KR20220148440A - Biomarker composition for diagnosing cancer induced by microplastic exposure and uses thereof - Google Patents

Abstract

The present invention relates to a biomarker composition for diagnosing cancer induced by microplastic exposure, and uses thereof. Changes in the expression levels of SLC7A2, PCDH7, and CLDN7 genes have been confirmed in gastric cancer tissues exposed to microplastics (PS). When micro-sized PS is administered for a long period of time, the level of expression change of gastric cancer-related genes is very large, and the long-term administration of micro-sized PS also affects the overall survival rate. Therefore, the gastric cancer-related genes can be used as biomarkers for diagnosing gastric cancer induced by exposure to PS. The biomarker composition for diagnosing cancer induced by exposure to microplastics of the present invention, is selected from the group consisting of proteins consisting of SLC7A2, PCDH7 and CLDN7 or genes encoding the proteins.

Description

Biomarker composition for diagnosing cancer induced by microplastic exposure and uses thereof

The present invention relates to a biomarker composition for diagnosing cancer induced by microplastic exposure and use thereof.

Gastric cancer is a very common cancer in Asia and one of the leading causes of cancer death worldwide. In the past few years, many attempts have been made to better elucidate the biological processes related to the development of gastric cancer in order to improve the understanding of the carcinogenesis mechanism as well as the early diagnosis and treatment of gastric cancer. remains the subject of research.

In Korea, it is the most common cancer with the highest incidence and the second leading cause of death. Gastric cancer is staging according to the degree of invasion of surrounding structures, metastasis to regional lymph nodes, and metastasis to other organs. However, treatment and prognosis will vary accordingly. As the stage increases, the prognosis gradually deteriorates, especially in the late stage (Stage 4), the prognosis is poor, with a 5-year survival rate of only 3%.

Plastic has contributed greatly to modern people's affluent daily life and industrial development due to its excellent function and low price. Although it has been reported as a health-threatening cause, the effect of microplastics on cancer diseases has not been studied.

Republic of Korea Patent Publication No. 10-2017-0067137 (published on June 15, 2017)

An object of the present invention is to provide a biomarker composition for diagnosing cancer induced by exposure to microplastics, a kit for diagnosing cancer using the same, and a method for providing useful information for diagnosis.

The present invention provides a biomarker composition for diagnosing cancer that is selected from the group consisting of proteins consisting of SLC7A2, PCDH7 and CLDN7 or genes encoding the proteins, and induced by exposure to microplastics.

The present invention is one or more selected from the group consisting of proteins consisting of SLC7A2, PCDH7 and CLDN7 or genes encoding the proteins, and the expression or activity level of the protein, or the expression level of the gene encoding the protein. Provided is a composition for diagnosing cancer induced by exposure to microplastics containing the formulation as an active ingredient.

The present invention provides a kit for diagnosing cancer induced by exposure to microplastics comprising the composition.

In addition, the present invention is one or more selected from the group consisting of proteins consisting of SLC7A2, PCDH7 and CLDN7 or genes encoding the proteins in a sample isolated from a sample suspected of being exposed to microplastics, and the expression or activity level of the protein , or determining the expression level of the gene encoding the protein; and

It provides a method of providing information for diagnosing cancer induced by microplastic exposure, comprising comparing the expression level with a normal control group.

According to the present invention, changes in the expression level of SLC7A2, PCDH7 and CLDN7 genes were confirmed in gastric cancer tissues exposed to microplastics (PS). As it has been confirmed that they appear large and affect overall survival rate, the genes can serve as biomarkers for diagnosing gastric cancer induced by exposure to PS.

1 is a result of confirming that microparticles (MP) accumulated in mouse gastric tissue promote gene expression changes. FIG. 1A is a schematic diagram showing the process of exposing polystyrene microparticles (PS) to human gastric cancer cell lines, ppm, PS (10 μm diameter) was mixed with normal cell culture medium and subcultured for 4 weeks. 1B is a Western blot analysis result confirming DNMT1 expression in HGC cell lines, confirming the decrease in DNMT1 by PS exposure in all human gastric cancer cells (HGC) except for MKN45, and FIG. 1C is the effect of low DNMT1 expression on prognosis. is the result of a Kaplan-Meier plot for the overall survival period of patients who confirmed After exposing 100 ppm/100 μL of particles (PS, 10 μm diameter) for 4 weeks, stomachs were extracted from PS-exposed mice and RNAseq analysis was performed. Figure 1E is a representative microscopic image confirming the accumulation of fluorescent green polystyrene (FG-PE) in gastric tissue (magnification: × 20, scale bar, 100 μm), Figure 1F is DEGs (Cut-off: |FC|>2 and As a result of hierarchical cluster analysis of p < 0.05), the expression data was corrected to Z value and displayed in the clustergram as a result of gene change due to PS exposure, and relatively low expression is displayed in blue, and high expression is displayed in blue. is indicated in red. 1G is the result of ranking MSigDB with the lowest p-value associated with 2-fold or more PSMS-induced genes in gastric tissue. , the red line indicates log10 of the p value of the MSigDB analysis result, and FIG. 1H is the analysis result of the gene group.
2 is a result of confirming the overall survival period of TCGA-STAD patients, FIG. 2A is a schematic diagram for survival analysis. When genes (ABCB4, ASGR2...) increased by PS show high expression, negative effects on STAD patients When the genes (CLDN7, DNAH6 ...) decreased by PS were low expression, it was expected to have a negative effect on STAD patients and as a result of checking the DEG list, 33 genes were identified in the STAD and DEG list, In order to accurately confirm the association between gastric cancer and PS exposure, three genes were identified under the condition of FPKM > 1 and p < 0.001, and FIG. 2B is a fold change plot (PS / control) and It is a result of confirming the risk ratio (high / low) of TCGA-STAD, and FIG. 2C is the result of confirming the overall survival rate under stringent conditions. STAD data analyzed for FPKM values > 1 and p < 0.001, high SCL7A2 from the results and PCDH7 expression and low CLDN7 expression are the results of confirming that the relationship with the poor 5-year overall survival rate. 2D shows the results of in vitro qPCR analysis of SLC7A2, PCDH7 and CLDN7 (*p < 0.05, **p < 0.01, Student's t-test).

Hereinafter, the present invention will be described in more detail.

Microplastics (MP) are contaminants found in the global marine environment including seawater, sediments and biota. MP contamination of marine organisms is emerging as an environmental problem that affects the safety of seafood. Although it is expected that it will affect the health of people who eat contaminated seafood, there is insufficient research on a method for confirming whether or not cancer disease is actually caused by exposure to microplastics. Accordingly, the inventors of the present invention have completed the present invention by identifying a biomarker that specifically shows a difference in expression in cells and animal models exposed to actual microplastics.

The present invention can provide a biomarker composition for diagnosing cancer that is selected from the group consisting of proteins consisting of SLC7A2, PCDH7 and CLDN7 or genes encoding the proteins, and induced by exposure to microplastics.

More specifically, the expression of SLC7A2 and PCDH7 may be increased in cancer cells induced by exposure to microplastics, and the expression of CLDN7 may be decreased in cancer cells induced by exposure to microplastics.

The "SLC7A2" is NCBI accession no. 6542, wherein "PCDH7" is NCBI accession no. 5099, wherein "CLDN7" is NCBI accession no. 1366, but is not limited thereto.

The microplastic is polystyrene, polypropylene, polyethylene, polyamide (Polyamide, PA), acrylonitrile-butadiene-styrene (ABS), polytetrafluoroethylene (PTFE), cellulose acetate (Cellulose Acetate, CA), polycarbonate (Polycarbonate, PC), polymethyl methacrylate (PMMA), polyvinyl chloride (Polyvinyl chloride, PVC) and polyethylene terephthalate (Polyethylene terephthalate, PET) to be selected from the group consisting of However, the present invention is not limited thereto.

The cancer may be selected from the group consisting of stomach cancer, breast cancer, uterine cancer, liver cancer, colorectal cancer, kidney cancer, lung cancer, prostate cancer, oral cancer and pancreatic cancer.

The present invention is one or more selected from the group consisting of proteins consisting of SLC7A2, PCDH7 and CLDN7 or genes encoding the proteins, and the expression or activity level of the protein, or the expression level of the gene encoding the protein. Provided is a composition for diagnosing cancer induced by exposure to microplastics containing the formulation as an active ingredient.

The agent may be selected from the group consisting of primers, probes, antibodies, peptides and aptamers, but is not limited thereto.

The present invention may provide a kit for diagnosing cancer caused by exposure to microplastics, including the composition for diagnosing cancer.

In addition, the present invention is one or more selected from the group consisting of proteins consisting of SLC7A2, PCDH7 and CLDN7 or genes encoding the proteins in a sample isolated from a sample suspected of being exposed to microplastics, and the expression or activity level of the protein , or determining the expression level of the gene encoding the protein; and

It is possible to provide a method for providing information for diagnosing cancer induced by microplastic exposure, comprising comparing the expression level with a normal control group.

In the present invention, "diagnosis" means confirming the presence or characteristics of a pathological condition. For the purpose of the present invention, diagnosis is to determine whether or not cancer is caused by exposure to microplastics, preferably gastric cancer.

In the present invention, the "biomarker" is a substance capable of diagnosing by distinguishing the tissue or cell of a subject with gastric cancer from the tissue or cell of a normal control, and increases or and organic biomolecules such as proteins or nucleic acids, lipids, glycolipids, glycoproteins, and the like showing a decreasing pattern.

In the present invention, "a method for determining the expression level of a gene" includes a polymerase reaction (PCR), a reverse transcription polymerase reaction (RT-PCR), a competitive reverse transcription polymerase reaction (Competitive RT-PCR), a real-time reverse transcription polymerase reaction (Realtime RT-PCR), RNase protection assay (RPA), northern blotting, or DNA microarray assay, but is not limited thereto.

In the present invention, "a method for determining the level of protein expression or activity" includes western blotting, ELISA (enzyme linked immunosorbent assay), radioimmunoassay, radioimmunoassay, radioimmunodiffusion, octero Ouchterlony immunodiffusion method, Rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complete fixation assay, Fluorescence Activated Cell Sorter (FACS) or protein chip ( protein chip) analysis method, but is not limited thereto.

Hereinafter, to help the understanding of the present invention, examples will be described in detail. However, the following examples are merely illustrative of the content of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

<Experimental example>

The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

1. Cell Lines and PS Exposure In Vitro Models

Human gastric cancer cell lines AGS, MKN1, MKN45 and KATO III were obtained from Korea Cell line Bank (KLCB, Korea), and NCI-N87 was obtained from American Type Culture Collection (ATCC, USA). All cell lines were maintained in RPMI 1640 medium (Corning, USA) containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37° C. and 5% CO ₂ conditions.

To confirm the effect of microplastics on gastric cancer cells, polystyrene microspheres (PS, 500 mg, 9.5-11.5 μm, Cospheric, USA) were used. PSs were mixed with 10 mL of normal RPMI culture medium containing 10% fetal bovine serum and 1% antibiotics, and repeated sonication and vortexing were performed to prepare a 5% PS suspension. The suspension was aliquoted into the cell culture medium at the desired concentration during subculture.

After that, PS was removed by washing 3 times with PBS, and subcultured using EDTA-trypsin.

2. Animal Model for Microplastic Accumulation in Gastric Cancer Tissue

To confirm microplastic accumulation in gastric cancer tissues, fluorescent green polystyrene microspheres (100 ppm/100 μL; 10-20 μm; Cospheric, USA) were used. The microspheres were orally administered to 5-week-old BALB/c nude mice (Orient Bio Inc., Korea.) daily for 4 weeks. After 4 weeks, they were euthanized using CO 2 , and the stomach was extracted and fixed overnight at 4° C. with 4% PFA. Frozen sections (8 μm thick) were prepared using a rapid cooling material (optimal cutting temperature, OCT) and attached to a slide glass.

Cell nuclei were stained with DAPI (ThermoFisher Scientific, USA) and images were confirmed using IN cell analyzer 2200 (GE Healthcare, USA).

3. Western blot

Cell extracts were obtained using Extraction Cell Lysis Buffer 1× (Abcam, UK) containing Extraction Enhancer Buffer (Abcam, UK), and the protein concentration was confirmed by BCA assay (ThermoFisher Scientific, USA).

The tumor tissue isolated from the mouse was cut into small pieces using scissors and then homogenized by adding a protein extraction cell lysis buffer 1× (Abcam, UK) containing Extraction Enhancer Buffer (Abcam, UK).

Protein concentration was confirmed by bicinchoninic acid assay (ThermoFisher Scientific, USA), and Western blot analysis was performed using anti-DNMT1 (Abcam, UK., ab134148) and anti-β-actin (Abcam, UK., ab6276) antibodies. did.

4. Quantitative Real-Time PCR (qPCR)

Total RNA was extracted from the cells using TRIzol (Molecular Research Center, USA) according to the manufacturer's instructions.

The tumor tissue isolated from the mouse was cut into small pieces using scissors, and then Trizol was added to the tissue and homogenized. Total RNA was extracted from tissue lysate samples, and RNA was quantified by spectrometry and then diluted with RNase-free dH2O (ThermoFisher Scientific, USA).

For PCR reaction, cDNA was synthesized from 5 μg of mRNA using SuperScript III cDNA Synthesis Kit (Invitrogen, USA) according to the manufacturer's instructions.

qPCR was performed with the ABI qPCR system (Applied Biosystems, USA) using SYBR Green PCR Master Mix (Applied Biosystems, USA) according to the manufacturer's instructions, and the reaction conditions were 50 at 95°C for 15 seconds after 10 minutes at 95°C. The cycle proceeded for 60 seconds at 60°C.

Primer sequences are shown in Table 1, mRNA values were normalized to GAPDH, and relative mRNA values (RQ values) were calculated using the equation RQ = 2-ΔΔCt.

PCDH7 Forward TTGTGGGAGCAGGAGACAAC Reverse ATGGATGTAGACGCATCTGTTTG SLC7A2 Forward CCCGGGATGGCTTACTGTTT Reverse AATGACCCCTGCAGTCAACG CLDN7 Forward CTCCTATGCGGGTGACAACA Reverse GAGACCACCATTAGGGCTCG

5. TCGA-STAD data analysis

Comprehensive survival analysis was performed with the Human Protein ATLAS web toolkit (https://www.proteinatlas.org/) using RNAseq data from 354 patients in the Cancer Genome Atlas-Stomach Adenocarcinoma (TCGA-STAD) data set.

Based on the FPKM value of each gene, the patients were classified into two groups (high and low), and the correlation between the expression level and the patient survival rate was confirmed. To classify the two expression categories, the best expression cutoff values in the Protein ATLAS web-toolkit were used.

The prognosis of the patients in each group was confirmed by Kaplan-Meier survival estimators, and the survival results of the two groups were compared by the log-rank test.

Overall survival (OS) results included all stage I-IV and N/A patients, and a FPKM value of 1 or more and a p < 0.0001 value recommended by Human Protein ATLAS were judged as significant OS.

6. RNA Isolation and RNA Sequencing (RNA-seq)

To confirm the gene expression change caused by polystyrene microspheres (PS) in gastric cancer tissues, mice were orally administered with 10-μm PS (100 ppm/100 μL PBS) for 4 weeks, and total RNA was extracted from the gastric tissues. Three RNA sets were collected per group.

Briefly, RNA was randomly fragmented for fragment sequence sequencing and cDNA was reverse transcribed with different adapters attached to the 5′ and 3′ ends. PCR amplification was performed to the extent that sequencing was possible, and according to the manufacturer's instructions, size selection was performed to obtain an insertion size of 200-400 bp to be used in the NovaSeq 6000 Sequencing System (illumina, USA).

7. RNAseq Data Analysis

In order to remove low-quality sequences and adapter sequences before analysis, the original nucleotide sequence was previously analyzed from the sequencer, and sequencing was performed on a mouse (Mus musculus, mm10) using HISAT v2.1 for alignment.

HISAT used two types of indices for alignment: global whole genome indices and tens of thousands of small regional indices. The two types of indices were constructed using the same BWT (Burrows-Wheeler transform)/graph FM index (GFM) as Bowtie2, and due to the efficient use of data structures and algorithms, HISAT is superior to Bowtie and BWA, which are commonly used. Created junction alignments several times faster.

The mouse reference genome sequence and annotation data were downloaded from NCBI. After that, the transcript assembly of the known transcript as StringTie v1.3.4d, novel transcripts and alternative splicing transcripts were identified. Based on the above results, the expression levels of transcripts and genes were calculated as the number of reads per sample or FPKM value (Fragments Per Kilobase of exon per Million fragments mapped).

Expression profiles were used for further analysis such as differentially expressed genes (DEGs). In addition, differentially expressed genes or transcripts in groups of different conditions were filtered through statistical hypothesis testing.

In order to confirm the modification of the RNA sequencing data, the purified nucleotide sequence was aligned with respect to the mouse using STAR. The sequence sequence was used to confirm the modification in the mpileup module of Samtools v1.9 and the call module of BCFtools v1.9.

Samtools mpileup collected the summarized information from the injected BAM, calculated the likelihood of the data given the possible genotypes and saved it in BCF format. BCFtool applies the previous data and loads the actual data. Also, concatenate BCF files and convert BCF to VCF for quick random access.

Variant filtering was performed for each sample based on root mean square (RMS) mapping excellence (Q ≥ 20) and read depth (d ≥ 100) in the varFilter module of vcftools v0.1.16.

8. Statistical analysis of gene expression level

Relative frequencies of genes were identified as read counts using StringTie.

First, by measuring the frequency for each gene in the sample, the gene showing the difference in expression was statistically analyzed. Genes with zero or more read count values in the sample were excluded. The filtered data were log2 transformed and RLE normalized. Statistical significance of expression difference data was confirmed using DESeq2 nbinomWaldTest and fold change, and the null hypothesis means that there is no difference between groups.

The false discovery rate (FDR) was controlled by adjusting the p value using the Benjamini-Hochberg algorithm. For the DEG set, hierarchical clustering analysis was performed using full connectivity and geometric distance as a measure of similarity.

9. Hierarchical clustering

Hierarchical cluster analysis uses |fold change| was performed to display the expression patterns of transcripts showing expression differences satisfying >2 and raw p<0.05.

10. GSEA, gene group analysis and DAVID GO analysis

Gene groups and gene sets were obtained from the MSigDB website of the Broad Institute (http://software/broadinstitute.org/gsea/msigdb). A set of major gene biomarkers (H) and a set of oncogene biomarkers (C6) were selected for quantification of the DEG gene list (fold change > 2, p < 0.05).

All top-level gene sets were manually curated (p <0.05) to identify the correct functional and pathway categories. The website provided by the gene group analysis toolkit was used according to the instructions. Analysis was performed using the DAVID web toolkit (http://david.avcc.ncifcrf.goc) to assign GO categories according to the DAVID specification.

11. Network Analysis: String

The interaction network was analyzed with STRING software.

Briefly, Cytoscape (v3.8.0) and String App (Version 1.4.0) were downloaded from the official website, and important DEGs (fold change > 2, p < 0.05) and SNV (p < 0.05) genes for network analysis. A list was selected.

<Example 1> Confirmation of the effect of microplastics on changes in RNA expression in gastric cancer tissue

First, in order to determine whether polystyrene (PS) induces a change in gene expression through the same process as in FIG. 1A, gastric cancer cell lines were treated with PS for 4 weeks. It was assumed that PS would induce perturbation in the methylation process, and it was confirmed by Western blot analysis that changes in DNMT1 expression appeared after PS exposure in gastric cancer cell lines.

As a result, as shown in FIG. 1B, DNMT1 was increased in MKN45 among 5 gastric cancer cell lines, and decreased in the other 4 cell lines.

From the above results, it was confirmed that PS exposure interfered with the methylation process.

Referring to FIG. 1C , in Cancer Genome Atlas Stomach Adenocarcinoma (TCGA-STAD) overall survival (OS) data, it was shown that a decrease in DNMT1 had a negative effect on TCGA-STAD patients. Patients with low DNMT1 expression had a reduced 5-year survival rate from 43% to 23%.

Next, the effect of PS exposure in vivo was confirmed. First, in order to confirm the accumulation of microparticles (MP) in the digestive tract, 10-20 μm fluorescent green polystyrene (FG-PE) was supplied to BALB/nude mice daily for 4 weeks in the same manner as in FIG. 1D .

As a result, it was confirmed that FG-PE was accumulated in the gastric tissue as shown in FIG. 1E.

In addition, by confirming changes in RNA expression in gastric tissue, it was confirmed whether cancer could be induced by long-term PS administration. To confirm RNA expression change, 100 ppm/100 μL of 10 μm polystyrene microparticles were supplied to BALB/nude mice every day for 4 weeks.

As a result of analyzing the differentially expressed gene (DEG) in the mouse gastric tissue after 4 weeks of PS exposure, 194 (cut off fold change) showing a significant difference in expression in the PS-exposed group compared to the control group as shown in FIG. 1F > 2, P < 0.05) genes were identified.

Gene set enrichment analysis using MSigDB identified genes in a set of cancer characteristic markers (H) and tumorigenic biomarkers (C6).

As a result, as shown in FIG. 1G , the strongest similarity was found in xenobiotic metabolism, coagulation, and complement gene sets among specific gene sets.

In addition, 6 cytokines and growth factors, 17 interaction factors, 3 homeodomain proteins, 5 cell differentiation markers, 7 protein kinases, 2 translocated oncogenes, and 2 oncogenes were identified in gene group analysis. , tumor suppressor genes were not expressed.

From the above results, it was confirmed that long-term micro-sized PS interacts with gastric tissue to promote changes in RNA expression.

<Example 2> Confirmation of the effect of polystyrene (PS) exposure on overall survival in TCGA-STAD patients

As PS exposure is expected to adversely affect the gastric environment, DEG results and survival data of TCGA-STAD patients were used to identify 194 genes whose expression changes were confirmed with PS exposure.

Referring to FIG. 2A , it was confirmed that the gene increased after PS exposure had an adverse effect on the overall survival period (OS) of TCGA-STAD patients in DEG analysis, and the gene decreased after PS exposure was also confirmed that the overall survival period of TCGA-STAD patients (OS) was confirmed to have an adverse effect.

According to OS analysis, 33 genes (25 up-regulated and 8 down-regulated) were disrupted, and fold change values and risk ratios of 33 genes were identified as shown in FIG. 2B. For more detailed correlation analysis, FPKM > 1 and p < 0.001 genes were analyzed in RNAseq results of TCGA-STAD patients.

As a result, three genes SLC7A2, PCDH7 and CLDN7 were identified as genes satisfying the above conditions.

Hazard ratios (HR) for 3 genes were identified as follows: SLC7A2 (HR = 1.4250-3.281, P = 0.00031), PCDH7 (HR = 1.284-2.487, P = 0.00064) and CLDN7 (HR = 0.3497). -0.7396, P = 0.00041)

More specifically, in mouse DEG, SLC7A2 expression was increased by 2.42 fold, PCDH7 expression was increased by 2.08 fold, and CLDN7 expression was decreased. In addition, as shown in FIG. 2C , it was confirmed that high expression of SLC7A2 (P = 0.00031) or PCDH7 (P = 0.00064) or low expression of CLDN7 (P = 0.00041) was correlated with low 5-year overall survival in the TCGA-STAD data. .

Expression changes of LC7A2, PCDH7 and CLDN7 genes confirmed under stringent conditions of TCGA-STAD OS analysis were confirmed in gastric cancer cell lines using qPCR.

As a result, it was confirmed that SLAC7A2 expression was increased after PS exposure in five gastric cancer cell lines as shown in FIG. 2C. For TCGA-STAD patients, overall survival (OS) decreased from 40% to 21% in the patients with high SLC7A2 expression.

In addition, referring to FIG. 2D , similar to the results of the DEG analysis of gastric tissue, increased expression of PCDH7 gene was confirmed in AGS, MKN1 and KATOIII cell lines after PS exposure, and PCDH7 expression was not confirmed in NCI-N87 and MKN45 cells. On the other hand, in the case of TCGA-STAD patients, as shown in FIG. 2C , it was confirmed that the OS of the patient group in which PCDH7 was highly expressed was reduced from 46% to 18%.

In addition, similar to the results of gastric tissue DEG analysis as shown in FIG. 2D , a decrease in CLDN7 gene expression was confirmed in all gastric cancer cell lines after PS exposure. In the case of TCGA-STAD patients, as shown in FIG. 2C , it was confirmed that the OS of the patient group with low expression of CLDN7 was reduced from 42% to 19%.

From the above results, it was confirmed that the expression of genes in normal gastric tissues and gastric cancer cell lines may be abnormally changed by PS exposure, and in particular, when micro-sized PS is administered for a long period of time, it was confirmed that the level of change in the expression of gastric cancer-related genes is large.

From the above results, PS exposure can induce gastric cancer, and as it was confirmed that the expression level changes of SLC7A2, PCDH7 and CLDN7 genes in PS-exposed gastric cancer tissues were changed, the SLC7A2, PCDH7 and CLDN7 were induced by exposure to PS. It may serve as a biomarker for diagnosing gastric cancer.

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (9)

A biomarker composition for diagnosing cancer that is selected from the group consisting of proteins consisting of SLC7A2, PCDH7 and CLDN7 or genes encoding the proteins, and is induced by exposure to microplastics. The biomarker composition for diagnosing cancer according to claim 1, wherein the expression of SLC7A2 and PCDH7 is increased in cancer cells induced by microplastic exposure. The biomarker composition for diagnosing cancer according to claim 1, wherein the CLDN7 expression is reduced in cancer cells induced by microplastic exposure. The method according to claim 1, The microplastic is polystyrene, polypropylene, polyethylene, polyamide (Polyamide, PA), acrylonitrile-butadiene-styrene (ABS), polytetrafluoroethylene (Polytetrafluoroethylene, PTFE), cellulose consisting of acetate (Cellulose Acetate, CA), polycarbonate (PC), polymethyl methacrylate (PMMA), polyvinyl chloride (PVC) and polyethylene terephthalate (PET) A biomarker composition for cancer diagnosis, characterized in that it is selected from the group. The biomarker composition for diagnosing cancer according to claim 1, wherein the cancer is selected from the group consisting of gastric cancer, breast cancer, uterine cancer, liver cancer, colorectal cancer, kidney cancer, lung cancer, prostate cancer, oral cancer and pancreatic cancer. One or two or more selected from the group consisting of a protein consisting of SLC7A2, PCDH7 and CLDN7 or a gene encoding the protein, the expression or activity level of the protein, or an agent for detecting the expression level of the gene encoding the protein is effective A composition for diagnosing cancer induced by exposure to microplastics contained as a component. The composition for diagnosing cancer caused by exposure to microplastics according to claim 6, wherein the agent is selected from the group consisting of primers, probes, antibodies, peptides and aptamers. A kit for diagnosing cancer caused by exposure to microplastics comprising the composition according to claim 6 . One or more selected from the group consisting of proteins consisting of SLC7A2, PCDH7 and CLDN7 or genes encoding the proteins in a sample isolated from a sample suspected of being exposed to microplastics, the expression or activity level of the protein, or the protein determining the expression level of the encoding gene; and
A method for providing information for diagnosing cancer induced by microplastic exposure, comprising comparing the expression level with a normal control group.

Images