KR20220149980A - Ubiquitin-related novel antimicrobial peptide derived from starry flounder and uses thereof - Google Patents

Abstract

The present invention relates to: a ubiquitin-related novel antimicrobial peptide consisting of the amino acid sequence of SEQ ID NO: 1, and derived from Platichthys stellatus; and uses thereof. The antimicrobial peptide of the present invention can be usefully used as an antibiotic substitute for fish.

Description

Ubiquitin-related novel antimicrobial peptide derived from starry flounder and uses thereof

The present invention relates to a novel antibacterial peptide related to ubiquitin derived from Platichthys stellatus and uses thereof.

Antimicrobial peptide (AMP) is an important component of innate immunity, and it is a natural substance with a wide range of antibacterial, antifungal, antiviral and anticancer activities. . However, despite these advantages, natural AMPs have a problem in replacing antibiotics due to their high production cost, short in vivo half-life, and in vivo toxicity, and development of AMPs capable of overcoming the above problems is required. Currently, more than 20,000 AMP sequences are registered in the DRAMP (Data Repository of Antimicrobial Peptides, http://dramp.cpu-bioinfor.org/) database, but less than 0.4% of AMPs are being clinically tested.

In the fish farming industry, AMP is attracting attention due to growing public health concerns and regulation of antibiotic use. Since fish live in environments exposed to various pathogens, they can be used as important resources for discovering novel antimicrobial peptides.

Ubiquitin is known to be involved in the regulation of immune-related functions such as cell cycle, protein expression and apoptosis. It is also reported to be associated with ribosomes involved in protein synthesis and peptide bond formation.

On the other hand, Korean Patent Publication No. 2018-0039393 discloses 'a novel antimicrobial peptide derived from polar fish', and Korean Patent Publication No. 2013-0109543 discloses 'a new antimicrobial peptide derived from yellowfin tuna and uses thereof'. Although disclosed, there is no description about the novel antibacterial peptide related to ubiquitin derived from the strength leg of the present invention and its use.

The present invention was derived from the above needs, and the present inventors produced a ubiquitin-related peptide (S30FAU) derived from the strength bridge ( Platichthys stellatus ) and confirmed the antibacterial activity and cytotoxicity to the host's red blood cells. As a result, the strength bridge By confirming that the derived antibacterial peptide exhibits antibacterial activity against gram-positive bacteria and gram-negative bacteria, inhibits biofilm formation of gram-positive bacteria, and does not exhibit haemolytic activity against erythrocytes of the host, the present invention was completed.

In order to solve the above problems, the present invention provides an antibacterial peptide derived from ubiquitin, consisting of the amino acid sequence of SEQ ID NO: 1, leg strength ( Platichthys stellatus ).

In addition, the present invention provides a polynucleotide encoding the antibacterial peptide.

In addition, the present invention provides a recombinant vector comprising the polynucleotide.

In addition, the present invention provides a host cell transformed with the recombinant vector.

In addition, the present invention provides a method for producing an antibacterial peptide comprising the step of transforming a host cell with the recombinant vector to overexpress a polynucleotide encoding the antibacterial peptide.

In addition, the present invention provides an antibacterial peptide produced by the method.

In addition, the present invention provides an antimicrobial composition containing the antimicrobial peptide as an active ingredient.

In addition, the present invention provides an antibacterial method in a subject comprising administering a pharmaceutically effective amount of the antimicrobial peptide to a subject other than a human.

In addition, the present invention provides a feed additive for fish containing the antibacterial peptide as an active ingredient.

The novel antibacterial peptide derived from the strength leg according to the present invention not only has excellent antibacterial activity against various fish pathogens, but also does not show cytotoxicity to host cells, so it can be used as a substitute for conventional antibiotics for fish, or used as a substitute for aquaculture fish. It may be usefully used as a feed additive, etc.

1 is a result of confirming the expression level of S30FAU in each tissue of a healthy strength leg fish.
Figure 2 is the result of confirming the change in the expression level of S30FAU in each tissue of the robber leg fish after artificial infection with VHSV (A) or Streptococcus parauberis ( PH0710, B).
3 is a result of a red blood cell hemolysis test for strength leg to examine the cytotoxicity of S30FAU.
4 is a result confirming the biofilm formation inhibitory ability of S30FAU.

In order to achieve the object of the present invention, the present invention provides an antibacterial peptide derived from ubiquitin , consisting of the amino acid sequence of SEQ ID NO: 1.

The present inventors produced an antibacterial peptide consisting of the amino acid sequence of SEQ ID NO: 1 based on the amino acid sequence expected to be an antibacterial sequence from ubiquitin-related protein derived from Platichthys stellatus , and named it S30FAU.

The scope of the antibacterial peptide derived from the strength leg according to the present invention includes a peptide represented by an amino acid sequence selected from the group consisting of the amino acid sequence of SEQ ID NO: 1 and functional equivalents of the peptide. "Functional equivalent" means at least 60% or more, preferably 70% or more, more preferably 80% or more, even more preferably the amino acid sequence represented by SEQ ID NO: 1 as a result of addition, substitution or deletion of amino acids. refers to a peptide having a sequence homology of 90% or more, and exhibiting substantially the same physiological activity as the peptide represented by the amino acid sequence of SEQ ID NO: 1. "Substantially homogenous physiological activity" means antibacterial activity.

The present invention also provides a polynucleotide encoding the antibacterial peptide. The polynucleotide of the present invention may be DNA or RNA encoding the antibacterial peptide. DNA includes cDNA, genomic DNA, or man-made synthetic DNA, and the DNA may be single-stranded or double-stranded.

The present invention also provides a recombinant vector comprising the polynucleotide.

The term “vector” is used to refer to a DNA fragment(s), a nucleic acid molecule, that is delivered into a cell. The vector replicates DNA and can be reproduced independently in a host cell. The term "carrier" is often used interchangeably with "vector." The term "expression vector" refers to a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence necessary for expression of an operably linked coding sequence in a particular host organism. In general, any plasmid and vector can be used as long as it is capable of replication and stabilization in the host. An important characteristic of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element. The translation control elements available in eukaryotes, such as enhancers, ribosome binding sites, termination signals, polyadenylation signals, and promoters, are known in the art. The expression vector can be constructed by methods well known in the art. The method includes in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology. The DNA sequence can be effectively linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector may also contain a ribosome binding moiety and a transcription terminator as a translation initiation site.

Vectors of the invention can typically be constructed as vectors for cloning or expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of propagating transcription (eg, pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.); It generally includes a ribosome binding site for initiation of translation and a transcription/translation termination sequence. When E. coli is used as the host cell, the promoter and operator sites of the tryptophan biosynthesis pathway of E. coli, and the left-handed promoter (pLλ promoter) of phage (λ) may be used as regulatory regions.

On the other hand, vectors that can be used in the present invention include plasmids (eg, pSC101, ColE1, pBR322, pUC8/9, pHC79, pGEX series, pET series and pUC19, etc.), phage (eg, λgt4 λB) often used in the art. , λ-Charon, λΔz1 and M13, etc.) or viruses (eg, SV40, etc.). On the other hand, when the vector of the present invention is an expression vector and a eukaryotic cell is a host, a promoter derived from the genome of a mammalian cell (eg, a metallotionine promoter) or a promoter derived from a mammalian virus (eg, adeno viral late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and tk promoter of HSV) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

The vector of the present invention may include an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and a resistance gene to tetracycline.

The present invention also provides a host cell transformed with the recombinant vector.

As a host cell capable of stably and continuously cloning and expressing the vector of the present invention, any host cell known in the art may be used, for example, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, Bacillus genus strains such as E. coli B, E. coli X1776, E. coli W3110, Bacillus subtilis , Bacillus thuringiensis , Salmonella typhimurium , Serratia marcescens and There are enterobacteriaceae and strains such as various Pseudomonas species.

In addition, when the vector of the present invention is transformed into a eukaryotic cell, as a host cell, yeast ( Saccharomyce cerevisiae ), insect cells, human cells (eg, CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293 ) , HepG2, 3T3, RIN and MDCK cell lines) and plant cells may be used.

The method of delivering the vector of the present invention into a host cell is, when the host cell is a prokaryotic cell, the CaCl ₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114 (1973)) ), the Hanahan method (Hanahan, D., J. Mol. Biol., 166:557-580 (1983)) and the electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16:6127-6145). (1988)) and the like. In addition, when the host cell is a eukaryotic cell, microinjection method (Capecchi, MR, Cell, 22:479 (1980)), calcium phosphate precipitation method (Graham, FL et al., Virology, 52:456 (1973)), electroporation (Neumann, E. et al., EMBO J., 1:841 (1982)), liposome-mediated transfection (Wong, TK et al., Gene, 10:87 (1980)), DEAE- Dextran treatment (Gopal, Mol. Cell Biol., 5:1188-1190 (1985)) and gene bambadment (Yang et al., Proc. Natl. Acad. Sci., 87:9568-9572 (1990)) The vector may be injected into a host cell by such a method.

The present invention also provides a method for producing an antibacterial peptide comprising the step of overexpressing a polynucleotide encoding an antibacterial peptide by transforming a host cell with the recombinant vector, and an antibacterial peptide produced by the method.

In the method for producing the antibacterial peptide of the present invention, the transformant is cultured in a medium suitable for the production of a recombinant protein (peptide) using a known technique. For example, the cells may be cultured by small-scale or large-scale fermentation, shake flask culture in a laboratory or industrial fermentor conducted under suitable media and conditions permitting expression and/or isolation of the protein. Cultivation takes place in a suitable medium containing a carbon, nitrogen source and inorganic salts using known techniques. Suitable media are commercially available or can be prepared according to the ingredients and composition ratios described in publications such as, for example, catalogs of the American Type Culture Collection (ATCC).

In the production method, the protein (peptide) expressed by the target gene can be recovered using a protein isolation method known in the art. For example, the protein may be separated from the nutrient medium by conventional methods including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation or precipitation. Furthermore, proteins can be further purified through a variety of known methods including chromatography (e.g. ion exchange, affinity, hydrophobicity and size exclusion), electrophoresis, fractionation (e.g. ammonium sulfate precipitation), SDS-PAGE or extraction. can be purified.

The antibacterial peptide of the present invention is as described above, and is an antibacterial peptide having growth inhibitory activity against bacteria such as gram-positive bacteria or gram-negative bacteria.

In addition, the present invention provides an antimicrobial composition containing the antimicrobial peptide as an active ingredient. The antimicrobial composition may be used as an antimicrobial composition for fish, but is not limited thereto.

By "antimicrobial" is meant the ability to reduce, prevent, inhibit, or eliminate the growth or survival of a microorganism at a concentration, and preferably may mean anti-bacterial, wherein the bacterium may be Gram-positive bacteria or Gram-negative bacteria, preferably, the Gram-positive bacteria are Streptococcus iniae or S. parauberis , and the Gram-negative bacteria are Vibrio harveyi or Vibrio camphor. Belly ( V. campbellii ) may be, but is not limited thereto.

The present invention also provides an antibacterial method in a subject, comprising administering a pharmaceutically effective amount of the antimicrobial peptide to a subject other than a human. The subject may preferably be a fish, but is not limited thereto.

The present invention also provides a feed additive for fish containing the antibacterial peptide as an active ingredient. The feed additive contains a peptide consisting of the amino acid sequence of SEQ ID NO: 1 having antibacterial activity as an active ingredient, and can induce an immune enhancing effect of fish.

The feed additive of the present invention includes auxiliary components such as amino acids, inorganic salts, vitamins, antibiotics, antibacterial substances, antioxidants, antifungal enzymes, and other live cell types of microbial preparations; grains such as milled or crushed wheat, oats, barley, corn and rice; plant protein feeds, such as those based on rape, soybean and sunflower; animal protein feeds such as blood meal, meat meal, bone meal and fish meal; Dry ingredients consisting of sugar and dairy products, for example, various milk powders and whey powder; lipids, for example main components such as animal fats and vegetable fats optionally liquefied by heating; Additives such as nutritional supplements, digestion and absorption enhancers, growth promoters, and disease prevention agents may be further included.

The feed additive of the present invention may be in the form of a powder or liquid formulation, and may include an excipient for adding feed. Examples of the excipient for adding feed include, but are not limited to, calcium carbonate, flour, zeolite, jade flour, or rice bran.

The feed additive of the present invention may further comprise one or more enzyme preparations. For example, lipolytic enzymes such as lipase, phytase that breaks down phytic acid to produce phosphate and inositol phosphate, and alpha-1,4-glycosidic bonds (α-1) contained in starch and glycogen Amylase, an enzyme that hydrolyzes 4-glycoside bond), phosphatase, an enzyme that hydrolyzes organophosphate esters, maltase that hydrolyzes maltose into two molecules of glucose, and glucose-fruc by hydrolyzing saccharose It may contain a converting enzyme, etc. to make a toss mixture.

The feed additive of the present invention may be administered to the fish alone or in combination with other feed additives in an edible carrier. In addition, the composition for addition to the feed can be easily administered as a top dressing or directly mixed with the feed, or separately from the feed, in a separate oral formulation, or in combination with other ingredients. Typically, a single daily intake or divided daily intake may be used as is well known in the art.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Next Generation Sequencing (NGS) Analysis

Next Generation Sequencing (NGS) analysis was performed to obtain the gene sequence. First, total RNA was isolated from the major tissues (leukocytes, red blood cells, liver, kidney, spleen) of the robber’s leg artificially infected with Streptococcus parauberis and synthesized as cDNA, and quality of the items such as concentration and purity Confirmation (QC) confirmed the suitability of samples for analysis prior to sequencing. Samples verified by QC were commissioned by DNAlink (Korea) to perform transcriptome sequencing and primary assembly, and for processed data, insilicogen (Korea) was commissioned to perform secondary assembly and finally S30FAU coding The coding sequence (CDS) was confirmed.

2. Normal fish tissue isolation and total RNA isolation

Experimental fish were purchased from a private farm in Pohang, Gyeongsangbuk-do, and had an average total length of 21.5 ± 1.3 cm and a weight of 128.7 ± 18.2 g. Viral hemorrhagic septicemia (VHSV) and Streptococcus parauberis used for artificial infection were provided by the National Institute of Fisheries Science, and were acclimatized to 17 ± 1 °C and 25 ± 1 °C. For the expression analysis by tissue, anesthetized and dissected the strength legs of 5 healthy subjects with Benzocain (Sigma, USA). The heart, skin, and stomach were enucleated. After the extracted tissues were homogenized, total RNA was extracted using TRIzol-based RNAiso (TaKaRa, Japan) according to the manufacturer's instructions.

3. Quantitative real-time PCR

The mRNA expression level of S30FAU was analyzed by the SYBR green method, and Thermal Cycler Dice ^® Real Time System Ⅲ (Takara) was used. For relative expression analysis, S30FAU specific primers [forward: AGAACACCCACACCCTTGAG (SEQ ID NO: 2) and reverse: CAGTGCTCCAAGACTCCACA (SEQ ID NO: 3)] were used and calculated using the 2 ^-ΔΔCT method.

4. Tissue Isolation of Artificial Infection Samples

After artificial infection with the pathogen, to confirm the expression characteristics of S30FAU, the strength legs were conditioned at 17 ± 1 °C and 25 ± 1 °C, Streptococcus parauberis PH0710 (1x10 CFU/fish) or VHSV (1x10 copies/fish) were each suspended in PBS and injected subcutaneously, and the same amount of PBS was injected subcutaneously as a control. After each injection of the pathogen and PBS, 5 subjects were randomly selected from each experimental group and control group at 1, 12 hours, 1, 3, 5, and 7 days, and the kidneys, spleen, gills, liver, brain, intestine, and heart were treated. It was extracted aseptically. The extracted tissue was stored at -80°C until used in the experiment. Total RNA isolation, cDNA synthesis, and quantitative real-time PCR were performed in the same manner as described above.

5. Peptide Synthesis

The amino acid sequence of S30FAU predicted to have antibacterial activity [QEKKKKKTGRAKRRI (SEQ ID NO: 1)] was synthesized by requesting GL Biochem Ltd (China). The synthesized peptide (antibacterial peptide) is as follows, and it was dissolved in PBS (phosphate-buffered saline) buffer and used for the experiment.

6. Pathogenic Bacteria

To analyze the antibacterial activity of the S30FAU peptide, Streptococcus parauberis PH0710, Streptococcus parauberis KSP28, Streptococcus iniae FP5228, Vibrio campbellii and Vibrio halves KCCM40684 ( V. harveyi) ATCC14126 was used. Each strain was smeared on BHIA (brain heart infusion agar) and the obtained colonies were cultured at 28°C or 37°C for 24 hours and then cultured in BHIB (brain heart infusion broth) at 28°C or 37°C for 24 hours. Thereafter, centrifugation was performed at 4,000 rpm for 10 minutes. The concentration of each strain was diluted with PBS to obtain an absorbance of 0.15 at 540 nm and resuspended to 1x10 ⁵ CFU/fish.

7. Minimum inhibitory concentration (MIC) analysis

To determine the minimum inhibitory concentration (MIC) of S30FAU, the peptide dissolved in 2.5% acetonitrile (ACN) was diluted in a 96 well-plate using PBS by a 2-fold dilution method. All strains were diluted with MH (Mueller Hinton) medium to 1x10 ⁵ CFU/fish, and 50 μl of the strain was mixed with 50 μl of 2-fold serially diluted peptide (7.81-250 μg/ml) at 28°C or 37°C. Incubated for 12 hours. After incubation, the absorbance was measured at 540 nm using a VICTOR3 1420 Multilabel Counter (PerkinElmer, USA). The MIC experiment was repeated three times to increase the accuracy.

8. Biofilm inhibitory ability analysis

To determine whether the antibacterial peptide affects the bacterial biofilm formation, the above-mentioned pathogenic bacteria were prepared in BHIA at a concentration of 1x10 ⁵ CFU/fish, and M9 medium (Welgene, Precision Solution™, Korea) was added. Each strain was cultured in a 96-well plate at 28°C or 37°C for 24 hours, washed with PBS, and then peptides of different concentrations (7.81-250 μg/ml) were added, followed by further incubation at 28°C or 37°C for 24 hours. . After incubation, the supernatant was removed, and 150 μl of anhydrous ethyl alcohol was added, followed by incubation at room temperature for 30 minutes. Then, after washing with PBS, stained with 1% crystal violet (Crystal violet, Sigma-Aldrich) for 10 minutes, washed with distilled water, 150 μl of 30% acetic acid solution was added, and incubated for 10 minutes at room temperature, 595 nm absorbance was measured. The controls used here are PBS and 2.5% ACN. All experiments were repeated three times to increase accuracy.

9. Cytotoxicity assay

Blood was drawn from the robber's leg using a heparin-treated syringe and added to Leibovitz's L-15 medium. Thereafter, a Percoll gradient method was performed using a 53% percoll solution, and red blood cells were isolated by centrifugation at 400x g for 15 minutes. The separated red blood cells were washed 3 times with PBS, mixed with antibacterial peptides of different concentrations (7.81-250 μg/ml) and 100 μl each, and incubated at room temperature for 30 minutes. In this case, PBS was used as a negative control, and 0.1% Triton X-100 (Sigma-Aldrich) was used as a positive control. After incubation, centrifugation was performed at 1,000x g for 10 minutes, and the supernatant was transferred to a 96-well plate and absorbance was measured at 540 nm.

10. Statistical Analysis

All samples were performed in triplicate, and the results were reported as mean ± standard deviation. Statistical analysis was performed using SPSS software version 19 (IBM, USA), the results were verified using ANOVA (one-way analysis of variance), and Tukey's test was used for comparison between the results (* p < 0.05 and ** p < 0.01).

Example 1. Gene expression profiling of S30FAU

It was confirmed that mRNA of S30FAU was abundantly expressed in body, stomach, heart, gills, and skin tissues in healthy strength legs (FIG. 1).

The mRNA expression level of S30FAU was lowered when VHSV was artificially infected. The highest expression was shown in cardiac tissue 1 hour and 3 days after infection ( FIG. 2A ), and when S. parauberis was artificially infected, the highest expression was found in kidney, liver, and heart tissues 7 days after infection. showed (Fig. 2B)

Example 2. Antimicrobial activity assay

The purity of the synthesized S30FAU antibacterial peptide used in the antimicrobial activity analysis was 98%. The MIC values of the S30FAU antibacterial peptide against Gram-positive and Gram-negative bacteria are shown in Table 1 below.

Antibacterial activity of S30FAU against various pathogens Bacterial strain Gram ℃ S30FAU (μg/ml) Streptococcus parauberis PH0710 (+) 37 7.81-15.63 Streptococcus parauberis KSP28 (+) 37 15.53-31.25 Streptococcus iniae (+) 28 7.81-15.63 Vibrio harveyi (-) 28 7.81-15.63 vibrio campbellii (-) 28 31.25-62.5

S30FAU is Streptococcus iniae ( Streptococcus iniae ), Streptococcus parauberis ( S. parauberis ) PH0710, Streptococcus parauberis KSP28, Vibrio campbellii ( Vibrio campbellii ) and Vibrio halveyi ( Inhibiting the growth of V. harveyi ) It was confirmed that it had antibacterial activity.

Example 3. Cytotoxicity assay

The present inventors measured the hemolytic activity of the S30FAU antibacterial peptide using RBCs. As a result, as shown in FIG. 3 , it was confirmed that the S30FAU and S30FAU antibacterial peptides did not show any hemolytic activity even at the highest treatment concentration of 250 μg/ml, indicating that they were antibacterial peptides without cytotoxicity.

Example 4. Inhibition of biofilm formation

S30FAU antibacterial peptide was confirmed to significantly reduce the biofilm formation in a concentration-dependent manner with respect to Streptococcus parauberi ( S. parauberi ) PH0710, Streptococcus parauberis KSP28 (Fig. 4). In addition, it was found that 2.5% of acetonitrile (ACN) used to confirm the solvent toxicity was not significantly different from the PBS control.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> Ubiquitin-related novel antimicrobial peptide derived from starry flounder and uses thereof <130> PN21124 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 15 <212> PRT <213> Unknown <220> <223> Platichthys stellatus <400> 1 Gln Glu Lys Lys Lys Lys Lys Thr Gly Arg Ala Lys Arg Arg Ile 1 5 10 15 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 agaacaccca cacccttgag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 cagtgctcca agactccaca 20

Claims (11)

Consisting of the amino acid sequence of SEQ ID NO: 1, an antibacterial peptide derived from Platichthys stellatus ubiquitin. A polynucleotide encoding the antimicrobial peptide of claim 1. A recombinant vector comprising the polynucleotide of claim 2. A host cell transformed with the recombinant vector of claim 3. A method for producing an antibacterial peptide comprising the step of transforming a host cell with the recombinant vector of claim 3 to overexpress a polynucleotide encoding the antibacterial peptide. An antibacterial peptide produced by the method of claim 5 . An antibacterial composition comprising the antimicrobial peptide of claim 1 or 6 as an active ingredient. The antibacterial composition according to claim 7, wherein the composition has antibacterial activity against gram-positive and gram-negative pathogens. According to claim 8, wherein the gram-positive pathogen is Streptococcus iniae or Streptococcus parauberis ( S. parauberis ), and the gram-negative pathogen is Vibrio harveyi or Vibrio campbellii. ), characterized in that the antibacterial composition. An antibacterial method in a subject, comprising administering a pharmaceutically effective amount of the antimicrobial peptide of claim 1 or 6 to a subject other than a human. A feed additive for fish containing the antibacterial peptide of claim 1 or 6 as an active ingredient.

Images