KR20220148567A - Hepatocellular carcinoma specific targeting exosome composition as a drug anticancer delivery and use thereof - Google Patents

Abstract

The present invention relates to: a recombinant expression vector in which a gene expressing a ligand binding to a receptor of hepatocellular carcinoma cells is inserted into a gene expressed into extracellular vesicles of stem cells; a pharmaceutical composition comprising extracellular vesicles transformed by using the expression vector; and a method for preparing an expression vector for preventing or treating hepatocellular carcinoma. The present invention utilizes exosomes, which are extracellular vesicles, as a drug delivery material and selectively binds to hepatocellular carcinoma cells, which are target cells, thereby providing an advantage of being able to have a specific action targeting hepatocellular carcinoma.

Description

Hepatocellular carcinoma specific targeting exosome composition as a drug delivery material and use thereof

The present invention relates to a hepatocellular carcinoma-specific targeting exosome composition comprising exosomes transformed from a recombinant expression vector and uses thereof.

Hepatocellular carcinoma (HCC) is a primary liver cancer that occurs in the liver. According to the 2014 national cancer registration statistics, it ranks sixth in the incidence rate among all cancers, but the 5-year survival rate is only 32.8%, so it is a cancer with a very high mortality compared to the incidence rate. In particular, in Asia, including Korea, where the hepatitis virus carrier rate is high, the incidence is high, and it is one of the cancers with a poor prognosis, with the second to third highest mortality compared to cancer, and prevention and early detection are important. The treatment of hepatocellular carcinoma is still a complex and difficult problem, because hepatocellular carcinoma expresses resistance genes for various drugs and shows low sensitivity to chemotherapy.

Exosomes are only 30-100 nm in size, but contain various substances such as proteins, nucleic acids, and lipids in original cells. They are nanoparticles secreted by our adipose-derived stem cells, such as immune cells or stem cells. . As the function of exosomes as an intercellular information carrier is known, it is attracting attention as a next-generation anticancer substance.

Accordingly, the present inventors have made intensive efforts to develop hepatocellular carcinoma-specific target extracellular vesicles as drug delivery materials. completed.

Republic of Korea Patent Publication No. 10-1662975 (2016.10.06)

It is an object of the present invention to provide a recombinant expression vector in which a gene for expressing a ligand that binds to a receptor of hepatocellular carcinoma is inserted into a gene expressed in the extracellular vesicles of stem cells.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating hepatocellular carcinoma comprising the extracellular vesicles transformed with the recombinant expression vector.

Another object of the present invention is to (a) introducing a gene expressing a ligand that binds to a receptor of hepatocellular carcinoma into the gene expressed in the extracellular vesicles of adipose-derived stem cells; And (b) culturing the cell into which the gene is introduced in a medium to obtain an extracellular vesicle; to provide a method for producing an expression vector for preventing or treating hepatocellular carcinoma, comprising.

Each description and embodiment disclosed in this application may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.

One aspect of the present invention provides a recombinant expression vector in which a gene for expressing a ligand that binds to a receptor of hepatocellular carcinoma is inserted into a gene expressed in the extracellular vesicles of stem cells.

The "expression vector" in the present invention may be selected from the group consisting of a linear DNA vector, a plasmid DNA vector, and a recombinant viral vector, but is not limited thereto, and all conventional vectors used for transformation in the art are the present invention. can be used in the method of In one embodiment of the present invention, the expression vector may be a pDisplay vector.

In the present invention, "ligand" refers to a substance that is inserted into a gene expressed in the extracellular vesicles of stem cells and binds to the receptors of hepatocellular carcinoma cells when expressed in the extracellular vesicles. Preferably, the ligand may be one represented by the amino acid sequence of SEQ ID NO: 1.

In addition, another aspect of the present invention provides a pharmaceutical composition for preventing or treating hepatocellular carcinoma comprising the extracellular vesicles transformed with the recombinant expression vector.

In the present invention, "extracellular vesicle" refers to a small sphere surrounded by a membrane derived from a cell, and the extracellular vesicle is an extracellular vesicle derived from a natural system, such as a plant, animal, microorganism, or an artificially produced extracellular vesicle. It may be an endoplasmic reticulum. In addition, the cell may be a cell isolated from a living organism in nature.

The "extracellular vesicle" may be an exosome, an ectosome, or a microvesicle, but in one embodiment of the present invention, the "extracellular vesicle" may be an exosome.

In the present invention, "exosome" refers to a small vesicle with a membrane structure secreted from various cells, and refers to a vesicle that is released into the extracellular environment due to fusion of the polycystic body and the plasma membrane. In one embodiment of the present invention, the 　 exosome may be derived or isolated from adipose-derived stem cells.

In one embodiment of the present invention, the 　 exosome may have a diameter of 50 to 150 nm. In addition, the exosome may be included at a concentration of 1 to 50 μL/ml.

In the present invention, "stem cells" refers to cells of various origins as pluripotent cells that can be differentiated into various tissue cells when appropriate conditions are met in an undifferentiated state.

The stem cells may be bone marrow-derived stem cells, cord blood-derived stem cells or adipose-derived stem cells. In one embodiment of the present invention, the 　 stem cells may be adipose-derived stem cells. In addition, the bone marrow-derived stem cells, cord blood-derived stem cells or adipose-derived stem cells may be human or animal-derived stem cells.

"Adipose-derived stem cells" in the present invention are stem cells derived from adipose tissue, and refer to cells with pluripotency and self-renewal capacity, and the adipose-derived stem cells of the present invention are obtained through liposuction and various surgical procedures. can, but is not limited thereto.

In one embodiment of the present invention, the exosome is transformed to express a ligand that binds to a receptor of a hepatocellular carcinoma in a gene expressed as an exosome of a host cell, such as stem cells, to act as a target on hepatocellular carcinoma cells. means there is

In addition, in one embodiment of the present invention, the exo-some may be additionally equipped with a self-assembly.

"Self-assembly" in the present invention is a material that exists as several small peptides and combines with each other under certain conditions to form hard polymers. The self-assembly formed in nano size can interact with cells to adjust the survival rate of cells. In one embodiment of the present invention, the "self-assembly" may be Mito-FF, and the "Mito-FF" may be a self-assembly that targets mitochondria.

In addition, another aspect of the present invention comprises the steps of (a) introducing a gene expressing a ligand that binds to a receptor of hepatocellular carcinoma into a gene expressed in the extracellular vesicles of adipose-derived stem cells; and (b) culturing the cells into which the gene is introduced in a medium to obtain an extracellular vesicle;

The "extracellular vesicle" in the present invention may be an exosome, an ectosome or a microvesicle, but in one embodiment of the present invention, the "extracellular vesicle" may be an exosome have.

"Medium" in the present invention may be an adipose-derived stem cell culture medium. In one embodiment of the present invention, the adipose-derived stem cell culture medium may be a medium with FBS-Free DMEM low glucose.

In the present invention, “prevention” refers to any action that suppresses or delays the onset of hepatocellular carcinoma by administration of the pharmaceutical composition according to the present invention.

"Treatment" in the present invention means any action in which symptoms for hepatocellular carcinoma are improved or beneficially changed by administration of the pharmaceutical composition according to the present invention.

In the present invention, "hepatocellular carcinoma" refers to a primary liver cancer occurring in the liver as a cancer occurring in the liver cells themselves. On the other hand, the liver cancer refers to all types of malignant tumors occurring in the liver, and may be hepatocellular carcinoma (HCC), selected from the group consisting of hepatoblastoma, cholangiocarcinoma, cholangiocarcinoma, or liver cancer generated from viral infection. It may be one or more cancers. Hepatocellular carcinoma is the most important histological subtype, accounting for 70-85% of primary liver cancers.

A recombinant expression vector in which a gene for expressing a ligand binding to a receptor of hepatocellular carcinoma is inserted into the gene expressed in the extracellular vesicle of the stem cell of the present invention, and a pharmaceutical composition comprising the extracellular vesicle transformed with the expression vector As an extracellular vesicle, exosomes can be used as drug delivery materials to selectively bind to hepatocellular carcinoma cells, which are target cells, and thus act specifically for hepatocellular carcinoma. Therefore, the target exosomes can be applied in the field of hepatocellular carcinoma treatment, in particular, as a clinical application technology.

1 is a schematic diagram showing the binding of exosomes to cancer cells, which are target cells, by expressing a targeting ligand in the exosomes through an expression vector.
2A is a vector configuration in pDisplay for expression of the recombinant protein of the present invention, and B is a diagram showing aspects according to the expression of the vector.
Figure 3 is the result of confirming the peptide expression as the expression of the exosome marker CD9 and Myc-taq protein after introduction of the expression vector of the present invention.
4 is a result of confirming the expression level of Mcl-1 by the adipose-derived stem cell-derived target exosome in HepG2, a liver cancer cell line. In the lower graph, the horizontal axis means processing capacity (μL/ml), and the vertical axis means relative density.
5 is a result of confirming the expression level of Mcl-1 by adipose-derived stem cell-derived target exosomes in Hep3B, a liver cancer cell line. In the lower graph, the horizontal axis means processing capacity (μL/ml), and the vertical axis means relative density.
6 is a result confirming the expression level of Mcl-1 by adipose-derived stem cell-derived target exosomes in the liver cancer cell line Huh7. In the lower graph, the horizontal axis means processing capacity (μL/ml), and the vertical axis means relative density.
7 is a result of confirming the expression levels of PCNA, Mcl-1, Bcl-xL and Bax in a liver cancer animal model in which Huh7, a liver cancer cell line, is transplanted into a BALB/C Nude mouse.
8 is a result of confirming the expression levels of PCNA, Mcl-1, Bcl-xL and Bax in a liver cancer animal model transplanted with the liver cancer cell line Huh7 in BALB / C Nude mouse.
9 is a result confirming the expression levels of Mcl-1 and Bcl-xL in a liver cancer animal model in which Huh7, a liver cancer cell line, was transplanted into a BALB/C Nude mouse. The vertical axis of the graph means relative density.
10 shows the results of Hematoxylin & eosin (H&E) staining in a liver cancer animal model in which Huh7, a liver cancer cell line, was transplanted into a BALB/C Nude mouse.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1. Adipose-derived stem cell-derived 　 target exosome 　 production and confirmation

To prepare the target exosomes that specifically act on hepatocellular carcinoma of the present invention, the exosomes were extracted using adipose-derived stem cells. For reference, in the present invention, although adipose-derived stem cells were used as donor cells for producing target exosomes, immune cells such as NK cells are also possible, so the present invention is not limited thereto.

Adipose-derived stem cells were transduced with an amino acid sequence encoding a liver cancer cell target ligand (TCATTTAGTATAATACACACGCCTATACTCCCGCTC) in a pDisplay vector (invitrogen) using a transfection reagent (lipofectamine, invitrogen) according to the manufacturer's instructions. After cloning the vector, the result of cloning the vector was confirmed (FIG. 2), and a target exosome was prepared by inserting it into adipose-derived stem cells.

, 5% CO₂조건으로 배양하였다.To extract the prepared target exosomes, adipose-derived stem cells were cultured in DMEM low glucose medium supplemented with 10% FBS (inactivated fetal bovine serum) and 1% P/S (penicillin-streptomycin).

, 5% CO ₂ Incubated under conditions.

After 24 hours, the medium was exchanged with FBS-Free DMEM low glucose, and after 24 hours after the medium exchange, the culture medium of adipose-derived stem cells was removed and centrifuged at 1000 rpm by differential centrifugation method. Cells were removed.

Hepatocellular carcinoma target exosomes were obtained from the culture medium from which the cells were removed according to the manufacturer's instructions using a thermo exosome extraction kit (Thermo fisher scientific).

On the other hand, a plasmid capable of mounting a hepatocellular carcinoma target marker on the exosome surface of adipose-derived stem cells was introduced. Accordingly, it was confirmed that the peptide was expressed by the expression of the exosome markers CD9 and Myc-taq protein (FIG. 3). ).

Here, by using Neon (invitrogen) in the target exosome obtained through the above process, the mitochondrial target mito-FF was transformed into the target exosome using electroporation. Targetable exosomes were additionally prepared.

Example 2. Efficacy evaluation of adipose-derived stem cell-derived target exosomes in HepG2, a liver cancer cell line

In order to evaluate the anticancer efficacy of the adipose-derived stem cell-derived liver cancer target exosome cloned with the recombinant vector according to the present invention compared to the adipose-derived stem cell-derived exosome, each exosome composition was added to the liver cancer cell lines HepG2, Hep3B and Huh7 0, 5 , by comparing the expression level of Myeloid cell leukemia 1 (Mcl-1), an anti-apoptotic factor involved in the apoptosis mechanism, treated at doses of 12.5, 25, and 50 μL/ml, was observed ( FIGS. 4 to 6 ).

As a result, as shown in FIGS. 4 to 6 , at a higher concentration than at a low concentration, and compared to the adipose-derived stem cell-derived exosome, Mcl-1 was reduced in the adipose-derived stem cell-derived liver cancer target exosome cloned with the recombinant vector according to the present invention. It was confirmed that the expression level was decreased, and it was confirmed that the expression of the adipose-derived stem cell-derived exosome Mcl-1 was decreased compared to the adipose-derived stem cell exosome compared to the adipose-derived stem cell exosome cloned with the adipose-derived stem cell-derived liver cancer target exo. could

Example 3. Efficacy evaluation of adipose-derived stem cell-derived target exosomes using an animal model of liver cancer following transplantation of the liver cancer cell line Huh7

After inducing liver cancer by transplanting the liver cancer cell line Huh7 into BALB/C Nude mice (in vivo) at 5x10 ⁵ , the purpose of this study was to confirm the therapeutic efficacy of hepatocellular carcinoma using adipose-derived stem cell-derived exosomes. Tail each of exosomes (Exo), target exosomes (T-Exo), Mito-FF mounted exosomes (Exo+Mito) and Mito-FF mounted target exosomes (T-Exo+Mito) to the constructed tumor model. After 2 weeks of injection by vein injection, mice were sacrificed to confirm the effect of exosomes on the anti-tumor effect of liver cancer.

As a result, the expression of PCNA, a cell proliferation marker, was reduced in exosomes (Exo), target exosomes (T-Exo), Mito-FF-equipped exosomes (Exo+Mito) and Mito-FF-equipped target exosomes (T-Exo+). Mito) was found to decrease significantly ( FIGS. 7 and 8 ).

In addition, as shown in FIGS. 7 and 8 , in the group to which the target exo-some (T-Exo) was added, anti-apoptotic factors Mcl-1 (Myeloid cell leukemia 1) and Bcl-xL It was found that the expression of (B-cell lymphoma-extra large) decreased, and the level of the pro-apoptotic factor 　Bax (Bcl-2-associated X protein) increased.

Example 4. Efficacy evaluation of adipose-derived stem cell-derived target exosomes using an animal model of liver cancer following transplantation of the liver cancer cell line Huh7

After inducing liver cancer by transplanting the liver cancer cell line Huh7 into BALB/C Nude mice (in vivo) at 5x10 ⁵ , the purpose of this study was to confirm the therapeutic efficacy of hepatocellular carcinoma using adipose-derived stem cell-derived exosomes. Tail each of exosomes (Exo), target exosomes (T-Exo), Mito-FF mounted exosomes (Exo+Mito) and Mito-FF mounted target exosomes (T-Exo+Mito) to the constructed tumor model. After 2 weeks of injection by vein injection, mice were sacrificed to confirm the effect of exosomes on the antitumor effect of liver cancer (FIG. 9).

As a result, as shown in FIG. 9, in the group to which the target exo-some (T-Exo) of the present invention was added, anti-apoptotic factors Mcl-1 (Myeloid cell leukemia 1) and Bcl- It was confirmed that the expression of xL (B-cell lymphoma-extra large) was reduced, and in particular, it was confirmed that the expression of Mcl-1 and Bcl-xL was most inhibited in the target exosome equipped with Mito-FF (T-Exo+Mito). could

Example 5. Evaluation of histological characteristics of adipose-derived stem cell-derived target exosomes using an animal model of liver cancer

After inducing liver cancer by transplanting the liver cancer cell line Huh7 into BALB/C Nude mice (in vivo) at 5x10 ⁵ , the purpose of this study was to determine the changes in the histological characteristics of hepatocellular carcinoma using adipose-derived stem cell-derived exosomes.

Mito-FF mounted exosomes (Exo + Mito) and Mito-FF mounted target exosomes (T-Exo + Mito) were injected into the constructed tumor model for 2 weeks in a tail vein injection method, then mice were sacrificed and the Hematoxylin & eosin (H&E) staining was performed on the lesion tissue, and histological changes according to the delivery of each 　 exosome were observed (FIG. 10).

As a result, as shown in FIG. 10 , it was confirmed that the anti-tumor effect of the Mito-FF-equipped target exosome (T-Exo+Mito) was greater in the constructed liver cancer model.

The foregoing description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> The Catholic University of Korea Industry-Academic Cooperation Foundation <120> Hepatocellular carcinoma specific targeting exosome composition as a drug anticancer delivery and use thereof <130> DPC212177 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> encoding sequence <400> 1 tcatttagta taatacacac gcctatactc ccgctc 36

Claims (10)

A recombinant expression vector in which a gene for expressing a ligand that binds to a receptor of hepatocellular carcinoma is inserted into a gene expressed in the extracellular vesicles of stem cells. The recombinant expression vector according to claim 1, wherein the ligand binding to the receptor of the hepatocellular carcinoma is represented by the amino acid sequence of SEQ ID NO: 1. A pharmaceutical composition for preventing or treating hepatocellular carcinoma comprising the extracellular vesicle transformed with the recombinant expression vector of claim 1. The pharmaceutical composition for preventing or treating hepatocellular carcinoma according to claim 3, wherein the extracellular vesicles are exosomes. [Claim 5] The pharmaceutical composition for preventing or treating hepatocellular carcinoma according to claim 4, wherein the exo-some is additionally equipped with a self-assembly. The pharmaceutical composition for preventing or treating hepatocellular carcinoma according to claim 4, wherein the exosome is contained in a concentration of 1 to 50 μL/ml. The pharmaceutical composition for preventing or treating hepatocellular carcinoma according to claim 1, wherein the stem cells are bone marrow-derived stem cells, cord blood-derived stem cells, or adipose-derived stem cells. The pharmaceutical composition for preventing or treating hepatocellular carcinoma according to claim 7, wherein the bone marrow-derived stem cells, cord blood-derived stem cells or adipose-derived stem cells are human or animal-derived stem cells. (a) introducing a gene expressing a ligand that binds to a receptor of hepatocellular carcinoma into a gene expressed in the extracellular vesicles of adipose-derived stem cells; and
(b) culturing the cell into which the gene is introduced in a medium to obtain an extracellular vesicle; The method according to claim 9, wherein the extracellular vesicles are exosomes.

Images