KR20220087108A - Composition for preventing, improving or treating non-alcoholic fatty liver disease comprising trans-anethole - Google Patents

Abstract

The present invention relates to a composition for preventing, improving or treating nonalcoholic fatty liver disease, and more particularly, to a pharmaceutical composition for preventing or treating nonalcoholic fatty liver disease containing trans-anethole (TAO), and nonalcoholic fatty liver. It relates to a health functional food composition for preventing or improving diseases. Transanethol according to the present invention increases the activity of MMP, suppresses cellular aging of hepatocytes, acts as a lipolysis signal in hepatocytes, increases the expression of lipolysis markers, and inhibits the expression of factors that enhance the microenvironment of hepatocytes By increasing it, it shows significant efficacy in preventing, improving or treating cellular aging, improving immune activity, and preventing, improving, or treating fatty liver disease, and thus it can be used in pharmaceuticals, health functional foods, etc. for improving or treating non-alcoholic fatty liver disease.

Description

Composition for preventing, improving or treating non-alcoholic fatty liver disease comprising trans-anethole

The present invention relates to a composition for preventing, improving or treating non-alcoholic fatty liver disease, and more particularly, to a pharmaceutical composition for preventing or treating non-alcoholic fatty liver disease, including trans-anethole (TAO), and non-alcoholic fatty liver. It relates to a health functional food composition for preventing or improving diseases.

Nonalcoholic fatty liver disease (NAFLD), one of the most common liver diseases, causes nonalcoholic steatohepatitis, which can lead to serious diseases including liver cancer, cirrhosis and cardiovascular disease. In addition, it is known that metabolic dysfunction such as triglyceride (TG) and liver cholesterol accumulated by excessive fat production in hepatocytes causes nonalcoholic fatty liver disease.

To hydrolyze accumulated triglycerides (TG), hepatocytes secrete glycerol-3-phosphate acyl transferase (GPAT), diglyceride acyl transferase, acetyl-CoA carboxylase 1 (ACC1), and hormone-sensitive lipase (HSL). It is known to regulate the activation of various enzymes, including In addition, in order to regulate the activation of lipolytic enzyme, activation of AMPK (AMP-activated protein kinase), an upstream regulatory factor, is made in hepatocytes. By activating AMPK, β-oxidation of fatty acids is activated in hepatocytes. In particular, activated AMPK increases the levels of HSL and LPL related to lipolysis. Phosphorylated Perilipin-1 (PLIN1), a lipid droplet-associated protein, activates HSL to dissolve TGs. In β-oxidation, acyl-CoA synthetase (ACS) converts free fatty acids to acyl-CoA, and carnitine palmitoyltransferase (CPT) transports the converted acyl-CoA to the mitochondrial matrix. The converted aycl-CoA is fragmented by acyl-CoA dehydrogenase (ACAD)dp. It is known that the activation of lipolysis using ACC1, a major enzyme for adipogenesis, is inhibited by several factors, such as activated AMPK, blood glucagon levels, and increased acyl-CoA levels.

On the other hand, trans- anethole (TAO) (1-methoxy-4-(1-propenyl) benzene), an aromatic organic compound, is a colorless, weakly volatile liquid with a specific odor. ( Pimpinella anisum L. ), Star anise ( Illicium verum ) It is known to be found in many herbs, and the anti-wrinkle effect of transanethol extracted from plants is known (Korea Patent Publication 10-2016-0132160) . In addition to anti-wrinkle effects, transanethol has physiologically active functions including antibacterial, antifungal and insecticidal, and is also known to induce brown color in white adipocytes and activate brown adipocytes, including hypoglycemic action. In addition, transanethol is known to suppress tumorigenesis and oxidative stress by removing free radicals, and studies focusing on lipid metabolism in hepatocytes are being actively conducted. As for the treatment, nothing has been revealed yet.

In order to improve the above problems, the present inventors evaluated the physiological activity effect of transanethol, and as a result, the composition containing transanetol is non-alcoholic fatty liver disease through aging, lipid metabolism and microenvironment enhancement of HepG2 cells. The present invention was completed by confirming that it is useful for preventing, improving or treating and maintaining cell viability and activity.

Accordingly, an object of the present invention is to provide a pharmaceutical composition and a health functional food composition for preventing improvement or treatment of non-alcoholic fatty liver disease, comprising transanethol of the following formula (1).

[Formula 1]

However, the technical problems to be achieved by the present invention are not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the above object, the present invention provides a pharmaceutical composition and health functional food composition for preventing improvement or treatment of non-alcoholic fatty liver disease, comprising transanethol represented by the following formula (1).

[Formula 1]

In one embodiment of the present invention, the nonalcoholic fatty liver disease may be nonalcoholic fatty liver, nonalcoholic steatohepatitis, or nonalcoholic fatty liver-associated cirrhosis.

In another embodiment of the present invention, the composition can inhibit the aging of hepatocytes by increasing the activation of MMP.

The composition is AMPK (AMP-activated protein kinase), GLUT2 (glucose transporter type 2), GLUT4 (glucose transporter type 4), ACS (acyl-CoA synthetase), CPT1 (carnitine palmitoyltransferase-1), CPT2 (carnitine palmitoyltransferase-2) ), ACADS (acyl-CoA dehydrogenase), HSL (hormone sensitive lipase), PLIN1 (Perilipin-1), ApoB100 (Apolipoprotein B 100), ApoC3 (Apolipoprotein C3) and any one selected from the group consisting of AP2 (adipocyte protein 2) and increase the expression of one or more lipid metabolism genes.

In another embodiment of the present invention, the composition SREBP1c (Sterol regulatory element-binding protein 1) inhibition, ACC1 (Acetyl-CoA carboxylase 1) inhibition, GPAT (glycerol-3-phosphate acyltransferase) inhibition, FABP1 synthesis inhibition (Fatty) Acid-Binding Protein 1) or CD36 (Cluster of Differentiation 36) synthesis can be inhibited to inhibit fatty acid absorption or fat synthesis.

In another embodiment of the present invention, the composition can enhance the microenvironment of hepatocytes by increasing the expression levels of osteopontin (OPN), lipoprotein lipase (LPL) and pigment epithelium-derived factor (PEDF).

Transanethol according to the present invention increases the activity of MMP, suppresses cellular aging of hepatocytes, acts as a lipolysis signal in hepatocytes, increases the expression of lipolysis markers, and inhibits the expression of factors that enhance the microenvironment of hepatocytes By increasing it, it shows significant efficacy in preventing, improving or treating cellular aging, improving immune activity, and preventing, improving, or treating fatty liver disease, and thus it can be used in pharmaceuticals, health functional foods, etc. for improving or treating non-alcoholic fatty liver disease.

1 is a schematic diagram showing the signal result of lipid metabolism according to transanethol treatment in hepatocytes, the green background indicates the activated signal pathway and the red background indicates the inhibited signal pathway.
Figure 2 shows the cytotoxicity and catabolic activation of transanethol in hepatocytes, Figure 2a shows the HepG2 cell viability according to the transanethol treatment, Figure 2b is a histogram of the change in the number of senescent cells according to the transanethol treatment and a histogram, and FIG. 2c is a histogram and a histogram showing the number of activated MMP cells following transanethol treatment using a flow cytometer.
Figure 3 shows the expression level of lipid metabolism markers according to transanethol treatment in hepatocytes, Figure 3a shows the changes in the expression of lipolysis markers (AMPK, GLUT4, ACS), Figure 3b is a β-oxidation marker (CPT2) , ACADS) was confirmed, and Figure 3c shows the expression level of the lipid metabolism marker as a gel image.
4 shows the expression level of the lipolysis marker according to transanethol treatment in hepatocytes, FIG. 4a shows the change in the expression of the lipolysis marker, and FIG. 4b shows the expression level of the lipolysis marker with a gel image, 4c and 4d are histograms and bar graphs showing the number of PLIN1 and HSL-positive cells using flow cytometry.
Figure 5 confirms the expression of the lipogenesis marker and the measurement of stained lipids according to transanethol treatment in hepatocytes, Figure 5a is confirming the expression change of the lipogenesis marker, Figure 5b is the expression of the lipid formation marker as a gel image It was confirmed, and FIG. 5c shows an image of Oil Red O stained cells according to transanethol treatment.
Figure 6 confirms the possibility of enhancing the microenvironment according to transanethol treatment in hepatocytes, Figure 6a shows the relative expression changes for the expression of OPN and PEDF in HepG2 cells according to transanethol treatment, Figure 6b is OPN, The change in the expression of PEDF and GAPDH was confirmed with a gel image.
Figure 7 confirms the expression levels of additional proteins related to lipid metabolism. FABP1 and CD36 are markers for fatty acid absorption, CPT1, SREBP1c, ApoB100, ApoC3 is lipolysis, and Glut2 is a marker for glucose absorption.

As a result of evaluating the physiological activity effect of transanethol, the present inventors found that the composition containing transanetol prevents, improves or treats nonalcoholic fatty liver disease through aging, lipid metabolism, and microenvironment enhancement of HepG2 cells, and cell viability The present invention was completed by confirming that it is useful for maintaining hyperactivity.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating non-alcoholic fatty liver disease, including transanethol.

As used herein, the term “prevention” refers to any act of suppressing or delaying the onset of nonalcoholic fatty liver disease by administration of the composition according to the present invention.

As used herein, the term “treatment” refers to any action in which symptoms for nonalcoholic fatty liver disease are improved or beneficially changed by administration of the composition according to the present invention.

As used herein, the term “nonalcoholic fatty liver disease” includes, but is not limited to, nonalcoholic fatty liver, nonalcoholic steatohepatitis, and nonalcoholic fatty liver-associated cirrhosis.

“Transanethol” according to the present invention is composed of C ₁₀ H ₁₂ O, commonly referred to as 1-methoxy-4- (1-propenyl) benzene, and refers to a compound having the structure of the following [Formula 1].

[Formula 1]

The composition comprising transanethol according to the present invention can increase the activity of MMP and inhibit cellular aging in HepG2 cells, and this activity prevents and improves fatty liver disease by decomposing fatty acids through the activation of mitochondrial respiratory tract in hepatocytes. Or it can be treated.

In addition, the composition according to the present invention can increase the expression of AMPK, which activates various lipid-related metabolism such as fatty acid oxidation, ketogenesis, adipogenesis inhibition, and insulin secretion by pancreatic cells, and lipolysis markers ACS, CPT1, It can increase the expression of CPT2, ACADS, HSL, LPL, ApoB100, ApoC3 and AP2, and in the case of fatty acid absorption and lipogenesis, it promotes the inhibition of FABP1 and CD36 synthesis and the inhibition of SREBP1c and ACC1, thereby promoting fatty acid absorption and lipogenesis. effectively suppress By increasing the expression of GLUT2 and GLUT4, proteins that regulate glucose levels, it is possible to maintain blood sugar levels and increase AMPK and ATP levels by lipolysis.

In addition, the composition according to the present invention increases the expression of OPN, which promotes liver recruitment of macrophages and neutrophils, and increases the expression level of PEDF, which has effects such as inhibition of endothelial cell migration, angiogenesis, immunomodulation, etc. It can enhance the microenvironment.

The pharmaceutical composition according to the present invention may include a pharmaceutically effective amount of transanethol alone or may include one or more pharmaceutically acceptable carriers. In this case, pharmaceutically acceptable carriers are those commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose. , polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. may be additionally included in addition to the above components.

The pharmaceutical composition of the present invention may be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally or locally applied) according to a desired method, and the dosage may vary depending on the condition and weight of the patient, and the disease. Although it varies depending on the degree, drug form, administration route and time, it may be appropriately selected by those skilled in the art.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level depends on the type of disease, severity, drug activity, and drug. It can be determined according to factors including sensitivity, administration time, administration route and excretion rate, duration of treatment, concomitant drugs, and other factors well known in the medical field. The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Taking all of the above factors into consideration, it is important to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

Specifically, the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, sex, condition, weight, absorption of the active ingredient into the body, inactivation rate and excretion rate, disease type, and drugs used in combination, in general 1 to 500 mg per 1 kg of body weight may be administered daily or every other day, or divided into 1 to 3 times a day. However, since it may increase or decrease depending on the route of administration, sex, weight, age, etc., the dosage is not intended to limit the scope of the present invention in any way.

As another aspect of the present invention, the present invention provides a method for treating non-alcoholic fatty liver disease, comprising administering the pharmaceutical composition to an individual.

In the present invention, the “individual” may be a mammal, such as a rat, livestock, mouse, or human, and specifically may be a dog, a racehorse, a human, etc. in need of treatment for nonalcoholic fatty liver disease, preferably a human.

As another aspect of the present invention, the present invention provides the use of the pharmaceutical composition for the treatment of nonalcoholic fatty liver disease.

On the other hand, when the composition according to the present invention is in the form of a health functional food composition, it can be prepared as a food with high medical and medical effects processed to efficiently exhibit bioregulatory functions in addition to food for specific health and nutritional supply, and the food In some cases, it may be mixed as a functional food, health food, or health supplement, and may be prepared in various forms such as tablets, capsules, powders, granules, liquids, pills, etc. to obtain useful effects.

The present inventors confirmed that a composition containing transanetol exhibits an effect in the prevention, improvement or treatment of nonalcoholic fatty liver disease through specific examples.

In one embodiment of the present invention, cells treated with 0, 100, 500 and 1000 μg/ml of transanethol were obtained, and MMP and the degree of senescence were measured with a mitochondrial membrane potential analysis kit (Abcam, Cambridge, MA, USA), respectively. and CellEvent ^TM senescence green flow cytometry analysis kit (Thermo Fisher Scientific) as a result, it was confirmed that cellular senescence is reduced and the mitochondrial membrane potential (MMP) is increased during transanethol treatment (see Example 2), Cells cultured in a medium treated with transanethol at various concentrations (0, 100, 500 and 1000 μg/ml) were lysed using a Ribospin ^TM kit (GeneAll Biotech, Seoul, South Korea) to extract and analyze total RNA As a result, it was confirmed that the expression level of lipid metabolism-related genes, including the lipolytic genes AMPK, ACS, ACADS, LPL, CPT2, PLIN1 and HSL, was increased during transanethol treatment (see Example 3), and the microscopic It was confirmed that the expression of OPN and PEDF, which are genes involved in the environment, was upregulated in a dose-dependent manner of transanethol (see Example 4).

Therefore, it was confirmed that the present invention is effective in non-alcoholic fatty liver disease by inhibiting aging of hepatocytes, regulating the expression of lipid metabolism genes, and enhancing the liver microenvironment. It can be used as a health functional food for the prevention or improvement of alcoholic fatty liver disease.

Accordingly, as another aspect of the present invention, the present invention provides a health functional food composition for preventing or improving non-alcoholic fatty liver disease, comprising transanethol.

The health functional food of the present invention may include additional ingredients that are commonly used in food compositions to improve odor, taste, vision, and the like. For example, vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, and the like may be included. In addition, it may include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu). In addition, it may include amino acids such as lysine, tryptophan, cysteine, and valine. In addition, preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dihydroacetate, etc.), disinfectants (bleaching powder and high bleaching powder, sodium hypochlorite, etc.), antioxidants (butylhydroxyanisole (BHA), butylhydroxytoluene (BHT) ), etc.), colorant (tar pigment, etc.), color developer (sodium nitrite, sodium nitrite, etc.), bleach (sodium sulfite), seasoning (MSG sodium glutamate, etc.), sweetener (dulcin, cyclimate, saccharin, sodium, etc.), Food additives such as flavorings (vanillin, lactones, etc.), expanding agents (alum, D-potassium hydrogen tartrate, etc.), strengthening agents, emulsifiers, thickeners (flavors), film agents, gum base agents, foam inhibitors, solvents, and improving agents can be added. The additive may be selected according to the type of food and used in an appropriate amount.

When the health functional food of the present invention is used as a food additive, it may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method.

In the health functional food of the present invention, the content of transanethol is not particularly limited, and may be variously changed depending on the condition of the subject to be administered, the type of specific disease, the degree of progression, and the like. If necessary, it may also be included in the total content of the food.

Hereinafter, the present invention will be described in more detail through examples. However, the following examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

[Example]

Example 1. Experimental method

1-1. cell culture

HepG2 cells (Korea Cell Line Bank, Seoul, Korea) were cultured in low glucose Dulbecco's Modified Eagle's medium (Invitrogen, Carlsbad, CA, USA) with 10% fetal bovine serum (Sigma) and 100 U/ml penicillin (Invitrogen). Cultivated under 5% CO ₂ conditions at °C. In addition, 100, 500, and 1000 μg/ml of transanethol (Sigma-Aldrich, St.Louis, MO, USA) dissolved in DMSO was prepared in cultured HepG2 cells.

1-2. cytotoxicity

Cell viability was analyzed using the EZ-Cytox cell viability assay kit (DAEILL LAB Service Co., Seoul, Korea) to determine the optimal therapeutic dose of transanethol. Cells were cultured in a 96-well microplate at 37° C. under 5% CO ₂ conditions, and transanethol at various concentrations (0, 100, 200, 300, 400, 500, 1000, 1500 and 2000 μg/ml) was added. processed.

1-3. Oil Red O (ORO) dyeing

Cells cultured by treatment with various concentrations of transanethol were fixed with 4% paraformaldehyde for 20 minutes and washed with phosphate buffered saline. To detect neutral lipids and lipid droplets, cultured cells were stained with ORO (Sigma-Aldrich) prepared in isopropanol. The stained cells were observed with a fluorescence microscope (Eclipse Ts-2, Nikon, Shinagawa, Japan) and the intensity of ORO staining was analyzed with NIS-elements V5.11 (Nikon).

1-4. Polymerase Chain Reaction (PCR) for Lipid Metabolism Markers

Cells cultured in a medium treated with transanethol at various concentrations (0, 100, 500 and 1000 μg/ml) were lysed using a Ribospin™ kit (GeneAll Biotech, Seoul, South Korea) to extract total RNA. Quantification and quality evaluation of RNA were performed with a NanoDrop2000 spectrophotometer (Thermo Fisher Scientific, Waltham, USA). The isolated RNA was converted to cDNA using CycleScript RT Premix (dT20) (Bioneer, Dajeon, South Korea), and the cDNA was amplified by denaturation steps 40 at 95°C for 15 minutes (95°C for 10 seconds, 59°C for 15 minutes). sec, 72 ℃ 30 sec) was amplified using PCR (PCR PreMix, Bioneer, Dajeon, South Korea). The sequences of the PCR primers used are as shown in Table 1 below, and the products were analyzed using iBright (FL1000, Thermo Fisher Scientific) and iBright analysis software 3.1.3 (Thermo Fisher Scientific).

Primer F/R* Seq (5’ → 3’) Lipid oxidation AMPK F CGCCTTGATTCTTTTGAGGCTT (SEQ ID NO: 1) R AGGATCAGACTACACCTGGCT (SEQ ID NO: 2) ACS F CCTGGGATCTCTCTCATGGC (SEQ ID NO: 3) R CCCCAACAACTTGCAGTGAT (SEQ ID NO: 4) CPT1 F CCACAGTCTCGCAAGGATGG (SEQ ID NO: 5) R GCAAGTGGGGAGTTCTGGAG (SEQ ID NO: 6) CPT2 F GACTCGGCAGTGTTCTGTCT (SEQ ID NO: 7) R GTCAGCTGGCCATGGTACTTG (SEQ ID NO: 8) ACADS F TTCATCAAGGAGCCGGCAAT (SEQ ID NO: 9) R AGGGTAAAGGCACATGGCTC (SEQ ID NO: 10) SREBP1c F AGTTTCCGAGGAACTTTTCGC (SEQ ID NO: 11) R GCCGACTTCACCTTCGATGT (SEQ ID NO: 12) Glucose uptake GLUT2 F CACTATAGACATGTTTTGGGTGTT (SEQ ID NO: 13) R CCCATCAAGGAGCTCCAAC (SEQ ID NO: 14) GLUT4 F TCTCCAACTGGACGAGCAAC (SEQ ID NO: 15) R AGTTATGCCACTGGTGCGTT (SEQ ID NO: 16) Lipolysis HSL F AGCTGAGACACTTAGCCCCT (SEQ ID NO: 17) R CACTCCGGAGCTCTTTTTCC (SEQ ID NO: 18) AP2 F TGGTGGTGGTGAGTATCTTCT (SEQ ID NO: 19) R GGTCAACGTCCCTTGGCTTA (SEQ ID NO: 20) LPL F GGCAGCTTCATGCATTCCTC (SEQ ID NO: 21) R CAGCCAGAACGGCAACTACT (SEQ ID NO: 22) ApoB100 F TTTCTGAGTCCCAGTGCCCA (SEQ ID NO:23) R TTAATGTGTATGAAGGCACCAGG (SEQ ID NO: 24) ApoC3 F CCCGGGTACTCCTTGTTGTT (SEQ ID NO: 25) R CCTCAGGGTCCAAATCCCAG (SEQ ID NO: 26) Lipid synthesis ACC1 F GCACATCTTCACACTCCTGAA (SEQ ID NO: 27) R GTACCACTCACCTGCCGTAT (SEQ ID NO: 28) GPAT F TGGGTGAAGAATTCTGGTGGA (SEQ ID NO: 29) R CATGAGGGGTGCAGGTGTAG (SEQ ID NO: 30) Micro-environment OPN F GAATCTCCTAGCCCCACAGACC (SEQ ID NO: 31) R GTGTGAGGTGATGTCCTCGTC (SEQ ID NO: 32) PEDF F GCTGAGTTACGAAGGCGAAGT (SEQ ID NO: 33) R GCTGAGTTACGAAGGCGAAGT (SEQ ID NO: 34) Fatty acid up-taking FABP1 F GCAAGTACCAACTGCAGAGC (SEQ ID NO: 35) R AGTGCTTCCCATTCTGCACG (SEQ ID NO: 36) CD36 F GCAACAAACCACACACTGGG (SEQ ID NO: 37) R AGACTGTGTTGTCCTCAGCG (SEQ ID NO: 38) Housekeeping gene GAPDH F GTGGTCTCCTGACTTCAACA (SEQ ID NO: 39) R CTCTTCCTCTTGTGCTCTTGCT (SEQ ID NO: 40)

1-5. Flow cytometry

Fixed cells were treated with 0.02% tween 20 for 10 min and stained overnight with allophycocyanin-anti-HSL (Abcam, Cambridge, MA, USA) and fluorecein isothiocyanate-anti-perilipin-1 (Abcam, Cambridge, MA, USA) overnight. . Stained cells were analyzed using a flow cytometer (FACScalibur, BD science, CA, USA) and FlowJo 10.7.0 (BD science).

1-6. Mitochondrial membrane potential (MMP) and senescence

Cells treated with 0, 100, 500 and 1000 μg/ml of transanethol were obtained, and MMP and senescence levels were analyzed by mitochondrial membrane potential analysis kit (Abcam, Cambridge, MA, USA) and CellEvent ^TM senescence green flow cytometry, respectively. The measurements were made using a kit (Thermo Fisher Scientific). Treated cells were analyzed for membrane potential using a flow cytometer (FACScalibur) and FlowJo 10.7.0 (BD science).

1-7. statistical analysis

Statistical analysis was performed using SigmaPlot version 12.5 software. All statistical analyzes were performed using student's t-test and one-way ANOVA. A p-value of less than 0.05 was considered significant.

Example 2. Confirmation of cytotoxicity and cellular metabolism according to transanethol treatment

As a result of confirming the cytotoxicity in the cells treated with transanethol by the experimental method of Example 1-2, as shown in FIG. 2a, transanethol was treated with high concentrations (1000, 1500, and 2000 μg/ml) in HepG2 cells. In one case, it was confirmed that the cell viability was about 99%, indicating non-toxicity to the cells. In addition, as shown in FIG. 2b , when transanethol was treated at 100 and 500 μg/ml, aging was estimated to be 0.40 times and 0.37 times, respectively. At the two treatment concentrations (100 and 500 μg/ml), cellular senescence did not show a dose-dependent result, but when treated with 1000 μg/ml, it was confirmed that senescence was dramatically reduced by 0.14 fold.

In addition, as a result of confirming the mitochondrial membrane potential (MMP), as shown in FIG. 2c , it was confirmed that the relative activity when treated with transanetol increased by 1.50 times and 1.55 times at 500 μg/ml and 1000 μg/ml, respectively. , The result was based on the number of stained cells and showed the same trend as the geometric mean coefficient of fluorescence intensity, and it was confirmed that the fluorescence intensity was increased by 1.27 and 1.59 times at 500 μg/ml and 1000 μg/ml of transanethol, respectively. did

Example 3. Analysis of the expression level of lipid metabolism genes according to transanethol treatment

HepG2 cells were treated with transanethol and lipid oxidation-related genes; AMPK, ACS, CPT1, CPT2 and ACADS, SREBP1c, glucose uptake-related genes; GLUT2, GLUT4, lipolysis-related genes; HSL, AP2, LPL, ApoB100, ApoC3, lipogenesis-related genes; Expression of ACC1, GPAT, FABP1, and CD36 was confirmed.

As a result, as shown in FIGS. 3A to 3C and 7B , AMPK levels were increased by 1.35 times and 2.50 times, respectively, when 500 μg/ml and 1000 μg/ml of transanethol were treated for one day. In addition, when the AMPK level was increased, the levels of GLUT2 and GLUT4 increased about 2.5-fold and 7.68-fold on the 3rd day, and in the case of ACS, a downstream molecule of AMPK, the level increased 1.59-fold in the case of 1000 μg/ml transanethol, On the 3rd day of transanethol treatment, the ACAD significantly increased to about 11.76-fold as the CPT level increased by 5.82-fold. The level of the CPT1 gene of FIG. 7a was increased 2.57-fold when treated with transanethol at 1000 μg/ml for 1 day. In addition, in the case of SREBP1c, it was reduced by 0.33 times and 0.23 times when 1000 μg/ml of transanethol was treated for 1 day and 3 days.

In addition, as shown in FIGS. 4A to 4D , the levels of HSL and LPL after 1 day of transanethol treatment were up-regulated 1.29 and 1.45 times under the influence of 1000 μg/ml concentration of transanethol, and after 3 days of transanethol treatment AP2 levels were increased about 3.68-fold at a concentration of 1000 μg/ml of transanethol. The level of PLIN increased in a dose-dependent manner, and it was confirmed that HSL was 9.35 times higher than that of the control group when treated with transanethol at a concentration of 1000 μg/ml. In addition, as shown in FIGS. 5A and 5B , it was confirmed that the lipogenesis genes ACC1 and GPAT gene levels were down-regulated by 30% and 54%, respectively, when 1000 μg/ml of transanethol was treated. The levels of ApoB100 and ApoC3 genes in FIGS. 7c to d were increased 1.99-fold and 2.16-fold when treated with 1000 μg/ml transanethol for 3 days. In addition, FABP1 and CD36 gene levels related to fatty acid absorption of FIGS. 7b to d were decreased by 0.45 fold and 0.16 fold when treated with transanethol at 1000 μg/ml for 3 days.

Example 4. Confirmation of lipolysis effect according to transanethol treatment

In order to verify the lipolytic effect of transanethol, the level of lipid accumulation was confirmed using ORO staining in the method shown in Examples 1-3.

As a result, as shown in FIG. 5c , the number of stained granules in HepG2 cells decreased according to the transanetol dose, and it was confirmed that the significant transanetol dose indicating a reduction in lipid accumulation was 1000 μg/ml.

Example 5. Confirmation of the possibility of strengthening the microenvironment by transanethol treatment

Proper secretion of OPN from hepatocytes promotes immune activity by attracting macrophages and neutrophils to the surrounding hepatocytes. In addition, PEDF has the functions of immunoregulation, inhibition of cancer cellization, and migration of endothelial cells. Therefore, hepatocytes stimulated by transanethol have a microenvironment strengthening function such as suppressing immune activity and cancer cellization of surrounding hepatocytes through secretion of OPN and PEDF. To check whether there is OPN and the pigment epithelial-derived factor (PEDF) was checked.

As a result, as shown in FIG. 6 , it was confirmed that the OPN level increased by 5.82 times and the PEDF level also increased by 11.76 times after 3 days of treatment with 1000 μg/ml of transanethol. From the above results, it was confirmed that the level of genes related to microenvironment enhancement was up-regulated in a dose-dependent manner.

The above-described description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. There will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> Lifetogether Co.,LTD <120> Composition for preventing, improving or treating non-alcoholic fatty liver disease comprising trans-anethole <130> PD20-291 <160> 40 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> AMPK primer F <400> 1 cgccttgatt cttttgaggc tt 22 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> AMPK primer R <400> 2 aggatcagac tacacctggc t 21 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ACS primer F <400> 3 cctgggatct ctctcatggc 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ACS primer R <400> 4 ccccaacaac ttgcagtgat 20 <210> 5 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> CPT1 primer F <400> 5 ccacagtctc gcaaggatgg 20 <210> 6 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> CPT1 primer R <400> 6 gcaagtgggg agttctggag 20 <210> 7 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> CPT2 primer F <400> 7 gactcggcag tgttctgtct 20 <210> 8 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> CPT2 primer R <400> 8 gtcagctggc catggtactt g 21 <210> 9 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ACADS primer F <400> 9 ttcatcaagg agccggcaat 20 <210> 10 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ACADS primer R <400> 10 agggtaaagg cacatggctc 20 <210> 11 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> SREBP1c primer F <400> 11 agtttccgag gaacttttcg c 21 <210> 12 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> SREBP1c primer R <400> 12 gccgacttca ccttcgatgt 20 <210> 13 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> GLUT2 primer F <400> 13 cactatatagac atgttttggg tgtt 24 <210> 14 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> GLUT2 primer R <400> 14 cccatcaaga gagctccaac 20 <210> 15 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> GLUT4 primer F <400> 15 tctccaactg gacgagcaac 20 <210> 16 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> GLUT4 primer R <400> 16 agttatgcca ctggtgcgtt 20 <210> 17 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> HSL primer F <400> 17 agctgagaca cttagcccct 20 <210> 18 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> HSL primer R <400> 18 cactccggag ctctttttcc 20 <210> 19 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> AP2 primer F <400> 19 tggtggtggt gagtatcttc t 21 <210> 20 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> AP2 primer R <400> 20 ggtcaacgtc ccttggctta 20 <210> 21 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> LPL primer F <400> 21 ggcagcttca tgcattcctc 20 <210> 22 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> LPL primer R <400> 22 cagccagaac ggcaactact 20 <210> 23 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ApoB100 primer F <400> 23 tttctgagtc ccagtgccca 20 <210> 24 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> ApoB100 primer R <400> 24 ttaatgtgta tgaaggcacc agg 23 <210> 25 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ApoC3 primer F <400> 25 cccgggtact ccttgttgtt 20 <210> 26 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ApoC3 primer R <400> 26 cctcagggtc caaatcccag 20 <210> 27 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> ACC1 primer F <400> 27 gcacatcttc acactcctga a 21 <210> 28 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ACC1 primer R <400> 28 gtaccactca cctgccgtat 20 <210> 29 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> GPAT primer F <400> 29 tgggtgaaga attctggtgg a 21 <210> 30 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> GPAT primer R <400> 30 catgaggggt gcaggtgtag 20 <210> 31 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> OPN primer F <400> 31 gaatctccta gccccacaga cc 22 <210> 32 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> OPN primer R <400> 32 gtgtgaggtg atgtcctcgt c 21 <210> 33 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PEDF primer F <400> 33 gctgagttac gaaggcgaag t 21 <210> 34 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PEDF primer R <400> 34 gctgagttac gaaggcgaag t 21 <210> 35 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> FABP1 primer F <400> 35 gcaagtacca actgcagagc 20 <210> 36 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> FABP1 primer R <400> 36 agtgcttccc attctgcacg 20 <210> 37 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> CD36 primer F <400> 37 gcaacaaacc acacactggg 20 <210> 38 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> CD36 primer R <400> 38 agactgtgtt gtcctcagcg 20 <210> 39 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> GAPDH primer F <400> 39 gtggtctcct ctgacttcaa ca 22 <210> 40 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> GAPDH primer R <400> 40 ctcttcctct tgtgctcttg ct 22

Claims (8)

A pharmaceutical composition for preventing or treating non-alcoholic fatty liver disease (NAFLD), comprising trans-anethole (TAO) of Formula 1 below.
[Formula 1]

According to claim 1,
The non-alcoholic fatty liver disease is a pharmaceutical composition, characterized in that at least one selected from the group consisting of non-alcoholic fatty liver, non-alcoholic steatohepatitis and non-alcoholic fatty liver-associated cirrhosis. According to claim 1,
The composition increases the activation of mitochondrial membrane potential (MMP), characterized in that it inhibits the aging of hepatocytes, a pharmaceutical composition. According to claim 1,
The composition is AMPK (AMP-activated protein kinase), GLUT2 (glucose transporter type 2), GLUT4 (glucose transporter type 4), ACS (acyl-CoA synthetase), CPT1 (carnitine palmitoyltransferase-1), CPT2 (carnitine palmitoyltransferase-2) ), ACADS (acyl-CoA dehydrogenase), HSL (hormone sensitive lipase), PLIN1 (Perilipin-1), ApoB100 (Apolipoprotein B 100), ApoC3 (Apolipoprotein C3) and any one selected from the group consisting of AP2 (adipocyte protein 2) A pharmaceutical composition, characterized in that it increases the expression of one or more lipid metabolism genes. According to claim 1,
The composition is SREBP1c (Sterol regulatory element-binding protein 1) inhibition, ACC1 (Acetyl-CoA carboxylase 1) inhibition, GPAT (glycerol-3-phosphate acyltransferase) inhibition, FABP1 synthesis inhibition (Fatty Acid-Binding Protein 1) or CD36 ( Cluster of Differentiation 36) A pharmaceutical composition, characterized in that it inhibits the absorption of fatty acids or liposynthesis by inhibiting the synthesis. According to claim 1,
The composition increases the expression level of OPN (osteopontin), LPL (lipoprotein lipase) and PEDF (pigment epithelium-derived factor), characterized in that for enhancing the microenvironment of the hepatocytes, a pharmaceutical composition. A health functional food composition for preventing or improving non-alcoholic fatty liver disease (NAFLD), comprising transanethol of Formula 1 below.
[Formula 1]

8. The method of claim 7,
The non-alcoholic fatty liver disease is a health functional food composition, characterized in that at least one selected from the group consisting of non-alcoholic fatty liver, non-alcoholic steatohepatitis and non-alcoholic fatty liver-associated cirrhosis.

Images