KR20220139780A - Sanguisorba officinalis Linne extract having a suppressive effect against enzymatic activity of the SARS-CoV-2 3C-like protease and RNA-dependent RNA Polymerase - Google Patents

Abstract

The present invention relates to the use of a novel Sanguisorba officinalis extract for inhibiting SARS-CoV-2 virus 3CL protease and RdRp activity. A composition containing a Sanguisorba officinalis extract as an active component of the present invention inhibits 3CL protease and RdRp activity, so that there is an effect of preventing or treating infections caused by SARS-CoV-2 and variant viruses thereof.

Description

Oil extract composition inhibiting SARS-CoV-2 3CL protease and RdRp activity

The present invention provides a lipid that inhibits the activity of 3C-like protease (3CL protease) and RNA-dependent RNA polymerase (RdRp) possessed by SARS-CoV-2 virus. (Sanguisorba officinalis Linne) relates to the function of the extract and its use.

Jiyu refers to cucumber grass, and is a perennial herb belonging to the Rosaceae family. Distributed in Korea, China, Japan, Russia, etc., it is a wild plant that grows in mountains and fields. Since ancient times, fat oil has been used as a detoxification, burn, diarrhea, respiratory and gastrointestinal disease reliever, and various effects such as anti-allergic, anti-cancer, and antioxidant have been reported.

In general, methanol, ethanol, or water is used as a solvent for extracting plants, but hot water extract of L. oil has been reported to have useful effects. The effect of enhancing immunity (immunopotentiation) has been reported in previous studies. Compared to other methods, the hot water extraction method can easily extract natural substances, obtain a large amount of useful components, and because it is an extraction method that does not use chemical components such as ethanol, the efficacy of the extract is high due to low toxicity and food intake can be said to be safe. In addition, lipid oil is a medicinal plant that grows in mountainous areas, and has the advantage of being easy to cultivate, having high self-sustainability, and being readily available.

Korean Patent No. 10-17842540000 discloses 'a composition for the prevention or treatment of sepsis and a health functional food composition containing a fat oil extract as an active ingredient', and Korean Patent Publication No. 2011-0117540 discloses 'a fat oil extract as an active ingredient'. Pharmaceutical compositions and health foods for the prevention or treatment of Helicobacter infections containing It has not been reported to be effective for improvement or treatment.

The present inventors have completed the present invention by confirming that the oilseed oil extract is effective in preventing or treating infection caused by SARS-CoV-2.

The technical problem to be achieved by the present invention is to treat diseases induced by SARS-CoV-2 by inhibiting the activities of 3CL protease and RdRp, which are enzymes essential for the in vivo proliferation of SARS-CoV-2, using a fat oil extract as an active ingredient. and prevention.

In order to achieve the above object, the present invention provides a composition for treatment and/or prevention of COVID-19 induced by SARS-CoV-2 through inhibition of 3CL protease and RdRp activity, comprising a fat oil extract as an active ingredient do.

In addition, there is provided a health functional food composition for preventing and / or improving infection by SARS-CoV-2 comprising a fat oil extract as an active ingredient.

In addition, drying the oil;

extracting the dried fat oil with a solvent at 30 to 120°C; and

It provides a method for preparing a pharmaceutical composition for preventing or treating infection by SARS-CoV-2 virus, characterized in that it comprises the step of preparing a powder by lyophilizing the extracted solution.

The composition comprising the fat oil extract of the present invention as an active ingredient has a therapeutic effect on SARS-CoV-2 induced COVID-19 by inhibiting SARS-CoV-2 specific 3CL protease and RdRp activity.

1 is a diagram showing the results of inhibition of activity against 3CL protease in a fat oil extract, a negative control group and a positive control group in an in vitro assay. **, p <0.01; ***, p < 0.001
FIG. 2 is a diagram showing the results of inhibition of activity against SARS-CoV-2 3CL protease in a fat oil extract, a negative control group and a positive control group in a cell-based assay. *, p <0.05; **, p <0.01; ***, p < 0.001
3 is a diagram showing the results of inhibition of activity against SARS-CoV-2 RdRp in a fat oil extract, a negative control group and a positive control group in an in vitro assay. **, p <0.01; ***, p < 0.001
4 is a diagram showing the results of inhibition of SARS-CoV-2 proliferation of a fat milk extract, a negative control group, a positive control group 1 (GC376) and a positive control group 2 (Remdesivir) at the cellular level.
5 is a diagram showing the results of suppression of weight loss in a fat milk extract, a negative control group, and a positive control group in SARS-CoV-2 infected hamsters. *, p <0.05; **, p <0.01; ***, p < 0.001
6 is a diagram confirming the results of virus proliferation inhibition of a fat milk extract, a negative control group, and a positive control group in the lung tissue of a SARS-CoV-2 infected hamster through RT-PCR. *, p < 0.05
7 is a diagram confirming the results of virus proliferation inhibition in the lung tissue of the SARS-CoV-2 infected hamsters through a plaque assay of a fat milk extract, a negative control group, and a positive control group. M, mean value
FIG. 8 is a diagram confirming the results of virus proliferation inhibition in the lung tissue of the SARS-CoV-2 infected hamster, the fat milk extract, the negative control group, and the positive control group through tissue staining.
9 is a diagram showing the results of the inhibition of inflammation in the lung tissue of a hamster infected with SARS-CoV-2, a fat milk extract, a negative control group, and a positive control group. *, p < 0.05

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing or treating infection caused by SARS-CoV-2 comprising a fat oil extract as an active ingredient.

SARS-CoV-2 is a virus that causes respiratory syndrome by infection, and is designated as the first class of legal infectious diseases. Currently, it is causing a global pandemic, and the fatality rate in the elderly over 80 years old reaches 25%, causing a very serious condition. Intranasal penetration of SARS-CoV-2 through airborne droplets or person-to-person contact is pointed out as the main cause of transmission.

SARS-CoV-2 introduced into the human body binds to ACE2 (Angiotensin-Converting Enzyme 2) receptor on the cell surface, penetrates into the cell, and generates a large amount of new virus through division and proliferation (Jackson CB, et al. Mechanisms of SARS-CoV-2 entry into cells. Nat Rev Mol Cell Biol. 2021 5:1-18). The generated SARS-CoV-2 is secreted out of the cell again and proliferates by repeating the same process of re-penetrating into other cells. Therefore, mechanisms involved in cellular infection, intracellular replication and proliferation of SARS-CoV-2 are major targets for therapeutic development.

SARS-CoV-2 is generating a number of mutants including the delta type, and these mutated viruses are mainly due to genetic mutations in the spike domain that plays a role in infiltrating the host cell (Harvey, WT). , et al. SARS-CoV-2 variants, spike mutations and immune escape. Nat Rev Microbiol 19, 2021 409-424).

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is an acute severe respiratory disease coronavirus 2 first known in 2019 and is classified as a positive-sense single-stranded RNA virus. The disease infected by this virus was named Coronavirus disease 2019, abbreviated as COVID-19.

The disease caused by the SARS-CoV-2 may be coronavirus infection-19. The Coronavirus Infectious Disease-19 may be a respiratory disease. The respiratory disease may be pneumonia. The symptoms of COVID-19 may be at least one of fever, malaise, cough, shortness of breath, sputum, sore throat, headache, hemoptysis, nausea and diarrhea.

The SARS-CoV-2 virus may include a mutant thereof.

The mutant may be characterized in that a mutation occurs in a spike protein of the SARS-CoV-2 virus.

On the other hand, other than mutations in the spike protein of SARS-CoV-2 virus, there have been no reports of viruses with mutated genes in the regions involved in 3CL protease and RdRp activity. It is known that the same therapeutic efficacy can be expected for mutant viruses.

The composition comprising the oilseed oil extract as an active ingredient may be characterized in that it inhibits or inhibits 3CL protease (3C-like protease) activity.

The composition comprising the oilseed oil extract as an active ingredient may be characterized in that it inhibits SARS-CoV-2 specific 3CL protease and RdRp activity.

The 3CL protease is encoded in the SARS-CoV-2 gene together with the papain-like protease, and is an essential protein for the production of functional proteins necessary for the in vivo proliferation of SARS-CoV-2. (Anirudhan V, et al. Targeting SARS-CoV-2 viral proteases as a therapeutic strategy to treat COVID-19. J Med Virol. 2021 93(5): 2722-2734). The functional proteins required for proliferation encoded by SARS-CoV-2 are expressed in the form of a single polypeptide using the protein synthesis system of the host cell. Interestingly, each of the proteins covalently linked in this polypeptide does not exert its own function, but can be cleaved by protease to acquire a function when it exists independently (Anirudhan V, et al. Targeting SARS-CoV). -2 viral proteases as a therapeutic strategy to treat COVID-19. J Med Virol. 2021 93(5): 2722-2734). It is known that 3CL protease acts on 11 cleavage sites in the polypeptide to generate functional proteins, whereas papain-like protease acts on 3 cleavage sites to generate functional proteins (Anirudhan V, et al. Targeting). SARS-CoV-2 viral proteases as a therapeutic strategy to treat COVID-19. J Med Virol. 2021 93(5): 2722-2734). Therefore, when 3CL protease is inhibited, the production of a number of functional proteins can be inhibited compared to papain-like protease, so this enzyme can be a major target for the development of SARS-CoV-2 therapeutics.

The composition may be characterized in that it inhibits or inhibits RdRp (RNA-dependent RNA polymerase) activity.

The RdRp is an enzyme responsible for the replication and transcription of the RNA genome in most RNA viruses including SARS-CoV-2 (Aftab, S.O., et al. Analysis of SARS-CoV-2 RNA-dependent RNA polymerase as a potential therapeutic drug target using a computational approach. J Transl Med 2020 18, 275).

The present inventors completed the present invention by screening a substance that inhibits the enzyme activity of SARS-CoV-2 specific 3CL protease and RdRp using hot water extracts of 223 kinds of herbal medicines for the development of SARS-CoV-2 treatment and prevention agents.

In a specific embodiment of the present invention, a fat milk extract was prepared using fat milk, and it was used in vitro, in cell tests, and in animal experiments using hamsters. As a result, compared to the negative control group not using the fat oil extract, the SARS-CoV-2 proliferation inhibitory effect through 3CL protease and RdRp inhibition was shown (see FIGS. 1 to 9 ). It was confirmed that it can be usefully used as a pharmaceutical composition for preventing or treating infection by -2 virus.

In addition, as can be seen in Example 2 below, the 3CLglow assay kit (Montana Molecular, USA) used for this experiment is GFP in which the domain cleaved by 3CL protease is attached to the c-terminal of the GFP protein. It is based on a fusion protein. The GFP fusion protein does not show fluorescence, whereas the pure GFP protein in which the c-terminal fusion domain is cleaved by 3CL protease shows fluorescence. That is, when 3CL protease is inhibited, fluorescence production from GFP fusion protein is also reduced. Therefore, it could be confirmed that the activity of SARS-CoV-2 3CL protease was inhibited by the oily fat extract through the decrease in fluorescence production.

In addition, as can be seen in Example 5 below, as a positive control, molnupiravir, an RdRp inhibitor, is 100 mg/kg to 300 mg/kg, preferably MC containing 250 mg/kg. The vehicle may be orally administered to the hamster, but is not limited thereto. If the content of molnupiravir is less than the above range, the inhibitory effect of SARS-CoV-2 in hamsters is insignificant, and if the content of molnupiravir is higher than the above range, there is little practical benefit in terms of cost. The reason for using the high concentration (250 mg/kg) is that ferret (Cox RM et al. Therapeutically administered ribonucleoside analogue MK-4482/EIDD-2801 blocks SARS) using a low concentration (15 mg/kg) of molnupiravir. This is because, unlike CoV-2 transmission in ferrets. Nat Microbiol. 2021 6(1):11-18), high concentration of molupiravir exerts an inhibitory effect on SARS-CoV-2 in hamsters (Rosenke K et al. al. Orally delivered MK-4482 inhibits SARS-CoV-2 replication in the Syrian hamster model. Nat Commun. 2021 12(1):2295).

The fat oil extract may be characterized in that it is extracted with a solvent that is water, alcohol, or a mixture thereof.

The solvent may be water, ethanol, a lower alcohol having 1 to 5 carbon atoms, or an aqueous solution of a lower alcohol having 1 to 5 carbon atoms, but is not limited thereto.

When extracting through the solvent, the extraction temperature is preferably 20°C to 130°C, 30°C to 120°C, and more preferably 90°C to 110°C, but is not limited thereto.

The pharmaceutical composition may include a pharmaceutically acceptable carrier, excipient or diluent. As used herein, the term “pharmaceutically acceptable” means exhibiting properties that are not toxic to cells or humans exposed to the composition. The composition comprising a pharmaceutically acceptable carrier may be in various oral or parenteral formulations. In the case of formulation, it can be prepared using a diluent or excipient such as a filler, extender, binder, wetting agent, disintegrant, surfactant, etc. commonly used. The carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Polyvinyl pyrrolidone, physiological saline, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, dextrin, calcium carbonate, may be at least one selected from the group consisting of propylene glycol and liquid paraffin, but It is not limited, and any conventional carrier, excipient or diluent may be used. The components may be added independently or in combination to the active ingredient, the fat oil extract.

The pharmaceutical composition is any selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations and suppositories It may have one formulation.

As the base of the suppository, witepsol, macrogol, tween 60, cacao butter, laurin fat, glycerogelatin, etc. may be used.

The pharmaceutical composition may have any one formulation selected from the group consisting of powders, granules, tablets, capsules, and liquid forms.

The pharmaceutical dosage form of the extract may be used alone or in combination with other pharmaceutically active compounds, as well as in any suitable group.

The pharmaceutical composition may be administered orally, and may be a solid formulation or a liquid formulation. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the extract, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. There is no particular restriction on the administration dose, and it may vary depending on absorption into the body, body weight, age, sex, health status, diet, administration time, administration method, excretion rate, and severity of disease. The pharmaceutical composition of the present invention is prepared in consideration of the effective amount range, and the unit dosage form formulated in this way can be administered according to the judgment of an expert who monitors or observes the administration of the drug as necessary and a specialized dosing method according to the needs of the individual. It can be used or administered several times at regular time intervals. Preferably, the administration may be administered once a day, or may be administered in several divided doses.

The oil extract may be characterized in that it is extracted from the root of Sanguisorba officinalis L., the root of Sanguisorba longifolia, or a mixture thereof.

In addition, the present invention provides a food composition for preventing or improving infection or disease caused by SARS-CoV-2 comprising a fat oil extract as an active ingredient.

The food may be characterized in that any one or more of health functional food or beverage.

When the fat oil extract is used as a food additive, the fat oil extract may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixed amount of the active ingredient may be suitably determined according to its intended use (prevention, health or therapeutic treatment). In general, in the production of food or beverage, the extract of the present invention may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the raw material. However, in the case of long-term ingestion for health and hygiene purposes or for health control, the above amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

There is no particular limitation on the type of the health functional food. Examples of foods to which the fat milk extract can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks , alcoholic beverages and vitamin complexes, and may include all health functional foods in the ordinary sense.

The health functional beverage composition of the present invention may contain various flavoring agents or natural carbohydrates as an additional component like a conventional beverage. The above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetener, natural sweeteners such as taumatine and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used.

In addition to the above health functional food, the health functional food of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, and preservatives. , glycerin, alcohol, a carbonation agent used in carbonated beverages, and the like. In addition, it may contain the pulp for the production of natural fruit juice, fruit juice beverage and vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not very important, but is generally selected in the range of 0.01 to 2 parts by weight per 100 parts by weight of the composition of the present invention.

The fat oil extract is preferably prepared by a manufacturing method comprising the following steps, but is not limited thereto:

1) drying the oil;

2) extracting the dried fat oil with a solvent at 30 to 120° C.; and

3) preparing a powder by freeze-drying the extracted solution

The present invention comprises the steps of 1) drying the oil;

2) extracting the dried fat oil with a solvent at 30 to 120° C.; and

3) It provides a method for preparing a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it comprises the step of preparing a powder by lyophilizing the extracted solution.

In addition, the present invention comprises the steps of 1) drying the oil;

2) extracting the dried fat oil with a solvent at 30 to 120° C.; and

3) It provides a method for preparing a health functional food composition for preventing or improving infection by SARS-CoV-2, characterized in that it comprises the step of preparing a powder by freeze-drying the extracted solution.

In the above method, the oil of step 1) can be used without limitation, such as cultivated cucumber grass or long cucumber grass or commercially available ones, and any of leaves, roots, stems and branches can be used, but not limited thereto, but the present invention is not limited thereto. According to a preferred embodiment of , it is most preferable to use the root of the cucumber plant or the root of the long cucumber plant.

In the above method, the extraction solvent of step 1) is preferably water, alcohol, alcohol, or a mixture thereof and an organic solvent. It is preferable to use a lower alcohol having 1 to 5 carbon atoms as the alcohol, and it is preferable to use ethanol or methanol as the lower alcohol. As the extraction method, it is preferable to use hot water extraction, shaking extraction, Soxhlet extraction, or reflux extraction, but is not limited thereto. It is preferable to extract by adding the extraction solvent 5 to 30 times to the total weight of the dried fat oil, and it is more preferable to extract by adding 20 times the extraction solvent. The extraction temperature is preferably 20 °C to 130 °C, more preferably 90 °C to 110 °C, but is not limited thereto. In addition, the extraction time is preferably 2 to 48 hours, more preferably 15 to 30 hours, and most preferably 24 hours, but is not limited thereto. In addition, the number of extractions is preferably 1 to 5 times, more preferably 3 to 4 times repeated extraction, and most preferably 3 times, but is not limited thereto.

The fat oil extract is preferably 30 to 95% ethanol extract, more preferably 40 to 90% ethanol extract, most preferably 50 to 80% ethanol extract, and in the case of less than 50% ethanol extract, extraction efficiency This may not be effective for preventing or treating infection caused by the SARS-CoV-2 virus as this is lowered, and in the case of an alcohol extract exceeding 80%, it is not good to increase the production cost of the oilseed oil extract.

The composition comprising a fat oil extract prepared by the above preparation method as an active ingredient inhibits 3CL protease and RdRp activity, thereby exhibiting an effect in preventing or treating infection caused by SARS-CoV-2.

Hereinafter, the present invention will be described in detail by way of Examples and Experimental Examples.

However, the following Examples and Experimental Examples only illustrate the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

Example 1. Preparation of oilseed oil extract

Distilled water 20 times the total weight of dry fat oil was added to the dried fat oil (root of cucumber grass (Sanguisorba officinalis Linne)) and cooled for 1 hour and 30 minutes. Then, the solution was extracted by refluxing at 100 ^o C for 1 hour and 30 minutes using a large heater. The extracted solution was filtered under reduced pressure to remove impurities, and then freeze-dried at -20 ^o C to prepare a powder. The lyophilized 0.2 g oil-oil powder was added to 10 mL distilled water to prepare a solution containing oil-oil extract (20 mg/ml), which was used for in-vitro and cell tests. For animal testing using hamsters, 2 g of lyophilized fat oil powder was mixed with 0.1 g of excipient and put into 10 mL distilled water to prepare a solution containing fat oil extract.

Example 2. Inhibition of SARS-CoV-2 specific 3CL protease activity by oil extract

2-1. Analysis of 3CL protease activity using an in vitro experiment

The 3CL protease in-vitro activity assay was performed at the in vitro level as follows. In this experiment, SARS-CoV-2 3CL protease (3C-like protease) inhibitor assay kit (BPS bioscience, USA) was used. After reacting a test sample with a substrate that fluoresces upon binding to the active site of 3CL protease, fluorescence was measured by a known method to confirm the 3CL protease inhibitory efficacy of the sample. As a negative control, H ₂ O was used in the same volume as the sample, and as a positive control for inhibiting 3CL protease activity, 0.1, 1, and 10 μM of GC376 were used, respectively. The reaction volume was 50 μl, and the treated fat milk extract was 2, 20, and 200 μg/ml, respectively.

As a result, as shown in FIG. 1 , the IC50 was 26.8 μg/mL, and the oily fat extract inhibited the activity of SARS-CoV-2 3CL protease more than equal to or greater than that of the positive control group.

2-2. Analysis of 3CL protease activity using cell-based assay

Using 293 cells, the efficacy of inhibiting 3CL protease activity of the milk extract was verified at the cell level (Cell-based assay). For this experiment, 3CLglow assay kit (Montana Molecular, USA) was used.

293 cells (1x10 ³ pieces) were seeded in a 24-well plate. The next day (after 18 to 24 hours), 293 cells were infected with baculovirus (1x10 ³ ) (Montana Molecular, USA) containing 3CL protease and its substrate, GFP fusion protein. After that, the cells were treated with the oil extract at a concentration of 1, 10, and 100 μg/ml, respectively. As a negative control, H ₂ O was treated, and as a positive control, 0.1, 1, and 10 μM of GC376 were used, respectively. After 24 hours, the inhibitory effect of the oilseed oil extract was observed through a fluorescence microscope (magnification 100X, Scale bar=100 μm).

As a result, as shown in FIG. 2 , the number of cells expressing fluorescence was significantly reduced in the oil extract treatment group, similar to the positive control GC376. The IC50 for inhibiting SARS-CoV-2 3CL protease activity at the cellular level of the fat milk extract was 25.98 μg/ml, very similar to the previous in-vitro assay result. Therefore, it was confirmed that the fat milk extract had a remarkable effect of inhibiting the activity of SARS-CoV-2 3CL protease at the cellular level.

Example 3. Inhibition of SARS-CoV-2 specific RdRp activity by oil extract

RdRp (RNA-dependent RNA polymerase) in vitro activity assay was performed at the in vitro level as follows. It was purchased from the RdRp inhibitor assay kit (Profoldin, USA), which is a product used in the experiment. The efficacy of the test sample was measured based on the substrate that fluoresces upon binding to RNA amplified by RdRp. H ₂ O was used as a negative control for inhibition of RdRp activity, and Aurintricarboxylic acid (ATA) (Hung HC et al. Inhibition of enterovirus 71 replication and the viral 3D polymerase by aurintricarboxylic acid. J Antimicrob Chemother. 2010 65 ( 4): 676-83) was used. The reaction volume is 50 μl and the treated oily milk extract is 2, 20 and 200 μg/ml, respectively.

As a result, as shown in FIG. 3 , the IC50 was 66.7 μg/ml, and the oil extract inhibited the activity of RdRp more than equal to or greater than that of the positive control.

Example 4. Inhibition of the proliferation of SARS-CoV-2 by oil extract in VERO-E6 cells

Dispense VERO-E6 cells at a rate of 8x10 ³ cells/100 μL per well in a 96 well plate and incubate overnight in an incubator at 37°C, 5% CO ₂ to reach about 80% confluency on the day of the test. did. VERO-E6 cells are derived from kidney epithelial cells of African green monkeys and are used for viral infection experiments (Govorkova EA, et al. African green monkey kidney (Vero) cells provide an alternative host cell system for influenza A and B viruses.J Virol. 1996;70(8):5519-5524). As positive controls in this experiment, 3CL protease inhibitor GC376 and RdRp inhibitor Remdesivir (Gilead Sciences, USA) were used. The sample concentration was double-diluted to the highest concentration of 8.14 μg/ml, which is non-toxic to VERO-E6 cells, in the case of a fat milk extract, and the lowest concentration was 0.51 μg/ml. GC376 and remdesivir were diluted twice to the highest concentration of 12.5 μg/ml, and the lowest concentration was 1.56 μg/ml. The diluted sample was mixed with a culture medium containing SARS-CoV-2 (200 TCID ₅₀ ), adjusted to a volume of 200 μl, and then left at 37° C. CO ₂ in an incubator for 1 hour. Thereafter, the medium was removed from the cells and then exchanged with a medium containing the sample and virus. After culturing for 3 days, the cytopathic effect (CPE) induced by cell necrosis by virus proliferation was observed under a microscope, and the degree of CPE inhibition by virus proliferation inhibition was observed with the sample. This experiment was repeated three times and the sample concentration for CPE inhibition was calculated as an average value.

As a result, as shown in FIG. 4 , the mean CPE inhibition of GC376 was 3.125 μg/ml, the mean CPE inhibition of remdesivir was 8.333 μg/ml, and the mean CPE inhibition of the fat oil extract was 4.069 μg/ml. Through this, it was confirmed that the oil extract of the present invention had a SARS-CoV-2 proliferation inhibitory effect that was twice that of remdesivir, a drug actually prescribed for SARS-CoV-2 infection patients at the cellular level.

Example 5. Efficacy of SARS-CoV-2 proliferation inhibition by fat milk extract in hamster animal test

5-1 Construction of animal model for SARS-CoV-2 infection using hamsters and oral administration of test substances

A known virus, SARS-CoV-2 (NCCP43326), was subcultured and a virus of 10 ⁴ TCID50/mL was prepared in a PBS (Phosphate buffered saline) solution. Thereafter, 100 μL of the SARS-CoV-2 virus solution was administered to the left nasal cavity of the hamster. Immediately after virus infection, methylcellulose (MC) vehicle, an excipient, was orally administered as a negative control group, and a high concentration (250 mg/kg) of RdRp inhibitor molnupiravir (Merck, USA) as a positive control group was administered. The containing MC vehicle was orally administered. In the case of a fat milk extract, 100 mg/kg was orally administered using MC vehicle. Each test substance was administered in divided doses twice daily. The significance was tested between the test substance administration groups using Student's t-test, and for statistical analysis, Prism 7.04 (GraphPad Software Inc., San Diego, CA, USA) was used, and when the p value was less than 0.05, it was statistically significant. was judged to have been

5-2 Inhibition of Weight Loss by Fat Milk Extract in SARS-CoV-2 Infected Hamsters

As in Example 5-1, virus inoculation and test substance were administered to SARS-CoV-2 infected hamsters, and body weight was measured for each individual using an electronic scale every day for 7 days from that day.

As a result, as shown in FIG. 5 , when only vehicle, which is a negative control, was administered to SARS-CoV-2 infected hamsters, the body weight decreased between 2 and 4 days of infection. In contrast, the group administered with the oil extract had an effect of suppressing weight loss similarly to the group administered with molupiravir, a positive control. Therefore, it was found that the fat milk extract induced the normalization of body weight by restoring homeostasis in vivo by strongly inhibiting the division and proliferation of SARS-CoV-2 in the hamster animal test.

5-3 Confirmation of SARS-CoV-2 Proliferation Inhibition in Hamster Lungs by Fat Milk Extract Using Real-time RT-PCR Technique

On the 3rd day of infection (3 Day post infection, 3 DPI), a part of the lesion site was collected from the lung tissue of a hamster, a certain amount of Wizol ^™ (WizbioSolution, Seongnam, Korea) reagent was added, and then crushed using a tissue crushing bead, and then from the supernatant. Total RNA was extracted. The extracted total RNA was quantified using Nanodrop (NanoDrop2000, Thermo scientific). cDNA was synthesized from 1 μg of total RNA using the WizScript ^™ cDNA synthesis kit (WizbioSolution). After that, the synthesized cDNA was applied to real-time RT-PCR using probeWizPure™ qPCR Master-UDG (WizbioSolution) using E gene-specific primer of SARS-CoV2 or RdRp gene-specific primer. The primer sequences used for real-time RT-PCT are shown in Table 1.

Item primer SEQ ID NO: E gene forward 5'-ACAGGTACGTTAATAGTTAATAGCGT-3' One E gene reverse 5'-ATATTGCAGCAGTACGCACACA-3' 2 RdRp gene forward 5'-ATGAGCTTAGTCCTGTTG-3' 3 RdRp gene reverse 5'-CTCCCTTTGTTGTGTTGT-3' 4

Based on a standard curve prepared using RNA derived from SARS-CoV-2 with a known copy number, the residual amount of virus from lung tissue was quantitatively analyzed as the number of copies of the virus gene per ng or μg of total RNA.

As a result, as shown in FIG. 6 , it was found that the fat oil extract has the effect of inhibiting virus proliferation in the lung tissue of infected animals more significantly than molnupiravir, which inhibits the activity of RdRp and inhibits the proliferation of SARS-CoV-2. Confirmed.

5-4 Confirmation of inhibition of SARS-CoV-2 proliferation in hamster lungs by fat milk extract using Plaque assay

On the third day of infection (3 DPI), the lung tissue collected from the lung tissue of the hamster was homogenized by adding 10 μl of PBS per 1 mg. After centrifugation at 5,000 rpm for 3 minutes, the supernatant was recovered, the volume was adjusted to 200 μl by serial dilution with PBS, and treated with Vero E6 cells grown in a 12-well plate. After shaking so that the virus contacted the Vero E6 cells evenly for 1 hour at 15-minute intervals, the supernatant was removed and 1 ml of agarose overlay medium (medium) containing 1% agarose was added to each well. After confirming that the agarose overlay medium was solidified, the 12-well plate was inverted and cultured for 96 hours to observe the formation of plaques. The agarose overlay medium was removed and stained with crystal violet. The number of plaques per gram of tissue was calculated by visually comparing the dilution factor of the sample with the number of plaques derived from the virus with a known copy number.

As a result, as shown in FIG. 7 , it was found that the fat milk extract had a more significant effect in inhibiting the proliferation of SARS-CoV-2 in the lung tissue of hamsters than the RdRp inhibitor molnupiravir.

5-5 Confirmation of SARS-CoV-2 Proliferation Inhibition in Hamster Lungs by Lung Milk Extract Using Antibody Tissue Staining (immunohistochemistry)

On the third day of infection (3 DPI), the lung tissue of the hamster was collected, a paraffin block was prepared, and the tissue was sectioned to a thickness of 5 μm. Thereafter, using an antibody (Cat# 40143-MM05; Sino Biological Inc.) against SARS-CoV-2 specific nucleocapsid, a known tissue staining method was used.

As a result, as shown in FIG. 8 , in the vehicle-treated group, a strong brown reaction (nucleocapsid reaction) indicating SARS-CoV-2 infection was observed in epithelial cells in the lung tissue of hamsters. In contrast, the nucleocapsid response of the oil extract treated group was similar to that of the positive control group, molnupiravir. Therefore, it could be confirmed using the antibody tissue staining method that the fat milk extract inhibits the division and proliferation of SARS-CoV-2 in hamster lung tissue.

5-6 Efficacy of Inhibition of Hamster Pulmonary Inflammation by SARS-CoV-2 Virus of Fat Oil Extract

On the 3rd day of infection (3 DPI), 3 hamsters per group were autopsied, the right lung tissue was fixed in 10% NBF (neutralized buffered formalin) solution, and histopathological examination was performed. After preparing a paraffin block using lung tissue fixed in 10% NBF, the tissue was sectioned to a thickness of 5 μm. Then, inflammation scoring was evaluated by H&E (Hematoxylin & Eosin) staining and optical microscopy. Scoring was determined by scoring in units of 0 - 3 points according to the degree of inflammation based on the literature (Reference 9). A value of 0 was a value without lesion, 1 point was given for 10% or less, 2 points for 10% - 50%, and 3 points for 50% or more. When bleeding or edema was observed, an additional 0.5 point was given.

As a result, as shown in FIG. 9 , it was confirmed that the oil extract had an effect equal to or greater than that of molnupiravir, a positive control, in relieving inflammation in hamster lung tissue induced by SARS-CoV-2 infection.

<110> Q Genetics <120> Sanguisorba officinalis Linne extract having a suppressive effect against enzymatic activity of the SARS-CoV-2 3C-like protease and RNA-dependent RNA Polymerase <130> PP21-255 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #1 <400> 1 ACAGGTACGTTAATAGTTAATAGCGT <210> 2 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #2 <400> 2 ATATTGCAGCAGTACGCACACA <210> 3 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #3 <400> 3 ATGAGCTTAGTCCTGTTG <210> 4 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #4 <400> 4 CTCCCTTTGTTGTGTTGT

Claims (20)

A pharmaceutical composition for the prevention or treatment of infection caused by SARS-CoV-2 (Severe acute respiratory syndrome coronavirus 2) comprising a fat oil extract as an active ingredient.
The method of claim 1,
The SARS-CoV-2 is a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it includes a mutant thereof.
3. The method of claim 2,
The mutant is a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that a mutation occurs in a spike protein of SARS-CoV-2.
The method of claim 1,
The composition is a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it inhibits 3CL protease (3C-like protease) activity.
The method of claim 1,
The composition is a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it inhibits RdRp (RNA-dependent RNA polymerase) activity.
The method of claim 1,
The oil extract is a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it is extracted with a solvent that is water, alcohol, or a mixture thereof.
The method of claim 1,
The pharmaceutical composition is a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it comprises a pharmaceutically acceptable carrier, excipient or diluent.
The method of claim 1,
The pharmaceutical composition is any one formulation selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, emulsions, freeze-dried preparations and suppositories A pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it has a.
The method of claim 1,
The pharmaceutical composition is an oral composition for the prevention or treatment of infection by SARS-CoV-2, characterized in that it has any one formulation selected from the group consisting of powders, granules, tablets, capsules, and liquids. .
The method of claim 1,
The oil extract is a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it is extracted from the root of Sanguisorba officinalis L., the root of Sanguisorba longifolia, or a mixture thereof.
A health functional food composition for preventing or improving infection caused by SARS-CoV-2 (Severe acute respiratory syndrome coronavirus 2) comprising a fat milk extract as an active ingredient.
12. The method of claim 11,
The SARS-CoV-2 virus is a health functional food composition for preventing or improving infection by SARS-CoV-2, characterized in that it contains a mutant thereof.
12. The method of claim 11,
The mutant is a health functional food composition for preventing or improving infection by SARS-CoV-2, characterized in that a mutation occurs in a spike protein of the SARS-CoV-2 virus.
12. The method of claim 11,
The composition is a health functional food composition for preventing or improving infection by SARS-CoV-2, characterized in that it inhibits 3CL protease (3C-like protease) activity.
According to claim 11,
The composition is a health functional food composition for preventing or improving infection by SARS-CoV-2, characterized in that it inhibits RdRp (RNA-dependent RNA polymerase) activity.
drying the oil;
extracting the dried fat oil with a solvent at 30 to 120°C; and
A method for preparing a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it comprises the step of preparing a powder by lyophilizing the extracted solution.
17. The method of claim 16,
The method for producing a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that the solvent is at least one selected from the group consisting of water, alcohol, or a mixture thereof.
17. The method of claim 16,
The pharmaceutical composition is a method for preparing a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it comprises a pharmaceutically acceptable carrier, excipient or diluent.
17. The method of claim 16,
The pharmaceutical composition is any one formulation selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, emulsions, freeze-dried preparations and suppositories A method for preparing a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it has a.
17. The method of claim 16,
The pharmaceutical composition is a pharmaceutical composition for preventing or treating infection by SARS-CoV-2, characterized in that it has any one formulation selected from the group consisting of powders, granules, tablets, capsules, and liquid forms. manufacturing method.

Images