KR20220092036A - Circular Nucleic Acid Template for DNA Hydrogel Production and Protein Synthesis System using The Same - Google Patents

Abstract

The present invention relates to a circular nucleic acid template for DNA hydrogel production and a protein synthesis system using the same. According to a composition including the circular nucleic acid template for DNA hydrogel production and a manufacturing method of DNA hydrogel production using the same, continuous DNA synthesis is possible in vitro through rolling circle amplification (RCA), and it is useful as a low-cost and high-yield DNA synthesis and amplification platform and can be used for nucleic acid synthesis and genetic diagnosis technology. In addition, the synthesized DNA forms a G-quadruplex structure to form a DNA hydrogel, and DNA hydrogels have high stability and unique physical or chemical properties. In particular, it is possible to synthesize cell-free peptides or proteins from DNA hydrogels encoding peptides or proteins. Also, significantly better protein synthesis efficiency than the existing cell-free synthesis system is shown. Furthermore, as a higher production efficiency is shown than the RNA hydrogel developed by the present inventors, the composition can be usefully utilized in various fields requiring protein synthesis such as medicine and pharmacy, food, and environment as a platform technology for producing peptides.

Description

Circular Nucleic Acid Template for DNA Hydrogel Production and Protein Synthesis System using The Same}

The present invention relates to a circular nucleic acid template for production of a DNA hydrogel and a protein synthesis system using the same, and a DNA hydrogel comprising a promoter sequence, a sequence complementary to a G-quadruplex motif sequence, and a target sequence It relates to a circular nucleic acid template for use and a protein synthesis system using a DNA hydrogel produced from the template.

Central dogma refers to a flow path of genetic information that was identified and named by British molecular biologist Francis Crick in 1956. DNA replication, DNA to RNA transcription , and RNA to protein translation. The initial concept meant the flow of expression from DNA to protein, but the current central dogma includes reverse transcription from RNA to DNA, and as various functions other than the protein coding function of RNA have been demonstrated, the function of genetic information and a concept that encompasses all flows. As research on the flow of genetic information and the function of the composition of the central dogma continues, the synthesis technology of genomes (DNA and RNA, etc.) and proteins (peptides) from the perspective of each stage of the central dogma has been developed in the life sciences, medicine, and alternative energy industries. It has been researched and developed as the most fundamental technology that has a significant impact on

In the existing gene synthesis technology, a method of synthesizing the precise nucleic acid sequence of a specific gene into short oligonucleotides and linking them is used. It is difficult to find errors of various factors that occur during nucleic acid sequencing and accurate sequencing analysis, and there are disadvantages in that only one type of gene of a specific nucleic acid sequence can be synthesized at a time (Mol Biosyst. 2009 Jul; 5 (Mol Biosyst. 2009 Jul; 5) 7):714-22.doi:10.1039/b822268c.Epub 2009 Apr 6.).

Techniques currently used for DNA synthesis mainly include PCR and typical plasmid purification procedures from bacterial and other cellular sources. Methods for purifying plasmids from bacteria and other cells are expensive in time/human/economical, and PCR, which is in vitro amplification, relies on rapid thermal cycling, which is impractical for large-scale use.

Functional single-stranded (eg mRNA) and double-stranded RNA molecules have been produced in living cells and in vitro using purified recombinant enzymes and purified nucleotide triphosphates (European Patent No. 1631675 and US Patent Application Publications). Double wide band (see No. 014/0271559 A1). Nevertheless, the production of RNA on a scale that allows for a wide range of commercial applications requires excessive costs. Recently, RNA-based development applications (e.g., siRNA or RNAzyme therapeutics or miRNA or piwi RNA-based diagnostic platforms, etc.) have been actively used in various fields, especially medicine, replacing existing DNA and proteins. According to the central dogma that sustains biology, it is produced from DNA to RNA to the final protein. RNA has a very short viability of a few seconds or minutes compared to DNA or protein, but it has a DNA genome code and a unique function of a protein at the same time, so its potential application is great. As such, the potential of RNA is illuminated, and various biological techniques for commercial use are plentiful, but there is a technically and costly very difficult in extracting RNA in cells or synthesizing it by chemical techniques. For example, since the degradation rate of intracellular RNA is faster than that of DNA, extraction or storage is difficult, and it is difficult to synthesize more than 50 bases in length with current chemical synthesis technology, and even if successful, the yield is very low. Current RNA production methods are divided into intracellular culture and chemical synthesis, both of which have limitations in spite of excellent applications of RNA due to high cost and low yield.

On the other hand, the G-quadraplex (G4) is a secondary structure of DNA found in the terminal region of chromosomes and transcriptional regulatory regions of various genes, and is divided into four It refers to a complex of G-quadrued strands formed in the form of hydrogen bonds by pairing DNA strands with each other. Telomeres are rich in guanine to form G-quadrules, which inhibit the activity of telomerase. Inhibition of the activity of telomerase using the characteristics of the G-quadrel has been proposed as a therapy for inducing apoptosis of tumor cells. In addition, it is known that the G-quadrel regulates the transcription of genes according to the formation site of the structure.

The present inventors use a nucleic acid containing a sequence complementary to a G-quadruplex motif sequence as a template to solve the problems of the above-described RNA synthesis (transcription) and protein production (translation) systems and synthetic RNA A system for producing hydrogelled nucleic acids and protein production based on rolling circle transcription (RCT) was invented and applied for a patent (Korean Patent Application No. 10-2019-0136416, unpublished). Since the RNA synthesized by the nucleic acid production system is hydrogelled by forming a G-quartet structure, the stability of RNA can be significantly increased, and it is useful as a platform technology for cell-free protein synthesis from which peptides or proteins can be produced. can be used

Under this background, the present inventors have made intensive efforts to develop templates for the production of DNA hydrogels as well as the above-described RNA hydrogels, promoter sequences; target sequence; and a sequence complementary to the G-quadrel motif sequence; a nucleic acid template for production of a DNA hydrogel was developed, and using the nucleic acid template for production of the DNA hydrogel as a template, rolling circle amplification (RCA) was performed. It was confirmed that DNA amplification was possible in a very high yield, and it was confirmed that the produced DNA was hydrogelled to form a gel having stable and physical strength.

Furthermore, when a DNA hydrogel is prepared through circular cyclic amplification using the nucleic acid template as a template, and a protein is synthesized by transcription and translation of the DNA hydrogel in a cell-free protein synthesis system, the RNA hydrogel developed by the present inventors The present invention was completed by confirming that the production of protein with a significantly higher yield is possible.

The information described in the background section is only for improving the understanding of the background of the present invention, and it does not include information forming prior art known to those of ordinary skill in the art to which the present invention pertains. it may not be

It is an object of the present invention to provide a nucleic acid template for the production of a DNA hydrogel.

Another object of the present invention is to provide a method for preparing a DNA hydrogel using the nucleic acid template.

Another object of the present invention is to provide a use for preparing a peptide or protein of the DNA hydrogel.

In order to achieve the above object, the present invention provides a promoter sequence; target sequence; and a nucleic acid template comprising a sequence complementary to a G-quadruplex motif.

The present invention also relates to a promoter sequence; target sequence; and synthesizing DNA from a nucleic acid template comprising a sequence complementary to a G-quadruplex motif.

The present invention provides a sequence complementary to the promoter sequence produced by the method for preparing the DNA hydrogel; a sequence complementary to the target sequence; And it provides a DNA hydrogel comprising a G- quadruplex motif.

The present invention comprises the steps of synthesizing mRNA by transcription of the DNA hydrogel; synthesizing a peptide or protein by translating the synthesized mRNA; And it provides a method for producing a peptide or protein comprising the step of obtaining a synthesized peptide or protein.

The composition comprising a nucleic acid template for production of a DNA hydrogel of the present invention and a method for preparing a DNA hydrogel using the same enable continuous DNA synthesis in vitro through rolling circle amplification (RCA), resulting in low cost and high cost It is useful as a high-yield DNA synthesis and amplification platform, and can be used for nucleic acid synthesis and gene diagnosis technology.

The synthesized DNA forms a G-quartet structure by the included G-quartet motif to form a DNA hydrogel, and the DNA hydrogel has high stability and unique physical/chemical properties, especially peptides or proteins. It is possible to synthesize cell-free peptides or proteins from the encoding DNA hydrogel, and shows significantly superior protein synthesis efficiency than the existing cell-free synthesis system, and furthermore, higher production efficiency than the RNA hydrogel developed by the present inventors As a platform technology for producing peptides, it can be usefully used in various fields requiring protein synthesis, such as medicine, food, and the environment.

1 schematically shows a process for producing a DNA hydrogel using the nucleic acid template for producing a DNA hydrogel of the present invention.
2 is a result confirming whether the circular template synthesis process was successfully performed through 12% polyacrylamide gel electrophoresis in each step. The information for each lane is as follows:
Lane 1: 25 bp DNA ladder, Lane 2: Circular circular amplification primers, Lane 3: Linear template before annealing, Lane 4: Circular template with nicks after annealing, Lane 5: Complete circular circular amplification template after conjugation, Lane 6: 50 bp DNA ladder.
3 is a result of confirming the gelation of the circular circulation amplification product DNA through 12% polyacrylamide gel electrophoresis. The information for each lane is as follows:
Lane 1: 25 bp DNA ladder, Lane 2: Linear template before annealing, Lane 3: Circular template with nicks after annealing, Lane 4: Completed circular cyclic amplification template after conjugation, Lane 5: Formed after circular cyclic amplification process DNA.
4 is a photograph showing the results of visual verification of a DNA hydrogel synthesized through circular circulation amplification.
Figure 4a: circular circulating amplification products contained in tubes.
Figure 4b: DNA gel staining with SYBR Green I (Invitrogen) and fluorescing in the blue light region.
Figures 4c-4e: Elasticity of the gel visually confirmed by lifting the DNA gel using a 20 μl pipette.
5 is a result according to the visually confirmed circular circulation amplification process time (3 hours or 48 hours).
Figure 5a: Results immediately after the end of the circular circular amplification process at 45 °C.
Figure 5b: The appearance of separation into a gel and a clear solution after a period of time after the completion of circular circulation amplification (3 hours, 48 hours).
5c to 5d: Results of comparing the shape and size of a solution that has undergone circular circulation amplification for 3 hours and 48 hours, respectively, placed at the tip of a 20 μl pipette.
6 is a result of time diversification of the circular circulation amplification process confirmed by 12% polyacrylamide gel electrophoresis. The information for each lane is as follows:
Lane 1: 25 bp DNA ladder, Lane 2: Linear template before annealing, Lane 3: Circular template with nicks after annealing, Lane 4: Completed circular circular amplification template after conjugation, Lane 5: 3 hour circular circular amplification. Solutions other than opaque gel after process, lane 6: 48 hours circular cycle solution other than opaque gel after amplification process. Electrophoresis was performed at 15 mA for 60 minutes.
7 is a result of verifying the expression efficiency of a protein using a DNA hydrogel prepared using the nucleic acid template of the present invention. Using a DNA gel encoding the HiBiT protein as a template, the relative amount of the protein expressed through the cell-free protein expression system was analyzed as the relative phosphorescence intensity. The information on the X-axis is as follows:
Negative control: no rolling circle amplification template, positive control: linear DNA template encoding HiBiT, gel 1: DNA gel+0 μM, gel 2: DNA gel+1 μM, gel 3: DNA gel+10 μM, gel 4: DNA gel+20 μM, gel 5: DNA gel+30 μM using T7 promoter primer.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is those well known and commonly used in the art. All nucleotide sequences described in this specification were written from the 5' end to the 3' end.

The present inventors have developed a hydrogelled nucleic acid (RNA hydrogel) based on rolling circle transcription (RCT) using a nucleic acid containing a sequence complementary to a G-quadruplex motif sequence as a template. Invented a production and protein production system and applied for a patent (Korean Patent Application No. 10-2019-0136416, unpublished).

The hydrogelled nucleic acid (RNA hydrogel) production and protein production system uses a nucleic acid template comprising a promoter sequence (antisense), a target sequence, and a sequence complementary to a G-quartet motif sequence, and the target sequence is a protein It is the 'antisense strand' of the encoding nucleic acid sequence, and the RNA transcribed using the nucleic acid template as a template is hydrogelled, and the hydrogelled RNA is translated to produce a protein.

On the other hand, the present invention provides a nucleic acid template for the preparation of a DNA hydrogel based on the G-quadrel, a method for preparing a DNA hydrogel using the nucleic acid template, and a protein synthesis system using the same. The DNA hydrogel production system of the present invention uses a nucleic acid template including a promoter sequence (sense strand), a target sequence, and a sequence complementary to a G-quartet motif sequence, and amplifies the nucleic acid template to prepare a DNA hydrogel. can

The DNA hydrogel of the present invention may have different properties and uses from the RNA hydrogel, and in particular, in the synthesis of a peptide or protein, the target sequence is a sense strand of a nucleic acid sequence encoding a protein, and amplified as a template A peptide or protein can be synthesized through transcription and translation of the DNA hydrogel. The present invention is characterized in that it exhibits superior efficiency than the conventional protein synthesis system as well as the RNA hydrogel-based protein synthesis system.

In an embodiment of the present invention, a circular nucleic acid template including a promoter sequence, a target sequence, and a sequence complementary to a G-quadrel motif sequence was prepared, and a DNA hydrogel was prepared through circular circulation amplification using the nucleic acid template as a template. synthesized.

In another embodiment of the present invention, as a result of synthesizing the protein by in vitro translation and transcription of the synthesized DNA hydrogel, the protein was produced in a significantly higher yield than the existing cell-free protein synthesis system and the RNA hydrogel-based synthesis system. Synthesis was confirmed.

Accordingly, in one aspect, the present invention provides a promoter sequence; target sequence; And it relates to a composition for producing a DNA hydrogel comprising a nucleic acid template comprising a sequence complementary to the G- quadruplex motif (G-quadruplex motif).

"DNA hydrogel" of the present invention refers to a nucleic acid gel hydrogelled through various interactions such as hydrogen bonding, covalent bonding, and hydrophobic interactions between DNA strands. In the present invention, in particular, the template of the present invention is synthesized as a template It is characterized by forming a gel by forming a unique cube-shaped structure in which the G-quadrued sequence contained in the DNA strand is hydrogen-bonded to form a quadruple strand. In the present invention, the "DNA hydrogel" may be used interchangeably in the same meaning as "hydrogelled DNA" and "hydrogelled nucleic acid".

As used herein, the term "promoter sequence" refers to a sequence capable of regulating transcription initiation in the process of protein expression.

In the present invention, the promoter sequence may be used by selecting a suitable promoter by those skilled in the art according to the type of template, the synthesis method, the type of nucleic acid to be produced, and the target sequence. In double-stranded nucleic acids, the promoter sequence is generally a concept including both the sense strand and the antisense strand, but in the present invention, for the purpose of distinguishing both strands, the sequence of the sense strand is a 'promoter sequence', and the promoter sequence of the antisense strand is It was designated as a 'sequence complementary to the promoter sequence'.

In the present invention, the DNA hydrogel synthesized using the nucleic acid template including the "promoter sequence" as a template may be characterized in that it includes a sequence complementary to the promoter sequence (antisense sequence).

In the present invention, the promoter is, for example, T7 promoter, T5 promoter, T3 promoter, lac promoter, tac and trc promoter, cspA promoter, lacUV5 promoter, Ltet0-1 promoter, phoA promoter, araBAD promoter, trp promoter, tetA There are promoters, Ptac promoters, SP6 promoters, and the like, and may preferably be selected from the above examples, but is not limited thereto.

In one embodiment of the present invention, the promoter sequence included in the nucleic acid template is the sense sequence of the T7 promoter, but is not limited thereto.

As used herein, the term "target sequence" refers to a nucleic acid sequence comprising a sequence complementary to a 'nucleic acid sequence to be produced'. When amplification or transcription occurs using the target sequence as a template, "nucleic acid to be produced" can be produced. The nucleic acid to be produced is included in the DNA hydrogel of the present invention. For example, the nucleic acid to be produced may be a functional moiety or a sequence complementary thereto.

In the present invention, when the nucleic acid template is used for production of a DNA hydrogel for protein expression, the target sequence may be a sense sequence of a gene sequence encoding a specific peptide or protein. In this case, the synthesized DNA hydrogel may include an antisense sequence of a gene sequence encoding a specific protein, and may be transcribed and translated into a template to synthesize a peptide or protein encoded by the gene sequence.

As used herein, the term "G-quadruplex" refers to a structure in which two or more G-tetraplexes appearing in a DNA nucleotide sequence having a high ratio of guanosine residues are vertically stacked. , Here, G-quadrel refers to a unique cube-shaped DNA structure in which four guanosine-rich DNA strands are paired with each other to form a quadruple in a hydrogen bond form, and four guanine bases form a Hoogsteen hydrogen bond (Hoogsteen hydrogen bonding) refers to a rectangular structure formed densely. The G-quadrel is very stable under various biochemical conditions, and the orientation within the quaternary is variable. In particular, the cation (mainly K+) at the center of the G-quartet contributes to maintaining the structure of the G-quartet more stably. G-quadrules are known to have diverse biological functions in the telomere region and in the promoter region (Henderson E, et al., Telomeric DNA oligonucleotides form novel intramolecular structures containing guanine-guanine base pairs., Cell (December 1987)). G-quartets are formed predominantly at guanine-rich sequence sites (Murat P, Balasubramanian S (April 2014)). However, not all guanine-rich sequence sites form G-quartets.

As used herein, the term “G-quartet motif” or “G-quartet motif sequence” refers to a nucleic acid (DNA or RNA) sequence that forms a G-quartet. Specifically, a method for predicting whether a specific nucleic acid sequence has the ability to form a G-quadruplex has been previously reported (Todd AK, Johnston M, Neidle S (2005)). For example, Todd AK, Johnston M et al. reported that d(G ₃₊ N _1-7 G ₃₊ N _1-7 G ₃₊ N _1-7 G ₃₊ ) (where the subscript is the range of numbers of each base, N is any base, d is an integer greater than or equal to 1, which means the repetition of the nucleotide sequence in parentheses) has been reported as a general pattern for forming a G-quadrel, but is not limited thereto.

In the present invention, the G-quadrel motif may include at least two, at least three, or at least four or more consecutive guanines.

In the present invention, the G- quadruplex motif may be characterized in that it comprises guanine in a specific gravity of at least 20% or more, at least 30% or more, at least 40% or more, or at least 50% or more.

In the present invention, the G-quartet motif may additionally include 1 to 7 arbitrary bases between the consecutive guanines.

In one embodiment of the present invention, the G-quadruple motif sequence (5'-TAGGGTTAGGGT-3') of the DNA amplified as a template in a DNA template comprising a sequence complementary to the G-quadrel motif sequence is a G-quadruplex. designed to form

In the present invention, the sequence complementary to the G-quadruplex motif refers to any sequence capable of forming a G-quadruplex when amplified or transcribed.

In the present invention, the sequence complementary to the G-quartet motif forms a G-quartet when DNA is synthesized (amplified) using it as a template, and preferably 3 or more consecutive guanines and 1 to 7 arbitrary sequences may be characterized as complementary to a nucleic acid sequence repeated one or more times, and most preferably, it may be characterized as 5'-ACCCTAACCCTA-3' (SEQ ID NO: 3), but is limited thereto not.

As used herein, the term “template” refers to a nucleic acid strand serving as a template for nucleic acid replication or transcription. In the present invention, the template may be circular or linear, except where specifically mentioned, and the shape may be selected and manufactured by a person skilled in the art if necessary. When using circular circular amplification (RCA) to produce a DNA hydrogel, it is preferably a circular template.

In the present invention, the nucleic acid template may include, without limitation, additional functional or non-functional sequences in addition to a sequence complementary to a promoter sequence, a target sequence, and a G-quartet motif sequence according to use and/or necessity. For example, the nucleic acid template may further include a second target sequence, a spacer, Poly T, a ribosome binding site, and the like, but is not limited thereto.

In the present invention, each component of the nucleic acid template (eg, a promoter sequence, a target sequence, and a sequence complementary to a G-quartet motif sequence) is "operably linked" to each other when placed in a functional relationship. do. Linking of these sequences may be performed by ligation (linkage) at convenient restriction enzyme sites, but is not limited thereto, and may be linked via a synthetic oligonucleotide adapter or linker according to a conventional method. can

In the present invention, the nucleic acid template may be a DNA template or an RNA template. In the case of an RNA template, reverse transcriptase may be used for production of a DNA hydrogel, and in the case of a DNA template, a DNA polymerase may be used for production of a DNA hydrogel, but is not limited thereto.

In the present invention, the nucleic acid template may be linear, and the promoter sequence may be separated and present at the 3'-end and 5'-end of the nucleic acid template. In this case, the composition may further comprise an oligonucleotide comprising a sequence complementary to the promoter sequence to form a circular template.

The term "separation" of the term "promoter sequence" of the present invention means that the promoter sequence is separated into two or more. The separation is possible without restriction of position as long as it is within the promoter sequence, but for effective annealing with the intact complementary promoter sequence, it is preferable to separate the promoter sequences at the 3′-end and the 5′-end so that the lengths of the promoter sequences are similar. .

As in an embodiment of the present invention, an oligonucleotide comprising a sequence complementary to the promoter sequence is annealed to the isolated promoter sequence of the nucleic acid template to partially form a duplex comprising a nick or space, thereby forming a nucleic acid template can be made circular, and nicks or voids can be joined by ligation or polymerization to form a complete circular template.

In the present invention, the composition may be used for the production of DNA hydrogel, NTP, dNTP, rNTP, ddNTP, primer, any one or more selected from the group consisting of DNA polymerase and RNA polymerase It may be characterized in that it further comprises.

In the present invention, the composition may include a cation for stability of the formed G-tetrapolymer, and most preferably, may further include a potassium ion or a sodium ion. The ion may be included in the form of a buffer, but is not limited thereto.

In the present invention, the composition may be used for the production of peptides or proteins, and in this case, it may be included together with additional components necessary for peptide or protein synthesis, such as ribosomes and amino acids.

In another aspect, the present invention relates to a method for preparing a DNA hydrogel, comprising the step of synthesizing DNA from a nucleic acid template comprising a sequence complementary to a promoter sequence, a target sequence, and a G-quartet motif sequence.

In the present invention, the DNA hydrogel may be characterized in that it comprises a sequence complementary to a promoter, a sequence complementary to a target sequence, and a G-quartet motif sequence.

In the present invention, the sequence complementary to the target sequence may include an antisense sequence of a gene sequence encoding a specific protein.

In the present invention, the step of synthesizing DNA from the nucleic acid template may be performed through various nucleic acid amplification methods. For example, the step of synthesizing DNA from the nucleic acid template may include: Rolling Circle RCA, Polymerase Chain Reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), and TMA. (transcription-mediated amplification), and as in one embodiment of the present invention, it is preferable to synthesize DNA using rolling circle amplification (Rolling Circle RCA), but is not limited thereto .

In the present invention, the nucleic acid template is linear,

The promoter sequence is separated and is present at the 3'-end and 5'-end of the nucleic acid template,

annealing the nucleic acid template with an oligonucleotide comprising a sequence complementary to a promoter sequence; and

It may further comprise the step of linking the 3'-end and the 5'-end of the annealed nucleic acid template with the oligonucleotide to form a circular template including a double strand, synthesizing DNA from the circular template It may be characterized in that it includes.

In the present invention, the "circular template" refers to a circular nucleic acid strand serving as a template for DNA synthesis. The circular nucleic acid template can be used as a template in a technique called "Rolling Circle" or "Rolling Circle" amplification.

In an embodiment of the present invention, a DNA hydrogel was prepared using a rolling circle amplification (RCA). When RCA is performed using the circular template, the polymerization reaction does not end until the material (eg, dNTP, ddNTP) is depleted, and a nucleic acid having an N-fold from one template can be prepared, so a linear template It may be characterized by exhibiting a higher production yield.

In the present invention, when using the circular template, it is most preferable to synthesize DNA using a rolling circle amplification (RCA).

In the present invention, the rolling circle amplification (RCA) may be characterized in that the isothermal amplification at 30 ℃ to 45 ℃, preferably 42 ℃ to 45 ℃.

In an embodiment of the present invention, it was confirmed that the elasticity of the DNA hydrogel increases as the Rolling Circle amplification (RCA) time increases (from 3 hours to 48 hours).

Therefore, the DNA synthesis time of the present invention may be characterized in that it is controlled according to the desired degree of elasticity of the DNA hydrogel.

In the present invention, in order to promote the formation of a G-tetrapolymer of the produced nucleic acid to promote hydrogelation, it may further comprise the step of adding a cation, most preferably potassium ion or sodium ion.

In another aspect, the present invention relates to a DNA hydrogel prepared by the method for preparing the DNA hydrogel.

In the present invention, the DNA hydrogel comprises a sequence complementary to a promoter sequence; a sequence complementary to the target sequence; and a G-quartet motif sequence.

In the present invention, the sequence complementary to the target sequence may include an antisense sequence of a gene sequence encoding a specific protein.

Commercial protein production methods known to date have mainly been used to destroy the cytoplasm of living cells or chemically polymerize amino acids. However, these methods go through a very complicated production process in the cell disruption process and purification/separation process, and the produced protein is not normally expressed or is not well accepted in the body and causes an immune response, and amino acid sequence in the polymerization of long-chain proteins. It had disadvantages such as poor accuracy of Therefore, in recent years, the development of a cell-free protein synthesis system (cell-free or in vitro protein synthesis system) that does not use cells in the peptide or protein production process is being actively conducted.

In addition, it is expected to increase productivity because it can be free from various external conditions such as pH, temperature, and ionic strength when protein is synthesized. However, despite having these advantages, it is not practically used because of the high cost of the reagents consumed due to the short reaction time and low protein production rate. In order to overcome these disadvantages, various attempts have been made to increase productivity by adding various chemicals such as iodoacetamide and glutathione or by developing a continuous flow system, but it is still insufficient for industrial use. the current situation.

In one embodiment of the present invention, the production efficiency of HiBiT protein is remarkably excellent even when the DNA hydrogel prepared by amplifying the nucleic acid template of the present invention is transcribed into a template, mRNA is synthesized, and a cell-free production method is used by translating it. was verified. In particular, it was confirmed that peptides and DNA can be synthesized at a higher yield than the peptide or protein synthesis system using the RNA hydrogel, which is the present inventor's existing invention.

Therefore, in another aspect, the present invention comprises the steps of synthesizing mRNA from the DNA hydrogel;

It relates to a method for producing a peptide or protein comprising the step of synthesizing the peptide or protein by translating the synthesized mRNA.

In the present invention, the synthesis of mRNA may be performed through "transcription". The transcription (transcription) is one of the expression processes of DNA. In the present invention, the transcription means synthesizing RNA using the DNA hydrogel of the present invention as a template. The transcription of the present invention can be performed without limitation using various conventionally known methods.

In one embodiment of the present invention, since the DNA hydrogel is a linear DNA strand and is designed to include a sequence complementary to the promoter sequence (antisense sequence) and a sequence complementary to the target sequence (HiBiT antisense sequence), For operation, transcription was performed by adding an oligonucleotide having a promoter sequence (sense sequence) as a primer.

In the present invention, it may be characterized in that mRNA is synthesized after adding an oligonucleotide including a promoter sequence.

In the present invention, the step of synthesizing the peptide or protein may be characterized in that it is synthesized by a cell free protein synthesis system.

As used herein, the term "cell-free protein synthesis system" refers to key elements (ATP (adenosine triphosphate), amino acids) required for protein synthesis by adding a substrate or enzyme to cell lysates or extracts. etc.) to synthesize proteins in vitro. Such a cell-free protein synthesis system can overcome the disadvantages of the existing protein production method using cells, and cell-free protein synthesis uses only the intracellular machinery and its factors related to protein production in the cell. By artificially repeating only the protein synthesis process in a state in which the physiological control mechanism of the cell is excluded from extraction and mass production of the target protein in a short period of time, it is possible to synthesize the protein at high speed without going through the cell culture process as well as the cell membrane Compared to the cell culture process in which protein expression is carried out in the space of the cell wall and cell wall, it is a completely open system that does not have any physical barriers, and has the advantage of being able to freely modify the conditions for protein synthesis to apply it to various studies. In addition, the intracellular protein synthesis system has a great problem in production and yield when the produced protein is cytotoxic. However, when a cell-free protein synthesis system is used, peptides or proteins can be freely produced in these problems.

As used herein, "cell-free protein synthesis system (cell-free or in vitro protein synthesis system)" refers to a 'cell-free or in vitro synthesis system' or a 'cell-free peptide synthesis system' depending on the production target. (cell-free or in vitro peptide synthesis system)' or 'cell-free protein/peptide synthesis system' can be used interchangeably with the same meaning.

Example

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1: Preparation of a circular nucleic acid template using a synthetic linear nucleic acid template

The T7 promoter sequence (sense sequence), the target sequence (HiBiT coding sequence, Sense), the sequence complementary to the G-quartet motif sequence, and the isolated T7 promoter sequence (sense sequence), isolated through Integrated DNA Technology, in turn. linear nucleic acid template; And oligonucleotides (primers) having a sequence complementary to the T7 promoter sequence (antisense sequence of the T7 promoter) were synthesized (Table 1). Phosphorylation treatment was performed on the 5'-end of the linear nucleic acid template for subsequent ligation of the 5'-end and the 3'-end.

sequence name sequence (5' -> 3') SEQ ID NO: Nucleic Acid Template AGGGAT TAAGTATAAGGAGGAAAAAATATGGTGAGCGGCTGGCGGCTGTTCAAGAAGTTAAGCTAAACCCTAACCCTA TAATACGACTCACTAT One T7 promoter sequence (Sense) TAATACGACTCACTATAGGGAT 2 sequence complementary to the G-quartet motif sequence ACCCTAACCCTA 3 target sequence
(HiBiT Encryption (Sense) Sequence) ATGGTGAGCGGCTGGCGGCTGTTCAAGAAGTTAAGCTAA 4 oligonucleotide
(primer) ATC CCT ATA GTG AGT CGT ATT A 5

* The 5'-end of the nucleic acid template is phosphorylated* Bold indicates the complementary sequence portion of the nucleic acid template (separated T7 promoter) and oligonucleotide (primer)

45 μM of the nucleic acid template, 45 μM of the primer. 100 mM NaCl was added, incubated at 95° C. for 5 minutes, and cooled to 4° C. at a rate of -0.5° C./30 sec to annealing the nucleic acid template and primer. Through the annealing, some sequences at the 3' and 5'-ends of the nucleic acid template and oligonucleotides (in bold) are complementary to each other and converted into a circular nucleic acid template including a nick.

The circular nucleic acid template containing the nick was annealed using Promega's T4 ligase (ligase) at a concentration of 10 μM, and the 5'-end and 3'-end were spliced at 16 °C for 16 hours. Thus, a complete circular nucleic acid template was prepared.

Oligonucleotides (primers) prepared by performing 12% polyacrylamide gel electrophoresis at 15 mA for 60 minutes, unannealed linear nucleic acid template, circular nucleic acid template including nick, complete nucleic acid template It was confirmed that the same was successfully prepared (FIG. 2). It was confirmed that the linear nucleic acid template changes the structure of the template according to the annealing and conjugation process, so that the degree of band movement on the electrophoresis decreases sequentially, which means that the circular nucleic acid template containing the nick and the complete nucleic acid template are successfully produced by each process. It was confirmed that it was manufactured. After the conjugation process, one band was observed at a position of 800 bp or more of bases, but this is presumed to be a phenomenon caused by a many-to-many reaction rather than a 1:1 reaction between the template and the primer.

Example 2: Preparation of DNA hydrogels through circular circular amplification (RCA)

When synthesizing DNA using the circular nucleic acid template prepared in Example 1 as a template, circular circulation amplification (RCA) was performed to confirm whether a DNA hydrogel was formed. The oligonucleotide was used as a primer in the DNA synthesis process. RCA was subjected to circular circulation amplification using Thermo Scientific's EquiPhi29 DNA polymerase at 45 °C for 3 hours according to the supplied manual. 12% polyacrylamide gel electrophoresis was performed at 15 mA for 60 minutes to confirm the movement of the synthesized DNA.

As shown in FIG. 3 , it was confirmed that the DNA prepared through circular circulation amplification was hydrogelled, did not move through the polyacrylamide gel, and spanned the rod groove.

As shown in FIG. 4 , it was confirmed that a DNA gel was also formed visually. In particular, as shown in FIG. 4a, the opaque part and the transparent liquid part were separated, and when the opaque part was lifted with a pipette, it resisted the pressure of the pipette and was pulled up as a single unit and exhibited a hydrogel-like shape. (FIGS. 4c to 4e). On the other hand, the transparent part did not show elasticity.

The DNA gel was stained with 10X SYBR Green I (Invitrogen) and fluorescence was observed in the blue light region. As a result, it was confirmed that the DNA formed a network, and the cross-link structure through G-tetramerization of the DNA was the gel. It has been proven to support the structure of

Example 3: Physical Characterization of DNA Hydrogels

The physical properties of the DNA hydrogel were analyzed using the DNA hydrogel prepared in Example 2. In order to confirm the change in the physical properties of the DNA gel according to the circular circulation amplification, RCA was performed for 3 hours and 48 hours, respectively, using the circular nucleic acid template prepared in Example 1 as a template, and then each solution was placed at the tip of a 20 μl pipette and the The shape and size were compared.

As shown in Figure 5, immediately after finishing the circular circulation amplification process at 45 °C, the whole solution looked turbid as shown in Figure A, but after time passes, it is separated into a gel and a transparent solution as shown in Figure B. Confirmed. As a result of 3 hours and 48 hours of RCA, respectively, to observe the change in the size of the gel according to the time of RCA at 45 °C, the DNA hydrogel subjected to RCA for 3 hours was larger than the DNA hydrogel subjected to RCA for 3 hours. is smaller and more resistant to pipette pressure.

A clear solution was separated from each amplification result, and 12% polyacrylamide gel electrophoresis was performed at 15 mA for 60 minutes to confirm the movement of the synthesized DNA. As shown in FIG. 6 , it was confirmed that the transparent part also did not move across the rod groove of the polyacrylamide gel, which means that the DNA product of circular cyclic amplification of the polymer exists even in the transparent part. The above result means that the transparent part does not exhibit strong physical properties like the opaque part, but has a polymer structure by locally forming a G-tetrapolymer.

Example 4: Protein expression using DNA hydrogel

Protein expression was confirmed using the DNA hydrogel prepared in Example 2. As a positive control, a HiBiT-encoding linear DNA template (Promega) including a HiBiT coding sequence (Antisense) and a T7 promoter sequence (Antisense) was prepared, and primers having the T7 promoter sequence were added at various concentrations to transcribe the T7 promoter during RNA transcription. to work properly (Table 2). Protein expression was performed at 25 °C for 2 hours using New England Biolabs' NEBExpress® Cell-free E. coli Protein Synthesis System, and the expressed HiBiT protein was relative phosphorescence using Promega's Nano-Glo HiBiT Extracellular Detection System. The production capacity was analyzed by the intensity of relative luminescence.

sequence name order SEQ ID NO: T7 promoter primer T AAT ACG ACT CAC TAT AGG GAT 6 HiBiT-encoded linear DNA template (positive control) ACAGTAACAGTATTAGCTAATCTTCTTGAACAGCCGCCAGCCGCTCACGGTGTTGGGTGTGTAGAAGAAGCCTCGTTCCCCGCACACTAGGTAGAGAGCTTCCACCAGGTGTGAGCCGCACAGGTGTTGGTTCACAAACATATTTTTTCCTCCTTATACTTAATCCCTATAGTGAGTCGTATTA 7

As shown in FIG. 7 , in the case of protein expression using a DNA hydrogel, it was confirmed that Hibit expression increased 34.8 to 46.7 times that of linear DNA and 6 to 8.1 times that of linear RNA at all primer concentrations. In particular, it was confirmed that the protein expression rate was 1.6 to 2.2 times higher than that of the protein synthesis system using the RNA hydrogel invented by the present inventors.

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby It will be obvious. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

<110> Progeneer Inc. <120> Circular Nucleic Acid Template for DNA Hydrogel Production and Protein Synthesis System using The Same <130> P20-B169 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 94 <212> DNA <213> Artificial Sequence <220> <223> neucleic acid template <400> 1 agggattaag tataaggagg aaaaaatatg gtgagcggct ggcggctgtt caagaagtta 60 agctaaaccc taaccctata atacgactca ctat 94 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> T7-promoter_Sense sequence <400> 2 taatacgact cactataggg at 22 <210> 3 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Complementary Sequence to G-quadraplex motif <400> 3 accctaaccc ta 12 <210> 4 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HiBiT coding sequence_Sense <400> 4 atggtgagcg gctggcggct gttcaagaag ttaagctaa 39 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide_(Primer for RCA) <400> 5 atccctatag tgagtcgtat ta 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> T7 promoter primer_(Primer for transcription) <400> 6 taatacgact cactataggg at 22 <210> 7 <211> 184 <212> DNA <213> Artificial Sequence <220> <223> HiBiT coding DNA template_linear <400> 7 acagtaacag tattagctaa tcttcttgaa cagccgccag ccgctcacgg tgttgggtgt 60 gtagaagaag cctcgttccc cgcacactag gtagagagct tccaccaggt gtgagccgca 120 caggtgttgg ttcacaaaca tattttttcc tccttatact taatccctat agtgagtcgt 180 atta 184

Claims (12)

promoter sequence; target sequence; and a nucleic acid template comprising a sequence complementary to a G-quadruplex motif sequence,
The promoter sequence is a composition for production of a DNA hydrogel, which is a sense sequence of the promoter.
According to claim 1,
The composition further comprises an oligonucleotide comprising the promoter sequence,
The nucleic acid template is linear,
The promoter sequence is separated and the composition for producing a DNA hydrogel, characterized in that present at the 3'-end and 5'-end of the nucleic acid template.
According to claim 1, wherein the promoter sequence is T7 promoter, T5 promoter, T3 promoter, lac promoter, tac and trc promoter, cspA promoter, lacUV5 promoter, Ltet0-1 promoter, phoA promoter, araBAD promoter, trp promoter, tetA promoter, A composition for producing a DNA hydrogel, characterized in that it is selected from the group consisting of Ptac promoter and SP6 promoter.
The DNA according to claim 1, wherein the G-quadruplex motif sequence comprises a nucleic acid sequence in which at least 3 consecutive guanines and 1 to 7 random sequences are repeated at least once. A composition for the production of hydrogels.
The composition for producing a DNA hydrogel according to claim 4, wherein the sequence complementary to the G-quadruplex motif sequence includes SEQ ID NO: 3 (ACCCTAACCCTA).
The composition for producing a DNA hydrogel according to claim 1, further comprising a DNA polymerase (polymerase).
A method for producing a DNA hydrogel comprising the step of synthesizing DNA from the nucleic acid template of claim 1.
8. The method of claim 7,
The nucleic acid template is linear,
The promoter sequence is separated and is present at the 3'-end and 5'-end of the nucleic acid template,
annealing the nucleic acid template with an oligonucleotide comprising a sequence complementary to the promoter sequence;
linking the 3'-end and 5'-ends of the oligonucleotide and the annealed nucleic acid template to form a circular template including a double strand; and
Method for producing a DNA hydrogel comprising the step of amplifying the DNA from the circular template.
The method of claim 7, wherein the step of amplifying the DNA from the circular template comprises performing a rolling circle amplification method.
A sequence prepared by the method of claim 7 and complementary to a promoter sequence; a sequence complementary to the target sequence; And DNA hydrogel comprising a G-quadrel motif sequence.
synthesizing mRNA from the DNA hydrogel of claim 10; and
A method for producing a peptide or protein comprising the step of synthesizing the peptide or protein by translating the synthesized mRNA.
The method according to claim 11, wherein the peptide or protein is synthesized by a cell free protein synthesis system.

Images