of DNA samples by applying a single-molecule counting method that does not require a standard curve, so it has the advantage of performing more accurate absolute quantification with a PCR reaction for one droplet per well. .

The 'primer and probe set (primer/probe set)' of the present invention means that three sequences of a forward primer, a reverse primer and a probe are configured as one set. In the present invention, the first to fifth primer sets refer to a set including a probe including the nucleotide sequence of SEQ ID NO: 3, 6, 9, 12 or 15, respectively.

'singleplex dPCR' of the present invention means digital PCR using one set of primers (and probes), and 'duplex dPCR' is digital PCR using two sets of primers (and probes). Meaning, 'multiplex dPCR (multiplex dPCR)' refers to digital PCR using a plurality of primer (and probe) sets.

The 'primer' of the present invention is a nucleic acid sequence having a short free 3' hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for template strand copying. refers to a nucleic acid sequence. That is, the primers are single-stranded capable of initiating template-directed DNA synthesis under appropriate conditions (e.g., four different nucleoside triphosphates and a polymerase such as DNA, DNA polymerase enzyme) and appropriate temperature in an appropriate buffer. oligonucleotides.

In the broad sense of the present invention, “diagnosis” refers to judging the actual condition of a patient's disease in all aspects. The content of the judgment is the disease name, etiology, disease type, severity, detailed mode of the disease, and the presence or absence of complications. Diagnosis in the present invention is preferably to determine the risk of sepsis and its onset caused by bacterial bloodstream infection.

The term 'prognosis' of the present invention refers to prediction of disease progression and recovery, and refers to a prospect or a preliminary evaluation. In the present invention, the prognosis means sepsis recurrence, overall survival, or disease-free survival. Prediction of prognosis (or diagnosis of prognosis) can provide clues for future sepsis treatment, including whether or not chemotherapy is used in early sepsis patients, and also includes prediction of the patient's response to sepsis treatment and treatment progress.

The 'limit of detection' of the present invention means the minimum amount of DNA capable of detecting a specific sepsis causative agent.

As described above, the conventional blood culture method used to detect sepsis causative bacteria takes 18 to 24 hours, so it takes too long to diagnose sepsis. There is a need for a method for rapidly diagnosing or predicting sepsis for more effective sepsis prevention or treatment.

We constructed a digital PCT (dPCR) primer/probe set that targets the major gram-negative pathogens that cause sepsis. For P. aeruginosa , ecfX, gyrB, oprI, algD, toxA and 16s rRNA genes were proposed as candidates. Among them, the ecfX gene was experimentally confirmed and selected as an appropriate target for P. aeruginosa -specific identification. For E. coli , a probe targeting the uidA gene encoding β-glucuronidase, a universal E. coli target, was designed. However, due to the genetic similarity between E. coli and Shigella spp., uidA alone cannot distinguish E. coli from Shigella spp. Therefore, a probe targeting lacY , an E. coli -specific gene encoding lactose permease, was additionally prepared. In the case of K. pneumoniae , a specific phoE gene was selected. In the case of A. baumannii , the ompA gene, which was specific for it and whose sensitivity and specificity were experimentally confirmed through real-time PCR, was selected. In addition, dPCR primer/probe sets were prepared for four major drug resistance genes (bla _TEM-type , bla _CTX-M group 1, bla _IMP-type , and bla _NDM-1 ). The suitability of the primer/probe set of the present invention was confirmed using a single dPCR (Example 1 and Example 2).

The minimum detection limit of dPCR using the primer/probe set of the present invention was 50 ag, which was 10 ⁴ times more sensitive than real-time qPCR (500 fg) (Example 3). In principle, the amount of genomic DNA in one E. coli cell is about 0.017 pg, which means that dPCR can detect less than 1 CFU/mL of the causative agent in blood. If the causative agent of 1-100 CFU/ml is present in the blood of an adult bacterial bloodstream infection (BSI) patient, the dPCR system of the present invention is sufficiently sensitive to detect sepsis causative bacteria or antimicrobial resistance genes in the early stages of BSI.

By mixing the target-specific primer/probe set of the present invention with 2 (VIC or FAM) different dyes, all 9 targets could be detected by 5 double dPCR reactions and the total reaction time was less than 3 hours ( Example 4). This means that the entire procedure of dPCR from blood sampling to final interpretation took less than 3 hours, which means that sepsis can be quickly diagnosed or predicted. The FAM and VIC are fluorescent dyes used for oligonucleotide (primer/probe) labeling. When the primer/probe is properly combined with the sequence of the target strain, it can be detected by causing the FAM or VIC fluorescent dye to emit blue or red light, respectively.

In addition, the results of TaqMan real-time PCR (TaqMan PCR), which is the most commonly used PCR-based technology for detecting causative bacteria, or the results of clinically culturing the patient's blood were consistent with the results of the dual dPCR system of the present invention. % Indicates the detection sensitivity. In particular, 6 samples negative in TaqMan PCR or 7 samples negative in blood culture showed a causative agent-specific positive signal in double dPCR, which could be detected in blood culture because of the high sensitivity of the dPCR of the present invention. This means that the causative organism at a very low dose that is not present can be identified. Additionally, 5 of the 6 TaqMan PCR negative samples were positive in blood culture, indicating that the detection sensitivity of TaqMan PCR assay is not yet sufficient for clinical application. All negative control samples were negative for the causative agent in dPCR analysis, indicating 100% specificity of the dPCR system of the present invention (Example 5, Table 3).

Accordingly, the present invention provides a first primer set comprising a pair of primers including the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2;

a second primer set comprising a pair of primers including the nucleotide sequence of SEQ ID NO: 4 and the nucleotide sequence of SEQ ID NO: 5;

a third primer set consisting of a pair of primers including the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 8;

a fourth primer set consisting of a pair of primers including the nucleotide sequence of SEQ ID NO: 10 and the nucleotide sequence of SEQ ID NO: 11; and

a fifth primer set consisting of a pair of primers including the nucleotide sequence of SEQ ID NO: 13 and the nucleotide sequence of SEQ ID NO: 14;

It provides a composition for detecting sepsis causative bacteria comprising any one or more primer sets selected from the group consisting of.

The primer sets may be used in various methods capable of amplifying and detecting the gene of the causative agent of sepsis, but preferably those used in polymerase chain reaction (PCR).

The PCR is quantitative PCR (qPCR), real-time PCR (real-time PCR), reverse transcription PCR (Reverse Transcription PCR, RT-PCR), solid phase PCR (Solid Phase PCR), competitive PCR (Competitive PCR), overlap PCR (Overlap-extension PCR), Multiplex PCR, Nested PCR, Inverse PCR, Ligation-mediated PCR, Intersequence-specific PCR, Methylation-specific PCR (MSP), colony PCR (colony PCR), miniprimer PCR (Miniprimer PCR), nanoparticle-assisted PCR (nanoPCR), TAIL-PCR (Thermal asymmetric interlaced PCR), touch Touchdown (Step-down) PCR, Hot start PCR, In silico PCR, allele-specific PCR, Assembly PCR, Asymmetric PCR PCR (asymmetric PCR), dial-out PCR (Dial-out PCR), digital PCR (Digital PCR, dPCR), and helicase- may be any one or more selected from the group consisting of amplification technology (helicase-dependent amplification), but preferably For example, it may be digital PCR (dPCR).

The sepsis causative bacteria is a concept including all of the Gram-negative bacteria causing sepsis, but preferably Acinetobacter baumannii , Escherichia coli , Klebsiella pneumoniae , Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Shigella soine ( Shigella sonnei ), Staphylococcus aureus ( Staphylococcus aureus ), Streptococcus pyogenes ( Streptococcus pyogenes ), Clostridium cereus ( Bacillus cereus ), Bacillus cereus ( Bacillus cereus ) Perfringens ( Clostridium perfringens ), Enterococcus faecalis ( Enterococcus faecalis ), Salmonella enteritidis ( Salmonella enteritidis ) and Campylobacter jejuni ( Campylobacter jejuni ) It may be any one or more selected from the group consisting of. More preferably, Acinetobacter baumannii , Escherichia coli , Klebsiella pneumoniae , Pseudomonas aeruginosa, and Shigella soyne ( Pseudomonas aeruginosa ) sonnei ) may be any one or more selected from the group consisting of, more preferably Acinetobacter baumannii , Escherichia coli , Klebsiella pneumoniae , and Pseudomonas aeruginosa ( Pseudomonas aeruginosa ) It may be any one or more selected from the group consisting of.

The detection limit of the composition of the present invention may be 1 ag/μl to 500 fg/μl, preferably 20 ag/μl to 50 fg/μl, more preferably 40 ag/μl to 5 fg /μl.

The first primer set of the present invention may further include a probe comprising the nucleotide sequence of SEQ ID NO: 3;

The second primer set may additionally include a probe comprising the nucleotide sequence of SEQ ID NO: 6;

The third primer set additionally includes a probe comprising the nucleotide sequence of SEQ ID NO: 9;

The fourth primer set additionally includes a probe comprising the nucleotide sequence of SEQ ID NO: 12; and

The fifth primer set additionally includes a probe comprising the nucleotide sequence of SEQ ID NO: 15; may include.

The present invention may also provide a kit for detecting the bacteria causing sepsis, comprising the composition for detecting the bacteria causing sepsis, and a reagent for the PCR amplification reaction.

Since the PCR is the same as the PCR in which the composition for detecting the causative bacteria of sepsis can be used, the description is replaced with the description thereof.

The kit of the present invention may include DNA polymerase, dNTPs, a buffer, and the like to perform a PCR amplification reaction. The kit may also further comprise a user's guide setting out conditions for performing the optimal reaction. The handbook is a printout explaining how to use the kit, eg, how to prepare reverse transcription buffer and PCR buffer, and suggested reaction conditions. Instructions include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information published or provided through an electronic medium such as the Internet.

The present invention also comprises the steps of: i) obtaining a biological sample from a subject suspected of sepsis;

ii) isolating cell free DNA from the biological sample obtained in step i); and

iii) detecting a sepsis causative organism using the cell-free DNA obtained in step ii) and the composition for detecting the sepsis causative organism;

It can provide a method for detecting bacteria causing sepsis, including.

The subject of step i) of the present invention refers to all animals that can develop sepsis, including humans, and preferably refers to humans.

The biological sample of step i) of the present invention is preferably at least one selected from the group consisting of blood, urine, cerebrospinal fluid and saliva, but more preferably blood. The blood may be obtained from a central blood vessel or a peripheral blood vessel of the subject, and the blood may be plasma.

The detection of step iii) of the present invention may be detection using a polymerase chain reaction (PCR), and since the PCR is the same as the PCR in which the composition for detecting the causative bacteria of sepsis can be used, the description is replaced with the description thereof.

The present invention may also provide a composition for diagnosing sepsis or predicting a prognosis, including the composition for detecting the bacteria causing sepsis.

The present invention may also provide a kit for diagnosing sepsis or predicting prognosis, comprising the composition for diagnosing or predicting sepsis and a reagent for PCR amplification reaction.

Since the reagents for the PCR amplification reaction are the same as those that can be included in the kit for detecting the bacteria causing sepsis, the description is replaced with the description thereof.

The present invention also comprises the steps of: i) obtaining a biological sample from a subject suspected of sepsis;

ii) isolating cell free DNA from the biological sample obtained in step i); and

iii) detecting a sepsis causative organism using the cell-free DNA obtained in step ii) and the composition for detecting the sepsis causative organism;

It can provide an information providing method for diagnosing sepsis or predicting a prognosis, including.

Since the steps i) to iii) are the same as the steps included in the method for detecting the bacteria causing sepsis, the description is replaced with the description thereof.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it is obvious to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

bacterial strains

Gram-negative strains used in the present invention are shown in Table 1 below. Five reference strains were obtained from the American Type Culture Collection (VA, Manassas, VA) and the Korean Collection of Type Cultures (Jeongeup, South Korea), and 13 clinical strains (cm241, cm241, cm66, cmPA-1, cmEC-1, 13B-333, 13B-236, cmPA-2, cmPA-4, Aci_080004, Aci_080014, Aci_090023, Aci_090047 and Aci_090050) were obtained. Each of the 18 strains was incubated anaerobically at 37°C for 24 h on blood agar plates (Sigma-Aldrich, Darmstadt, Germany) and Luria-Bertani (LB) agar plates (BD, NJ Franklin Lakes). .

strain bell antimicrobial resistance gene ATCC 19606 Acinetobacter baumani
( Acinetobacter baumannii ) ATCC 25922 Escherichia coli
( Escherichia coli ) KCTC 12385 Krebsiella pneumoniae
( Klebsiella pneumoniae ) ATCC 27853 Pseudomonas aeruginosa
( Pseudomonas aeruginosa ) ATCC 1985 Shigella Soine
( Shigella sonnei ) cm241 Escherichia coli
( Escherichia coli ) TEM-type β-lactamase, CTX-M-1 group broad spectrum β-lactamase (CTX-M-15) cm66 Escherichia coli
( Escherichia coli ) TEM-type β-lactamase, CTX-M-1 group broad spectrum β-lactamase (CTX-M-9) cmPA-1 Pseudomonas aeruginosa
( Pseudomonas aeruginosa ) IMP metallo-β-lactamase-1 cmEC-1 Escherichia coli
( Escherichia coli ) New Delhi metallo-β-lactamase-1 13B-333 Krebsiella pneumoniae
( Klebsiella pneumoniae ) TEM-type β-lactamase, CTX-M-1 group broad spectrum β-lactamase (CTX-M-15) 13B-236 Krebsiella pneumoniae
( Klebsiella pneumoniae ) cmPA-2 Pseudomonas aeruginosa
( Pseudomonas aeruginosa ) IMP metallo-β-lactamase-1 cmPA-4 Pseudomonas aeruginosa
( Pseudomonas aeruginosa ) IMP metallo-β-lactamase-1 Aci_080004 Acinetobacter baumani
( Acinetobacter baumannii ) Aci_080014 Acinetobacter baumani
( Acinetobacter baumannii ) Aci_090023 Acinetobacter baumani
( Acinetobacter baumannii ) Aci_090047 Acinetobacter baumani
( Acinetobacter baumannii ) Aci_090050 Acinetobacter baumani
( Acinetobacter baumannii )

Primer and probe design for the detection of sepsis causative bacteria

The present inventors designed a digital PCR (dPCR) primer/probe set targeting the main cause of causative bacteria gram-negative sepsis by altering the causative agent-related sequence. In this case, in addition to detecting the gram-negative causative bacteria, it was attempted to confirm the presence of the antibacterial resistance gene in the causative bacteria.

Specifically, ompA for A. baumannii as shown in Table 2 below; ecfX for P. aeruginosa ; phoE for K. pneumoniae ; A dPCR primer/probe set targeting uidA and lacY for E. coli was constructed. The specificity of each primer/probe set was determined by performing a singleplex dPCR (dPCR) reaction to analyze four clinical isolates identified to encode resistance genes (Table 1). To detect the antibacterial resistance gene, TEM-type beta-lactamase (TEM-type beta-lactamase; bla _TEM-type ), CTX-M-1 group extended spectrum β-lactamase (CTX-M-1 group extended- spectrum beta-lactamase; bla _CTX-M group 1), New Delhi metallo-β-lactamase-1 (New Delhi metallo-beta-lactamase-1; bla _NDM-1 ) and IMP metallo-β-lactamase ( A primer/probe set for IMP metallo-beta-lactamse; bla _IMP-type ) was prepared by modifying the sequence identified in the previous study. The specificity of the hybridization sequence of each probe was confirmed using BLAST (http://blast.ncbi.nlm.nih.gov/). The Gibbs free energy (ΔG) of each probe sequence was determined using Mfold software (http://mfold.rna.albany.edu/?q=mfold/), and probes with ΔG≥0 were used in this study. Homology scores of primer/probe sets to resistance genes were calculated using Clustal Omega software (http://www.ebi.ac.uk/Tools/msa/clustalo/).

target gene probe Primer/probe sequence SEQ ID NO: A. baumanii ompA VIC F: ACGTAGTTCTTGGTGGTCACTTGA One R: AGGTCTTCAGTTAACTCTTGTGGTGT 2 P: CTCCTGTAGTAGAAGTTG 3 E. coli uidA VIC F: GGGCGAACAGTTCCTGATCA 4 R: TCATGACGACCAAAGCCAGTAA 5 P: CCACAAACCGTTCTAC 6 lacY FAM F: CTGGTCTGTTTCTGCTTCTTTAAGC 7 R: TGCCCGCCAGTACAGACA 8 P: ACTGGCGATGATTTT 9 K. pneumoniae phoE VIC F: TGCAGTACCAGGGTAAAAAACGA 10 R: CGCCGTCGCCGTTCT 11 P: CCGTGAAGCGAAGAA 12 P. aeruginosa ecfX FAM F: CCGCGCGCATTTCTTTT 13 R: CCAATGGTCGCGCAACA 14 P: CAGATCGCCCGCAAC 15 antimicrobial resistance
gene bla _TEM-type VIC F: TGCTGCCATAACCATGAGTGA 16 R: GGTCCTCCGATCGTTGTCA 17 P: TGCTGCCAACTTACT 18 bla _{CTX -M}
group 1 FAM F: GACGCTGGGTAAAGCATTGG 19 R: GGTATTGCCTTTCATCCATGTCA 20 P: ACAGCCAACGGGC 21 bla _NDM-1 VIC F: GACCGCCCAGATCCTCAA 22 R: CGCGACCGGCAGGTT 23 P: TGGATCAAGCAGGAGAT 24 bla _IMP-type FAM F: CGATCTATCCCCACGTATGCA 25 R: GGCTTGAACCTTACCGTCTTTTT 26 P: CTGAATTAACAAATGAACTGC 27

As a result, all sets showed target-specific signals as shown in [Fig. 1]. ATCC 19606, a standard strain for A. baumanii , was specifically detected by the ompA primer-VIC probe set (FIG. 1A). ATCC 27853 for P. aeruginosa and KCTC 12385 for K. pneumoniae were identified with the ecfX primer-FAM and phoE primer-VIC probe sets, respectively ( FIGS. 1B and C). ATCC 25922 against E. coli was specifically detected by both the uidA primer-VIC and lacY primer-FAM probe sets ( FIGS. 1D and E). However, only uidA was detected in ATCC 19585 of S. sonnei ( FIGS. 1F and G). When the causative agent-specific dPCR primer/probe set reacted with another causative agent such as a gram-positive causative organism, no signal was observed (data not shown).

In addition, as shown in [Fig. 2], two ESBL genes were successfully detected when the E. coil isolate cm241 encoding the bla _TEM and bla _CTX-M-15 genes was applied (Figs. 2A and 2B). The two MBL genes are specifically distinct from P. aeruginosa isolate cmPA-1 and E. coli isolate cmEC-1, respectively ( FIGS. 2C and 2D ). Another E. coli isolate cm66, known to produce CTX-M group 9 ESBL and bla _TEM enzymes, showed a bla _TEM signal but not a bla _CTX-M group 1 signal ( FIGS. 2E and F ). Other clinical strains also succeeded in detecting the corresponding gene using each target primer/probe.

Detection sensitivity

The detection sensitivity of the primer/probe set of the present invention is confirmed, and furthermore, the detection sensitivity of the dPCR system and the detection sensitivity of TaqMan real-time qPCR (qPCR) analysis, the most commonly used PCR-based technology for causative bacteria detection, are compared. wanted to

Specifically, the genomic DNA of A. baumannii standard strain (ATCC 19606) was subjected to 50 pg/μl, 5 pg/μl, 500 fg/μl, 50 fg/μl, 5 fg/μl, 500 ag/μl, 50 ag/μl and serial dilutions to 5 ag/μl and subjected to dPCR or qPCR.

dPCR experiments were performed using the QuantStudio 3D digital PCR system (Thermo Fisher Scientific) according to the manufacturer's recommendations and the methodology of previous studies. A final volume of 14.5 μl sample containing 7.2 μl of QuantStudio 3D Digital PCR Mastermix v2 (Thermo) 1 μl of genomic DNA, 0.75 μl of primer/probe set (final concentration of 900 nM/250 nM respectively) was loaded onto the chip and QuantStudio Sealed using a 3D digital chip loader. PCR was performed using a GeneAmp™ PCR System 9700 thermocycler (Applied Biosystems) using the following cycling protocol: 96 °C for 10 min, followed by 45 cycles of 60 °C for 2 min and 98 °C for 30 s, final elongation at 60 °C. 2 minutes. After amplification, the fluorescence signal was analyzed using QuantStudio™3D digital PCR software v3.0.

TaqMan qPCR was performed as a quantitative polymerase reaction using a ViiA™7 QuantStudio real-time PCR system (Thermo Fisher Scientific) with the following cycle protocol: initial denaturation at 95 °C for 10 min, 95 °C for 10 min. 45 cycles of amplification, 60 °C for 20 s, 72 °C for 20 s. The amplicon mixture contained 5 μl of TaqMan Fast Advanced Master Mix (Applied Biosystems, Waltham, MA), 0.5 μl of the same primer/probe set used for dPCR and 5 μl of cell-free DNA from the patient's blood. All qPCR reactions were performed in triplicate.

As a result, it was confirmed that the minimum limit of detection in dPCR was 50 ag, and in TaqMan qPCR, the minimum limit of detection was 500 fg (FIG. 3B). This indicated that the sensitivity of the dPCR assay was approximately 10 ⁴ times higher than that of the TaqMan qPCR assay.

Double identification of sepsis causative bacteria

After confirming the performance of the dPCR system in a singleplex manner, it was attempted to determine whether the causative agent could be specifically detected in a duplex condition without cross-reaction or interference between primer/probe sets.

Specifically, for dual dPCR, target-specific primer/probe sets were mixed with two different dyes (FAM and VIC dyes) and dPCR was performed using 25 pg/μl of each causative organism genomic DNA mixture per reaction.

As a result, as shown in [Fig. 4], when the uidA primer-VIC and lacY primer-FAM probe sets were used, both uidA and lacY genes were clearly detected in E. coli DNA under double reaction conditions (Fig. 4A). . For the double identification of P. aeruginosa and K. pneumoniae , the ecfX primer-FAM and phoE primer-VIC probe sets were applied. The ecfX- FAM and phoE -VIC signals were clearly detected in the dual reaction conditions (Fig. 4B). For the double identification of A. baumannii and P. aeruginosa , the ompA primer-VIC and ecfX primer-FAM probe sets were applied. Both signals were clearly detected under double reaction conditions (Fig. 4C). There was no interference in all double dPCR experiments. To exclude non-specific amplification, cross-reactivity between each primer/probe set and incomparable gram-negative causative bacteria DNA was confirmed. There was no non-specific signal for all combinations (data not shown).

In addition, in double dPCR combining bla _TEM-type primer-VIC and bla _CTX-M group 1 primer-FAM probe, E. coli encoding both bla _TEM-type and bla _CTX-M-15 genes for target-specific signals It was successfully detected from cm241 DNA (Fig. 4D). In another double dPCR with the combination of bla _IMP-type primer-VIC and bla _NDM-1 primer-FAM probe, IMP and NDM-1 from the DNA mixture of P. aeruginosa cmPA-1 and E. coli cmEC-1 isolates The gene signal was successfully detected ( FIG. 4E ).

Taken together, 9 targets (5 Gram-negative causative bacteria-specific targets and 4 antimicrobial resistance genes) were successfully identified by 5 double reactions. We incorporated dual dPCR conditions as described in Materials and Methods to minimize the overall procedure time from blood sampling to causative agent identification. Therefore, all five double dPCR reactions could be performed simultaneously and the whole procedure took less than 3 hours.

Detection of gram-negative pathogens in the blood of patients with sepsis

The ultimate goal of the present invention is to sensitively and rapidly detect major gram-negative causative organisms and drug resistance genes in the blood of sepsis patients.

Specifically, a total of 30 whole blood samples were collected from central vessels (C) or peripheral vessels (P) of each of 15 ferbile patients. Four sepsis-negative blood samples were collected as negative controls at St. Mary's Hospital in Seoul under the approval of the Institutional Review Board of the Catholic Medical Center (IRB no: KC16TNSI0999). Plasma was separated by centrifuging 5 ml of whole blood at 1,200 g for 5 minutes. Cell-free DNA (cfDNA) from plasma was extracted using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Venlo, Netherlands). The same dPCR process described above was performed using the QuantStudio 3D digital PCR system with cfDNA samples. A total of 30 cell-free DNA samples were subjected to duplicate dPCR (5 duplicate reactions per sample). The analysis results are shown in [Table 3] below, which indicates a positive (positive) causative agent of sepsis or its antimicrobial resistance gene. A '-' or negative means that no gene was detected.

blood sample dPCR TaqMan PCR blood culture 6-C ecfX bla _IMP-type ecfX , bla _IMP-type voice 6-P ecfX bla _IMP-type ecfX , bla _IMP-type P. aeruginosa , bla _IMP-type 18-C uidA , lacY bla _TEM-type , bla _CTX-M
group 1 uidA , lacY , bla _TEM-type ,
bla _CTX-M group 1 E. coli , bla _TEM-type ,
bla _CTX-M group 1 18-P uidA , lacY bla _TEM-type , bla _CTX-M
group 1 uidA , lacY , bla _TEM-type ,
bla _CTX-M group 1 E. coli , bla _TEM-type ,
bla _CTX-M group 1 22-C uidA , lacY bla _TEM-type , bla _CTX-M
group 1 - E. coli , bla _TEM-type ,
bla _CTX-M group 1 22-P uidA , lacY bla _TEM-type , bla _CTX-M
group 1 - voice 36-C phoE - - K. pneumoniae 36-P phoE - - K. pneumoniae 67-C uidA , lacY - uidA , lacY voice 67-P uidA , lacY - uidA , lacY voice 78-C uidA , lacY - uidA , lacY E. coli 78-P uidA , lacY - uidA , lacY E. coli 93-C uidA , lacY - - E. coli 93-P uidA , lacY - - E. coli 96-C uidA , lacY - uidA , lacY E. coli 96-P uidA , lacY - uidA , lacY E. coli 100-C uidA , lacY - uidA , lacY voice 100-P uidA , lacY - uidA , lacY voice 102-C uidA , lacY - uidA , lacY E. coli 102-P uidA , lacY - uidA , lacY E. coli 107-C uidA , lacY - uidA , lacY E. coli 107-P uidA , lacY - uidA , lacY E. coli 109-C uidA , lacY bla _TEM-type , bla _CTX-M
group 1 uidA , lacY , bla _TEM-type ,
bla _CTX-M group 1 E. coli , bla _TEM-type ,
bla _CTX-M group 1 109-P uidA , lacY bla _TEM-type , bla _CTX-M
group 1 uidA , lacY , bla _TEM-type ,
bla _CTX-M group 1 E. coli , bla _TEM-type ,
bla _CTX-M group 1 116-C uidA , lacY - uidA , lacY E. coli 116-P uidA , lacY - uidA , lacY E. coli 117-C uidA , lacY - uidA , lacY E. coli 117-P uidA , lacY - uidA , lacY voice 119-C uidA , lacY - uidA , lacY E. coli 119-P uidA , lacY - uidA , lacY E. coli sheep

As a result of the analysis, 23 of the blood samples were culture positive (20 for E. coli , 2 for K. pnuemoniae , 1 for P. aeruginosa ). All culture-positive causative organisms were consistently detected by double dPCR. The other 7 culture negative samples showed causative agent-specific signals in double dPCR (6 E. coli and 1 P. aeruginosa ). Regarding the antibacterial resistance gene, 8 samples were found to have genes by double dPCR analysis (6 genes bla _TEM-1 and bla _CTX-M group 1 and 2 genes bla _IMP-type ). Seven of the eight resistance genes identified by double dPCR were consistently identified by culture and TaqMan PCR analysis.

In addition, as shown in [Fig. 5], the AC in [Fig. 5] is E. coli ( uidA and lacY genes) identified by dPCR in patient blood samples (18-C, 6-C and 36-C). , P. aeruginosa ( ecfX ) and K. pnuemoniae ( phoE ) are shown. For comparison, real-time PCR analysis was also performed on the same sample. In TaqMan PCR analysis, 24 were positive for the causative agent (22 for E. coli and 2 for P. aeruginosa ) and were consistently detected by double dPCR. However, 5 out of 6 samples negative by TaqMan PCR were blood culture positive, meaning that the detection sensitivity of the TaqMan PCR assay may be lower than that of the culture assay.

The gene of one sample (22-P) was not detected by incubation or real-time PCR but was detected by double dPCR. DF of FIG. 5 shows examples of antimicrobial resistance genes identified from blood samples of patients (18-C, 6-C and 36-C, respectively) by double dPCR. In the 18-C sample, both bla _TEM-1 and bla _CTX-M group 1 genes were clearly detected ( FIG. 5D ). In the 6-C sample, the bla _IMP-type gene was detected ( FIG. 5E ). In the 36-C sample, no antimicrobial resistance gene was detected by double dPCR (Fig. 5F). In addition, it was confirmed that the causative bacteria-specific signal by double dPCR, TaqMan PCR and culture did not appear when blood samples from individuals without sepsis were irradiated as a negative control.

SEQUENCE LISTING <110> CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Composition for detecting pathogen of sepsis and uses thereof <130> 1072100 <160> 27 <170> PatentIn version 3.2 <210> 1 <211> 24 <212> DNA <213> <220> <223> A. baumanii_ompA_F <400> 1 acgtagttct tggtggtcac ttga 24 <210> 2 <211> 27 <212> DNA <213> <220> <223> A. baumanii_ompA_R <400> 2 aggtcttcag ttaactcttg tggttgt 27 <210> 3 <211> 18 <212> DNA <213> <220> <223> A. baumanii_ompA_P <400> 3 ctcctgtagt agaagttg 18 <210> 4 <211> 20 <212> DNA <213> <220> <223> E. coli_uidA_F <400> 4 gggcgaacag ttcctgatca 20 <210> 5 <211> 22 <212> DNA <213> <220> <223> E. coli_uidA_R <400> 5 tcatgacgac caaagccagt aa 22 <210> 6 <211> 16 <212> DNA <213> <220> <223> E. coli_uidA_P <400> 6 ccacaaaccg ttctac 16 <210> 7 <211> 25 <212> DNA <213> <220> <223> E. coli_lacY_F <400> 7 ctggtctgtt tctgcttctt taagc 25 <210> 8 <211> 18 <212> DNA <213> <220> <223> E. coli_lacY_R <400> 8 tgcccgccag tacagaca 18 <210> 9 <211> 15 <212> DNA <213> <220> <223> E. coli_lacY_P <400> 9 actggcgatg atttt 15 <210> 10 <211> 22 <212> DNA <213> <220> <223> K. pneumoniae_phoE_F <400> 10 tgcagtacca gggtaaaaac ga 22 <210> 11 <211> 15 <212> DNA <213> <220> <223> K. pneumoniae_phoE_R <400> 11 cgccgtcgcc gttct 15 <210> 12 <211> 15 <212> DNA <213> <220> <223> K. pneumoniae_phoE_P <400> 12 ccgtgaagcg aagaa 15 <210> 13 <211> 17 <212> DNA <213> <220> <223> P. aeruginosa_ecfX_F <400> 13 ccgcgcgcat ttctttt 17 <210> 14 <211> 17 <212> DNA <213> <220> <223> P. aeruginosa_ecfX_R <400> 14 ccaatggtcg cgcaaca 17 <210> 15 <211> 15 <212> DNA <213> <220> <223> P. aeruginosa_ecfX_P <400> 15 cagatcgccc gcaac 15 <210> 16 <211> 21 <212> DNA <213> <220> <223> blaTEM-type_F <400> 16 tgctgccata accatgagtg a 21 <210> 17 <211> 19 <212> DNA <213> <220> <223> blaTEM-type_R <400> 17 ggtcctccga tcgttgtca 19 <210> 18 <211> 15 <212> DNA <213> <220> <223> blaTEM-type_P <400> 18 tgctgccaac ttact 15 <210> 19 <211> 20 <212> DNA <213> <220> <223> blaCTX-M group 1_F <400> 19 gacgctgggt aaagcattgg 20 <210> 20 <211> 23 <212> DNA <213> <220> <223> blaCTX-M group 1_R <400> 20 ggtattgcct ttcatccatg tca 23 <210> 21 <211> 13 <212> DNA <213> <220> <223> blaCTX-M group 1_P <400> 21 acagccaacg ggc 13 <210> 22 <211> 18 <212> DNA <213> <220> <223> blaNDM-1_F <400> 22 gaccgcccag atcctcaa 18 <210> 23 <211> 15 <212> DNA <213> <220> <223> blaNDM-1_R <400> 23 cgcgaccggc aggtt 15 <210> 24 <211> 17 <212> DNA <213> <220> <223> blaNDM-1_P <400> 24 tggatcaagc aggagat 17 <210> 25 <211> 21 <212> DNA <213> <220> <223> blaIMP-type_F <400> 25 cgatctatcc ccacgtatgc a 21 <210> 26 <211> 23 <212> DNA <213> <220> <223> blaIMP-type_R <400> 26 ggcttgaacc ttaccgtctt ttt 23 <210> 27 <211> 21 <212> DNA <213> <220> <223> blaIMP-type_P <400> 27 ctgaattaac aaatgaactg c 21

Claims (16)

a fifth primer set consisting of a pair of primers including the nucleotide sequence of SEQ ID NO: 13 and the nucleotide sequence of SEQ ID NO: 14;
A composition for detecting sepsis causative bacteria comprising a.
The composition of claim 1, wherein the primer set is used for polymerase chain reaction (PCR).
According to claim 2, wherein the PCR is quantitative PCR (quantitative PCR, qPCR), real-time PCR (real-time PCR), reverse transcription PCR (Reverse Transcription PCR, RT-PCR), solid phase PCR (Solid Phase PCR), competitive PCR ( Competitive PCR), Overlap-extension PCR, Multiplex PCR, Nested PCR, Inverse PCR, Ligation-mediated PCR, ISSR ( Intersequence-specific PCR), Methylation-specific PCR (MSP), Colony PCR (colony PCR), Miniprimer PCR (Miniprimer PCR), Nanoparticle-Assisted PCR (nanoPCR), TAIL-PCR (Thermal asymmetric interlaced PCR), Touchdown (Step-down) PCR, Hot start PCR, In silico PCR, Allele-specific PCR, Assembly PCR (Assembly PCR), asymmetric PCR (asymmetric PCR), dial-out PCR (Dial-out PCR), digital PCR (Digital PCR, dPCR) and helicase- any one selected from the group consisting of amplification technology (helicasedependent amplification) A composition for detecting the causative bacteria of sepsis, characterized in that the above.
According to claim 1, wherein the causative bacteria of sepsis is Acinetobacter baumannii , Escherichia coli , Klebsiella pneumoniae , Pseudomonas aeruginosa , Shigella sonnei ( Shigella sonnei ), Staphylococcus aureus ( Staphylococcus aureus ), Streptococcus pyogenes ), Bacillus cereus ( Bacillus cereus ), Clostridium perfringens ( Clostridium perfringens ), Caucus faecalis ( Enterococcus faecalis ), Salmonella enteritidis ( Salmonella enteritidis ) and Campylobacter jejuni ( Campylobacter jejuni ) A composition for detecting sepsis causative bacteria, characterized in that at least one selected from the group consisting of.
[Claim 2] The composition for detecting sepsis causative bacteria according to claim 1, wherein the detection limit of the composition is 1 ag/μl to 500 fg/μl.
The method of claim 1, wherein the fifth primer set further comprises: a probe comprising the nucleotide sequence of SEQ ID NO: 15;
A composition for detecting sepsis causative bacteria comprising a.
A kit for detecting sepsis causative bacteria comprising the composition of claim 1 and a reagent for the PCR amplification reaction.
According to claim 7, wherein the PCR is quantitative PCR (quantitative PCR, qPCR), real-time PCR (real-time PCR), reverse transcription PCR (Reverse Transcription PCR, RT-PCR), solid phase PCR (Solid Phase PCR), competitive PCR ( Competitive PCR), Overlap-extension PCR, Multiplex PCR, Nested PCR, Inverse PCR, Ligation-mediated PCR, ISSR ( Intersequence-specific PCR), Methylation-specific PCR (MSP), Colony PCR (colony PCR), Miniprimer PCR (Miniprimer PCR), Nanoparticle-Assisted PCR (nanoPCR), TAIL-PCR (Thermal asymmetric interlaced PCR), Touchdown (Step-down) PCR, Hot start PCR, In silico PCR, Allele-specific PCR, Assembly PCR (Assembly PCR), asymmetric PCR (asymmetric PCR), dial-out PCR (Dial-out PCR), digital PCR (Digital PCR, dPCR) and helicase- any one selected from the group consisting of amplification technology (helicasedependent amplification) A kit for detecting bacteria causing sepsis, characterized in that the above.
i) obtaining a biological sample from a subject suspected of sepsis;
ii) isolating cell free DNA from the biological sample obtained in step i); and
iii) detecting a bacterium causing sepsis using the cell-free DNA obtained in step ii) and the composition of claim 1;
Sepsis causative bacteria detection method comprising a.
The method according to claim 9, wherein the biological sample of step i) is at least one selected from the group consisting of blood, urine, cerebrospinal fluid and saliva.
The method according to claim 10, wherein the blood is obtained from central vessels or peripheral vessels of an individual.
[10] The method of claim 9, wherein the detection of step iii) is performed using PCR (polymerase chain reaction).
According to claim 12, wherein the PCR is quantitative PCR (quantitative PCR, qPCR), real-time PCR (real-time PCR), reverse transcription PCR (Reverse Transcription PCR, RT-PCR), solid phase PCR (Solid Phase PCR), competitive PCR ( Competitive PCR), Overlap-extension PCR, Multiplex PCR, Nested PCR, Inverse PCR, Ligation-mediated PCR, ISSR ( Intersequence-specific PCR), Methylation-specific PCR (MSP), Colony PCR (colony PCR), Miniprimer PCR (Miniprimer PCR), Nanoparticle-Assisted PCR (nanoPCR), TAIL-PCR (Thermal asymmetric interlaced PCR), Touchdown (Step-down) PCR, Hot start PCR, In silico PCR, Allele-specific PCR, Assembly PCR (Assembly PCR), asymmetric PCR (asymmetric PCR), dial-out PCR (Dial-out PCR), digital PCR (Digital PCR, dPCR) and helicase- any one selected from the group consisting of amplification technology (helicasedependent amplification) Sepsis causative bacteria detection method, characterized in that the above.
A composition for diagnosing sepsis or predicting a prognosis comprising the composition of claim 1.
A kit for diagnosing sepsis or predicting prognosis, comprising the composition of claim 14 and a reagent for PCR amplification.
i) obtaining a biological sample from a subject suspected of sepsis;
ii) isolating cell free DNA from the biological sample obtained in step i); and
iii) detecting a bacterium causing sepsis using the cell-free DNA obtained in step ii) and the composition of claim 1;
Information providing method for sepsis diagnosis or prognosis prediction comprising a.

Images