KR20220141216A - A Novel Biomarker for Diagnosing Breast Cancer - Google Patents

Abstract

The present invention relates to a composition for diagnosis or prognosis prediction of breast cancer, containing, as an active ingredient, an agent for measuring the expression of one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 or proteins encoded by the genes. The present invention allows factors to function as diagnostic markers having high reliability in breast cancer, especially, in triple-negative breast cancer (TNBC), which has a very poor prognosis and has no suitable diagnosis or treatment targets, and inhibits the proliferation, invasiveness and metastasis of tumors through expression regulation of the factors, and thus can be effectively used as a foundational therapeutic composition for remarkably increasing the survival rate of patients with triple-negative breast cancer, which is refractory cancer.

Description

A Novel Biomarker for Diagnosing Breast Cancer

The present invention relates to a biomarker for the diagnosis and prognosis of breast cancer, particularly triple-negative breast cancer that does not express both estrogen receptor, progesterone receptor and human epidermal growth factor receptor 2.

Triple-negative breast cancer (TNBC) is the most aggressive subtype of invasive breast cancer. As the name suggests, TNBC does not express estrogen receptor (ER) or progesterone receptor (PR), nor does it overexpress human epidermal growth factor receptor 2 (HER2), which is overexpressed in other breast cancers [1]. Due to the absence of such a molecular target, an effective therapeutic agent has not been discovered, and the prognosis and survival rate are poor because it is still mainly dependent on surgery [2, 3]. Accordingly, the need to develop an efficient and non-invasive treatment method for TNBC is emerging.

A typical treatment strategy is to inhibit TNBC mobility and invasiveness. In particular, the extracellular matrix (ECM) and its kinetics are key regulators of these properties. The extracellular matrix is composed of various proteins such as collagen, laminin, and Matricell protein, and their structure and function are determined [4, 5]. In particular, the composition of the ECM continuously changes during the tumorigenic process [6, 7]. For example, during epithelial-mesenchymal transition (EMT), ECM is degraded by matrix metalloproteinases (MMPs), promoting the conversion of migrating mesenchymal cells and allowing them to infiltrate into other parts of the body [8]. Among many EMT- and ECM-related factors, MATN3 (matrillin 3) and extracellular matrix protein 2 (ECM2) have been implicated in cancer metastasis. MATN3 is associated with gastric cancer recurrence and regulates the expression of ECM-degrading proteins such as MMP1, MMP3 and MMP13 [9]. In addition, ECM2, also known as secreted protein acidic and rich in cysteine-like1 (SPARCL1), acts as an antagonist of cell adhesion. ECM2 overexpression inhibits hilar cholangiocarcinoma cell migration by suppressing the expression of MMP-9 and MMP-2, and inhibits the migration of trophoblast cells by regulating MMP-2 and MMP-3 expression [10, 11]. However, it is not yet known whether the aberrant regulation of these genes is related to TNBC tumorigenesis.

Numerous papers and patent documents are referenced throughout this specification and citations thereof are indicated. The disclosure contents of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly describe the level of the technical field to which the present invention pertains and the content of the present invention.

Patent Literature 1. Korean Patent Registration No. 10-1976219

The present inventors made intensive research efforts to discover a highly reliable diagnostic marker for breast cancer, particularly triple-negative breast cancer (TNBC), which is difficult to find an effective therapeutic agent for due to the absence of a molecular target and has a very poor prognosis and survival rate. As a result, by examining the fact that HOXB2 expression is decreased in triple-negative breast cancer, and thus tumor invasiveness and metastasis are promoted, HOXB2 and its positive correlation were confirmed by HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2. By discovering that it can be used as a new therapeutic target for negative breast cancer and an efficient diagnostic marker that can provide accurate information on whether or not it occurs, the present invention has been completed.

Accordingly, an object of the present invention is to provide a composition for diagnosing triple negative breast cancer and a method for diagnosing breast cancer using the same.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention includes an agent for measuring the expression level of one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 or the protein they encode as an active ingredient It provides a composition for diagnosing breast cancer.

The present inventors made intensive research efforts to discover a highly reliable diagnostic marker for breast cancer, particularly triple-negative breast cancer (TNBC), which is difficult to find an effective therapeutic agent for due to the absence of a molecular target and has a very poor prognosis and survival rate. As a result, by examining the fact that HOXB2 expression is decreased in triple-negative breast cancer, and thus tumor invasiveness and metastasis are promoted, HOXB2 and its positive correlation were confirmed by HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2. It was found that it can be used as an efficient diagnostic marker that can provide accurate information about a new treatment target for negative breast cancer and its onset.

As used herein, the term “diagnosis” refers to determining a subject's susceptibility to a specific disease or disorder, determining whether an object currently has a specific disease or disorder (eg, of triple-negative breast cancer). identification), determining the prognosis of a subject afflicted with a particular disease or condition, or therametrics (e.g., monitoring a subject's condition to provide information about the efficacy of treatment). .

As detailed in the Examples below, as a result of examining the correlation between the expression of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 and the clinical characteristics of breast cancer patients, the expression of HOXB2 and HOXB3 was higher in breast cancer patients, especially It was found for the first time that the expression of HOXB2 was significantly reduced in patients with triple-negative breast cancer, and that it not only showed a significant negative correlation with overall survival (OS) of breast cancer patients, but also played a key role in regulating the TNBC-related phenotype. became We also found that HOXB2 directly regulates MATN3 and ECM2 at the transcriptional level, and that reduction of HOXB2 induces a decrease in expression of MATN3 and ECM2 in TNBC cells, ultimately leading to EMT-related phenotype and metastasis of primary cancer. In addition, it was confirmed that HOXB-AS1 is an upstream regulator that regulates HOXB2 through SMYD3, and that HOXB-AS1 and SMYD3 can also function as diagnostic and prognostic markers of breast cancer that objectively reflect the expression pattern of HOXB2. Accordingly, the expression level of these factors provides important clinical information about the overall prognosis of the disease, including the onset of breast cancer as well as its metastatic potential and patient survival rate.

As used herein, the term “diagnostic composition” is a means for measuring the expression level of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 genes or proteins encoding them in order to determine whether or not a subject develops triple-negative breast cancer or predicts the possibility of occurrence. It means an integrated mixture or device containing

According to another aspect of the present invention, one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 or an agent for measuring the expression level of the protein they encode are included as an active ingredient It provides a composition for predicting breast cancer prognosis.

As used herein, the term “prognosis” refers to predicting the future course or outcome of a specific disease, and in the case of cancer, it is usually evaluated by the patient's 5-year survival rate from the time of diagnosis. Diseases that can be treated with surgery or other forms of medical treatment are generally rated as having a “good” prognosis. A disease with a good prognosis rarely causes a patient's direct death, but in contrast, a disease that is likely to recur, metastasize to other parts of the body, or cause death is generally considered to have a "bad" prognosis. .

According to another aspect of the present invention, one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 or an agent for measuring the expression level of the protein they encode as an active ingredient It provides a composition for detecting recurrence or metastasis of breast cancer, comprising.

As used herein, the term “metastasis” refers to the process of forming a new tumor formed while cancer cells separated from the primary tumor tissue penetrate into surrounding blood vessels or lymphatic vessels and move to other parts of the body through this passage. . Since more than 90% of the causes of death of cancer patients are due to metastasis from the primary cancer (Nature Reviews Cancer, 2006, 6:449-458), inhibiting cancer metastasis to improve the mortality of cancer patients is the It is as important as treatment.

The mechanism by which cancer cells acquire mobility in the metastasis process is the epithelial to mesenchymal transition (EMT), in which tumor epithelial cells acquire the characteristics of mesenchymal cells by genetic mutation, and the opposite process, mesenchymal (MET) to epithelial transition) ( J Clin Invest . 2009, 119:1417-1419). In other words, epithelial cells with the characteristics of mesenchymal cells lose their original position due to weakened cell-to-cell binding and move to the blood vessel, and the cells that migrated through the blood vessel recover their original epithelial properties (MET) and return to the primary site. It settles in a distant secondary site and causes the tumor to proliferate.

According to a specific embodiment of the present invention, the breast cancer is negative for at least one selected from the group consisting of estrogen receptor, progesterone receptor and human epidermal growth factor receptor 2 (HER2).

More specifically, the breast cancer is negative for both the estrogen receptor, the progesterone receptor and HER2.

According to a specific embodiment of the present invention, an antibody or antigen-binding fragment thereof that specifically binds to the protein; or an aptamer that specifically binds to the protein.

According to the present invention, the protein of the present invention can be detected according to an immunoassay method using an antigen-antibody reaction and used to analyze triple-negative breast cancer in an individual. Such an immunoassay may be performed according to various immunoassays or immunostaining protocols previously developed.

For example, when the method of the present invention is performed according to a radioimmunoassay method, antibodies labeled with radioisotopes (eg, C ¹⁴ , I ¹²⁵ , P ³² and S ³⁵ ) may be used. In the present invention, the antibody specifically recognizing HOXB2, HOXB3, MATN3 and ECM2 proteins is a polyclonal or monoclonal antibody, and more specifically, a monoclonal antibody.

Antibodies of the present invention can be prepared by methods commonly practiced in the art, for example, fusion methods (Kohler and Milstein, European Journal of Immunology , 6:511-519 (1976)), recombinant DNA methods (U.S. Patent No. 4,816,567). ) or phage antibody library methods (Clackson et al, Nature , 352:624-628 (1991) and Marks et al, J. Mol. Biol. , 222:58, 1-597 (1991)). . General procedures for antibody preparation are described in Harlow, E. and Lane, D., Using Antibodies: A Laboratory Manual , Cold Spring Harbor Press, New York, 1999; and Zola, H., Monoclonal Antibodies: A Manual of Techniques , CRC Press, Inc., Boca Raton, Florida, 1984.

By analyzing the intensity of the final signal by the above-described immunoassay process, triple-negative breast cancer can be predicted. That is, when signals for HOXB2, HOXB3, SMYD3, MATN3, and ECM2 proteins are weaker than in normal samples, it is determined that the risk of triple-negative breast cancer is increased.

As used herein, the term “antigen binding fragment” refers to a portion of a polypeptide capable of binding an antigen in the entire immunoglobulin structure, for example, F(ab')2, Fab', Fab, Fv and scFvs, but are not limited thereto.

As used herein, the term "specifically binding" has the same meaning as "specifically recognizing", and an antigen and an antibody (or a fragment thereof) interact specifically through an immunological reaction. means to do

The present invention may use an aptamer that specifically binds to the marker protein of the present invention instead of an antibody. As used herein, the term “aptamer” refers to a single-stranded nucleic acid (RNA or DNA) molecule or peptide molecule that binds to a specific target substance with high affinity and specificity. For general information on aptamers, see Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med. 78(8):426-30(2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA. 95(24):14272-7 (1998).

According to a specific embodiment of the present invention, the agent for measuring the expression level of the gene is a primer or probe that specifically binds to a nucleic acid molecule of the gene.

As used herein, the term “nucleic acid molecule” has a meaning comprehensively including DNA (gDNA and cDNA) and RNA molecules. analogues (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90:543-584 (1990)).

As used herein, the term “primer” refers to conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand (template), that is, the presence of nucleotides and a polymerization agent such as DNA polymerase, and a suitable temperature and pH. It refers to an oligonucleotide that acts as a starting point of Specifically, the primer is a single-stranded deoxyribonucleotide. The primer used in the present invention may include naturally occurring dNMP (ie, dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides, and may also include ribonucleotides.

The primer of the present invention may be an extension primer that is annealed to a target nucleic acid to form a sequence complementary to the target nucleic acid by a template-dependent nucleic acid polymerase, which is extended to the position where the immobilized probe is annealed so that the probe is It occupies the annealed area.

The extension primer used in the present invention includes a hybridization nucleotide sequence complementary to a specific nucleotide sequence of a target nucleic acid, for example , HOXB2, HOXB3, MATN3 and ECM2 genes. The term “complementary” means that a primer or probe is sufficiently complementary to selectively hybridize to a target nucleic acid sequence under certain annealing or hybridization conditions, and when substantially complementary and perfectly complementary ), and specifically means a completely complementary case. As used herein, the term "substantially complementary sequence" is meant to include not only a completely identical sequence, but also a sequence that is partially mismatched with a sequence to be compared within a range that can function as a primer by annealing to a specific sequence.

The primer should be long enough to prime the synthesis of the extension product in the presence of a polymerizer. A suitable length of a primer depends on a number of factors, such as temperature, pH and source of the primer, but is typically 15-30 nucleotides. Short primer molecules generally require lower temperatures to form sufficiently stable hybrid complexes with the template. The design of such a primer can be easily performed by those skilled in the art with reference to the target nucleotide sequence, for example, using a primer design program (eg, PRIMER 3 program).

As used herein, the term “probe” refers to a natural or modified monomer or a linear oligomer including deoxyribonucleotides and ribonucleotides capable of hybridizing to a specific nucleotide sequence. Specifically, the probe is single-stranded for maximum efficiency in hybridization, more specifically deoxyribonucleotides. As the probe used in the present invention, a sequence perfectly complementary to a specific nucleotide sequence of the marker gene of the present invention may be used, but a substantially complementary sequence within a range that does not interfere with specific hybridization This may also be used. In general, since the stability of the duplex formed by hybridization tends to be determined by the match of the sequences at the ends, it is preferable to use a probe complementary to the 3'-end or 5'-end of the target sequence. do.

Suitable conditions for hybridization are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach , IRL Press, Washington , can be determined with reference to the details disclosed in DC (1985).

According to another aspect of the present invention, the present invention provides one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2, a protein they encode, or an activator that increases the expression or activity thereof It provides a composition for preventing or treating breast cancer comprising an active ingredient.

As used herein, the term “activator” refers to an active ingredient that enhances the expression level or activity of the gene or protein encoding them of the present invention, for example, the expression of a gene whose sequence and structure is already known in the art. It includes, but is not limited to, nucleic acid molecules, peptides, proteins, compounds and natural products that enhance at the gene or protein level or enhance intrinsic biological activity. Accordingly, “activator of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2” is used in the same sense as “agonist of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2”. .

As used herein, the term “prevention” refers to inhibiting the occurrence of a disease or disease in a subject who has never been diagnosed as having a disease or disease, but is likely to be afflicted with the disease or disease.

As used herein, the term “treatment” refers to (a) inhibiting the development of a disease, disorder or condition; (b) alleviation of the disease, condition or condition; or (c) eliminating the disease, condition or symptom. When the composition of the present invention is administered to a subject, the expression level or activity of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 is increased to suppress the proliferation of breast cancer cells as well as inhibit the invasiveness and metastasis of breast cancer, thereby causing breast cancer It plays a role in inhibiting, eliminating, or alleviating the progression of symptoms caused by

Accordingly, the composition of the present invention may be a composition for treating these diseases by itself, or may be administered together with other anticancer agents and applied as a therapeutic adjuvant for the above diseases. Accordingly, as used herein, the term “treatment” or “therapeutic agent” includes the meaning of “therapeutic adjuvant” or “therapeutic adjuvant”.

As used herein, the term “administration” or “administering” refers to direct administration of a therapeutically effective amount of the composition of the present invention to a subject so that the same amount is formed in the subject's body.

In the present invention, the term “therapeutically effective amount” refers to the content of the composition in which the pharmacological component in the composition is sufficient to provide a therapeutic or prophylactic effect to an individual to whom the pharmaceutical composition of the present invention is to be administered. prophylactically effective amount”.

As used herein, the term “subject” includes, without limitation, humans, mice, rats, guinea pigs, dogs, cats, horses, cattle, pigs, monkeys, chimpanzees, baboons or rhesus monkeys. Specifically, the subject of the present invention is a human.

According to another aspect of the present invention, the present invention provides one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2, a protein they encode, or an activator that increases the expression or activity thereof It provides a composition for inhibiting recurrence or metastasis of breast cancer comprising as an active ingredient.

Since the HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 genes of the present invention, proteins they encode, and activators that increase their expression or activity have already been described above, they are omitted to avoid excessive duplication.

According to another aspect of the present invention, the present invention provides a method for screening a composition for preventing or treating breast cancer, comprising the steps of:

(a) contacting a test substance with a biological sample comprising cells expressing one or more genes selected from the group consisting of OXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2; and

(b) measuring the expression level or activity of the gene in the sample,

When the expression level or activity of one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 is increased, the test substance is judged as a composition for preventing or treating breast cancer.

Since the cancer type to be prevented or treated by the composition screened in the present invention has already been described above, the description thereof will be omitted to avoid excessive duplication.

As used herein, the term “biological sample” refers to any sample obtained from mammals including humans, including cells expressing HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 or ECM2, and is a tissue, organ, cell or cell culture medium. including, but not limited to. More specifically, the biological sample is a biological sample comprising breast tissue or cells derived therefrom.

The term “test substance” used while referring to the screening method of the present invention is added to a sample containing the cells expressing the protein and is used in screening to check whether the activity or expression level of the protein is affected. means material. The test substance includes, but is not limited to, compounds, nucleotides, peptides and natural extracts. The step of measuring the expression level or activity of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 or ECM2 in the biological sample treated with the test substance may be performed by various methods for measuring expression level and activity known in the art. As a result of the measurement, when the expression level or activity of these proteins is increased, the test substance may be determined as a composition for preventing or treating breast cancer, specifically triple negative breast cancer (TNBC).

As used herein, the term “increase in expression amount or activity” refers to tumor proliferation, invasion, and metastasis inhibitory effects mediated by increased expression of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 or ECM2 to such an extent that it increases to a measurable level. It means that the expression level of the factor or the intrinsic function in vivo is increased. Specifically, it may refer to a state in which the activity or expression level is increased by 20% or more, more specifically, a state increased by 40% or more, more specifically, a state increased by 60% or more compared to the control group.

It provides a screening method for a composition for inhibiting recurrence or metastasis of breast cancer, comprising the steps of:

(a) contacting a test substance with a biological sample comprising cells expressing one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2; and

(b) measuring the expression level or activity of the gene in the sample,

When the expression level or activity of one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 is increased, the test substance is judged as a composition for inhibiting breast cancer recurrence or metastasis.

Carcinomas to be prevented or inhibited by the composition screened in the present invention have already been described above, and thus description thereof will be omitted to avoid excessive overlap.

The features and advantages of the present invention are summarized as follows:

(a) The present invention is HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and one or more genes selected from the group consisting of ECM2, or a preparation for measuring the expression level of a protein encoding these genes for breast cancer diagnosis or prognosis comprising as an active ingredient A composition for prediction is provided.

(b) In the present invention, the above factors not only function as reliable diagnostic markers in breast cancer, particularly triple-negative breast cancer (TNBC) with a very poor prognosis and no suitable diagnostic or therapeutic target, but also control the expression of tumors through their expression. It can be usefully used as a fundamental therapeutic composition that significantly improves the survival rate of patients with triple-negative breast cancer, which is intractable cancer, by inhibiting proliferation as well as invasiveness and metastasis.

1 is a diagram showing that HOXB2 downregulation correlates with TNBC. 1A is public data retrieved from cBioPortal showing the distribution of breast cancer subtypes according to HOXB2 alteration, and the Cancer Genome Atlas (TCGA, Nature 2012) data set was used for this analysis. 1B is a diagram showing that various HOXB2 malformations can be observed in breast cancer tissue samples. 1C and 1D are diagrams showing the results of analysis of the TCGA data set (Nature 2012) ( FIG. 1C ) and the published data set GSE65194 ( FIG. 1D ) on the expression of HOXB2 in various breast cancer subtypes. 1E and 1F show OS analysis of the relationship between survival time and HOXB2 expression characteristics in breast cancer using Kaplan-Meier plotter (FIG. 1E) and Molecular Therapeutics for Cancer, Ireland (MTCI) online tool (FIG. 1F). In the figure, the HOXB2 (205453_at for KM plot, 3212 for MTCI) probe was selected and analyzed for survival analysis. 1g is a diagram showing HOXB2 mRNA expression values in various human breast cancer cell lines by RT-qPCR. 1h is a diagram showing the results of Western blotting of lysates of various human breast cancer cell lines to investigate HOXB2 protein levels.
2 is a diagram showing that HOXB2 attenuates EMT properties in breast cancer cells. 2A and 2B are diagrams showing the mRNA ( FIG. 2A ) and protein ( FIG. 2B ) levels of HOXB2 knocked down in T47D breast cancer cells. Figure 2c shows the results of transwell analysis of T47D cells transfected with siCON or siHOXB2. Invasive (left panel) and migrated (right panel) cells were stained with DAPI and counted. 2D is a diagram showing the wound healing assay of T47D cells transfected with siCON or siHOXB2. 2e and 2f are diagrams showing mRNA and protein levels of HOXB2 overexpressed in MDA-MB-231 breast cancer cells. FIG. 2G is a diagram showing the results of transwell analysis of MDA-MB-231 cells transfected with an empty vector or HOXB2. Invasive (left panel) and migrated (right panel) cells were stained with DAPI and counted. Figure 2h is a diagram showing the wound healing assay of MDA-MB-231 cells transfected with empty vector or HOXB2. 2i and 2j are diagrams showing the results of analyzing the expression level of epithelial or mesenchymal markers in siHOXB2 transfected T47D cells or HOXB2 overexpressing MDA-MB-231 cells through qPCR and western blotting. Figure 2k shows the results of analysis using immunofluorescence confocal microscopy of epithelial (E-cadherin and Integrin b4) and mesenchymal (N-cadherin and vimentin) markers in MDA-MB-231 cells overexpressing an empty vector or HOXB2. In the figure, nuclei were stained with DAPI (blue). Figure 2l shows the result of observed morphological change from a cobblestone shape to an elongated spindle shape in T47D cells after suppressing HOXB2 expression (upper panel). The opposite result in MDA-MB-231 cells after inducing HOXB2 overexpression. was observed (bottom panel).
3 is a diagram showing that ECM tissue molecules are involved in HOXB2-related breast cancer progression. Figure 3a shows a volcanic plot of gene expression in microarrays generated by comparing a pair of breast cancer tissues with and without HOXB2 altered or unaltered in the TCGA data set, where the blue dots show a marked decrease in expression in patient tissues with altered HOXB2 expression. The figure shows the increased expression (in the overexpressed region) and the overexpressed gene (in the underexpressed region). Figure 3b shows the GO analysis results of HOXB2 dysregulation in the TCGA data set, and the bar graph is a figure showing the significant upper high expression score. Figure 3c shows a heatmap of the microarray gene expression fold change of ECM tissue-related genes in GO analysis, each column is the result for one patient. Figures 3d and 3e are plots showing analysis of TCGA data set (Nature 2012) and Kaplan-Meier survival for nine ECM tissue gene expression in different subtypes of breast cancer. 3f and 3g are diagrams showing the expression levels of nine ECM tissue genes in MDA-MB-231:HOXB2 and MDA-MB-157:HOXB2 cells. Figure 3h is a diagram showing the positive correlation between HOXB2, MATN3, SMOC2, ECM2 and COL8A2 in HOXB2-altered basal-like subtype breast cancer patients.
Figure 4 is a diagram showing that MATN3 and ECM2 are transcriptionally regulated by HOXB2 and are associated with the aggressive phenotype of TNBC. Figure 4a is a diagram showing the expression levels of MATN3, SMOC2, ECM2 and COL8A2 in MDA-MB-231:HOXB2 cells transfected with siRNA for each target gene. *P<0.05, **P<0.01, ***P<0.001. Figure 4b shows transwell analysis of MDA-MB-231:HOXB2 cells transfected with siCON or siMATN3, siSMOC2, siECM2 and siCOL8A2, in which invaded (lower left panel) or migrated (lower right panel) cells were stained with DAPI. and counted. *P<0.05, **P<0.01. Fig. 4c shows a schematic diagram of the predicted binding site of HOXB2 in the designated MATN3 (left panel) and ECM2 (right panel) promoter regions, and the green rectangle indicates the RT-qPCR amplicon site. Figure 4d is a diagram showing ChIP analysis of HOXB2 enrichment in the MATN3 and ECM2 promoter regions, where IgG was used as a negative control. *P<0.05, ***P<0.001. Figure 4e shows a schematic diagram (left panel) of the MATN3 and ECM2 promoter regions cloned into the pGL3 luciferase reporter plasmid, and quantified luciferase activity of the MATN3 and ECM2 promoter reporters in HEK293T cells (right panel). **P<0.01, ***P<0.001. Figures 4f and 4g show the results of analyzing the public data sets GSE65194 and GSE58812 for the expression of MATN3, ECM2 and HOXB2, and the relative mRNA levels of MATN3 and ECM2 were plotted against the mRNA levels of HOXB2.
5 is a diagram showing that overexpression of HOXB2 attenuates TNBC metastasis in vivo. Figure 5a is a diagram showing representative IHC staining images of HOXB2, MATN3 and ECM2 in breast cancer samples, the left panel shows a negative signal for each protein, the middle panel shows a low signal for each protein, and the right panel shows a high signal for each protein, respectively. . Scale bar = 70 μm. 5B is a diagram showing a positive correlation between HOXB2 and MATN3 (upper graph) or between HOXB2 and ECM2 (lower graph). Figure 5c shows the results of analysis of the metastatic breast cancer project data set on the expression of HOXB2 in regional lymph node metastases, the left panel shows metastasis to regional lymph nodes at the time of diagnosis of metastatic disease, and the right panel shows metastases to regional lymph nodes recorded during the treatment of the patient. is a picture showing 5D and 5E are diagrams showing the results of analysis of the metastatic breast cancer project dataset for expression of HOXB2 in brain/CNS and liver metastases. Figure 5f is a diagram showing that HOXB2 overexpression reduces tumor growth in the MDA-MB-231 xenograft mouse model, the left panel shows tumor growth calculated and compared between each time point, and the right panel shows the MDA-MB-231: Figures showing resected tumors from mice injected with Emp.Vec and MDA-MB-231:HOXB2 cells. In FIG. 5G , each circle (injected with control cells) and triangles (injected with HOXB2 overexpressing cells) represent each lung and open circles indicate that the tumor has metastasized and developed in the lung. The lower panel shows representative pictures of lungs collected in each condition, with arrows representing tumors formed in the lungs. Figure 5h is a diagram showing the mRNA expression levels of HOXB2, MATN3 and ECM2 in metastatic and non-metastatic primary tumors of the lung.
6 is a diagram showing that HOXB2, MATN3 and ECM2 are potent clinical markers for various cancer patients. 6A to 6G are diagrams showing Kaplan-Meier OS analysis, in which FIG. 6A is ER-positive, FIG. 6B is PR-positive, FIG. 6C is lymph node-positive, FIG. 6D is lymph node-negative, FIG. 6E is grade I, FIG. 6f shows a graph comparing high and low expression of HOXB2 in grade II and grade III cancers. FIG. 6h is a diagram showing OS curves of total breast cancer patients with high or low HOXB2/MATN3/ECM2 expression. Figures 6i-6k show Kaplan-Meier OS analysis, comparing the levels of HOXB2 or HOXB2/MATN3/ECM2 expression in lung cancer (Figure 6i), renal clear cell carcinoma (Figure 6j) and hepatocellular carcinoma (Figure 6k), respectively. . For survival analysis, HOXB2 (205453_at), MATN3 (206091_at) and ECM2 (206101_at) probes were selected and analyzed. 6L shows a schematic model of the coordinated role of HOXB2 in TNBC carcinogenesis.
7 is a diagram showing the expression level of anterior HOXB cluster genes in various types of breast cancer. 7A and 7B are diagrams showing the analysis of the METABRIC data set (Nat 2012 & Nat Commun 2016) and the SMC data set (SMC 2018) on the expression of HOXB2 in various subtypes of breast cancer. 7c to 7e are diagrams showing the analysis of the TCGA data set ( Nature 2012) for the expression of HOXB1, HOXB3 and HOXB4 in various breast cancer subtypes.
8 is a diagram illustrating a Kaplan-Meier overall survival (OS) analysis comparing the expression level of HOXB3 in breast cancer. 8A and 8B show OS analysis for the relationship between survival time and HOXB3 expression characteristics in breast cancer using the Kaplan-Meier plotter online tool, and the HOXB3 228904_at and 208414_at probes were selected and analyzed for survival analysis. indicates.
9 is a diagram showing that HOXB2 attenuates invasion and migration ability in non-TNBC cells. Figure 9a is a diagram showing the protein level of knockdown HOXB2 in MCF7 breast cancer cells. Figure 9b shows transwell analysis of MCF7 cells transfected with siCON or siHOXB2, invading (left panel) and migrating (right panel) cells were stained with DAPI and counted. 9c is a diagram showing the protein level of HOXB2 knocked down in MDA-MB-453 breast cancer cells. FIG. 9D is a diagram showing transwell analysis of MDA-MB-453 cells transfected with siCON or siHOXB2, and cells that were invaded (left panel) and migrated (right panel) were stained with DAPI and counted.
10 is a diagram showing the expression level of the extracellular matrix (ECM) gene in HOXB2 dysregulated breast cancer. 10A is a diagram showing the expression levels of nine extracellular matrix genes in T47D cells transfected with siCON or siHOXB2. 10B is a diagram showing the expression levels of HOXB2, LAMB2, LAMA2, JAM2, JAM3 and DCN in HOXB2-altered basal-like subtype breast cancer patients.
11 is a diagram showing HOXB-AS1 is a positive upstream regulator of HOXB2 expression in breast cancer cell lines. 11A is a diagram showing the location of the HOXB2 and HOXB-AS1 genes on human chromosome 17, the box indicates the exon, the line indicates the intron, the arrow indicates the transcription direction, and the arrowhead indicates the genomic position of the target siRNA sequence. 11B shows the TCGA data set (Nature 2012) analysis of the expression of HOXB-AS1 in various breast cancer subtypes. 11C shows the correlation curve between HOXB2 and HOXB-AS1 expression in the TCGA breast cancer tissue database, FIG. 11D shows the correlation curve between HOXB2 and HOXB-AS1 in the CCLE breast cancer cell line database, and FIG. 11E shows siHOXB2 for 24 hours. Figure showing real-time qPCR values of HOXB2 and HOXB-AS1 in T47D and MCF7 cell lines transiently transfected with 11f shows real-time qPCR values of HOXB2 and HOXB-AS1 in T47D cells transiently transfected with siHOXB-AS1 for 24 hours, and FIG. 11g shows transwell analysis of T47D cells transfected with siCON or siHOXB-AS1; Invasive (left panel) and migrating (right panel) cells were stained with DAPI and counted. 11H is a diagram showing real-time qPCR values of HOXB2 and HOXB-AS1 in MCF7 cells transiently transfected with siHOXB-AS1 for 24 hours. 11I shows transwell analysis of MCF7 cells transfected with siCON or siHOXB-AS1, invading (left panel) and migrating (right panel) cells were stained with DAPI and counted.
12 is a diagram showing that the increase in SMYD3 by HOXB-AS1 causes the increase in HOXB2 expression in breast cancer cell lines by mediating the increase in H3K4me3. 12A shows a schematic diagram of the HOXB2 and HOXB-AS1 loci on human chromosome 17, the boxes indicate exons, lines indicate introns, and arrows indicate transcription directions. Gray bars show the amplicon sites used for chromatin immunoprecipitation-qPCR (ChIP-qPCR). 12b-d are diagrams showing ChIP-qPCR analysis of (b) H3K4me3, (c) H3K27me3 and (d) H3K9ac in various breast cancer cell lines. 12E shows the TCGA data set (Nature 2012) analysis of the expression of SMYD3 in various breast cancer subtypes, FIG. 12F shows the correlation curve between HOXB2 and SMYD3 in the CCLE breast cancer cell line database, and FIG. 12G shows the various breast cancer cell lines. It is a figure showing the value of RIP-qPCR analysis for the interaction between HOXB-AS1 and SMYD3 in 12h is a diagram showing ChIP-qPCR analysis of SMYD3 and H3K4me3 in HOXB-AS1-knockdown ER+ breast cancer cell line. All experiments were repeated three times.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Experimental method

cell line

The parental BT474, MCF7, T47D, MDA-MB-453 and MDA-MB-231 cell lines were purchased from the American Type Culture Collection Bioresource Center (Manassas, VA, USA). MDA-MB-157 and MDA-MB-468 cell lines were provided by Professor Jong-Hoon Park, Sookmyung Women's University. These breast cancer cell lines were cultured as previously reported and periodically checked for mycoplasma contamination. For overexpression studies, cells were transfected with GFP-HOXB2 plasmid (pCMV6-AC-GFP vector backbone; Origene, Rockville, MD, USA) for 24 h using Attractene Transfection Reagent (Qiagen, Hilden, Germany) according to the manufacturer's protocol. infected. GFP-HOXB2 plasmid transfected cells were treated with neomycin (0.5 mg/ml; Thermo Fisher Scientific, Waltham, MA, USA) for 2 weeks to generate stable cell lines overexpressing HOXB2. For transient knockdown study, HOXB2-siRNA (Genolution, Seoul, Korea), MATN3-siRNA (Genolution), SMOC2-siRNA (Genolution), ECM2-siRNA (Genolution), COL8A2-siRNA (Genolution) and control siRNA were incubated for 48 hours. Transfected at a final concentration of 40 nM.

Real-time quantitative polymerase chain reaction (qPCR)

Real-time qPCR analysis was performed by a previously reported method using the StepOnePlus™ real-time quantitative polymerase chain reaction system (Applied Biosystems, Foster City, CA, USA) and the Power SYBR Green PCR Master Mix (Applied Biosystems) kit [26] . All samples were analyzed in triplicate and HOXB2 expression was normalized to the expression of beta-actin used as an internal loading control. The primers for PCR are as follows: human HOXB2 : F-5'-TTC ACC AGT ACG CTC TGT GC-3', R-5'-AAA GAT AAC CGA GTG CCC AAT-3'; Human CDH1 : F-5'-AGG ACC AGG ACT TTG ACT TG-3', R-5'-ATT GCC CCA TTC GTT CAA GT-3'; Human ITGB4 : F-5'-TGA GCC ACT GGA GAG CC-3', R-5'-TCA TGT CCG TCT GCG GG-3'; Human CDH2 : F-5'-CGT GAA GGT TTG CCA GTG TG-3', R-5'-CGG ATT CCC ACA GGC TTG AT-3'; Human VIM : F-5'-CTG CCA ACC GGA ACA ATG AC-3', R-5'-CAT TTC ACG CAT CTG GCG TT-3'; Human MATN3 : F-5'-CTC TAT GCT GTG GGC GTG G-3', R-5'-TGG CAC TGG TGT GTT CCA A-3'; Human SMOC2 : F-5'-CAA AGC GGA CAC CAA GAA ACG-3', R-5'-GTG TCT AGG AAC TGC CTT CGG-3'; Human LAMB2 : F-5'-GTA CGT GGC AAC TGC TTC TG-3', R-5'-GAA ATC CTG ACA CTG CTC GC-3'; Human ECM2 : F-5'-CTC ACT GGC AAT TCC ATC GC-3', R-5'-GGA CCT ATG CCT GAA GAA GTG A-3'; Human DCN : F-5'-GGG ATA GGC CCA GAA GTT CC-3', R-5'-CAG AAC ACT GGA CCA CTC GAA-3'; Human COL8A2 : F-5'-ACC CAA ATC TGC CCA AGT GA-3', R-5'-AGA GGT TGA GCG AAG AAC CC-3'; Human LAMA2 : F-5'-GAA CCC GCA GTG TCG AAT C-3', R-5'-GGA CTC TGC CAC CAA GTG T-3'; Human JAM2 : F-5'-ATT AGT GGC TCC AGC AGT TCC-3', R-5'-CCA TGT GTA TTC AGG AGC TGG A-3'; Human JAM3 : F-5'-CCA GTA GGC AAG ATG GCA AC-3', R-5'-CCC AGA GTC GTC CTT GTG AA-3'; and human beta-actin : F-5'-CAT GTT TGA GAC CTT CAA CAC CCC-3', R-5'-GCC ATC TCC TGC TCG AAG TCT AG-3'.

Western blotting and antibodies

Western blot analysis was performed by a previously reported method [26]. anti-HOXB2 (1:1000, ab220390, Abcam, Cambridge, UK), anti-E-cadherin (1:10000, ab40772, Abcam), anti-integrin b4 (1:2000, ab133682, Abcam), anti-N Each protein was detected using -cadherin (1:1000, ab18203, Abcam), anti-vimentin (1:5000, ab92547, Abcam) and anti-beta-actin (1:10000, ab6276, Abcam) antibodies. .

Matrigel invasion and migration analysis

The Matrigel invasion assay was performed according to a previously reported method using Matrigel™ (BD Biosciences, Franklin Lakes, NJ, USA) [27]. Mobility analysis was performed using the same protocol in the absence of Matrigel. For the experiment, 5 × 10 ⁴ cells were placed in each chamber. After cell line-dependent 24-72 hours of incubation, the invading cells were stained with a fluorochrome 4,6-diamidino-2-phenylindole (DAPI) and observed through a fluorescence microscope (Nikon Instruments Inc., Melville, NY, USA). . The acquired images were analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

wound healing analysis

Cells were cultured in 24-well culture vessels at a density of 6 x 10 ⁵ cells/well until confluent, and then straight wounds were made in monolayers using a 200 μl pipette tip. After washing with a culture solution to remove cell debris, a monolayer with wounds was cultured in a culture solution, wound gaps were photographed at regular intervals (0, 12, 24 hours), and the wound area without cells was measured. Results were obtained from at least three independent experiments.

Immunocytochemistry (ICC) analysis

ICC analysis was performed using the manufacturer's ICC protocol (Abcam). Anti-E-cadherin (1:300, ab40772, Abcam), anti-integrin b4 (1:300, ab133682, Abcam), anti-N-cadherin (1:500, ab18203, Abcam), anti-vimentin (1:500, ab92547, Abcam) was used to detect each protein, and the nucleus was counterstained with DAPI. Images were captured with a 40 x C-Apochromat water immersion lens on a Zeiss LSM 700 confocal microscope (Oberkochen, Germany) using Zen 2011 software.

Chromatin Immunoprecipitation (ChIP) Assay

ChIP analysis was performed with a slight modification of the previously reported method [26]. Anti-HOXB2 antibodies (ab220390, Abcam) were used for immunoprecipitation. ChIP-PCR data are expressed as a percentage of the input after normalization to IgG. The primers used for ChIP-PCR are as follows. MATN3 site #1: F-5'-GCG AGG CTC GGA TTT AAA GG-3', R-5'-CAG ACA TTC CGT TTC TGC CG-3'; MATN3 site #2: F-5'-TCA GGA AGG GTT TGC TCA CT-3', R-5'-GAT GTG GGT CTC CTG AAG CTC-3'; ECM2 site #1: F-5'-AGG CTT TGC TTG GTG TCA TTT-3', R-5'-TAT CCC CAA GGG AGG CAG TT-3'; ECM2 site #2: F-5'-TCA GCC AAG AAA GTA ACC AGG G-3', R-5'-TCC AAC TCT GCC TTT TCA GC-3'; and gene desert, F-5'-TGG TGG TCT GCC TTC TGC CAG T-3', R-5'-TCA CGT GGG AGG AAG AAG TAG GGC-3'.

Dual luciferase assay

The double luciferase assay was performed as previously reported [28]. Genomic DNA fragments of the MATN3 and ECM2 promoter regions were cloned into the pGL3-Basic vector (Promega, Madison, WI, USA). Control pGL3-Basic vector, pGL3-MATN3 or pGL3-ECM2 constructs were transfected with Renilla luciferase vector (pRL Renilla luciferase control) into HEK293T cells.

animal testing

All animal experiments were approved by the Animal Care Committee of Yonsei University Animal Research Institute (IACUC No: 2020-0197) and were performed in accordance with the guidelines for the care and use of laboratory animals. BALB/c nude mice were purchased from Orient Bio Inc. (Seongnam, Gyeonggi-do, Korea). All mice were maintained in a 12 h light/12 h dark condition in a barrier facility free of specific pathogens. For xenograft experiments, 2.0 x 10 ⁶ MDA-MB-231 cells, empty vector overexpressing MDA-MB-231 (MDA-MB-231:Emp.Vec) cells and HOXB2 overexpressing MDA-MB-231 (MDA-MB-231) cells. :HOXB2) cells were suspended in 100 μl PBS and a mixture of Matrigel (BD Bioscience) (50:50 v/v) and injected subcutaneously into the fat pad of test animals. Tumor volume was monitored using calipers for 40 days. When the tumor size reached 10 mm ³ , the tumor volume (V) was calculated using the equation V(mm ³ ) = 3.14 x width (W) x length (L) x height (H)/6. Eight weeks after injection, mice were euthanized and internal organs dissected for metastasis analysis.

Tissue microarray and immunohistochemistry (TMA-IHC) analysis

Formalin-fixed paraffin-embedded human breast cancer tissue microarrays containing 100 invasive carcinomas of no particular type were obtained from US Biomax (Rockville, BC081116d, MD, US Biomax Inc.). Before deparaffinizing with xylene, the slides were baked in an incubator at 60° C. for 1 hour. The rehydration operation was performed while the ethanol concentration was gradually decreased from 100% to 95%, 85%, and 70% for 1 minute. For antigen retrieval, slides were soaked in citrate buffer and boiled in a microwave for 10 minutes. Sufficiently cooled slides were stained with Novolink Polymer Detection Systems (Leica Biosystems Inc., Buffalo Grove, IL) according to the manufacturer's instructions. Anti-HOXB2 (1:200, ab220390, ABCam), anti-MATN3 (1:100, ab238893, ABCam) and anti-ECM2 (1:300, ab122268, ABCam) antibodies were prepared in Tween 20 (PBST) buffered phosphate solution. diluted. DAB staining was performed until the tissue sections were colored brown. Tissue samples were then dehydrated with 70%, 85%, 95%, 100% ethanol and removed with xylene. DAB signals for 100 breast cancers were scored using ImageJ software. Negative/low/high levels were classified based on scores for each protein signal intensity and region.

RNA Immunoprecipitation (RIP) Analysis

The RIP analysis was performed with a slight modification of the previously reported method. Briefly, 1 x 10 ⁷ cells/antibody were collected and lysed on ice for 10 min in RIP buffer containing protease inhibitors and then sonicated with Sonics Vibra Cell ^™ (5 min: 10 sec pulse, 10 sec interval) on ice. did. The lysate was centrifuged at 12,000 x g for 5 min at 4 °C and the supernatant was taken. Samples were first incubated with anti-SMYD3 (ab228015, Abcam, Cambridge, UK) and non-immune mouse IgG (sc2025, Santacruz, CA, USA) antibodies at 4 °C for a minimum of 4 h, followed by protein-coated A/G agar Ross beads (Santa Cruz, CA, USA) were added and incubated overnight at 4 °C with gentle shaking. The next day, the immunoprecipitated eluate was resuspended in 1 mL TRIzol, RNA was extracted, and the desired product was detected by real-time-qPCR.

Bioinformation analysis

Survival analyzes were performed using a Kaplan-Meier plotter (http://kmplot.com) and Irish Cancer Molecular Therapy (MTCI; http://glados.ucd.ie/BreastMark/index.html)). The web-accessible database cBioPortal (https://www.cbioportal.org) has determined the genetic modification of HOXB2 in various breast cancer subtypes (TCGA, Nature 2012, MESABRIC , Nature 2012 and Nat Communication 2016, SMC 2018) and has been was used to determine the expression level. The GEO data sets (GSE65194 and GSE58812) were used to evaluate the positive correlation between HOXB2 expression and HOXB2 and MATN3/ECM2 in breast cancer patients. DAVID v6.8 (https://david.ncifcrf.gov/home.jsp) was used for gene ontology (GO) analysis.

statistical analysis

Data were expressed as mean ± standard error, and statistical significance was determined using Student's t-test, one-way ANOVA or chi-square test. A p-value <0.05 was considered to have statistical significance.

Nucleotide and amino acid sequence information of the target gene first sequence HOXB2 mRNA second sequence HOXB2 amino acids 3rd sequence HOXB-AS1 mRNA 4th sequence HOXB3 mRNA 5th sequence HOXB3 amino acids 6th sequence MATN3 mRNA 7th sequence MATN3 amino acids sequence 8 ECM2 mRNA ninth sequence EMC2 amino acids sequence 10 SMYD3 mRNA sequence 11 SMYD3 amino acids

Experiment result

Downregulation of HOXB2 is associated with TNBC.

The TCGA data set was used to determine whether HOXB2 expression differed between different breast cancer subtypes. Changes in HOXB2 expression were significantly increased in basal-like breast cancer compared to other subtypes (Fig. 1a). In particular, genetic alterations such as mRNA underexpression and missense mutations ultimately leading to HOXB2 downregulation were particularly frequent in basal-like subtypes, whereas the genetic alterations responsible for HOXB2 upregulation were associated with luminal A, B and HER2 abundance and It was found only in the same subtype (Fig. 1b). To further study the HOXB2 expression characteristics in breast cancer, microarray analysis was performed. The expression level of HOXB2 was similar in normal-like, luminal A, B and HER2-rich breast cancer subtypes, but HOXB2 expression was significantly lower in basal-like breast cancer ( FIG. 1C ). GSE65194 (41 TNBC, 30 HER2-enriched breast cancer, 29 luminal A and 30 luminal B breast cancer, FIG. 1D), METABRIC (199 TNBC, 220 HER2-rich breast cancer and 279 luminal A and 461 luminal B breast cancer) and Similar expression patterns were observed in other datasets of SMCs (36 TNBC, 18 HER2-enriched breast cancer, 47 luminal A and 65 luminal B breast cancer datasets) ( FIGS. 7A-B ). We also examined the gene expression of the anterior HOXB genes (HOXB1, B3 and B4) adjacent to HOXB2 because the HOX gene is clustered. Among the anterior HOXB genes, HOXB3 was also reduced in TNBC expression (Fig. 7c-e).

Therefore, we further investigated the correlation between the expression of HOXB2 and HOXB3 and the clinical characteristics of breast cancer patients. As a result of survival analysis using the Kaplan-Meier and MTCI databases, it was confirmed that the lower the HOXB2 expression, the significantly decreased the overall survival rate (OS) of breast cancer patients (FIGS. 1e-f). Nevertheless, the expression level of HOXB3 did not affect patient prognosis, suggesting that HOXB2 is a pivotal component in regulating the TNBC-associated phenotype (Fig. 8a-b). Real-time qPCR and Western blot analysis showed lower expression levels of HOXB2 in TNBC than in non-TNBC cell lines (Fig. 1g–h), further supporting the involvement of HOXB2 in tumor aggressiveness and poor patient outcomes.

HOXB2 attenuates aggressive phenotype and EMT characteristics in breast cancer cells

To evaluate the functional role of HOXB2 in breast cancer progression, siRNA was used to suppress HOXB2 expression in the T47D ER+ breast cancer cell line ( FIGS. 2a-b ), and then, invasion and migration assays were performed. HOXB2 knockdown greatly enhanced the invasion and migration ability of T47D cells (Fig. 2c). Also, similar results were observed when HOXB2 was knocked down in MCF7 ER+ breast cancer cells (FIG. 9A) (FIG. 9B). In addition, the wound healing ability of HOXB2-depleted T47D (T47D:siHOXB2) cells was higher than that of control cells ( FIG. 2D ). On the other hand, when HOXB2 was overexpressed in MDA-MB-231 TNBC cells (FIG. 2e-f), invasion and migration ability was reduced (FIG. 2g). Also, MDA-MB-231:HOXB2 cells did not heal wounds as rapidly as control cells (Fig. 2h). These results suggest that HOXB2 deficiency promotes epithelial-mesenchymal transition (EMT) in breast cancer cells.

To investigate the effect of HOXB2 on EMT in breast cancer, EMT marker gene expression by RT-qPCR was measured using T47D:siHOXB2 cells, MDA-MB-231:HOXB2 cells and their respective control cells. Expression of epithelial genes such as CDH1 and ITGB4 was downregulated in the absence of HOXB2 in T47D cells and upregulated when HOXB2 was overexpressed in MDA-MB-231 cells. In contrast, the mesenchymal genes CDH2 and VIM were upregulated in T47D:siHOXB2 cells and downregulated in MDA-MB-231:HOXB2 cells (Fig. 2i). Similarly, the protein levels of these EMT-related markers were consistent with the corresponding gene expression patterns (Fig. 2j). Similarly, increased function of HOXB2 in MDA-MB-231 cells was associated with significant epithelial marker induction and an apparent decrease in mesenchymal marker levels (Fig. 2k). In addition, cell morphology was altered upon HOXB2 manipulation ( FIG. 2L ). These results suggest that HOXB2 functions as a key factor in EMT regulation in breast cancer cells.

Genome-wide identification of HOXB2 transcriptional targets in breast cancer

To further investigate the molecular mechanism of HOXB2 in TNBC, genes expressed in a pattern similar to HOXB2 were analyzed using cBioPortal (Fig. 3a). As a result of applying a 2-fold change as a cutoff, it was found that most genes showing abnormal regulation with HOXB2 were related to ECM tissue, collagen treatment, and cell adhesion (Fig. 3b). As a result of examining the expression between these genes and other breast cancer subtypes using a heat map, 67 genes were identified (FIG. 3c). Among them, MATN3 , SMOC2 , LAMB2 , LAMA2 , JAM2 , JAM3 , ECM2 , DCN and COL8A2 were exclusively decreased in TNBC compared to ER+ breast cancer, and their expression was reduced in TNBC compared to ER+ breast cancer, and their expression was normal-like breast cancer, basal-like breast cancer compared to ER+ and/or HER2+ was significantly downregulated. In addition, the expression of these 9 genes is strongly associated with poor OS in breast cancer patients (Fig. 3e).

To further explore the molecular mechanisms underlying the interaction between HOXB2 and the nine genes, RT-qPCR was performed on empty vector or HOXB2-overexpressing MDA-MB-231 and MDA-MB-157 TNBC cells. MATN3, SMOC2, ECM2 and COL8A2 were significantly upregulated when HOXB2 was overexpressed in both cell lines, showing consistency across cell lines (Fig. 3f-g). In addition, these genes were significantly downregulated in T47D:siHOXB2 cells (Fig. 10a). Consistent with this , MATN3, SMOC2, ECM2 and COL8A2 overexpression positively correlated with HOXB2 expression in TNBC patients with altered HOXB2 expression (Fig. 3h). However, expression of other factors related to ECM tissue ( LAMB2, DCN, LAMA2, JAM2 and JAM3 ) was not associated with HOXB2 expression (Fig. 10b).

MATN3 and ECM2 are transcriptionally regulated by HOXB2 and are associated with the aggressive phenotype of TNBC.

Given that HOXB2 functions as a transcription factor, we hypothesized that HOXB2 could become an upstream regulator of MATN3, SMOC2, ECM2 and COL8A2 , leading to aggressive TNBC properties. To confirm this, RT-qPCR was first performed using MDA-MB-231:HOXB2 cells transiently transfected with siRNA targeting MATN3, SMOC2, ECM2 or COL8A2 . Despite HOXB2 overexpression, siRNA successfully knocked down each downstream target gene (Fig. 4a). Invasion and migration assays using transiently transfected MDA-MB-231:HOXB2 cells (in the absence of MATN3 and ECM2) showed that, despite HOXB2 overexpression, cells easily invaded and migrated through the pore compared to that of parental or control cells. showed that (Fig. 4b). However, deficiency of SMOC2 and COL8A2 did not affect the ability of cells to invade and/or migrate (Fig. 4b).

MATN3 is highly expressed in patients with gastric adenocarcinoma and has been found to be associated with recurrence in patients undergoing therapeutic surgery and chemoradiation. Expression of ECM2 also indicates an aggressive clinical phenotype of breast cancer. In addition, both genes encode important ECM proteins involved in various cellular functions, including cell invasion, migration, and remodeling of the ECM. Given that MATN3, ECM2 and HOXB2 expression are correlated, the functional relationship between them was further investigated. The putative promoter regions of MATN3 and ECM2 were identified by increased RNA polymerase II (Pol2) and histone H3 lysine 4 trimethylation (H3K4me3). To investigate whether HOXB2 functions as a transcription factor, we designed an amplicon site for ChIP experiments (Fig. 4c). Quantitative ChIP analysis was performed on the MATN3 and ECM2 promoter regions with an antibody against HOXB2 using MDA-MB-231:HOXB2 cells, showing that HOXB2 can bind to and regulate expression in the promoter region of the target gene (Fig. 4d). To further support that HOXB2 functions as a transcriptional regulator of MATN3 and ECM2, luciferase promoter analysis was performed in the HEK293T cell line. As expected, HOXB2 overexpression increased the promoter activity of MATN3 and ECM2 compared to parental and control HEK293T cells (Fig. 4e).

Because there was a positive correlation between the expression of HOXB2, MATN3 and ECM2 in breast cancer cells, we reanalyzed data from patient samples in accessible clinical data sets (GSE65194 and GSE58812). HOXB2 expression strongly positively correlated with expression of MATN3 and ECM2 in both data sets, supporting our novel finding that MATN3 and ECM2 are transcriptionally regulated by HOXB2 (Fig. 4f-g).

HOXB2 overexpression attenuates TNBC metastasis in vivo

To further confirm the therapeutic significance of the HOXB2/MATN3/ECM2 transcriptional axis in breast cancer treatment, IHC for HOXB2, MATN3 and ECM2 was performed using 100 human tissue samples from breast cancer patients obtained from US Biomax (Fig. 5a). As a result of comparing the IHC scores of HOXB2, MATN3 and ECM2 by Pearson correlation analysis, both MATN3 (Fig. 5b, upper graph) and ECM2 (Fig. 5B, lower graph) expression were positively correlated with HOXB2 expression in human breast cancer tissues. In addition, according to the signal intensities of HOXB2, MATN3 and ECM2, clinicopathological features including age, hormone receptor status, histological grade, clinical stage, and Ki67 score were classified into “negative/low” and “high” status and investigated (Table). 2). HOXB2 expression was significantly positively correlated with hormone receptor expression. That is, HOXB2-negative/low expression was observed in TNBC patients. Moreover, Ki67, a marker of cell proliferation, also significantly positively correlated with HOXB2 expression (Table 2). MATN3 expression was also significantly positively correlated with hormone receptor expression, clinical stage and Ki67 expression. ECM2 expression also correlated with hormone receptor expression (Table 2). These findings support that HOXB2 is consistently associated with TNBC and its function. Therefore, using data from the Metastatic Breast Cancer Project, the degree of metastasis according to HOXB2 expression was investigated. As a result, we found that breast cancer metastasized to regional lymph nodes, brain and central nervous system (CNS), and liver when HOXB2 levels were low (Fig. 5c-e). When HOXB2 expression was low, metastasis occurred during treatment regardless of whether it was an existing or newly formed metastatic tumor. These data are consistent with the results of in silico and in vitro studies, suggesting that HOXB2 plays an important role in breast cancer invasion and migration, and ultimately metastasis in TNBC patients.

To evaluate whether metastasis is inhibited by the presence of HOXB2 in vivo, MDA-MB-231:Emp.Vec and MDA-MB-231:HOXB2 cells were subcutaneously injected into the mammary fat pad of BALB/c nude mice. After monitoring the growth of the primary tumor in each mouse for 8 weeks, the animals were sacrificed to measure the degree of cancer metastasis to the lungs. Test animals injected with MDA-MB-231:Emp.Vec showed significant tumor growth, whereas mice injected with MDA-MB-231:HOXB2 cells were unable to form tumors of substantial size. At day 58, the mean tumor volume was 131.82 ± 13.18 mm ³ and 27.29 ± 4.8 mm ³ in the control and HOXB2 overexpressing groups, respectively ( FIG. 5f ). In particular, metastatic lung tumors were found in 3 out of 5 MDA-MB-231:Emp.Vec-injected mice, but no tumors were observed in MDA-MB-231:HOXB2 injected mice, indicating that HOXB2 overexpression caused lung metastasis. It shows that it protects the mouse from (Fig. 5g). In addition, primary and lung metastatic tumors were collected and sampled to investigate the expression levels of HOXB2 and its downstream genes using RT-qPCR. As a result, the expression of HOXB2, MATN3 and ECM2 was significantly higher in metastatic tumors compared to primary tumors. inhibited (Fig. 5h).

Clinicopathological characteristics and expression of HOXB2, MATN3 and ECM2 proteins in breast cancer patients (n=100) HOXB2 score P-value MATN3 score P-value ECM2 score P-value Low High Low High Low High Age (years) 0.335 0.236 0.475 ≤ 50 20 (71.4%) 44 (61.1%) 21 (75%) 45 (62.5%) 20 (71.4%) 46 (63.9%) > 50 8 (28.6%) 28 (38.9%) 7
(25%) 27 (37.5%) 8 (28.6%) 26 (36.1%) ER status 1.74E-05 0.001 0.004 voice 19 (67.9%) 16 (22.2%) 18 (64.3%) 17 (23.6%) 16 (57.1%) 19 (26.4%) positivity 9 (32.1%) 56 (77.8%) 10 (35.7%) 55 (76.4%) 12 (42.9%) 53 (73.6%) PR status 0.001 0.001 0.031 voice 21 (75.0%) 26 (36.1%) 21 (75%) 26 (36.1%) 18 (64.3%) 29 (40.3%) positivity 7 (25.0%) 46 (63.9%) 7
(25%) 46 (63.9%) 10 (35.7%) 43 (59.7%) HER2 status 0.013 0.449 0.276 voice 23 (82.1%) 40 (55.6%) 16 (57.1%) 47 (65.3%) 20 (71.4%) 43 (59.7%) positivity 5 (17.9%) 32 (44.4%) 12 (42.9%) 25 (34.7%) 8 (28.6%) 29 (40.3%) LN metastasis 0.715 0.383 0.096 voice 20 (71.4%) 54 (75.0%) 19 (67.9%) 55 (76.4%) 24 (85.7%) 50 (69.4%) positivity 8 (28.6%) 18 (25.0%) 9 (32.1%) 17 (23.6%) 4 (14.3%) 22 (30.6%) histological grade 0.884 0.383 0.607 I, II 21 (75.0%) 55 (76.4%) 19 (67.9%) 55 (76.4%) 20 (71.4%) 55 (76.4%) III 7 (25.0%) 17 (23.6%) 9 (32.1%) 17 (23.6%) 8 (28.6%) 17 (23.6%) Stage 0.089 0.039 0.533 I - II 25 (89.3%) 53 (73.6%) 18 (64.3%) 60 (83.3%) 23 (82.1%) 55 (76.4%) III - IV 3 (10.7%) 19 (26.4%) 10 (35.7%) 12 (16.7%) 5 (17.9%) 17 (23.6%) Ki67 2.67E-09 0.026 0.368 ≤ 20% 9 (32.1%) 65 (90.3%) 21 (75%) 66 (91.7%) 23 (82.1%) 64 (88.9%) > 20% 19 (67.9%) 7 (9.7%) 7 (25%) 6 (8.3%) 5 (17.9%) 8
(11.1%)

HOXB2 and MATN3/ECM2 are downregulated in multiple carcinomas, which correlate with poorer OS.

As HOXB2 directly regulates MATN3 and ECM2 at the transcriptional level and induces their reduction in TNBC cells, leading to an aggressive EMT-associated phenotype and ultimately metastasis, the Kaplan-Meier survival curve was used to investigate whether these findings also apply in the clinical setting. wanted to As a result, low expression of HOXB2 was associated with poor OS in both ER and PR-positive breast cancer patients (Fig. 6a-b). We also observed that low HOXB2 expression leads to poor OS in lymph node-negative breast cancer patients. However, a similar survival curve was shown in lymph node-positive breast cancer patients regardless of the expression level of HOXB2 ( FIGS. 6c-d ). This supports that HOXB2, when expressed at low levels in early-stage cancer (lymph node negative), can regulate invasion and migration of TNBC cells and ultimately lead to metastatic cancer. Similarly, low HOXB2 expression was significantly associated with poor OS in patients with Grade I breast cancer, whereas OS in patients with more advanced Grade II and III cancers was not significantly affected by HOXB2 expression levels (Fig. 6e–g). ).

In addition, poor OS in breast cancer patients was significantly associated with simultaneous downregulation of HOXB2, MATN3 and ECM2 (Fig. 6h). The same trend of worse prognosis was observed in patients with lung cancer, renal clear cell carcinoma or hepatocellular carcinoma exhibiting low HOXB2 and/or low HOXB2/MATN3/ECM2 expression ( FIGS. 6i-k ). These results suggest that downregulation of HOXB2 and its downstream factors, MATN3 and ECM2, is involved not only in the malignant progression of breast cancer, but also in the progression of other solid tumors.

HOXB-AS1 is an upstream regulator of HOXB2 expression in breast cancer cell lines

Previously, the present inventors have found that the expression of HOXB2 in TNBC is reduced to promote tumorigenesis and metastasis. To analyze the cause of the decrease in HOXB2 expression, an up-regulator of HOXB2 was searched. Recently, the role of lncRNA (Long non-coding RNA) as a transcriptional regulator of adjacent genes has been highlighted. Within the HOXB cluster is HOXB-AS1, an lncRNA located between HOXB2 and HOXB3 (Fig. 11a). First, we investigated the expression level of HOXB-AS1 in various types of breast cancer using a publicly accessible in silico data set (Fig. 11b). As a result, the expression level of HOXB-AS1 was similar to that of a basal level, with significantly lower expression of HOXB2 compared to other subtypes. It was significantly decreased in breast cancer patients (Fig. 11b). Also, using the data retrieved from TANRIC and CCLE, a positive correlation between HOXB2 and HOXB-AS1 was confirmed in breast cancer patients and cell lines ( FIGS. 11c-d ).

To further confirm the association between HOXB2 and HOXB-AS1, the expression levels of HOXB2 and HOXB-AS1 were investigated after depletion of HOXB2 in T47D and MCF7 cells. Knockdown was successfully performed and the expression of HOXB2 was significantly reduced, but the expression of HOXB-AS1 was not changed ( FIG. 11E ). Conversely, as a result of knocking down HOXB-AS1 in T47D cells and examining whether it can function as a regulator of HOXB2 expression, a significant decrease in the expression of HOXB2 was observed in T47D cells in which the expression of HOXB-AS1 was suppressed compared to control cells ( 11f). Similar results were also observed in MCF7 cells (FIG. 11h). Taken together, it was found that HOXB-AS1 is an important upstream regulator of HOXB2 in breast cancer cells.

To further demonstrate whether the aggressive phenotype of breast cancer cells is induced by HOXB2 expression regulated by HOXB-AS1, invasion and migration assays after HOXB-AS1 knockdown were performed (Figs. 11g and i). When HOXB-AS1 was inhibited, the invasion and migration ability of T47D and MCF7 breast cancer cells was significantly improved ( FIGS. 11g and i ). Through this, it was confirmed that the aggressive phenotype of breast cancer cells develops through the HOXB-AS1/HOXB2 transcriptional axis.

SMYD3 increase induced by HOXB-AS1 regulates HOXB2 expression in breast cancer cell lines by mediating H3K4me3 status.

To understand the molecular mechanism of HOXB-AS1-mediated HOXB2 transcription, we first investigated histone modifications in the HOXB2 promoter region using ER-positive and TNBC breast cancer cell lines. To this end, three amplicon sites (Fig. 12a) were designed and histone 3 lysine 4 trimethylation (H3K4me3), histone 3 lysine 27 trimethylation (H3K27me3) and histone 3 lysine 9 acetylation (H3K9ac) at those sites via ChIP-PCR. ) was analyzed for increase. H3K4me3, which exhibits active gene transcription, was significantly enriched in ER-positive breast cancer cells compared to TNBC cells at all three amplicon sites (Fig. 12b). On the other hand, H3K27me3 and H3K9ac did not show a significant difference between breast cancer subtypes (Fig. 12c-d). Therefore, it was to investigate the reason why H3K4me3 does not match in the HOXB2 promoter region. Among the many histone methyltransferases and histone demethylases involved in the modification of H3K4, SMYD3 was discovered as a possible factor. As a result of analyzing the expression of SMYD3 in normal breast cancer and various breast cancer subtypes using data retrieved from TCGA (Fig. 12e), it was found that the expression level of SMYD3 was particularly low in basal-like breast cancer compared to other subtypes. because of this, It was found that the decrease in the expression level of SMYD3 in TNBC inhibited the increase of H3K4me3 in the HOXB2 promoter, ultimately leading to a decrease in HOXB2.

Therefore, we found a positive correlation between the expression of HOXB2 and SMYD3 in breast cancer cell lines using data retrieved from CCLE (Fig. 12f). Consequently, it was speculated that HOXB-AS1 acts as a guide molecule for SMYD3 to accumulate H3K4me3 in the HOXB2 promoter. RIP analysis was performed to illuminate the connections between HOXB2, HOXB-AS1 and SMYD3 and found that there was a direct interaction between HOXB-AS1 and SMYD3 in non-TNBC cells, but none was observed in TNBC cells (Fig. ). Finally, to confirm that the binding of SMYD3 and ultimately H3K4me3 deposition in the HOXB2 promoter region is mediated by HOXB-AS1, we inhibited HOXB-AS1 in ER-positive breast cancer cells and performed ChIP-PCR analysis. It was confirmed that the binding of SMYD3 and H3K4me3 was significantly disrupted in the absence of AS1 (Fig. 12h).

As described above in detail a specific part of the present invention, for those of ordinary skill in the art, this specific description is only a preferred embodiment, and it is clear that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

references

1. Foulkes WD, Smith IE, Reis-Filho JS: N Engl J Med 2010, 363:1938-1948.

2. Collignon J, Lousberg L, Schroeder H, Jerusalem G: Breast Cancer (Dove Med Press) 2016, 8:93-107.

3. DeSantis CE, Ma J, Gaudet MM, Newman LA, Miller KD, Goding Sauer A, Jemal A, Siegel RL: CA Cancer J Clin 2019, 69:438-451.

4. Frantz C, Stewart KM, Weaver VM: J Cell Sci 2010, 123:4195-4200.

5. Henke E, Nandigama R, Ergun S: Front Mol Biosci 2019, 6:160.

6. Winkler J, Abisoye-Ogunniyan A, Metcalf KJ, Werb Z: Nat Commun 2020, 11:5120.

7. Oskarsson T: Breast 2013, 22 Suppl 2:S66-72.

8. Lu P, Takai K, Weaver VM, Werb Z: Cold Spring Harb Perspect Biol 2011, 3:a005058.

9. Klatt AR, Klinger G, Paul-Klausch B, Kuhn G, Renno JH, Wagener R, Paulsson M, Schmidt J, Malchau G, Wielckens K: FEBS Lett 2009, 583:3611-3617.

10. Yu Y, Chen Y, Ma J, Yu X, Yu G, Li Z: Tumor Biol 2016, 37:4159-4167.

11. Liu X, Zhao J, Luan X, Li S, Zhai J, Liu J, Du Y: Placenta 2020, 89:33-41.

12. Mallo M, Alonso CR: Development 2013, 140:3951-3963.

13. Duboule D: Development 2007, 134:2549-2560.

14. Pearson JC, Lemons D, McGinnis W: Nat Rev Genet 2005, 6:893-904.

15. Soshnikova N, Duboule D: Science 2009, 324:1320-1323.

16. Tschopp P, Tarchini B, Spitz F, Zakany J, Duboule D: PLoS Genet 2009, 5:e1000398.

17. Shah N, Sukumar S: Nat Rev Cancer 2010, 10:361-371.

18. Bhatlekar S, Fields JZ, Boman BM: J Mol Med (Berl) 2014, 92:811-823.

19. Hur H, Lee JY, Yun HJ, Park BW, Kim MH: Mol Biotechnol 2014, 56:64-71.

20. Chen H, Sukumar S: Cancer Biol Ther 2003, 2:524-525.

21. Inamura K, Togashi Y, Ninomiya H, Shimoji T, Noda T, Ishikawa Y: Anticancer Res 2008, 28:2121-2127.

22. Gonzalez-Herrera A, Salgado-Bernabe M, Velazquez-Velazquez C, Salcedo-Vargas M, Andrade-Manzano A, Avila-Moreno F, Pina-Sanchez P: Asian Pac J Cancer Prev 2015, 16:1349-1353.

23. Xu F, Liu Z, Liu R, Lu C, Wang L, Mao W, Zhu Q, Shou H, Zhang K, Li Y, et al: Cell Commun Signal 2020, 18:17.

24. Yu HY, Pan SS: Eur Rev Med Pharmacol Sci 2020, 24:2256-2263.

25. Chen X, Li LQ, Qiu X, Wu H: Neoplasma 2019, 66:386-396.

26. Oh JH, Lee JY, Kim KH, Kim CY, Jeong DS, Cho Y, Nam KT, Kim MH: Cancer Lett 2020, 495:145-155.

27. Oh JH, Hur H, Lee JY, Kim Y, Seo Y, Kim MH: Sci Rep 2017, 7:42256.

28. Oh JH, Lee JY, Yu S, Cho Y, Hur S, Nam KT, Kim MH: Sci Rep 2019, 9:2977.

29. Wu PL, He YF, Yao HH, Hu B: Med Sci Monit 2018, 24:348-355.

30. Heldin P, Basu K, Olofsson B, Porsch H, Kozlova I, Kahata K: J Biochem 2013, 154:395-408.

31. Bergamaschi A, Tagliabue E, Sorlie T, Naume B, Triulzi T, Orlandi R, Russnes HG, Nesland JM, Tammi R, Auvinen P, et al: J Pathol 2008, 214:357-367.

32. Yiqi Z, Ziyun L, Qin F, Xingli W, Liyu Y: Technol Cancer Res Treat 2020, 19:1533033820980769.

33. Lu XD, Liu YR, Zhang ZY: Eur Rev Med Pharmacol Sci 2020, 24:5231-5241.

34. Jakharia A, Borkakoty B, Singh S: J Gastrointest Oncol 2016, 7:278-283.

35. Li H, Zhu G, Xing Y, Zhu Y, Piao D: J Int Med Res 2020, 48:300060519883731.

36. Dongre A, Weinberg RA: Nat Rev Mol Cell Biol 2019, 20:69-84.

37. Zeisberg M, Neilson EG: J Clin Invest 2009, 119:1429-1437.

38. Scheau C, Badarau IA, Costache R, Caruntu C, Mihai GL, Didilescu AC, Constantin C, Neagu M: Anal Cell Pathol (Amst) 2019, 2019:9423907.

<110> Yonsei University Industry-Academic Cooperation Foundation <120> A Novel Biomarker for Diagnosing Breast Cancer <130> PDPB214167k01 <150> KR 10-2021-0047058 <151> 2021-04-12 <160> 51 <170> KoPatentIn 3.0 <210> 1 <211> 1562 <212> DNA <213> Homo sapiens <400> 1 gggtgcagga ggggggtccc ttccgatcct ccctcctgac gcccccccca gcagccccct 60 cccccaccat tgaaagccat gaattttgaa tttgagaggg agattgggtt tataaacagc 120 cagccgtcgc tcgccgagtg tctgacttcc ttccccgctg tcttggagac atttcaaact 180 tcatcaatca aggagtcgac attaattcct cctcctcctc ctttcgagca aaccttcccc 240 agcctccagc ccggcgcctc cacccttcag agacccagga gccaaaagcg agccgaagat 300 gggcctgctc tgccgccgcc accgccgccg ccactccccg ctgccccccc ggcccccgag 360 ttcccttgga tgaaagagaa gaaatccgcc aagaaaccca gccaatccgc cacgtctcct 420 tctccggccg cctccgccgt tccggcctcc ggggtcggat cgcctgcaga tggcctggga 480 ctgccggagg ctggtggcgg cggggcgcgc aggctgcgca cggcttacac caacacgcag 540 ctgctggaac tggagaagga attccacttt aataagtacc tgtgccggcc acgccgcgtc 600 gagatcgcgg ccttgctgga cctcaccgaa ag gcaggtca aagtctggtt tcagaaccgg 660 cgcatgaagc acaagcggca gacgcagcac cgagagccgc cggatgggga gcctgcctgc 720 ccgggagccc tggaggacat ctgcgaccct gccgaggaac ccgcggccag cccgggcggc 780 ccctccgcct cgcgggcggc gtgggaagcc tgctgtcacc cgccggaggt ggtgccgggg 840 gccttaagcg cggacccccg gcctttagcc gttcgcttag agggcgcagg cgcgtcgagt 900 cccggctgcg cgctgcgcgg ggccggcggg ctggagcccg ggccattgcc agaagacgtc 960 ttctcggggc gccaggattc acctttcctt cccgacctca acttcttcgc ggccgactcc 1020 tgtctccagc tatccggagg cctctcccct agcctacagg gttctctcga cagcccggtc 1080 cctttttccg aggaagagct ggattttttc accagtacgc tctgtgccat cgacctgcag 1140 tttccctaac ctgtttcctc ctcccggtcc tttcgacccc cgcgctcctt ggccgtctac 1200 tggaaaaatc gagcctctcc caccctcagt cgcatagact tatgtgtttt gctaaaattc 1260 aggtattact gaattagcgt ttaatccact ccctttcttc ttcttctaaa atattgggca 1320 ctcggttatc ttttaaaatt cacacagaaa aattccgttt ggtagactcc ttccaatgaa 1380 atctcaggaa taattaaact ctagggggac tttcttaaaa ataactagag ggacctattt 1440 tcctcttttt tatgttttag actgtagatt atttattaaa att ctttaat aataggaaaa 1500 ggggaaagta tttattgtac attattttca tagattaaat aaatgtcttt ataataccaa 1560 aa 1562 <210> 2 <211> 356 <212> PRT <213> Homo sapiens IGlu <400> 2 Met Asn Phe Glu Phe Glu Phe Glu 1 Arg 5 10 15 Ser Leu Ala Glu Cys Leu Thr Ser Phe Pro Ala Val Leu Glu Thr Phe 20 25 30 Gln Thr Ser Ser Ile Lys Glu Ser Thr Leu Ile Pro Pro Pro Pro Pro 35 40 45 Phe Glu Gln Thr Phe Pro Ser Leu Gln Pro Gly Ala Ser Thr Leu Gln 50 55 60 Arg Pro Arg Ser Gln Lys Arg Ala Glu Asp Gly Pro Ala Leu Pro Pro 65 70 75 80 Pro Pro Pro Pro Pro Leu Pro Ala Ala Pro Pro Ala Pro Glu Phe Pro 85 90 95 Trp Met Lys Glu Lys Lys Ser Ala Lys Lys Lys Pro Ser Gln Ser Ala Thr 100 105 110 Ser Pro Ser Pro Ala Ala Ser Ala Val Pro Ala Ser Gly Val Gly Ser 115 120 125 Pro Ala Asp Gly Leu Gly Leu Pro Glu Ala Gly Gly Gly Gly Ala Arg 130 135 140 Arg Leu Arg Thr Ala Tyr Thr Asn Thr Gln Leu Leu Glu Leu Glu Ly s 145 150 155 160 Glu Phe His Phe Asn Lys Tyr Leu Cys Arg Pro Arg Arg Val Glu Ile 165 170 175 Ala Ala Leu Leu Asp Leu Thr Glu Arg Gln Val Lys Val Trp Phe Gln 180 185 190 Asn Arg Arg Met Lys His Lys Arg Gln Thr Gln His Arg Glu Pro Pro 195 200 205 Asp Gly Glu Pro Ala Cys Pro Gly Ala Leu Glu Asp Ile Cys Asp Pro 210 215 220 Ala Glu Glu Pro Ala Ala Ser Pro Gly Gly Pro Ser Ala Ser Arg Ala 225 230 235 240 Ala Trp Glu Ala Cys Cys His Pro Pro Glu Val Val Pro Gly Ala Leu 245 250 255 Ser Ala Asp Pro Arg Pro Leu Ala Val Arg Leu Glu Gly Ala Gly Ala 260 265 270 Ser Ser Pro Gly Cys Ala Leu Arg Gly Ala Gly Gly Leu Glu Pro Gly 275 280 285 Pro Leu Pro Glu Asp Val Phe Ser Gly Arg Gln Asp Se r Pro Phe Leu 290 295 300 Pro Asp Leu Asn Phe Phe Ala Ala Asp Ser Cys Leu Gln Leu Ser Gly 305 310 315 320 Gly Leu Ser Pro Ser Leu Gln Gly Ser Leu Asp Ser Pro Val Pro Phe 325 330 335 Ser Glu Glu Glu Leu Asp Phe Phe Thr Ser Thr Leu Cys Ala Ile Asp 340 345 350 Leu Gln Phe Pro 355 <210> 3 <211> 806 <212> DNA <213> Homo sapiens <400> 3 gttagcggcc aggcctgaac cccagtggga tattctact cgaaattacaccca ggaatg 60 gggaattcgt ggtcacggga ccggcctccg ccaatcgctc 120 gtctgggcct ggtggaaaac agagagcatt atttggttta attgattcaa aaacaccaga 180 ggaccacgac caggacacca tgagccccca ttcctacacc agtgcctcac atgctctctc 240 cccaatgcct ccgtttctcc agaaaagcta gaggaacctt ttcctcatcc ccttcgaagg 300 aaaagatgag tgaggatctc cgcgttggag gaagagggag tcgaaagagg cttccactct 360 ttgaaaaaga cccaatggtg gttgggcttc gggtcacgtg acaccttctt tgtggctccg 420 gaagaggatt gtgaagttta ggtttcgtgg a agaaaccga taattgagga aaaaaaaaaa 480 tcaagatttg gggggaatta cctacaaaga tgtaaggtgt gttaatttgg gcgcttcttg 540 gattctaccc tgaggaggag gcgcgtggtg agaggagagc tccaccagct gcgcgctcgt 600 gtacgccgtc cgcgcccgct tggacgccgc cgaccccggg gggctcttgt cccctccccc 660 gccgccgccg ccaccgcccc cgctgccacc actgcctccg ccgccgccgc caccgccgcc 720 gccaccacag ccctctgctg gatccgaggg ggaggggtgg gaaggggaga aaatgaaata 780 aaagataatt actgaacacg ccgaaa 806 <210> 4 <211> 943 <212> DNA <213> Homo sapiens <400> 4 caaagggatg tgagatttct attcgccgcg gaggcggcga caattagaac gtctcggacc 60 catggcgggg cggccattgg ctcggaggat cacgtgggcg cctaactttg ttcacttgac 120 acaaatctcc ttggaccggc tgttggggga aaaaagtgtt agccgtctct cccggatctg 180 caagggggaa aaaatttgga accataaagt tgaaaacttt tttctctcag tttggaagaa 240 gcccttcgtc atgaatggga tctgcagagt tcgggcgaga ggaggcgaga ggcgcaaagg 300 aggggagatt tgtcgcctgc cgctcgctct ggggctcgat gtgaatatat attatgtctg 360 cctgttctcc cctcgtcggt ggctaaggcc tcggcgccct ccaacccgga gccctgctga 420 gcaaagtccc gaagcggagt tt ttaatt cggttacctc cagctcccaa 480 aacttgctgc cgcccgcggg gctcggccct cggccggctg gtgtgctggg aacctgcctc 540 cgataaccgt tttggtgtcc tgatcgcttg ctcttcttcg cctccttggg ccatcgtagg 600 tggctggtag cttgtcgcca gtcgccgcgg cagcagcgac cggctgaggc agcctggcag 660 cagcagccag ggactacccg ggtgcacaaa ccttcccagc cctgtctgca ccaccggcgg 720 agtctccatt ctttcctatc gcgtctctgg ctccttcgct ttccacactc gcctggcctc 780 cgtcccgcga tggtttgggg tttattgcaa ggggagcggc aggaatttcg gccccaggca 840 tctagttaaa ttattgtttt attattatta ctatcatcat catcgtcatc attattattg 900 ctgtaacaat cagactaaat aaagccaggg cctagccagc caa 943 <210> 5 <211> 119 <212> PRT <213> Homo sapiens <400> 5 Met Asn Gly Ile Cys Arg Val Arg Ala Arg Gly Gly Glu Arg Arg 1 5 10 15 Gly Gly Glu Ile Cys Arg Leu Pro Leu Ala Leu Gly Leu Asp Val Asn 20 25 30 Ile Tyr Tyr Val Cys Leu Phe Ser Pro Arg Arg Trp Leu Arg Pro Arg 35 40 45 Arg Pro Pro Thr Arg Ser Pro Ala Glu Gln Ser Pro Glu Ala Glu Phe 50 55 60 Leu Arg Arg Leu Leu Ile Arg Leu Pro Pro Ala Pro Lys Thr Cys Cys 65 70 75 80 Arg Pro Arg Gly Ser Ala Leu Gly Arg Leu Val Cys Trp Glu Pro Ala 85 90 95 Ser Asp Asn Arg Phe Gly Val Leu Ile Ala Cys Ser Ser Ser Pro Pro 100 105 110 Trp Ala Ile Val Gly Gly Trp 115 <210> 6 <211> 2557 <212> DNA <213> Homo sapiens <400> 6 gcccccgacg gacaccacca ggcccacgga gcccaccatg ccgcgcccgg cccccgcgcg 60 ccgcctcccg ggactcctcc tgctgctctg gccgctgctg ctgctgccct ccgccgcccc 120 cgaccccgtg gcccgcccgg gcttccggag gctggagacc cgaggtcccg ggggcagccc 180 tggacgccgc ccctctcctg cggctcccga cggcgcgccc gcttccggga ccagcgagcc 240 tggccgcgcc cgcggtgcag gtgtttgcaa gagcagaccc ttggacctgg tgtttatcat 300 tgatagttct cgtagcgtac ggcccctgga attcaccaaa gtgaaaactt ttgtctcccg 360 gataatcgac actctggaca ttgggccagc cgacacgcgg gtggcagtgg tgaactatgc 420 tagcactgtg aagatcgagt tccaactcca ggcctacaca gataagcagt ccctgaagca 480 ggccgtgggt cgaatcacac ccttgtcaac aggcaccatg tcaggcctag ccatccagac 540 agcaatggac gaagccttca cagtggaggc aggggctcga gagccctctt ctaacatccc 600 taaggtggcc atcattgt ta cagatgggag gccccaggac caggtgaatg aggtggcggc 660 tcgggcccaa gcatctggta ttgagctcta tgctgtgggc gtggaccggg cagacatggc 720 gtccctcaag atgatggcca gtgagcccct agaggagcat gttttctacg tggagaccta 780 tggggtcatt gagaaacttt cctctagatt ccaggaaacc ttctgtgcgc tggacccctg 840 tgtgcttgga acacaccagt gccagcacgt ctgcatcagt gatggggaag gcaagcacca 900 ctgtgagtgt agccaaggat acaccttgaa tgccgacaag aaaacgtgtt cagctcttga 960 taggtgtgct cttaacaccc acggatgtga gcacatctgt gtgaatgaca gaagtggctc 1020 ttatcattgt gagtgctatg aaggttatac cttgaatgaa gacaggaaaa cttgttcagc 1080 tcaagataaa tgtgctttgg gtacccatgg gtgtcagcac atttgtgtga atgacagaac 1140 agggtcccat cattgtgaat gctatgaggg ctacactctg aatgcagata aaaaaacatg 1200 ttcagtccgt gacaagtgtg ccctaggctc tcatggttgc cagcacattt gtgtgagtga 1260 tggggccgca tcctaccact gtgattgcta tcctggctac accttaaatg aggacaagaa 1320 aacatgttca gccactgagg aagcacgaag acttgtttcc actgaagatg cttgtggatg 1380 tgaagctaca ctggcattcc aggacaaggt cagctcgtat cttcaaagac tgaacactaa 1440 acttgatgac attttggaga agttgaaaa t aaatgaatat ggacaaatac atcgttaaat 1500 tgctccaatt tctcacctga aaatgtggac agcttggtgt acttaatact catgcattct 1560 tttgcacacc tgttattgcc aatgttcctg ctaataattt gccattatct gtattaatgc 1620 ttgaatatta ctggataaat tgtatgaaga tcttctgcag aatcagcatg attcttccaa 1680 ggaaatacat atgcagatac ttattaagag caaactttag tgtctctaag ttatgactgt 1740 gaaatgattg gtaggaaata gaatgaaaag tttagtgttt ctttatctac taattgagcc 1800 atttaatttt taaatgttta tattagataa ccatattcac aatggaaact ttaggtctag 1860 tttcttttga tagtatttat aatataaatc aatcttatta ctgagagtgc aaattgtaca 1920 aggtatttac acatacaact tcatataact gagatgaatg taattttgaa ctgtttaaca 1980 ctttttgttt tttgcttatt ttgttggagt attattgaag atgtgatcaa tagattgtaa 2040 tacacatatc taaaaatagt taacacagat caagtgaaca ttacattgcc atttttaatt 2100 cattctggtc tttgaaagaa atgtactact aaagagcact agttgtgaat ttagggtgtt 2160 aaacttttta ccaagtacaa aaatcccaaa ttcactttat tattttgctt caggatccaa 2220 gtgacaaagt tatatattta taaaattgct ataaatcgac aaaatctaat gttgtctttt 2280 taatgttagt gatccacctg cctcagcctc ccaa agtgct gggattacag gcttgaaagt 2340 ctaacttttt tttacttata tatttgatac atataattct tttggctttg aaacttgcaa 2400 ctttgagaac aaaacagtcc tttaaatttt gcactgctca attctgtttt tcgtttgcat 2460 tgtctttaat ataataaaag ttattacctt tacatattat catgtctatt tttgatgact 2520 catcaatttt gtctattaaa gatatttctt taaatta 2557 <210> 7 <211> 486 <212> PRT <213> Homo sapiens <400> 7 Met Pro Arg Pro Ala Pro Ala Arg Arg Leu Pro Gly Leu Leu Leu Leu 1 5 10 15 Leu Trp Pro Leu Leu Leu Leu Pro Ser Ala Ala Pro Asp Pro Val Ala 20 25 30 Arg Pro Gly Phe Arg Arg Leu Glu Thr Arg Gly Pro Gly Gly Ser Pro 35 40 45 Gly Arg Arg Pro Ser Pro Ala Ala Pro Asp Gly Ala Pro Ala Ser Gly 50 55 60 Thr Ser Glu Pro Gly Arg Ala Arg Gly Ala Gly Val Cys Lys Ser Arg 65 70 75 80 Pro Leu Asp Leu Val Phe Ile Ile Asp Ser Ser Arg Ser Val Arg Pro 85 90 95 Leu Glu Phe Thr Lys Val Lys Thr Phe Val Ser Arg Ile Ile Asp Thr 100 105 110 Leu Asp Ile Gly Pro Ala Asp Thr Arg Val Ala Val Val Asn Tyr Ala 115 120 125 Ser Thr Val Lys Ile Glu Phe Gln Leu Gln Ala Tyr Thr Asp Lys Gln 130 135 140 Ser Leu Lys Gln Ala Val Gly Arg Ile Thr Pro Leu Ser Thr Gly Thr 145 150 155 160 Met Ser Gly Leu Ala Ile Gln Thr Ala Met Asp Glu Ala Phe Thr Val 165 170 175 Glu Ala Gly Ala Arg Glu Pro Ser Ser Asn Ile Pro Lys Val Ala Ile 180 185 190 Ile Val Thr Asp Gly Arg Pro Gln Asp Gln Val Asn Glu Val Ala Ala 195 200 205 Arg Ala Gln Ala Ser Gly Ile Glu Leu Tyr Ala Val Gly Val Asp Arg 210 215 220 Ala Asp Met Ala Ser Leu Lys Met Met Ala Ser Glu Pro Leu Glu Glu 225 230 235 240 His Val Phe Tyr Val Glu Thr Tyr Gly Val Ile Glu Lys Leu Ser Ser 245 250 255 Arg Phe Gln Glu Thr Phe Cys Ala Leu Asp Pro Cys Val Leu Gly Thr 260 265 270 His Gln Cys Gln His Val Cys Ile Ser Asp Gly Glu Gly Lys His His 275 280 285 Cys Glu Cys Ser Gln Gly Tyr Thr Leu Asn Ala Asp Lys Lys Thr Cys 290 295 300 Ser Ala Leu Asp Arg Cys Ala Leu Asn Thr His Gly Cys Glu His Ile 305 310 315 320 Cys Val Asn Asp Arg Ser Gly Ser Tyr His Cys Glu Cys Tyr Glu Gly 325 330 335 Tyr Thr Leu Asn Glu Asp Arg Lys Thr Cys Ser Ala Gln Asp Lys Cys 340 345 350 Ala Leu Gly Thr His Gly Cys Gln His Ile Cys Val Asn Asp Arg Thr 355 360 365 Gly Ser His His Cys Glu Cys Tyr Glu Gly Tyr Thr Leu Asn Ala Asp 370 375 380 Lys Lys Thr Cys Ser Val Arg Asp Lys Cys Ala Leu Gly Ser His Gly 385 390 395 400 Cys Gln His Ile Cys Val Ser Asp Gly Ala Ala Ser Tyr His Cys Asp 405 410 415 Cys Tyr Pro Gly Tyr Thr Leu Asn Glu Asp Lys Lys Thr Cys Ser Ala 420 425 430 Thr Glu Glu Ala Arg Arg Leu Val Ser Thr Glu Asp Ala Cys Gly Cys 435 440 445 Glu Ala Thr Leu Ala Phe Gln Asp Lys Val Ser Ser Tyr Leu Gln Arg 450 455 460 Leu Asn Thr Lys Leu Asp Asp Ile Leu Glu Lys Leu Lys Ile Asn Glu 465 470 475 480 Tyr Gly Gln Ile His Arg 485 <210> 8 <211> 3253 <212> DNA < 213> Homo sapiens <400> 8 caaatacttt tcaacattcc cttctgtcct ttctttgttt ttaaagaaag ctctgatttt 60 gtttcatttt cagctggaga cttaaatgac accaagcaaa gcctacttag tttagatctc 120 cagaaattgg ctggtggaaa aaaatcaaac atgaagattg cagttttgtt ttgttttttt 180 ctgcttatca tttttcaaac tgactttgga aaaaatgaag aaattcctag gaagcaaagg 240 aggaagatct accacagaag gttgaggaaa agttcaacct cacacaagca cagatcaaac 300 agacagcttg gaattcagca aacaacagtt tttacaccag tagcaagact tcctattgtt 360 a actttgatt atagcatgga ggaaaagttt gaatcctttt caagttttcc tggagtagaa 420 tcaagttata atgtgttacc aggaaagaag ggacactgtt tggtaaaggg cataaccatg 480 tacaacaaag ctgtgtggtc gcctgagccc tgcactacct gcctctgctc agatggaaga 540 gttctttgtg atgaaaccat gtgccatccc cagaggtgcc cccaaacagt tatacctgaa 600 ggggaatgct gcccggtctg ctccgctact gtctcctatt ctctactcag tggtatagca 660 ttaaatgata gaaatgaatt ttctggtgat tcttcagaac aaagagaacc taccaattta 720 cttcataagc aactgccacc tcctcaggtg ggaatggacc gaatagtaag aaaagaagca 780 cttcaatctg aggaggatga agaagtgaaa gaagaagata cagagcaaaa gagagagacc 840 cctgaatcta gaaatcaggg gcaactttac agtgaggggg acagcagagg aggagacaga 900 aagcagaggc ctggagagga gaggaggctg gcacaccagc aacaacgcca aggaagggag 960 gaggaggagg atgaggagga ggagggtgag gagggtgagg aggatgagga ggacgaggag 1020 gacccggtaa gaggagatat gttccgaatg ccctctcgat ccccgcttcc tgctcctccc 1080 agaggcacac tgcgcctgcc aagcgggtgc tctctgtcct acaggaccat cagctgcatc 1140 aacgccatgc ttacccagat accaccgctg acagcaccac agataacaag tctggagctc 1200 actggcaatt ccatcg cctc catcccagat gaagcattta atggattacc aaatttggaa 1260 aggcttgatc tgagtaaaaa taatatcact tcttcaggca taggtccaaa agcattcaag 1320 cttctgaaga agttaatgcg tttgaatatg gatggaaata atttgataca gattccttca 1380 caattgccat ctacattaga agaacttaaa gtcaatgaga acaatcttca ggctatcgat 1440 gaagaaagtt tatcagactt aaatcagttg gtcaccttag aattggaagg aaacaatctc 1500 agtgaagcca atgtcaatcc tttagctttc aaacctttga agagcctagc ctacttgcgt 1560 ctgggaaaaa ataaatttag aattataccg cagggtcttc ctggttctat tgaggaatta 1620 tacctagaaa ataaccaaat tgaagaaata actgaaattt gtttcaatca taccagaaag 1680 atcaatgtca ttgtactacg ttataacaaa attgaagaaa ataggattgc tcctttagcc 1740 tggataaatc aagaaaatct agaatccatt gatctctcct acaacaagct ctatcacgtc 1800 ccgtcctatc tacccaagtc cttgctgcac ctagtactcc ttgggaacca gattgaacgg 1860 atccctggct atgtgtttgg ccacatggaa ccaggcctgg aatacttgta cctgtcattt 1920 aacaaacttg ctgatgatgg catggaccgt gtctccttct atggggcata tcattctctg 1980 agagaattat ttctggatca caatgactta aaatctatac cacctgggat acaagaaatg 2040 aaagcactac attttctgag g ctgaacaac aacaagatac ggaacattct tccagaagaa 2100 atttgcaatg ctgaagagga tgatgactca aatctggaac atcttcatct tgaaaacaat 2160 tatattaaaa ttagagaaat accatcttac acattttc ta accttac acattttc t acct 280 t ttacctt t acc t ttactcatgt atttgtagta gctgcatttg tcattaataa gagagacata atcctcctgt 2340 tatactcagt atcattatat gctagtcaac ctgattcact aacacacaga tgaacaacca 2400 aaatatacct aaaaggtata gtctctagga gttttattaa tagtaaaggt aaaatctctc 2460 agtttcctac ctctagaaag aggccatctc actagaatag gatattatgc atactgagct 2520 agaccagaag agtctggaac aaaataaaca cagcctttat aatcaacttg aatactggtg 2580 ttagctgaga actctgtaag tccctttaaa aattatgtat cttttggttc aagattaaga 2640 agcataatga caacaaaaaa agcaggcaga atttatgaat aagtgttgtt tattattaaa 2700 acaataattt gttaatttct tataaggtcc tgtgctataa ttactggtat aaatataact 2760 gaatattggg gtagctttca tttcttccat taattacatg tgtaaaatta aaacactact 2820 gtaatgttaa tttcctggtt ttgaaaatca tattatggtt atgtacattg ttaacattaa 2880 ggaaagctgg cagaagggtg tgcataaatt ctatactctt tttgaaactt ttctataatt 2940 ctaaaattat tttttaaagt taaacagtat attaagatta ccttcactat tcctcactca 3000 agattaagac attttttgaa aagcagtaga gtttgcttaa aatacaaatt aattattctt 3060 gactataacc ttgtaaaggt aaatctaatg tataaatttt tgaaaaattt tgcaccactg 3120 gtcata gcat ctatctcctt tgccttaatt tactgaaata catcatttta ttcggttcaa 3180 ttgaaataaa gctatgtctt tactatgtat tggccctacc aaaatcatat attaaaattt 3240 tctaacataa 213 Leu Plea Ile Ile Phe Gln 1 5 10 15 Thr Asp Phe Gly Lys Asn Glu Glu Ile Pro Arg Lys Gln Arg Arg Lys 20 25 30 Ile Tyr His Arg Arg Leu Arg Lys Ser Ser Thr Ser His Lys His Arg 35 40 45 Ser Asn Arg Gln Leu Gly Ile Gln Gln Thr Thr Val Phe Thr Pro Val 50 55 60 Ala Arg Leu Pro Ile Val Asn Phe Asp Tyr Ser Met Glu Glu Lys Phe 65 70 75 80 Glu Ser Phe Ser Ser Phe Pro Gly Val Glu Ser Ser Tyr Asn Val Leu 85 90 95 Pro Gly Lys Lys Gly His Cys Leu Val Lys Gly Ile Thr Met Tyr Asn 100 105 110 Lys Ala Val Trp Ser Pro Glu Pro Cys Thr Thr Cys Leu Cys Ser Asp 115 120 125 Gly Arg Val Leu Cys Asp Glu Thr Met Cys His Pro Gln Arg Cys Pro 130 135 140 Gln Thr V al Ile Pro Glu Gly Glu Cys Cys Pro Val Cys Ser Ala Thr 145 150 155 160 Val Ser Tyr Ser Leu Leu Ser Gly Ile Ala Leu Asn Asp Arg Asn Glu 165 170 175 Phe Ser Gly Asp Ser Ser Glu Gln Arg Glu Pro Thr Asn Leu Leu His 180 185 190 Lys Gln Leu Pro Pro Pro Gln Val Gly Met Asp Arg Ile Val Arg Lys 195 200 205 Glu Ala Leu Gln Ser Glu Glu Asp Glu Glu Val Lys Glu Glu Asp Thr 210 215 220 Glu Gln Lys Arg Glu Thr Pro Glu Ser Arg Asn Gln Gly Gln Leu Tyr 225 230 235 240 Ser Glu Gly Asp Ser Arg Gly Gly Asp Arg Lys Gln Arg Pro Gly Glu 245 250 255 Glu Arg Arg Leu Ala His Gln Gln Gln Arg Gln Gly Arg Glu Glu Glu 260 265 270 Glu Asp Glu Glu Glu Glu Gly Glu Glu Gly Glu Glu Asp Glu Glu Asp 275 280 2 85 Glu Glu Asp Pro Val Arg Gly Asp Met Phe Arg Met Pro Ser Arg Ser 290 295 300 Pro Leu Pro Ala Pro Pro Arg Gly Thr Leu Arg Leu Pro Ser Gly Cys 305 310 315 320 Ser Leu Ser Tyr Arg Thr Ile Ser Cys Ile Asn Ala Met Leu Thr Gln 325 330 335 Ile Pro Pro Leu Thr Ala Pro Gln Ile Thr Ser Leu Glu Leu Thr Gly 340 345 350 Asn Ser Ile Ala Ser Ile Pro Asp Glu Ala Phe Asn Gly Leu Pro Asn 355 360 365 Leu Glu Arg Leu Asp Leu Ser Lys Asn Asn Ile Thr Ser Ser Gly Ile 370 375 380 Gly Pro Lys Ala Phe Lys Leu Leu Lys Lys Leu Met Arg Leu Asn Met 385 390 395 400 Asp Gly Asn Asn Leu Ile Gln Ile Pro Ser Gln Leu Pro Ser Thr Leu 405 410 415 Glu Glu Leu Lys Val Asn Glu Asn Asn Leu Gln Ala Ile Asp Glu Glu 420 425 430 Ser Leu Ser Asp Leu Asn Gln Leu Val Thr Leu Glu Leu Glu Gly Asn 435 440 445 Asn Leu Ser Glu Ala Asn Val Asn Pro Leu Ala Phe Lys Pro Leu Lys 450 455 460 Ser Leu Ala Tyr Leu Arg Leu Gly Lys Asn Lys Phe Arg Ile Ile Pro 465 470 475 480 Gln Gly Leu Pro Gly Ser Ile Glu Glu Leu Tyr Leu Glu Asn Asn Gln 485 490 495 Ile Glu Glu Ile Thr Glu Ile Cys Phe Asn His Thr Arg Lys Ile Asn 500 505 510 Val Ile Val Leu Arg Tyr Asn Lys Ile Glu Glu Asn Arg Ile Ala Pro 515 520 525 Leu Ala Trp Ile Asn Gln Glu Asn Leu Glu Ser Ile Asp Leu Ser Tyr 530 535 540 Asn Lys Leu Tyr His Val Pro Ser Tyr Leu Pro Lys Ser Leu Leu His 545 550 555 560 Leu Val Leu Leu Gly Asn Gln Ile Glu Arg Ile Pro Gly Tyr Val Phe 565 570 575 Gly His Met Glu Pro Gly Leu Glu Tyr Leu Tyr Leu Ser Phe Asn Lys 580 585 590 Leu Ala Asp Asp Gly Met Asp Arg Val Ser Phe Tyr Gly Ala Tyr His 595 600 605 Ser Leu Arg Glu Leu Phe Leu Asp His Asn Asp Leu Lys Ser Ile Pro 610 615 620 Pro Gly Ile Gln Glu Met Lys Ala Leu His Phe Leu Arg Leu Asn Asn 625 630 635 640 Asn Lys Ile Arg Asn Ile Leu Pro Glu Glu Ile Cys Asn Ala Glu Glu 645 650 655 Asp Asp Asp Ser Asn Leu Glu His Leu His Leu Glu Asn Asn Tyr Ile 660 665 670 Lys Ile Arg Glu Ile Pro Ser Tyr Thr Phe Ser Cys Ile Arg Ser Tyr 675 680 685 Ser Ser Ile Val Leu Lys Pro Gln Asn Ile Lys 690 695 < 210> 10 <211> 1565 <212> DNA <213> Homo sapiens <400> 10 agcccgtgag acgcccgctg ctggacgcgg gtagccgtct gaggtgccgg agctgcggga 60 gg atggagcc gctgaaggtg gaaaagttcg caaccgccaa gaggggaaac gggctgcgcg 120 ccgtgacccc gctgcgcccc ggagagctac tcttccgctc ggatcccttg gcgtacacgg 180 tgtgcaaggg gagtcgtggc gtcgtctgcg accgctgcct tctcgggaag gaaaagctga 240 tgcgatgctc tcagtgccgc gtcgccaaat actgtagtgc taagtgtcag aaaaaagctt 300 ggccagacca caagcgggaa tgcaaatgcc ttaaaagctg caaacccaga tatcctccag 360 actccgttcg acttcttggc agagttgtct tcaaacttat ggatggagca ccttcagaat 420 cagagaagct ttactcattt tatgatctgg agtcaaatat taacaaactg actgaagata 480 agaaagaggg cctcaggcaa ctcgtaatga catttcaaca tttcatgaga gaagaaatac 540 aggatgcctc tcagctgcca cctgcctttg acctttttga agcctttgca aaagtgatct 600 gcaactcttt caccatctgt aatgcggaga tgcaggaagt tggtgttggc ctatatccca 660 gtatctcttt gctcaatcac agctgtgacc ccaactgttc gattgtgttc aatgggcccc 720 acctcttact gcgagcagtc cgagacatcg aggtgggaga ggagctcacc atctgctacc 780 tggatatgct gatgaccagt gaggagcgcc ggaagcagct gagggaccag tactgctttg 840 aatgtgactg tttccgttgc caaacccagg acaaggatgc tgatatgcta actggtgatg 900 agcaagtatg gaaggaagttcaagaatccc tgaaaaaaat tgaagaactg aaggcacact 960 ggaagtggga gcaggttctg gccatgtgcc aggcaatcat aagcagcaat tctgaacggc 1020 ttcccgatat caacatctac cagctgaagg tgctcgactg cgccatggat gcctgcatca 1080 acctcggcct gttggaggaa gccttgttct atggtactcg gaccatggag ccatacagga 1140 tttttttccc aggaagccat cccgtcagag gggttcaagt gatgaaagtt ggcaaactgc 1200 agctacatca aggcatgttt ccccaagcaa tgaagaatct gagactggct tttgatatta 1260 tgagagtgac acatggcaga gaacacagcc tgattgaaga tttgattcta cttttagaag 1320 aatgcgacgc caacatcaga gcatcctaag ggaacgcagt cagagggaaa tacggcgtgt 1380 gtctttgttg aatgccttat tgaggtcaca cactctatgc tttgttagct gtgtgaacct 1440 ctcctattgg aaattctgtt ccgtgtttgt gtaggtaaat aaaggcagac atggtttgca 1500 aaccacaaga atcattagtt gtagagaagc acgattataa taaattcaaa acatttggtt 1560 gagga 1565 <210> 11 <211> 428 <212> PRT <213> Homo sapiens <400> 11 Met Glu Pro Leu Lys Val Glu Lys Phe Ala Thr Ala Lys Arg Gly Asn 1 5 10 15 Gly Leu Arg Ala Val Thr Pro Leu Arg Pro Gly Glu Leu Leu Phe Arg 20 25 30 Ser Asp Pro L eu Ala Tyr Thr Val Cys Lys Gly Ser Arg Gly Val Val 35 40 45 Cys Asp Arg Cys Leu Leu Gly Lys Glu Lys Leu Met Arg Cys Ser Gln 50 55 60 Cys Arg Val Ala Lys Tyr Cys Ser Ala Lys Cys Gln Lys Lys Ala Trp 65 70 75 80 Pro Asp His Lys Arg Glu Cys Lys Cys Leu Lys Ser Cys Lys Pro Arg 85 90 95 Tyr Pro Pro Asp Ser Val Arg Leu Leu Gly Arg Val Val Phe Lys Leu 100 105 110 Met Asp Gly Ala Pro Ser Glu Ser Glu Lys Leu Tyr Ser Phe Tyr Asp 115 120 125 Leu Glu Ser Asn Ile Asn Lys Leu Thr Glu Asp Lys Lys Glu Gly Leu 130 135 140 Arg Gln Leu Val Met Thr Phe Gln His Phe Met Arg Glu Glu Ile Gln 145 150 155 160 Asp Ala Ser Gln Leu Pro Pro Ala Phe Asp Leu Phe Glu Ala Phe Ala 165 170 175 Lys Val Ile Cys Asn Ser Phe Thr Ile Cys Asn Ala Glu Met Gln Glu 180 185 190 Val Gly Val Gly Leu Tyr Pro Ser Ile Ser Leu Leu As n His Ser Cys 195 200 205 Asp Pro Asn Cys Ser Ile Val Phe Asn Gly Pro His Leu Leu Leu Arg 210 215 220 Ala Val Arg Asp Ile Glu Val Gly Glu Glu Leu Thr Ile Cys Tyr Leu 225 230 235 240 Asp Met Leu Met Thr Ser Glu Glu Arg Arg Lys Gln Leu Arg Asp Gln 245 250 255 Tyr Cys Phe Glu Cys Asp Cys Phe Arg Cys Gln Thr Gln Asp Lys Asp 260 265 270 Ala Asp Met Leu Thr Gly Asp Glu Gln Val Trp Lys Glu Val Gln Glu 275 280 285 Ser Leu Lys Lys Ile Glu Glu Leu Lys Ala His Trp Lys Trp Glu Gln 290 295 300 Val Leu Ala Met Cys Gln Ala Ile Ile Ser Ser Asn Ser Glu Arg Leu 305 310 315 320 Pro Asp Ile Asn Ile Tyr Gln Leu Lys Val Leu Asp Cys Ala Met Asp 325 330 335 Ala Cys Ile Asn Leu Gly Leu Leu Glu Gl u Ala Leu Phe Tyr Gly Thr 340 345 350 Arg Thr Met Glu Pro Tyr Arg Ile Phe Phe Pro Gly Ser His Pro Val 355 360 365 Arg Gly Val Gln Val Met Lys Val Gly Lys Leu Gln Leu His Gln Gly 370 375 380 Met Phe Pro Gln Ala Met Lys Asn Leu Arg Leu Ala Phe Asp Ile Met 385 390 395 400 Arg Val Thr His Gly Arg Glu His Ser Leu Ile Glu Asp Leu Ile Leu 405 410 415 Leu Leu Glu Glu Cys Asp Ala Asn Ile Arg Ala Ser 420 425 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MTN3 site #1 Forward primer <400> 12 gcgaggctcg gattaaagg 20 <210> 13 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> MTN3 site #1 Reverse primer <400> 13 cagacattcc gtttctgccg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MTN3 site #2 Forward primer <400> 14 tcaggaaggg tttgctcact 20 <210> 15 <211> 21 <212 > DNA <213> Artificial Sequence <220> <223> MTN3 site #2 Reverse primer <400> 15 gatgtgggtc tcctgaagct c 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ECM2 site #1 Forward primer <400> 16 aggctttgct tggtgtcatt t 21 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ECM2 site #1 Reverse primer <400> 17 tatccccaag ggaggcagtt 20 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ECM2 site #2 Forward primer <400> 18 tcagccaaga aagtaaccag gg 22 <210> 19 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> ECM2 site #2 Reverse primer <400> 19 tccaactctg ccttttcagc 20 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Gene desert Forward primer <400> 20 tggtggtctg ccttctgcca gt 22 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Gene desert Reverse primer <400> 21 tcacgtggga ggaagaagta gggc 24 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human HOXB2 Forward primer <400> 22 ttcaccagta cgctctgtgc 20 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Human HOXB2 Reverse primer <400> 23 aaagataacc gagtgcccaa t 21 <210> 24 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> Human CDH1 Forward primer <400> 24 aggaccagga ctttgacttg 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human CDH1 Reverse primer <400 > 25 attgccccat tcgttcaagt 20 <210> 26 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Human ITGB4 Forward primer <400> 26 tgagccactg gagagcc 17 <210> 27 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Human ITGB4 Reverse primer <400> 27 tcatgtccgt ctgcggg 17 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human CDH2 Forward primer <400> 28 cgtgaaggtt tgccagtgtg 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human CDH2 Reverse primer <400> 29 cggattccca caggcttgat 20 <210> 30 <211> 20 < 212> DNA <213> Artificial Sequence <220> <223> Human VIM Forward primer <400> 30 ctgcc aaccg gaacaatgac 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human VIM Reverse primer <400> 31 catttcacgc atctggcgtt 20 <210> 32 <211> 19 <212> DNA < 213> Artificial Sequence <220> <223> Human MATN3 Forward primer <400> 32 ctctatgctg tgggcgtgg 19 <210> 33 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Human MATN3 Reverse primer <400 > 33 tggcactggt gtgttccaa 19 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Human SMOC2 Forward primer <400> 34 caaagcggac accaagaaac g 21 <210> 35 <211> 21 <212 > DNA <213> Artificial Sequence <220> <223> Human SMOC2 Reverse primer <400> 35 gtgtctagga actgccttcg g 21 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human LAMB2 Forward primer <400> 36 gtacgtggca actgcttctg 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human LAMB2 Reverse primer <400> 37 gaaatcctga cactgctcgc 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human ECM2 Forward primer <400> 38 ctcactggca attccatcgc 20 <210> 39 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Human ECM2 Reverse primer <400> 39 ggacctatgc ctgaagaagt ga 22 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human DCN Forward primer <400> 40 gggataggcc cagaagttcc 20 <210> 41 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Human DCN Reverse primer <400> 41 cagaacactg gaccactcga a 21 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human COL8A2 Forward primer <400> 42 acccaaatct gcccaagtga 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human COL8A2 Reverse primer <400> 43 agaggttgag cgaagaaccc 20 <210> 44 <211> 19 < 212> DNA <213> Artificial Sequence <220> <223> Human LAMA2 Forward primer <400> 44 gaacccgcag tgtcgaatc 19 <210> 45 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Human LAMA2 Reverse primer <400> 45 ggactctgcc accaagtgt 19 <210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Human JAM2 Forward primer <400> 46 attagtggct ccagcagttc c 21 <210> 47 <211 > 22 <212> DNA <213> Artificial Sequence <220> <223> Human JAM2 Reverse primer <400> 47 ccatgtgtat tcaggagctg ga 22 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human JAM3 Forward primer <400> 48 ccagtaggca agatggcaac 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human JAM3 Reverse primer <400> 49 cccagagtcg tccttgtgaa 20 <210> 50 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Human Beta-Actin Forward primer <400> 50 catgtttgag accttcaaca cccc 24 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human Beta-Actin Reverse primer<400> 51 aggaccagga ctttgacttg 20

Claims (11)

A composition for diagnosing breast cancer comprising, as an active ingredient, an agent for measuring the expression level of one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 or a protein encoded by them.
HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and one or more genes selected from the group consisting of ECM2, or a composition for predicting breast cancer prognosis comprising an agent for measuring the expression level of a protein encoding them as an active ingredient.
HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3, and a composition for detecting recurrence or metastasis of breast cancer comprising an agent for measuring the expression level of one or more genes selected from the group consisting of, or a protein encoding them, as an active ingredient.
The method according to any one of claims 1 to 3, wherein the breast cancer is negative for at least one selected from the group consisting of estrogen receptor, progesterone receptor and human epidermal growth factor receptor 2 (HER2). composition.
5. The composition of claim 4, wherein the breast cancer is negative for all of estrogen receptor, progesterone receptor and HER2.
The method according to any one of claims 1 to 3, comprising: an antibody or antigen-binding fragment thereof that specifically binds to the protein; Or the composition characterized in that it is an aptamer that specifically binds to the protein.
The composition according to any one of claims 1 to 3, wherein the agent for measuring the expression level of the gene is a primer or probe that specifically binds to a nucleic acid molecule of the gene.
One or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2, the protein they encode, or a composition for preventing or treating breast cancer comprising an activator that increases the expression or activity thereof as an active ingredient .
One or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2, the protein they encode, or an activator that increases the expression or activity thereof As an active ingredient For inhibiting recurrence or metastasis of breast cancer composition.
A method for screening a composition for preventing or treating breast cancer comprising the steps of:
(a) contacting a test substance with a biological sample comprising cells expressing one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2;
(b) measuring the expression level or activity of the gene in the sample,
When the expression level or activity of one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 is increased, the test substance is judged as a composition for preventing or treating breast cancer.
A screening method for a composition for inhibiting recurrence or metastasis of breast cancer, comprising the steps of:
(a) contacting a test substance with a biological sample comprising cells expressing one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2;
(b) measuring the expression level or activity of the gene in the sample,
When the expression level or activity of one or more genes selected from the group consisting of HOXB2, HOXB3, HOXB-AS1, SMYD3, MATN3 and ECM2 is increased, the test substance is judged as a composition for inhibiting breast cancer recurrence or metastasis.

Images