KR20220139566A - Single guide RNA combination for suppressing the expression of clock gene Period, and use thereof - Google Patents

Abstract

The present invention relates to a single guide RNA combination for suppressing an expression of a period of a clock gene, and a use thereof, in which a specific sgRNA combination capable of inhibiting the expression of period 1 (Per1) and period 2 (Per2) which are clock genes is designed, circadian molecular clock oscillation is confirmed to be suppressed in the suprachiasmatic nucleus (SCN) by using a vector containing the same, and symptoms due to circadian rhythm inhibition are confirmed to appear, e.g., lower motor activity or appearance of arrhythmia in exercise diurnal locomotor activity in an animal model injected with a virus containing the vector, thereby providing the sgRNA combination and the vector containing the same as a tool for changing a circadian biorhythm.

Description

Single guide RNA combination for suppressing the expression of clock gene Period, and use thereof

The present invention relates to a single guide RNA combination for inhibiting the expression of a clock gene Period, and uses thereof.

All living things have a biological clock that autonomously vibrates in a cycle of about 24 hours depending on the external environment. The biological clock causes a biological diurnal fluctuation called an activity cycle, and regulates the sleep/wake cycle, as well as the diurnal fluctuation of various biological activities such as temperature control, blood pressure, hormone secretion, metabolism, mental and physical activity, and eating. In recent years, disruption of the circadian rhythm has been pointed out as a cause of various mental and physical symptoms or diseases such as sleep disorders, skin diseases, lifestyle-related diseases, and neuropsychiatric diseases such as depression. For example, jet lag caused by the movement of airplanes, etc., sleep disturbance due to irregular life patterns due to shift work (shift work), etc., modulation of sleep awakening rhythm etc. There are many problems caused by disruption of the circadian rhythm due to changes in the environment and working environment. In addition, since the amount of secretion of hormones such as melatonin that regulates the circadian rhythm decreases with aging, various rhythms such as sleep awakening and body temperature regulation are attenuated in the elderly. The decline in QOL due to sleep disturbance in old age is also concerned as a social problem along with the recent rapid aging of the population. In view of such a phenomenon, there is a need for a method capable of resolving modulation, attenuation, etc. of circadian circadian rhythm, and further, treating and improving the sleep disorders, etc., but such a method has not yet been established.

In mammals, the circadian rhythm is controlled in the suprachiasmatic nucleus (SCN), which is located on the optic nerve junction (optic junction) where the optic nerves extending from the retinas of the left and right eyes intersect in the hypothalamus of the brain. The circadian rhythm created by SCN is formed by a group of genes called clock genes (Bmal1, Clock, Period, Cryptochrome, etc.). More specifically, BMAL1 and CLOCK proteins, which are transcriptional activators, activate the expression of Period and Cryptochrome genes, and thus the transcriptionally translated Period (PER1, PER2) and Cryptochrome (CRY1, CRY2) proteins interact with BMAL1 and CLOCK proteins. As they act, they form a negative feedback that self-represses transcription. After that, the PER and CRY proteins are subjected to phosphorylation and ubiquitination modifications, and then are degraded into the proteasome, so that the transcription inhibitor is released. The molecular mechanism of circadian circadian rhythm formation is that the next cycle is initiated by BMAL1 and CLOCK proteins, requiring about 24 hours per week of this cycle.

Such a clock gene feedback mechanism also exists in peripheral tissues such as the liver, muscle, lung, and heart, and in tissues other than the SCN in the brain, and it has been found that this mechanism forms a circadian circadian rhythm in peripheral tissues and the like. In addition, the rhythm is controlled by signals from neurohormones and the like through various tissues of the SCN, which is the center of control. These circadian circadian rhythms are controlled by the expression of clock genes. Therefore, in order to search for substances that can treat sleep disorders, depression, and mental disorders caused by circadian rhythm changes, it is required to develop a genetic method capable of changing the circadian circadian rhythm by suppressing the expression of the clock gene.

On the other hand, CRISPR (clustered regularly interspaced short palindromic repeats) is a short repetitive sequence of several tens of base pairs present in bacteria and is involved in the mechanism of acquired immunity against foreign DNA such as bacteriophages and plasmids. One of the Cas gene clusters upstream of CRISPR recognizes a specific short sequence called a proto-spacer adjacent motif (PAM) in foreign DNA, cleaves dozens of base pairs upstream of it and inserts them into the CRISPR region. The inserted target sequence is transcribed together with the repeat sequence as a series of CRISPR RNA (crRNA) precursors, which are cleaved by the action of a trans-activating crRNA (tracrRNA) partially complementary to the crRNA to provide a mature crRNA, which matures crRNA forms a complex with Cas9, a double-stranded break-inducing endonuclease as one of the tracrRNA and Cas gene clusters. The complex recognizes the PAM sequence in foreign DNA, binds to a target sequence adjacent thereto, and Cas9 (CRISPR associated protein 9) cleaves and removes the foreign DNA. This set of mechanisms is called the CRISPR/Cas9 system. In order to use CRISPR/Cas9 to artificially suppress a specific gene, it is essential to design a single guide RNA (sgRNA) targeting the appropriate sequence of the target gene. Since it does not exist, it is essential to prove its effectiveness experimentally.

Korean Patent Registration No. 10-1770706 (2017. 08. 23. Announcement)

It is an object of the present invention to provide a sgRNA combination capable of simultaneously inhibiting the expression of clock genes, Period 1 (Per1), and Period 2 (Per2), and a vector for circadian rhythm control comprising the same.

The present invention provides an sgRNA for suppressing the expression of a clock gene Period.

In addition, the present invention is sgRNA having the nucleotide sequence shown in SEQ ID NO: 1; And it provides a vector for controlling the circadian rhythm of a mammal comprising an sgRNA having the nucleotide sequence represented by SEQ ID NO: 2 or 3.

According to the present invention, a specific sgRNA combination capable of simultaneously inhibiting the expression of the clock genes, Period 1 (Per1) and Period 2 (Per2), is designed, and using a vector containing the same, suprachiasmatic (suprachiasmatic) nucleus, SCN), and to suppress circadian rhythms such as decreased motor activity and abnormal body temperature control in an animal model injected with the virus containing the vector. By confirming the appearance of the disease caused by the sgRNA and the vector including the sgRNA can be provided as a tool to change the circadian rhythm.

1 is a result of setting a single guide RNA (sgRNA) targeting Period genes related to the weekly rhythm (a), a vector to include it (b), and a result of confirming the efficiency of the vector (c).
2 is a vector (a) containing multiple sgRNA expression cassettes targeting the Period genes involved in the weekly rhythm (a) and the result of suppressing the expression of PERIOD proteins using the vector (b).
3 is an adeno-associated virus (AAV) containing the vector in order to evaluate the effect of a vector containing sgRNA targeting Period genes on udon activity and body temperature in an animal model in the suprachiasmatic nucleus of an animal. , SCN) is a schematic diagram (a), a photograph of a fluorescent reporter protein (b), and a result showing the site of virus infection (c).
4 is a result of evaluating the effect of a vector including an sgRNA targeting the Period gene on the weekly exercise activity of an animal in an animal model.
5 is a result of evaluating the effect of a vector including an sgRNA targeting the Period gene on changes in body temperature in an animal model in an animal model.
6 is a result of evaluating the average exercise activity and body temperature change according to the light and dark conditions of a vector including sgRNA targeting the Period gene in an animal model.

The terms used in this specification have been selected as currently widely used general terms as possible while considering the functions in the present invention, which may vary depending on the intention or precedent of a person skilled in the art, the emergence of new technology, and the like. In addition, in a specific case, there is a term arbitrarily selected by the applicant, and in this case, the meaning will be described in detail in the description of the corresponding invention. Therefore, the term used in the present invention should be defined based on the meaning of the term and the overall content of the present invention, rather than the name of a simple term.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Terms such as those defined in a commonly used dictionary should be interpreted as having a meaning consistent with the meaning in the context of the related art, and should not be interpreted in an ideal or excessively formal meaning unless explicitly defined in the present application. does not

Numerical ranges are inclusive of the values defined in that range. Every maximum numerical limitation given throughout this specification includes all lower numerical limitations as if the lower numerical limitation were expressly written. Every minimum numerical limitation given throughout this specification includes all higher numerical limitations as if the higher numerical limitation were expressly written. All numerical limitations given throughout this specification will include all numerical ranges that are better within the broader numerical limits, as if the narrower numerical limitations were expressly written.

Hereinafter, the present invention will be described in more detail.

The present invention provides an sgRNA for suppressing the expression of a clock gene Period.

The sgRNA is a single guide RNA that serves to find the DNA position to be edited, and the sgRNA has a nucleotide sequence that can specifically bind to the clock gene Period 1 (Per1) or Period 2 (Per2). do.

The sgRNA is an sgRNA having the nucleotide sequence shown in SEQ ID NO: 1, and may inhibit the expression of the clock gene Period 1 (Per1). In addition, the sgRNA is an sgRNA having a nucleotide sequence represented by SEQ ID NO: 2 or 3, and may inhibit the expression of a clock gene Period 2 (Per2).

In addition, the present invention is sgRNA having the nucleotide sequence shown in SEQ ID NO: 1; And it provides a vector for controlling the circadian rhythm of a mammal comprising an sgRNA having the nucleotide sequence represented by SEQ ID NO: 2 or 3.

The vector is used when referring to a DNA fragment(s) or nucleic acid molecule that is delivered into a cell. The vector replicates DNA and can be reproduced independently in a host cell. The term "carrier" is often used interchangeably with "vector." The term "expression vector" refers to a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence necessary for expression of an operably linked coding sequence in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotes are known.

The vector can be applied to CRISPR/Cas9 technology, and may be a promoter that induces the expression of an RNA sequence in a living organism in general, and specifically may be an expression vector including a U6 promoter, more specifically pAAV-hU6- gRNA-hSyn-mCherry-KASH. The promoter refers to a region upstream of DNA from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription.

The vector includes sgRNA having the nucleotide sequence shown in SEQ ID NO: 1, sgRNA having the nucleotide sequence shown in SEQ ID NO: 2, and sgRNA having the nucleotide sequence shown in SEQ ID NO: 3, Period protein It suppresses the expression .

In addition, the present invention provides a CRISPR/Cas9-based single adeno-associated virus (AAV) vector system comprising the vector. In addition, the present invention provides a transformant transformed with the vector system.

In addition, the present invention comprises the steps of treating the transformant with a test substance; And it provides a drug screening method for improving circadian rhythm, comprising the step of analyzing a change in the circadian rhythm of the transformant treated with the test substance.

The test substance refers to a substance whose circadian rhythm improvement effect is to be confirmed, and may include any molecule such as extracts, proteins, oligopeptides, small organic molecules, polysaccharides, polynucleotides, and a wide range of compounds. These test substances also include natural as well as synthetic substances. The change in the circadian cycle can be confirmed through the expression of the related gene, and the change in the cycle and amplitude of the circadian cycle of the cell line according to the treatment of the test substance can be determined by comparing it with the untreated control group and normal cells.

Hereinafter, experimental examples and examples will be described in detail to help the understanding of the present invention. However, the following experimental examples and examples are only to illustrate the content of the present invention, the scope of the present invention is not limited to the following experimental examples and examples. Experimental examples and examples of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

<Experimental example> Experimental material and method

The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

1. Animals

All mice were born and housed in standard mouse cages (16 x 36 x 12.5 cm), and were fed with food and water autonomously. Mice were weaned at 3-4 weeks of age and housed together with siblings of the same sex, up to 4 mice per cage. Mice were housed at 22±1° C. on a 12-hour light-dark cycle. All procedures were approved by the Animal Experimentation Ethics Committee of the Daegu Gyeongbuk Institute of Science and Technology (DGIST). PER2::LUC knock-in mice were obtained from Joseph Takahashi, and Cas9-phenotype mice were provided by Feng Zhang.

2. Cell Culture and Mutation Detection

Neuro2a and Neuro2a Cas9-GFP-Hygor ^res (CSC-RO0033, Genecopeoia, Rockville, MD, USA) cells were treated with 1 x penicillin/streptomycin (Capricorn Scientific, Ebsdorfergrund, Germany), 10 mg/mL hygromycin (H-34274, Merck) Millipore, Burlington, MA, USA), and 10% FBS (fetal bovine serum, Hyclone) containing DMEM (Dulbecco's modified Eagle medium, Hyclone, Chicago, IL, USA) 37 ℃ 5% CO ₂ Conditions were cultured. Neuro2a-Cas9 cells were pAAV-U6-sgBMAL-hSyn-mCherry, pAAV-U6-sgCRY-hSyn-mCherry using Lipofectamine 2000 transfection reagent (#11668019, Thermo Scientific, Waltham, MA, USA) according to the manufacturer's instructions. , pAAV-U6-sgPER-hSyn-mCherry, or pAAV-U6-sgLacZ-hSyn-mCherry. After 48 hours, cells were collected, and genomic DNA was prepared using a tissue mini kit (Cosmo Genetech, Seoul, South Korea) according to the manufacturer's instructions. Surveyor mutation detection assays (Integrated DNA Technologies, Coralville, IA, USA) were performed according to the manufacturer's instructions.

3. Plasmid and Vector Production

DNA oligomers of sgRNA designed using CHOPCHOP were synthesized commercially by Bionics (Seoul, South Korea) after adding an adapter for cloning. After annealing, the DNA fragment containing the sgRNA was cloned into an sgRNA expression vector, pAAV-hU6-gRNA-hSyn-mCherry-KASH. The U6-sgRNA expression cassette was multiplexed using the Goldengate assembly method to generate three multiplexed cassettes assembled in pAAV-(hU6-gRNA)X3-hSyn-mCherry-KASH. The plasmid DNA sequence was verified by Sanger sequencing (Macrogen, Seoul, South Korea). Adeno-associated virus (AAV) was produced using the triple transfection method and purified by the iodixanol gradient method. All adeno-associated virus (AAV) vectors administered in this example were entered as 10 ¹² to 10 ¹³ virus genome counts per milliliter (GC/mL), as quantified by qPCR: AAV-DJ-hU6-sgLacZ -hSyn-mCherry-KASH 1.8 x 10 ¹³ GC/mL; AAV-DJ-CSAC-Pers-hSyn-mCherry-KASH 3.1 x 10 ¹³ GC/mL; AAV-2-hSyn-mCherry 4.7 x 10 ¹² GC/mL.

4. Western Blot Analysis

Cells were washed twice with phosphate-buffered saline, lysed by sonication in radioimmunoprecipitation assay (RIPA) buffer (#9806, Cell Signaling, Danvers, MA, USA) and left on ice for 30 min. cultured. The lysate was centrifuged to obtain a supernatant that was boiled for 5 minutes in Laemmli sample solution (#NP0007, Invitrogen, Waltham, MA, USA). Proteins were separated on 4-15% TG gels in Tris-glycine (TG) buffer (#45101080003-2, SMOBIO, Hsinchu, Taiwan), and polyvinylidene fluoride (PVDF) membranes (#A16646282, GE Healthcare, Chicago, IL, USA) was moved. The membrane was blocked in Tris buffered with TTBS (Tween-20) containing 1% BSA (bovine serum albumin), and incubated at 4° C. in TTBS containing 0.1% BSA and the following primary antibody: mPer1 (#AB2201) , Merck Millipore), PER2 (#AB2202, Merck Millipore) and β-actin-HRP (#SC-47778, Santa Cruz, Dallas, TX, USA). Anti-Rabbit (SKU#31460, Thermo Scientific) or antigoat (Jackson Laboratory, Bar Harbor, ME, USA) secondary antibodies were used. Protein bands were detected using enhanced chemiluminescence (ECL) Select Solution (GE healthcare) and ECL Pico System (ECL-PS100, Dongin, Seoul, Korea).

5. Stereotaxic injection

The surgery was performed using aseptic technique. Mice were anesthetized with a mixture of 100 mg/kg ketamine and 10 mg/kg xylazine, and 0.1 μL/kg using a Nanoliter injector system (WPI) in a stereotaxic device (RWD Life Science, Shenzhen, China). AAV was injected at a rate of less than or equal to min. 250 nL each on both sides of the SCN of the brain (AP = -0.8 mm, ML = ± 0.22 mm at the bregma, DV = 5.85 mm at the brain surface).

6. Motor activity and body temperature measurement

The motor activity and body temperature of the mice were measured using an E-mitter, a radio transmitter-based telemetry system (Starr Life Science, Oakmont, PA, USA). E-mitter was implanted under the dorsal skin of mice using aseptic technique under general anesthesia induced by intraperitoneal 100 mg/kg ketamine and 10 mg/kg xylazine injections. After implantation, the mice recovered for at least 1 week and were acclimatized to a regular 12 hour light-dark cycle. The activity and temperature data detected by the implanted sensor were transmitted to a receiver (ER-4000 engergizer receiver, Starr Life Science). Data collection and digital conversion were performed every 6 minutes using VitalView software (Starr Life Science).

7. Tissue Sample Preparation and Confocal Microscopy

Three weeks after virus expression, mice were intracardiac perfused with 4% paraformaldehyde and fixed overnight at 4°C. 50-μm thick coronal sections were collected using a Leica VT1000 S vibratome (Leica, Wetzlar, Germany). Nuclei were counterstained with DAPI (4'6'-diamidino-2-phnylindole), images were taken using a Nikon C2+ confocal microscope system and linearly adjusted with sebum.

8. Data and Statistical Analysis

Chi-square periodogram analysis was performed using the xsp package of R. Real-time bioluminescence was analyzed by the cosinor procedure. Graphs were constructed using Prism 8 (GraphPad, SanDiego, CA, USA) or ggplot2. The threshold for statistical significance was set at P < 0.05.

Example 1. Design and evaluation of sgRNAs targeting key clock gene family members

To obtain a single guide RNA (sgRNA) set capable of removing the essential molecular components of the week clock, we used CHOPCHOP, a web-implemented target site selection algorithm for CRISPR-Cas9, to target the Period genes ( Per1 and Per2 ). sgRNA was designed. As shown in Figure 1a, in order to maximize the effect of the frame shift-mediated nonsense mutation among the predicted sgRNAs, three targeting the initial exon were selected. Thereafter, as shown in FIG. 1B , individual sgRNAs were cloned into a U6 promoter-driven sgRNA expression vector to evaluate mutagenesis efficiency. Each sgRNA-expressing plasmid was transfected with the SpCas9 -expressing plasmid into the Neuro2a neuroblastoma cell line. Mutation rates of harvested genomic DNA were assessed using the Surveyor nuclease mismatch cleavage assay, which can detect possible mutations induced in the genomic DNA of transfected cells.

As shown in Figure 1c, all genomic DNA of Neuro2a cells transfected with a plasmid expressing sgRNA targeting Per1 (sgPer1) produced cleaved DNA bands (arrows) in the mutation mismatch cleavage assay. Similar discordant truncation analysis results were obtained in the sgPer2 group. Since a single AAV can accommodate up to three sgRNA expression cassettes, one sgRNA (sgPer1-3 with the nucleotide sequence represented by SEQ ID NO: 1) targeting Per1 with strong mutagenesis efficiency and Per2 targeting Per2 By combining two sgRNAs (sgPer2-1 having the nucleotide sequence shown in SEQ ID NO: 2 and sgPer2-2 having the nucleotide sequence shown in SEQ ID NO: 3), the possibility of simultaneously knocking out Per1 and Per2 was increased. The sgRNA sequence is shown in Table 1 below.

SEQ ID NO: sgRNA base sequence (5'-> 3') Strand exons Distance from ATG
(bp) One sgPer1-3 GGATGCGCTCGGCAATGAGTAGG - 8 1013 2 sgPer2-1 GGATGGCGAGCATCAAGGGCCGG + 10 1118 3 sgPer2-2 GAGCACAACCCCTCCACGAGCGG - 3 278

In addition, the genome editing efficacy of multiplexed sgRNAs in reducing protein expression was investigated. Before the protein extract was isolated and Western blot analysis was performed using an antibody against PER, Neuro2a cells stably expressing Cas9:EGFP (hereinafter referred to as Neuro2a-Cas9 cells) were multiplexed with U6-mediated sgRNA as shown in FIG. 2A . Transfected with a plasmid containing the expression cassette. As shown in Figure 2b, the high levels of PER1 and PER2 proteins in the sgPer-transfected group were less than half that of the sgLacZ control group. Consistently, mutation analysis and Western blot analysis of genomic DNA from transfected cells indicated successful target gene KO. Therefore, the multiple sgRNA expression AAV vector system was named CSAC in the Examples below.

Example 2. Effect of SCN-Injected CSACs on Motor Activity and Body Temperature

To demonstrate the utility of CSAC in vivo, CSAC-Per or control AAV was injected into the SCN of mice constitutively expressing Cas9 as shown in FIG. 3A . AAV delivery was confirmed histologically by confocal microscopy of brain sections containing the SCN. As shown in Fig. 3c-d, viral infection sites covering the SCN appeared in mice.

To determine the effect of CSAC on the behavioral and physiological aspects of circadian rhythm in awake behavioral animals, motor activity and body temperature were simultaneously recorded using a telemetry-based method. As shown in Fig. 4a, weekly locomotor activity was found to be normal in control animals injected with AAV-expressing fluorescent protein, which exhibited light-inhibited locomotion during the light phase and distinct behavioral onset consistent with the light-off point. In constant darkness, control animals clearly showed circadian awakening and resting cycles with a duration slightly shorter than the 24 h characteristic of the C57BL/6J group. However, as shown in FIG. 4b , mice injected with CSAC-Per exhibited disrupted circadian activity under constant darkness (DD). Chi-square periodogram analysis clearly indicates that CSAC interferes with circadian motor activity. As shown in Figure 4c, mean Qp values in control animals peaked significantly before 24 h, typical of circadian motor activity. As shown in Fig. 4d, the mean Qp value of the CSAC-Per group was not significant at any time point.

Body temperature showed almost the same pattern as the motor activity of the experimental animals. As shown in Figure 5a,b, the control animals showed typical circadian actograms in both LD and DD conditions, whereas the CSAC-Per group showed no circadian changes in body temperature in the free running condition without a light signal. That is, as shown in Fig. 5c, d, the chi-square periodogram supports the result that the mean Qp value of the control animals, unlike the mice in the CSAC-Per group, exceeds the significance threshold at about 24 hours.

In addition, to evaluate whether CSAC-mediated transfection of circadian proteins in SCN affected baseline activity levels or temperature, mean activity and body temperature were calculated, respectively. As shown in FIG. 6 , there was no significant difference in average motor activity and body temperature between the control group and the CSAC group. The above results indicate that CSAC injection into the SCN efficiently and specifically inhibited the physiological features of circadian rhythm in vivo without affecting average motor activity or body temperature.

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> Daegu Gyeongbuk Institute of Science and Technology <120> Single guide RNA combination for suppressing the expression of clock gene Period, and use thereof <130> ADP-2021-0027 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sgPer1-3 <400> 1 ggatgcgctc ggcaatgagt agg 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sgPer2-1 <400> 2 ggatggcgag catcaagggc cgg 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sgPer2-2 <400> 3 gagcacaacc cctccacgag cgg 23

Claims (9)

sgRNA for suppressing expression of clock gene Period. According to claim 1, wherein the sgRNA is a sgRNA having the nucleotide sequence shown in SEQ ID NO: 1, to suppress the expression of the clock gene (clock gene) characterized in that it suppresses the expression of the clock gene Period 1 (Per1) for sgRNA. According to claim 1, wherein the sgRNA is a sgRNA having a nucleotide sequence represented by SEQ ID NO: 2 or 3, and the expression of the clock gene (clock gene) characterized in that it suppresses the expression of the clock gene Period 2 (Per2) sgRNA for inhibition. sgRNA having the nucleotide sequence represented by SEQ ID NO: 1; and sgRNA having the nucleotide sequence represented by SEQ ID NO: 2 or 3 for controlling circadian rhythm in mammals. The vector according to claim 4, wherein the vector is applicable to CRISPR/Cas9 technology. 5. The method of claim 4, wherein the vector comprises a sgRNA having the nucleotide sequence shown in SEQ ID NO: 1, sgRNA having the nucleotide sequence shown in SEQ ID NO: 2, or sgRNA having the nucleotide sequence shown in SEQ ID NO: 3, Period A vector characterized in that it suppresses the expression of a protein. A CRISPR/Cas9 based single adeno-associated virus (AAV) vector system comprising the vector of any one of claims 4 to 6. A transformant transformed with the vector system of claim 7. treating the transformant of claim 8 with a test substance; and
A drug screening method for improving circadian rhythm, comprising the step of analyzing a change in the circadian rhythm of the transformant treated with the test substance.

Images